WO2011132835A2 - 에탄올-, 열- 또는 퍼퓨랄-저항성 효모 균주, 및 이의 유전자 - Google Patents

에탄올-, 열- 또는 퍼퓨랄-저항성 효모 균주, 및 이의 유전자 Download PDF

Info

Publication number
WO2011132835A2
WO2011132835A2 PCT/KR2010/007863 KR2010007863W WO2011132835A2 WO 2011132835 A2 WO2011132835 A2 WO 2011132835A2 KR 2010007863 W KR2010007863 W KR 2010007863W WO 2011132835 A2 WO2011132835 A2 WO 2011132835A2
Authority
WO
WIPO (PCT)
Prior art keywords
yeast strain
ethanol
spp
gene
yeast
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2010/007863
Other languages
English (en)
French (fr)
Other versions
WO2011132835A3 (ko
Inventor
최원자
김현수
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ewha Womans University
Original Assignee
Ewha Womans University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020100101747A external-priority patent/KR101182752B1/ko
Priority claimed from KR1020100101754A external-priority patent/KR101243903B1/ko
Priority claimed from KR1020100110215A external-priority patent/KR101165733B1/ko
Application filed by Ewha Womans University filed Critical Ewha Womans University
Publication of WO2011132835A2 publication Critical patent/WO2011132835A2/ko
Publication of WO2011132835A3 publication Critical patent/WO2011132835A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01205—IMP dehydrogenase (1.1.1.205)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01015—Polygalacturonase (3.2.1.15)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/10—Process efficiency

Definitions

  • the present invention relates to ethanol-, heat- or perfural-resistant yeast strains and genes thereof and their use.
  • Yeast Saccharomyces cerevisiae (5. cerevisiae) has been used in a variety of industries, including the production of bioethanol from biomass resources (Schubert, 2006). Yeast cells are always exposed to various environmental stresses such as high concentrations of ethanol that occur during industrial ethanol fermentation, which in turn leads to a decrease in cell growth, cell viability and ethanol production (Casey & Ingledew, 1986; Suutari and Laakso, 1994). Therefore, the development of yeast strains that can overcome the stress caused mainly by high concentration of ethane has been required.
  • CBP Consolidated BioProcess
  • genes 7, GND1, RPE1, and these major factors included in the pentose phosphate pathway are mainly the redox regulators of coenzyme NADPH / NADH. Redox balance was important (Gorsich, et al., 2006).
  • genes responsible for resistance have been identified through screening of ethanol-, heat- and perfural sensitive mutations (Takahashi, et al., 2001; Auesukaree et al., 2009), but ethanol by arbitrary transposon insertion Direct construction of heat- and perfural resistant yeast strains How to identify relevant target genes is not reported yet.
  • Yeast Saccharomyces cerevisiae has extensive use of strong ethane in ethanol-related industries due to its production capacity and resistance (Schubert 2006). Yeast cells are always exposed to various environmental stresses such as high concentrations of ethanol, high temperature or high osmotic pressures and inhibitors that occur during industrial ethanol fermentation, resulting in decreased cell growth, survival and ethanol production (Casey & Ingledew 1986; Suutari & Laakso 1994). . Therefore, the development of yeast strain that can withstand a variety of stress is urgently required.
  • UV mutagenesis (Sridhar, et al., 2002), error-prone polymerase chain react ion (Shimoda, et al., 2006) and long—term adaptation at ion to high temperatures
  • ethanol-resistant yeast strains in itself is important for high ethanol production rates, since ethanol concentration constantly increases to harmful and even fatal levels during the fermentation process.
  • Several physiological changes including intracellular accumulation of Trihalose (Kim, et al., 1996), Plin (Takagi, et al., 2005) and Ergoste (Inoue, et al., 2000) Occur in ethanol-resistant yeast strains.
  • Evolutionary Hero (Stanley, et al., 2010)
  • researchers have recently been used in addition to classical strategies such as random chemical mutagenesis (Mobini-Dehkordi, et al., 2008) and gene shuffling (Hou, 2010).
  • yeast strains possessing high ethanol-resistance We sought to develop yeast strains possessing high ethanol-resistance.
  • the inventors have identified ethanol-resistant, or ethanol_ / heat-resistant, or ethanol- / heat- / perfural-resistant yeast transformants by inducing mutations in the yeast chromosome by transposon-mediated gene homologous recombination in yeast.
  • high concentrations of ethanol eg 10%, 12.5%, 15% ethanol
  • high temperatures eg 42 ° C., 43 ° C.
  • high concentrations of furfural eg 15 mM, 20 mM, 30 mM, 40.
  • mM, 50 mM to confirm that the present invention was completed. Accordingly, it is an object of the present invention to provide ethane-resistant yeast strains and related genes.
  • Another object of the present invention is to provide ethanol- and heat-resistant yeast strains and related genes.
  • Another object of the present invention is to provide a perfural-resistant yeast strain and genes related thereto.
  • the present invention provides an inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn_4); Or an ethanol-resistant transformed yeast strain comprising the MSN2 gene (Tn-5).
  • Tn-1 inactivated CMP2 or IMD4 gene
  • DLD3 gene Tn_4
  • Tn-5 ethanol-resistant transformed yeast strain comprising the MSN2 gene
  • the present inventors have identified ethanol-resistant, or ethanol- / heat-resistant, or ethanol- / heat- / perfural-resistant yeast transformants by inducing mutations in the yeast chromosome by transposon-mediated gene homologous recombination in yeast.
  • high concentrations of ethanol eg 10%, 12.5%, 15% ethanol
  • high temperatures eg 42 ° C, 43 ° C
  • high concentrations of furfural eg 15 mM, 20 mM, 30 mM, 40.
  • Ethanol a flammable, volatile colorless liquid
  • ethanol is used as an automotive fuel and fuel additive, and also as a perfume, flavorings, color ings and medicines.
  • ethanol is a major psychoactive component in alcoholic beverages and has a calming effect on the central nervous system.
  • Ethanol can be produced petrochemically through hydration of ethylene and biologically by fermenting sugars using yeast, which is produced by petrochemical processes that depend on the price of petroleum and grain feed. Much more economical than Therefore, the development of yeast strains for the production of biological ethane is very important.
  • Transposon mutagenesis has been used in several studies to analyze genes involved in cell morphology, and provides an effective means for comprehensive screening for genes whose survival of gene disrupting mutations has been maintained. The purpose of this study was to directly construct ethane-resistant yeast strains by random transposon insertion and to identify related target genes.
  • the present invention provides transformed yeast strains having increased ethanol-resistance by transposon-mediated mutations in yeast.
  • transposon refers to a DNA sequence capable of transposition to another location within the genome of a single cell. DNA sequence that causes mutations.
  • Transposons called jumping genes, are good examples of mobile genetic elements. Various kinds of mobile genetic elements can be classified according to transposition mechanisms as follows: (a) Group I retrotranspozone, transposon transcribed into RNA and then reverse transcribed into DNA; And (b) group II jumping transposons, transposons which are jumped ("cut and paste") from one position to another position of DNA by a transposase.
  • the transposon construct used in the present invention is introduced into the yeast chromosome via a homologous recombinat ion into the m n3-J acZ / LEU2 construct.
  • the present invention comprises the steps of (a) causing mutations in the yeast chromosome; And (b) culturing the mutated yeast in a medium containing a high concentration of ethane.
  • Step (a) is carried out using a variety of methods, preferably using a transposon.
  • the inventors have described yeast comprising mln3-JacZ / LEU2 constructs obtained from Yale Genome Analysis Center, New Haven, CT: http://ygac.med.yale.edu/mtn/reagent. cerevisiae) library pool was used (see Figure 1). Mutations were induced by cleaving the transposon construct from plasmid DNA using restriction enzymes and transforming the fragment into yeast chromosomes via homologous recombination.
  • Homologous recombination known as the general recombination process, is a form of genetic recombination that refers to the exchange of nucleotide sequences that occur between two similar or identical DNA strands, and is used in most organisms.
  • the yeast strain transformed in step (b) is cultured in a high concentration of ethanol to isolate / identify a strain capable of growth.
  • a growth assay spot assay for the transformed yeast strain with a control in various concentrations of ethane (10%, 12.5%, 15% ethanol) in the final (ethanol-resistant transformed yeast strain) choose.
  • the present invention relates to an inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or ethanol-resistant yeast strains containing MSN2 gene (Tn-5) were isolated / identified.
  • inactivated refers to inactivation when the function of the target gene is blocked, for example transposon-induced mutations, point mutations, nonsense mutations, missense mutations, replacement mutations, deletion mutations.
  • inactivation of target genes caused by mutations including.
  • inactivation of the present invention means inactivation through mutations caused by transposons.
  • the inactivation of the target gene described above is caused by transposon.
  • nucleotide sequence and amino acid sequence of the above-described target genes namely, CMP2, IMD4, DLD3 and MSN2 genes, respectively, are listed in SEQ ID NO: 1, 2, 6, 7, and 8, 9 It is apparent in the art that the nucleotide sequence encoding the amino acids of the genes described in the sequence, the thirteenth sequence and the fourteenth sequence, and variants thereof, can also be used.
  • the above-described yeast strain may be grown at 5-15% ethanol, more preferably 10-15% ethanol, and most preferably 12.5-15% ethanol culture conditions.
  • the above-mentioned yeast strain is Saccharomyces sp. Saccharomyces spp.), Schizosaccharomyces spp.), Piche ⁇ ⁇ ⁇ Pichia spp.), Papy ⁇ species 03 ⁇ 4 // / a spp.), Kluyveromyces sp. UUuyveromyces spp.), Candida ⁇ Candida spp.), Talaromyces spp.), Bret tanomyces spp.), pachysolen spp.
  • Yeast strain more preferably Saccharomyces species, most preferably Saccharomyces cerevisiae L32620K 7- a ura3 to 52 leu2-3, 112 his4- 34).
  • the invention provides ethane- and heat-resistant transformed yeast strains comprising an inactivated SSK2 or PPG1 gene.
  • the present invention provides ethane- and heat-resistant yeast strains comprising an inactivated PAM1 gene.
  • the method of the present invention includes the method using the transposon described above, the contents in common between the two are omitted in order to avoid excessive complexity of the present specification.
  • Transformed yeast strains are cultured in high concentration ethanol to isolate / identify strains that can grow.
  • a growth assay spot assay
  • yeast strains was performed in various concentrations of ethanol (10%, 12.5%, 15% ethanol).
  • Strains capable of growing at high temperatures (42 ° C) compared to the control by incubating at 30 ° C or 42 ° C with the selected ethanol-resistant strains were selected as ethanol- and heat-resistant transformed yeast strains.
  • the present invention isolated / identified ethanol- and heat-resistant yeast strains comprising an inactivated SSK2 or PPG1 gene, or PAM1 gene.
  • the inactivation of the target gene described above is caused by transposon.
  • the nucleotide sequence and amino acid sequence of the above-described target genes that is, the SSK2, PPG1 and PAM1 genes, are included in SEQ ID NO: 3, 4 and 5, and SEQ ID NO: 10, 11 and 12, respectively. It is apparent in the art that nucleotide sequences encoding amino acids of these genes and variants thereof may also be used.
  • the above-described yeast strain may be grown at 5-15% ethanol, more preferably 10-15% ethanol and most preferably 12.5-15% ethanol culture conditions.
  • the above-mentioned yeast strain is 30-43 ° C, more preferably 37-43 ° C, even more preferably 40-43 ° C and most preferably 42-43 ° C Can grow at temperature conditions.
  • the present invention provides a furfural-resistant transformed yeast strain comprising an inactivated 5 gene. Seen . Since the method of the present invention includes the method using the transposon described above, the contents in common between the two are omitted in order to avoid excessive complexity of the present specification.
  • Transformed yeast strains are cultured in high concentration ethanol to isolate / identify strains that can grow.
  • a growth assay spot assay
  • Selected ethane-resistant strains were cultured at 30 ° C. or 42 ° C. with a control to ethane- and heat-resistant transformed strains that could grow even at high temperatures (42 ° C.) compared to the control. It was selected as a yeast strain.
  • ethanol-resistant strains were grown with varying concentrations of the ethanol-resistant strains with the control to grow even at higher concentrations of perfural (15 mM, 20 mM, 30 mM, 40 mM or 50 mM) compared to the control.
  • concentrations of perfural 15 mM, 20 mM, 30 mM, 40 mM or 50 mM
  • the inactivation of the target gene described above is caused by transposon, and the nucleotide sequence and amino acid sequence of the SSK2 gene, which is the target gene described above, are included in SEQ ID NO: 3 and SEQ ID NO: 10, respectively. It is apparent in the art that nucleotide sequences encoding amino acids of these genes and variants thereof may also be used.
  • Perfural is an organic compound derived from various agricultural by-products such as corn, oats, wheat and sawdust, and is an aromatic aldehyde having a ring structure represented by the following formula (I) (0C 4 3 ⁇ 4CH0):
  • Perfural is a colorless oily liquid with an almond flavor, but turns yellow quickly when exposed to air.
  • furfural is used as a solvent in the petrochemical stagnation process of extracting diene from other hydrocarbons.
  • Perfural and its alcohol derivatives are used together with phenol, acetone or urea to prepare solid resins. These resins are made of fiberglass Used in aircraft components and automatic brakes.
  • Perfural is an active factor that inhibits the growth of yeast by inhibiting enzymes such as ADH, PDH, ALDH of yeast cells and inhibits glycolysis, and develops strains resistant to ethanol production using yeast. It is very important to.
  • the present invention provides transformed yeast strains having increased ethanol-, heat- and perfural-resistance by transposon-mediated mutations in yeast.
  • the above-mentioned yeast strain can be grown at 5-100 mM perfural, more preferably 10-75 mM perfural and most preferably 15-50 mM perfural culture conditions.
  • the above-described yeast strain may be grown in 5-15% ethane, more preferably 10-15% ethanol and most preferably 12.5-15% ethanol culture conditions.
  • the above-described yeast strain is 30-43T, more preferably 37-43 ° C, even more preferably 40-43 ° C and most preferably 42-43 ° C temperature conditions Can grow in
  • the present invention provides the above-mentioned inactivated yeast strains, such as the above-mentioned CMP2 or IMD4 gene (Tn-1); SSK2 or PPG1 gene (Tn-2); PAM1 gene (Tn_3); DLD3 gene (Tn-4); Or it provides a method for producing ethanol comprising the step of culturing a homozygous insert MSN2 gene (Tn-5) in a culture medium comprising one or more substrates that can be metabolized into ethanol.
  • the above-mentioned inactivated yeast strains such as the above-mentioned CMP2 or IMD4 gene (Tn-1); SSK2 or PPG1 gene (Tn_2); PAM1 gene (Tn-3); DLD3 gene (Tn-4);
  • the yeast strain into which the MSN2 gene (Tn_5) is inserted provides a method for more efficiently producing ethanol under high ethanol conditions necessary for an integrated process that overcomes the existing inefficient multi-step process.
  • the method of the present invention comprises the above-described inactivated yeast strains of the present invention, such as the above-mentioned CMP2 or IMD4 gene (Tn-1); SS 2 or PPG1 gene (Tn- 2); PAM1 gene (Tn-3); DLD3 gene (Tn-4); Or because the yeast strain transformed with MSN2 gene (Tn-5) as an active ingredient, the overlapping content between the two is omitted in order to avoid excessive complexity of the present specification according to the overlapping description.
  • the present invention can be used as a method for producing ethane-resistant yeast strain comprising the step of causing mutation in the above-described yeast strain.
  • the present invention provides the above-described inactivated CMP2 or IMD4 gene (Tn-1); SSK2 or PPG1 gene (Tn-2); PAM1 gene (Tn-3); DLD3 gene (Tn-4); Or a cell infected with a recombinant vector or a transcript thereof comprising the MSN2 gene (Tn-5) and a transformed cell by gene introduction.
  • the present invention provides the above-described inactivated CMP2 or IMD4 gene (Tn-1); .
  • the substrate which can be metabolized to ethanol comprises C6 sugars, and according to a more preferred embodiment of the invention, the C6 sugar comprises glucose, but is not limited thereto. no.
  • Recombinant vectors of the invention include the above-mentioned inactivated CMP2 or IMD4 gene (Tn-1); SSK2 or PPG1 gene (Tn_2); PAM1 gene (Tn_3); DLD3 gene (Tn-4); Or a nucleotide sequence encoding the amino acid sequence of the MSN2 gene (Tn-5) or a complementary nucleotide sequence thereof.
  • Vectors of the invention can typically be constructed as vectors for cloning or vectors for expression.
  • the vector of the present invention can be constructed using prokaryotic and eukaryotic cells as hosts.
  • prokaryotic cells include bacterial cells and archaea
  • eukaryotic cells include yeast cells, mammalian cells, plant cells, tortilla cells, follicular cells, and gourds, most preferably yeast cells.
  • the recombinant vector of the present invention comprises (i) a nucleotide sequence encoding the above-described expression target of the present invention; (ii) a promoter operably linked to the nucleotide sequence of (i) and acting on an animal cell, preferably a yeast cell, to form an RNA molecule, more preferably (i) the above-described invention One inactivated CMP2 or IMD4 gene (Tn-1); SSK2 or PPG1 gene (Tn-2); PAM1 gene (Tn-3); DLD3 gene (Tn-4); Or a nucleotide sequence encoding the amino acid sequence of the MSN2 gene (Tn-5) or a complementary nucleotide sequence thereof; (ii) a promoter operably
  • the above-described expression target material is inactivated CMP2 or IMD4 gene (Tn-1); SSK2 or PPG1 gene (Tn_2); PAM1 gene (Tn-3); DLD3 gene (Tn-4); Or MSN2 gene (Tn-5), but is not limited thereto.
  • promoter refers to a DNA sequence that regulates the expression of a coding sequence or functional RNA.
  • the expression-coding nucleotide sequence is operably linked to the promoter.
  • operatively linked means a functional binding between a nucleic acid expression control sequence (eg, an array of promoter sequences, signal sequences, or transcriptional regulator binding sites) and another nucleic acid sequence; Whereby the regulatory sequence modulates the transcription and / or translation of the other nucleic acid sequence.
  • a strong promoter capable of promoting transcription for example, a tac promoter, a lac promoter, a lac UV5 promoter, an Ipp promoter, a p L x promoter, a ⁇ ⁇ ⁇ promoter, rad ⁇ Promoters, shock promoters, recA promoters, SP6 promoters, trp promoters, T7 promoters, etc.
  • the host cell used is E. coli, most preferably E. coli DH5a.
  • ⁇ coli when used as a host cell, a promoter and an operator site of the E. coli tryptophan biosynthesis pathway (Yanofsky, C., J. Bacteriol., 158: 1018-1024 (1984)) and a phage ⁇ left promoter ( ⁇ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., 14: 399-445 (1980)) can be used as regulatory sites.
  • vectors that can be used in the present invention are plasmids often used in the art (eg pRS316, pSClOl, ColEl, pBR322, pUC8 / 9, P HC79, pUC19, pET, etc.), phages (eg, Xgt4. ⁇ , ⁇ -Charon, ⁇ ⁇ , and M13) or viruses (eg SV40, etc.).
  • a promoter that can be used is a promoter derived from a yeast cell that can regulate the transcription of the expression target material of the present invention, a mammal. Promoters derived from animal viruses and promoters derived from genomes of mammalian cells, such as yeast (5. cerevisiae) GAPDHCGlyceraldehyde 3-phosphate dehydrogenase promoters, yeast (5.
  • GAL1 to GAL10 promoters yeast S Pidn ' a pastor is) A0X1 or A0X2 promoter, cyt omega lo virus (CMV) promoter, late adenovirus promoter, vaccinia virus 7.5K promoter, SV40 promoter, tk promoter of HSV, RSV promoter, EF1 alpha promoter, metallothionine Promoter, beta-actin promoter, promoter of human IL-2 gene, promoter of human IFN gene Motors, promoters of the human IL-4 gene, promoters of the human lymphotoxin gene, and promoters of the human GM-CSF gene.
  • the expression construct for use in the present invention comprises a poly adenylation sequence (eg, a glial hormone terminator and a SV40 derived poly adenylation sequence).
  • the method for carrying the vector of the present invention into a host cell may use various methods known in the art, for example, when the host cell is a prokaryotic cell, the CaCl 2 method (Cohen, et al., Proc. Natl. Acac Sci. USA, 9: 2110-2114 (1973), one method (Cohen, et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973); and Hanahan, J. Mo. J. Biol., 166: 557-580 (1983)) and electroporation methods (Dower, et al., Nucleic.
  • CaCl 2 method Cohen, et al., Proc. Natl. Acac Sci. USA, 9: 2110-2114 (1973
  • one method Cohen, et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973
  • Eukaryotic cells, transduction, electroporation, lipofection, microinjection, particle bombardment, yeast globulars / cells used in YAC Fusion can be performed using Agrobacterium-mediated transformation used in plant cells.
  • the expression-encoding nucleotide sequence used in the present invention has a structure of "promoter-expression encoding nucleotide sequence-poly adenylation sequence".
  • the vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are described in Sambrook et al. , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.
  • Production of transformed yeast cells using the recombinant expression vector of the present invention can be carried out by gene transfer methods commonly known in the art. For example, electroporation, lithium acetate / DMS0 method (Hi 11, et al., (1991), DMSO—enhanced whole cell yeast transformation.Nucleic Acids Res. 19, 5791), liposome-mediated transfer method (Wong, et al., 1980), retrovirus-mediated transfer methods (Chen, et al., (1990), J. Reprod.
  • the expression target protein of the present invention in order to use the expression target protein of the present invention as an active ingredient to introduce the gene should be able to effectively penetrate into the cell.
  • the above-mentioned inactivated CMP2 or IMD4 gene Tn-1
  • SSK2 or PPG1 gene Tn-2
  • PAM1 gene Tn-3
  • DLD3 gene Tn-4
  • the MSN2 gene Tn-5
  • the protein transduction domain PTD
  • the inactivated CMP2 or IMD4 gene (Tn-1) of the present invention as an active ingredient; SSK2 or PPG1 gene (Tn-2); PAM1 gene (Tn-3); DLD3 gene (Tn-4);
  • a protein transduction domain (PTD) is fused with the protein to form a fusion protein.
  • the protein transport domain (PTD) mainly contains basic amino acid residues such as lysine / arginine, and serves to infiltrate the cell membrane with the fused protein.
  • the protein transport domain is preferably in the HIV-1 Tat protein, the homeodomain of the drosophila antennaepedia, the HSV VP22 transcriptional regulator protein, the MTS peptide derived from vFGF, the penetratin, the transpotane or the Pep-1 peptide. Including but not limited to sequences derived.
  • the present invention relates to inactivated yeast strains, such as the CMP2 or IMD4 gene (Tn-1) described above; SSK2 or PPG1 gene (Tn-2); PAM1 gene (Tn-3); DLD3 gene (Tn-4); Or ethanol-resistant or ethanol- / heat-resistant, or ethanol- / heat- / perfural transformed yeast strains comprising the MSN2 gene (Tn-5) and uses thereof.
  • inactivated yeast strains such as the CMP2 or IMD4 gene (Tn-1) described above; SSK2 or PPG1 gene (Tn-2); PAM1 gene (Tn-3); DLD3 gene (Tn-4); Or ethanol-resistant or ethanol- / heat-resistant, or ethanol- / heat- / perfural transformed yeast strains comprising the MSN2 gene (Tn-5) and uses thereof.
  • Yeast strains of the present invention are yeast strains that can grow in high concentration ethanol, preferably 10-153 ⁇ 4> ethanol.
  • Yeast strains of the present invention are also yeast strains that can grow at high temperatures (eg, 42 ° C.).
  • Yeast strains of the present invention are yeast strains that can grow even at high concentrations of furfural (e.g. 15-50 mM), among high ethanol- and heat-resistant yeast strains, including yeasts comprising an inactivated 55 ⁇ gene. Lord.
  • Yeast strains of the present invention have a high ethanol resistance can be more efficiently produced ethanol in the future integration process.
  • FIG. 1 is a diagram showing the transformation process of Saccharomyces cerevisiae L3262 using a yeast DNA library mutated by transposon.
  • 2 is a growth assay result for investigating the ethanol or heat resistance of Saccharomyces cerevisiae transposon mutants.
  • 2A-2B show growth assay results for investigating ethanol-resistance.
  • 2C is a growth assay result for investigating heat-resistance.
  • transposon insertion site 3 is a diagram showing a transposon insertion position.
  • the transposon insertion site was determined via sequencing of transposons recovered from five ethanol-resistant or ethanol- / heat-resistant strains. Peripheral genetic loci are shown.
  • FIG. 4 is a result showing expression of genes affected by transposon.
  • Northern blot analysis was performed using total RNA extracted from control L3262. Signals were relatively quantified using a scanning densitometer and normalized to ACT1 and presented as> control.
  • 5 is a growth assay result showing ethanol-resistance of SGK0 mutants.
  • 5A and 5B show 10 days serially diluted SGK0 mutants on YPD plates containing 0%, 10%, 12.5% and 15% ethanol, followed by 1 day (0%) at 30 ° C. Results are grown for 3 days (10%), 4 days (12.5%) or 5 days (15%).
  • 5C shows spotted YPD plates for 1 day (30 ° C) or
  • the result is growth for 3 days (43 ° C).
  • 6 is a growth assay result showing recovery of stress sensitivity by complement at ion.
  • 6A and 6B show 10 days serially diluted complemented strains on a YPD plate containing 0% and 10% ethanol, followed by 1 day (0%) or 4 days (10%) at 30 ° C. It is a result of growing.
  • Figure 6c is the result of growing the spotted YPD plate for 1 day (30 ° C) or 4 days (42 ° C). Control strains were prepared by transforming pRS316 to Tn mutants.
  • 7 shows the results of observing the effect of over-expression on stress sensitivity.
  • 7A and 7B show over-expression of 10-fold successive dilution The strains were spotted on YPD plates containing 03 ⁇ 4 and 10% ethanol and then grown at 30 ° C. for 1 day (0%) or 4 days (10%).
  • 7C shows the result of growing spotted YPD plates for 1 day (30 ° C.) or 4 days (42 ° C.).
  • Control strains were prepared by transforming pRS316-GAPDH to L3262.
  • FIG. 8 is a graph showing the fermentation profile of Tn mutants.
  • 8A-8D show the results of growing exponentially growing cells (0.5 0D 600 ) in YPD medium supplemented with 30% glucose and 63 ⁇ 4, ethanol at 30 ° C.
  • Cell growth FIGS. 8A and 8C
  • ethanol production FIGS. 8B and 8D
  • 8E-8F show similar experiments conducted in the absence of ethanol at 42 ° C. to monitor cell growth (FIG. 8E) and ethanol production (FIG. 8F) during fermentation.
  • 9 is a growth assay result showing perfural resistance of ⁇ -2 mutants. 10-fold serially diluted ⁇ 2 mutants were spotted on YPD plates supplemented with 15 mM, 20 mM, 30 mM, 40 mM and 50 mM perfural, and then at 30 ° C for 1 day (00, 4 days (15 mM), 5 days (20 mM), 7 days (30 mM), 9 days (40 mM) or 11 days (50 mM).
  • results are obtained by spotting SGK0 mutants 10-fold consecutively on YPD plates containing 0 mM and 20 mM perfural and then growing at 30 ° C. for 1 day (0 mM) or 7 days (20 mM). .
  • 11 is a growth assay result showing recovery of stress sensitivity by complement at ion.
  • SGK0 mutants serially diluted 10-fold were spotted on YPD plates containing 0 mM and 20 mM perfuralol and then grown at 30 ° C. for 1 day (0 mM) or 7 days (20 mM).
  • Control strains were prepared by transforming pRS316 to Tn-2 mutants.
  • 12 shows the results of observing the effect of over-expression on stress sensitivity.
  • SGK0 mutants serially diluted 10-fold were spotted on YPD plates containing 0 mM and 20 mM perfural, followed by 1 day (0 mM) at 3C C or Results are grown for 7 days (20 mM).
  • Control strains were prepared by transforming pRS316-GAPDH to L3262.
  • Saccharomyces cerevisiae (5acc? A / / 3 ⁇ 4Kces cerevisiae) 32 & 2 (MAT- a ura3-52 leu2 to 3, 112 his4-34: provided by Korea Research Institute of Bioscience and Biotechnology) was used as the host strain. Saccharomyces ceresevier was incubated at 30 ° C. in YPD medium (1% Bakto Yeast Extract, 23 ⁇ 4 Bakto Peptone, 2% Dextrose, w / v; Difco, MI).
  • Saccharomyces cerevisiae transformants were treated with SD-Leucine medium [0.67% Difco YNB (yeast nitrogen base; no amino acid), 2% glucose, 0.069% complete supplement mixture (CSM) _leu; MP, OH].
  • SD-Leucine medium 0.67% Difco YNB (yeast nitrogen base; no amino acid), 2% glucose, 0.069% complete supplement mixture (CSM) _leu; MP, OH.
  • CSM complete supplement mixture
  • the Saccharomyces ceresevier genome library pool with m3 ⁇ 43-lacZlLEU2 by random insertion ion of the transposon was extracted from the Yale Genome Analysis Center, New Haven, CT: http: // ygac .med.yale. edu / mtn / reagent). Plasmid DNA extracted from the mTn3-mutated genome library pool was cleaved with Not ⁇ and used for transformation of Saccharomyces cerevisiae L3262. Yeast transformation was carried out by the lithium acetate method. Transformants were selected in SI) -leucine medium (FIG. 1). Ethanol—Isolation of Tolerant Mutants
  • Transformants were plated in two pairs on YPD medium and YPD medium plates containing 12. ethanol and incubated for 48 hours at 30 ° C. Mutants were selected that could grow well in all media conditions. These mutants were incubated in YPD medium to OD 6 oo value 1 and then serially diluted 10-fold in sterile water. Aliquots of each dilution (5 were plated in YPD agar (Difco, MI) without or with 10%, 12.5%, 15% ethanol and incubated for 3-6 days at 30 ° C. The assays were triplicated three times, with mutants capable of growing well on YPD plates containing ethanol compared to control strains finally selected as ethanol-resistant mutants. Incubated at 30 t .. Isolation of Ethanol-/ Heat-Resistant Mutants
  • Ethanol resistant mutants identified according to the method described above were cultured at 42 ° C. for 4 days to select well growing mutants. To identify these mutants, the mutants were incubated in YPD medium to 0D 600 value 1 and then serially diluted 10-fold with sterile water. Aliquots of each dilution (5 were plated in YPD agar folate without or with 10%, 12.5%, 15% ethanol and incubated at 30 ° C or 42 ° C for 3-6 days Three growth assays were performed (triplicate) Representative experimental results were presented: YPD agar plates containing 103 ⁇ 4, 12.5% and 15% ethanol and well-developed mutations at 42 ° C compared to the control strain. Sieves were finally selected as ethanol- and heat-resistant mutants. Isolation of Ethanol- / Heat- / Purral-Tolerant Mutants
  • the m n3- 1 acZ / LEU2 insertion site was determined by plasmid rescuring using the lacZ sequence adjacent to the lacZ sequence in the ethanol-resistant mutant.
  • a plasmid designated as ⁇ 3 (recovery plasmid; P RSQ2-URA3, provided by Yale Genome Analysis Center) was introduced into the plasmid-borne copy and transposon-derived lacZ sequence. It is replaced by part of the transposon by recombination between copies.
  • Yeast DNA was recovered from these transformants and digested with the appropriate enzymes Sail, HindlU, Pstl or KpnV). The cleaved fragments were then circularized to recover in E.
  • the resulting plasmid was sequenced using lacZ primers complementary to the 5 'end of the transposon and the primer sequences used were as follows: 5'-GTTTTCCCAGTCACGAC-3'.
  • the transposon-inserted genes were analyzed using a BLAST server (ht tp: // www, yeast genome.org/) of the Saccharomyces genome database. Northern blot analysis
  • RNAs were extracted and used 15 / g.
  • the fragments used as probes obtained appropriate gene-specific primers from L3263 genomic DNA. Prepared via PCR. Purified PCR fragments were labeled with 32 P-dCTP (GE Healthcare, Buckinghamshire, UK) using random primers. Subsequent procedures were performed as previously described (Adams, A., DE Gottschling, CA Kaiser, and T. Stearns. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (1997)). ACT1 was used as an internal control. Band intensities were quantified using NIH image J, version 1.61. Experiments for each gene were performed three times. Gene Cloning and Analysis Methods
  • 0RFs open reading frames of the identified genes were cloned into pRS316-GAPDH (g 1 ycer a 1 dehyde 3-phosphate dehydrogenase).
  • ORFs fused with promoter and terminator sequences were subcloned into the pRS316 vector.
  • the amplified product and vector were digested with suitable restriction enzymes and then transformed into E. coli DH5a.
  • the primer pairs used and the resulting plasmids are listed in Table 2. Clones were identified by sequenced and transformed into Saccharomyces cerevisiae L3262 or the corresponding transposon mutants.
  • PCR-amplified by pfu DNA polymerase using genomic DNA prepared by standard protocol as a template (Adams, A., DE Gottschling, CA Kaiser, and T. Stearns.Methods in yeast genetics.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (1997).
  • PCR fragments were purified with QIAquick gel extraction kit (Qiagen, Valencia, CA). All PCR constructs were verified by sequenced. Due to introns present in the middle of 0RF, 0RF of IMD4 was prepared via Reverse Transcription (RT) -PCR.
  • RT Reverse Transcription
  • single-stranded cDNA was synthesized by AMV (Avian Myeloblastosis virus) reversing enzyme (Promega, Madson, WI) from total RNA isolated.
  • AMV Allevin Myeloblastosis virus
  • IX reverse transcript buffer [10 mM Tris-HCKpH 9.0), 50 mM KC1, 0.1% Triton X—100], 1 mM deoxynucleoside triphosphate (dNTPs), 0.5 unit of RNase inhibitor, 100 pmol / of A 20 ⁇ reverse transcriptase complex containing a specific downstream primer (IMD4-R; Table 1) and 15 units of AMV reverse transcriptase were reacted at 42 ° C for 15 minutes and heated at 99 ° C for 5 minutes.
  • IMD4-R a specific downstream primer
  • PCR conditions were performed as follows: denaturation at 95 ° C. for 3 minutes; Conducting 35 cycles (one cycle consisting of denaturation at 95 ° C. for 1 minute, annealing at 65 ° C. for 1 minute, and extending at 72 ° C. for 2 minutes); And finally extending for 10 minutes at 72 ° C.
  • Cell growth was measured at 600 nm using a Beckman DU730 spectrophotometer (Beckman Coulter, Fullerton, Calif.) And monitored by hemocytometry. Fermentation
  • Exponentially growing cells were obtained and transferred to 100 ml of YPD30E6 [YP supplemented with 30% glucose and 63 ⁇ 4 (v / v) ethanol].
  • Starting cell density was adjusted to a 0D 600 value of 0.3.
  • Cells were incubated at 30 ° C with shaking at 120 rpm. After samples were taken every 12 hours, cell growth and ethanol concentration were determined using cell density measurement and HPLC (high-pressure liquid chromatography), respectively. Samples were loaded on an Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) set at 60 ° C. Glucose and ethanol were eluted with 0.5 mM SO 4 at a flow rate of 0.6 ml / min. Peaks were detected by refractory index and identified according to retent ion time and quantified according to a standard curve. Cell growth was monitored by measuring optical density at 600 nm.
  • a protein catalyzing the step In Saccharomyces cerevisiae, four gene families are present and always expressed.
  • MAP mi togen-act ivated protein
  • PPG1 Potential serine / threonine protein phosphatase required for glycogen accumulation, interacting with Tap42p, which binds and regulates other protein phosphatase.
  • PA 1 essential protein whose function is unknown
  • Tn-3 shows PAM1 expression and overexpressed
  • D lactate dehydrogenase
  • 1152 bp translocation binds to the reaction element in the DNA of stress-responsive genes to induce their expression.
  • the insertion position is the position from the starting ATG of each coding sequence.
  • the insertion position is the position from the stop codon of each coding sequence.
  • c Annotation of the Yeast Genome Database (YGD). Identification of destroyed genes
  • the position at which the transposon was inserted was as follows: Tnl, the termination site of CMP2 and the termination site of IMD4; Promoter region of Tn2, SSK2 and promoter region of PPG1; ORn site of Tn3, PAMl; Tn4, termination site of RMD6 and promoter site of DLD3; And Tn5, 0RF site of MSN2.
  • the expression levels of CMP2, IMD4, SSK2, PPG1, PAMl, RMD6, DLD3 and MSN2 were examined via Northern blot analysis ( 4A and 4B) Compared with the control, the levels of CMP2 and IMD4 were about 10% and 20% lower, respectively. Compared to the control, the levels of SSK2 and PPG1 were about 20% and 50% lower, respectively, meaning that PPG1 was affected to a greater extent than SSK2. Of DLD3 compared to the control group The level was about 2 lower, but RMD6 was excluded from future experiments because the level of RMD6 remained unchanged. As expected, no expression of PAM1 and MSN2 was detected. Thus, transposon insertion partially affected the expression of CMP2, IMD4, SSK2, PPG1 and DLD3, and completely inhibited the expression of PAM1 and MSN2.
  • CMP2 and IMD4 are simultaneously co-down-regulated at Tnl
  • SSK2 and PPG1 are down-regulated at the same time in Tn2
  • DLD3 is down-regulated at ⁇ 4, and at ⁇ 3 and ⁇ 5
  • PAM1 and MSN2 were destroyed, respectively.
  • SSK2, PPG1, PAM1, DLD3, and MSN2 single gene knockouts in S. cerevisiae in the BY4741 background ( The knock-out mutants for the seven genes obtained from the SGK0) collection library were examined individually. The library was kindly provided by Dr.
  • the S. cerevisiae BY4741 strain was the mother strain of the deletion mutants described above. All deletions when cultures of t ": mp2, Mwd4, Ass 2, Appgl, t ⁇ paml, Mld3 and VII2 were spot-assayed on YPD plates containing 10%, 12.5% and 15% ethanol Growth of the mutants was increased at all ethanol concentrations examined as compared to the control BY4741 strain (FIGS. 5A and 5B) When the spotted YPD plates were grown at 43 ° C., at temperatures where Tnl to Tn5 could not grow ssk2, Appgl and Example 1 showed increased growth (FIG.
  • Tnl-Tn5 acquires ethanol- and / or heat-resistance through the deletion or simultaneous down-regulation of certain genes means that supplementation of the genes described above may indicate cell sensitivity to the stress.
  • the amplified DNA fragments containing the promoter, 0RF and terminator (0RF +/- 700 bp) were cloned into the pRS316 vector and transfected into the Tnl-Tn5 mutant, which was complemented, except for IMD4. Each gene was expressed by itself.
  • RT-PCT was performed and cloned into pRS316-GAPDH to obtain a total 0RF, and the cloned DNA was overexpressed under the control of the GAPDH promoter.
  • Controls were constructed by transforming the PRS316 vector.
  • spot assays were performed on YPD agar containing 10% ethanol, the resistance of supplemented cells was significantly reduced compared to ⁇ mutants (FIGS. 6A and 6B)-individually supplemented with SSK2 and PPG1. Reduced heat-resistance was observed when ⁇ 3 complemented with Tn2 and PAM1 was incubated at 42 ° C. (FIG. 6C).
  • ethanol-resistant cells are known to produce more ethane than non-resistive strains because of their high cell viability at high concentrations of ethane.
  • the parent strain is basically capable of producing up to about ethanol from 30% glucose, which is hardly seen as an effect of resistance on the increased ethane, so the final ethanol titer is 9 It was necessary to establish conditions exceeding%. In this respect, we started fermentation in a culture medium containing 6% ethanol and starting cells with a 0D 600 value of 0.5.
  • one mutant (Tn-2) was able to grow in YPD plates supplemented with 15 mM, 20 mM, 30 mM, 40 mM and 50 mM perfural.
  • one mutant (Tn-2) simultaneously had resistance to both ethanol-, heat- and perfural-stress (FIG. 9). Contribution to Ethanol-/ Heat-/ Perfural-Resistance
  • Tn-2 acquires ethanol-, heat- and perfural-resistance through the deletion or simultaneous down-regulation of certain genes suggests that supplementation of the genes described above may be represented by the cell's sensitivity to the stress. Means that.
  • amplified DNA fragments containing the promoter, SSK2 0RF and terminator (0RF +/- 700 bp) were cloned into the pRS316 vector and transfected into the corresponding Tn-2 mutant.
  • pRS316 vector was constructed by transformation.
  • the transposon was inserted at the expected regulatory site of the affected genes.
  • screening libraries containing appropriate clone counts would allow for the isolation of a larger number of strains with increased resistance. Isolation of Tnl, Tn2 and ⁇ 4, indicating down-regulation of affected genes would not have been possible without the SGK0 collection.
  • our study was the first to identify that RNA level is a determinant for ethanol- and / or heat-resistance.
  • the CMP2 gene encodes calcineurin A, an isotype of the active subunit of Ca 2 V calmodulin-dependent phosphatase that regulates Crzlp (stress-responsive transcription factor). Calcineurin dephosphorylates Crzlp, causing rapid translocation from the cytoplasm to the nucleus. Crzlp then activates transcription of genes involved in cell survival (Cyert, 2003; Panadero, et al., 2007).
  • CRZ1 is important for cell growth under ethanol stress through function in the ethanol-induced calcineurin / Crzl pathway (Araki, et al., 2009). Calcineurin, on the other hand, increases the degradation of Msn2p, resulting in insufficient induction of genes with stress-response elements (STRE) (Takatsume, et al., 2010). Thus, whether the calcineurin-Crzlp pathway functions as an ethanol-protective mechanism in yeast is controversial. The results of the invention that CMP2 knock-out results in increased ethanol resistance support the latter.
  • IMD4 encodes isozymes of inosine monophosphate dehydrogenase (IMPDH), which catalyzes the first step of GMP biosynthesis.
  • IMD4 There are no reports of IMD4 related to ethanol resistance to S. cerevisiae.
  • Ethanol stress reduces the level of IMPDH, resulting in the production of nicotinamide nucleotides, leading to the induction of glutathione reductase leading to a decrease in NADPH levels (39 ).
  • CMP2 and IMD4 will be important for ethanol resistance.
  • SSK2 encodes the mitogen-activated protein kinase kinase kinase kinase ( ⁇ ) of the H0G1 pathway (Posas, et al., 1998), which is essential for yeast survival against a variety of environmental stresses, including high osmoticol (Albertyn, 1994; Brewster, et al., 1993).
  • the HOG1 pathway is regulated independently of each other by two membrane-bound osmosensor proteins Slnlp and Sholp.
  • PPG1 encodes a potential serine / threonine protein phosphatase required for glycogen accumulation (Posas, et al., 1993). Glycogen biosynthesis genes are highly expressed in response to ethanol shock (Hirasawa, et al., 2007). Since the relevant data for PPG1 are not presented in this study, it is premature to take into account inconsistencies with the inventors' data that destruction of PPG1 confers resistance to both ethanol and heat.
  • knock-out conferred resistance to both ethanol and heat and encodes an essential protein whose function is unknown, presumably a protein phosphatase 2A multicopy suppressor.
  • Over-expression of this gene causes a fibrous phenotype by inhibiting growth and disrupting regulatory pathways regulating cell morphology (Hu, et al., 1994). So far, there is no evidence that these genes are associated with stress resistance.
  • DLD3 is part of a retrograde regulator consisting of genes that are stimulated and expressed by mitochondrial damage, encoding D-lactate dehydrogenase. To date, there is no report on the association of this gene with stress resistance.
  • MSN2 encodes a transcription factor that regulates the general stress response (Martinez-Pastor, et al., 1996; Schmitt, et al., 1996).
  • Msn4p which has 41% identity with Msn2p
  • Msn2p expresses the expression of about 200 genes that respond to various stresses, including heat and high levels of ethanol. Regulation by binding to the stress-response element (STRE) located in the promoter of these genes (Causton, et al., 2001; Gasch, et al., 2000; Martinez-Pastor, et al., 1996) .
  • STRE stress-response element
  • MSN2 and MSN4 Single base deletion mutations of msn2 and msn4 do not show any phenotype, but msn2 and msn4 double null mutants are hypersensitive to starvat ion, thermal shock, osmotic stress and oxidative stress.
  • Over-expression of the MSN2 and MSN4 genes reduces susceptibility to deficiency and heat stress (Estruch, et al., 1993).
  • MSN2 and MSN4 function as a team in many biological responses, although depending on specific genes and specific stress conditions, respectively (Fuji ta, et al., 2006).
  • MSN2 knock-out showed a higher phenotype (resistance to increased ethane) than previous studies.
  • Msn2p is able to function as a negative regulator of genes associated with ethanol resistance.
  • Msn2p and Msn4p have a partially redundant function in stress response (Estruch, et al., 1993). In this context, we propose that MSN4 modulates ethane stress response on behalf of MSN2 in the MSN2 knock-out strain.
  • CMP2, IMD4, SSK2, PPG1, PAM1, DLD3 and MSN2 genes responsible for increased ethanol-resistance
  • SSK2, PPG1 and PAM1 genes responsible for increased ethanol-resistance
  • SSK2, PPG1 and PAM1 genes responsible for increased ethanol-resistance
  • SSK2, PPG1 and PAM1 genes responsible for increased ethanol-resistance
  • SSK2, PPG1 and PAM1 three genes with increased heat-resistance
  • GPD1 which encodes g lycer o 1-3-phosphat e dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14: 4135-4144 (1994).
  • thermotolerance is a key physiological determinant of thermotolerance
  • thermotolerant yeast strains Saccharomyces cerevisiae for bioethanol production. Enzyme Microb. Techno 1., 43: 120-123 (2008).
  • Schmitt, A. P., and K. McEntee. Msn2 a zinc finger DNA ⁇ binding protein, is the transcriptional activator of the mult istress response in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA, 93: 577, 5782 (1996).
  • thermotolerant mutants by using proofreading-deficient DNA polymerase as an effective mutator in Saccharomyces cerevisiae. Genes Genet. Syst. 81: 391-397 (2006).
  • M. M.
  • D. Watanabe T. Akao
  • H. Shimoi Overexpression of MSN2 in a sake yeast strain promotes ethanol tolerance and increases ethanol product ion in sake brewing. J. Biosci. Bioeng. 107: 516-518 (2009).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 불활성화된(inactivated) CMP2 또는 IMD4 유전자(Tn-1); SSK2 또는 PPG1 유전자(Tn-2); PAM1 유전자(Tn-3); DLD3 유전자(Tn-4); 또는MSN2 유전자(Tn-5)를 포함하는 에탄올-, 에탄올-/열- 또는 에탄올-/열-퍼퓨랄(furfural)-저항성 형질변형 효모 균주 및 이의 용도에 관한 것이다. 본 발명의 효모 균주는 고농도 에탄올, 바람직하게는 고농도 에탄올(예컨대, 5-15%)에서 성장할 수 있다. 또한, 본 발명의 효모 균주는 고온(예컨대, 42℃ 또는 43℃) 또는 고농도 퍼퓨랄(예컨대, 15-50 mM)에서도 성장할 수 있는 효모 균주를 포함한다. 따라서, 본 발명의 효모 균주는 기존의 비효율적인 다단계 공정을 극복하는 통합공정에 필요한 고온, 고농도 에탄올 및 고농도 퍼퓨랄 조건에서 보다 효율적으로 에탄올을 생산할 수 있다.

Description

【명세서】
【발명의 명칭】
에탄올-, 열 - 또는 퍼퓨랄-저항성 효모 균주， 및 이의 유전자 [기술 분야]
본 발명은 에탄올-， 열- 또는 퍼퓨랄-저항성 효모 균주 및 이의 유전자， 그리고 이의 용도에 대한 것이다.
【배경 기술】
효모 사카로미세스 세레비지에 (5. cerevisiae)는 바이오매스 자원으로부터 바이오에탄올의 생산을 포함하는 여러 산업 분야에서 다양하게 이용되어 왔다 (Schubert, 2006). 효모 세포는 산업적 에탄올 발효 과정 동안 발생하는 고농도 에탄올 같은 여러 환경적 스트레스에 항상 노출되고， 이는 결국 세포 성장， 세포 생존율 및 에탄올 생산에 있어서의 감소를 초래한다 (Casey & Ingledew, 1986； Suutari and Laakso, 1994) . 따라서， 주로 고농도 에탄을에 의해 야기된 스트레스를 극복할 수 있는 효모 균주의 개발이 요구되어져 왔다. 한편， 새로운 기술로서 제안되어 지는 목질계 분해효소 생산라인과 목질계 분해라인, 발효라인이 한 반응기 (reactor)에서 일어나도록 균주체계를 개발하고자 하는 통합공정 (CBP: Consolidated BioProcess)은 목질계 분해효소의 적정환경 과 효모의 발효환경의 차이를 극복할 조건에 맞는 고에탄올 및 열 저항성을 보유한 효모균주를 개발 하는 것이 향후 효율적인 에탄올 생산을 위한 가장 중요한 요소이다. 또한， 목질계 분해과정에서 생성되는 발효저해제 일종인 퍼퓨랄 (furfural)에 저항성을 획득한 균주를 개발하는 것이 더욱 필요하다 할 수 있다.
에탄올 스트레스 저항성에 대한 기작을 조사하기 위해 많은 연구들이 있었다. 특히， 막 유동성과 관계된 불포화 지방산은 효모에서 에탄을 저항성의 중요한 결정인자로 간주되어 보고되었다 (Kajiwara, et al . , 2000； You, et al, 2003). 또한, 트리할로오스 (Kim, et al., 1996) 또는 프를린 (Takagi, et al., 2005)의 세포내 축적이 효모의 에탄올 저항성을 개선시키고 에르고스테롤이 사카로미세스 세레비지에의 에탄올 저항성과 관련된 중요한 인자 (Inoue, et al . , 2000)라는 것이 보고되었다.
더 나아가， 마이크로어레이 및 포괄적 발현 패턴 분석 같은 지놈 전반에 걸친 (genome-wide) 분석들의 이용이 에탄올 스트레스 관련된 신규한 유전자들을 동정하는 데 유용하였다 (Hirasawa, et al . , 2007； Teixeira, et al., 2009； Yoshikawa, et al., 2009). 이러한 접근방법을 통해， 에탄을 저항성에 관련된 많은 유전자들이 비 -필수 (nonessential) 유전자들로 동정되었다. 또한， 에탄올 저항성에 관련된 결과들은 각각 매치하지 않았고， 이러한 불일치는 균주 및 성장 조건에 기인한다고 보고하였다 (Teixeira, et al., 2009). 따라서， 상술한 유전 정보로부터 구축된 균주는 항상 에탄올 스트레스 조건에 대한 변화를 초래하지 않는다 (Yoshikawa, et al., 2009). 또한， 상업적으로 유용한 사카로미세스 세레비지에의 결실 돌연변이 라이브러리는 에탄올 저항성에 관련된 유전자들의 지놈 전반에 걸친 스크리닝에 이용되었다 (Fuji ta, et al. , 2006； Teixeira, et al. , 2009； Yoshikawa, et al., 2009). 상술한 연구들은 주로 에탄올 민감성을 나타내는 돌연변이체들을 선택하여 상웅하는 유전자를 고농도 에탄올 조건 하에서 성장에 필요한 유전자들로 동정하였다. 한편， 고온 조건에서는 주로 열충격 단백질 (HSP: Heat shock protein)이 유도되어 성장을 유도한다고 보고 되었으며 (Sanchez, et al., 1990), 사카로미세스 지놈 결실 프로젝트에 의해 구축된 효모유전자 결실 돌연변이체들에 대한 온도를 포함한 여러 스트레스 민감조건에서 요구되어 지는 유전자들을 스크리닝 하였다 (Auesukaree et al., 2009). 또한， 퍼퓨랄에 대한 민감성을 나타내는 유전인자들을 동정한 결과 주로 펜토스 포스페이트 경로 (pentose phosphate pathway)에 포함된 유전자들 7， GND1, RPE1, 및 이 주요한 인자이며 이는 조효소 NADPH/NADH 의 레독스 조절 (Redox balance)이 중요하다고 하였다 (Gorsich, et al. , 2006).
상술한 바와 같이， 에탄올-，열- 및 퍼퓨랄 민감성 돌연변이들의 스크리닝을 통해 저항성을 책임지는 유전자들이 동정되었지만 (Takahashi, et al., 2001； Auesukaree et al., 2009), 임의적 트랜스포존 삽입에 의해 에탄올-， 열- 및 퍼퓨랄 저항성 효모 균주를 직접적으로 구축하고 이에 관계된 타겟 유전자들을 동정하는 방법에 대해서는 아직까지 보고되어 있지 않다.
한편， 지속적인 대체 연료로서 바이오에탄올에 대한 요구가 증가하고 있다. 효모 사카로미세스 세레비지에는 강력한 에탄을 생산능 및 저항성으로 인해 에탄올-연관된 산업에서 폭넓게 이용되고 있다 (Schubert 2006). 효모 세포는 고농도 에탄올， 고온 또는 고삼투압 같은 여러 환경 스트레스 및 산업적 에탄올 발효 동안 발생하는 억제인자들에 항상 노출되어 결국 세포 성장, 생존율 및 에탄올 생산율이 감소된다 (Casey & Ingledew 1986； Suutari & Laakso 1994) . 따라서 , 다양한 스트레스를 견딜 수 있는 효모 스트레인의 개발이 절실하게 요구된다.
연료 에탄올 생산을 위해 가장 강력하게 대두되는 기술들 중 하나가 동일 반응기에서 동시에 리그노샐를로오스계 바이오매스 (lignocellulosic biomass)의 당화 (sacchar i f icat ion) 및 발효로 특징지을 수 있는 CBP( consolidated bi으 processing)이다 (Lynd, et al. , 2005). CBP 에서는 당화를 위한 최적 온도 (45-50°C)가 발효를 위한 온도 (25-35°C)와 다르기 때문에， 열-저항성 스트레인의 이용이 반드시 필요하다 (Edgardo, et al . , 2008； Weber , et al., 2010). 또한, 열-저항성 효모 스트레인의 이용은 넁각 비용, 증류 비용 및 더 빠른 발효율을 감소시키는 데 유용하고 발효 동안 오염 기회를 감소시키는 데 도움이 된다. 자외선 돌연변이유발법 (Sridhar, et al., 2002) , 에러 -프론 PCR(error-prone polymerase chain react ion; Shimoda, et al . , 2006) 및 고온에 장기간 적웅 (long— term adapt at ion to high temperatures； Edgardo , et al . , 2008)을 이용한 여러 보고들에서 열-저항성 스트레인의 개발을 소개하고 있다.
에탄올-저항성 효모 스트레인의 이용은 그 자체로 높은 에탄올 생산율을 위해 중요한데， 왜냐하면 에탄올 농도가 발효 과정 동안 세포에 해로운， 심지어는 치명적인 레벨까지 끊임없이 증가하기 때문이다. 트리할로오스 (Kim, et al., 1996), 프를린 (Takagi, et al . , 2005) 및 에르고스테를 (Inoue, et al . , 2000)의 세포내 축적을 포함하는 여러 생리학적 변화들이 에탄올-저항성 효모 스트레인에서 일어난다. 에탄올 저항성 스트레인들을 개발하기 위해， 진화적 적웅 (Stanley, et al., 2010)， 임의적 화학물질 돌연변이유발법 (Mobini-Dehkordi, et al., 2008) 및 유전자 셔플링 (Hou, 2010) 같은 고전적인 전략 이외에 여러 전략들이 최근에 이용되고 있다. 상술한 대체 전략들은 지놈 전반에 걸친 DNA 마이크로어레이 분석 (Hirasawa, et al., 2007) , 트랜스포존-매개된 결실 돌연변이 라이브러리 (Takahashi, et al. , 2001) 또는 단일 유전자 넉 -아웃 single gene knockout (SGKO) 라이브러리 (Auesukaree, et al. , 2009； Fujita, et al. , 2006； Kubota, et al . , 2004； Teixeira, et al. , 2009； van Voorst , et al., 2006； Yoshikawa, et al., 2009) 스크리닝 및 gTME(global transcriptional machinery engineering; Alper , et al . , 2006)를 포함한다. 비록 gTME 가 에탄올 저항성 스트레인을 양성적으로 선택하는 수단으로서 홍미로울지라도， 그 효용도가 논란이 되고 있다 (Araki, et al. , 2009). 이와 대조적으로, 다른 3 가지 대체 전략들은 대부분 간접적이다: 타겟 유전자의 동정에 따른 확인 단계가 추가적으로 필요한데， 이는 에탄올 민감성 유전자의 동정이 에탄을 저항성의 분자 기반을 이해하는 데 도움을 주지만 에탄올 저항성 스트레인의 생산을 확실하게 하는 것은 아니기 때문이다. 더욱이， 동정된 타겟 유전자들의 많은 수가 복잡하게 고려해야 하는데, 이는 효모 지놈에서 인코딩된 유전자들의 5-10%는 다른 스트레스 인자들 (stressors)일 수 있기 때문이다.
몇몇 연구들이 특이 유전자 (들)의 파괴가 에탄올 (Kubota, et al., 2004； Yazawa, et al . , 2007)을 포함하는 여러 종류의 스트레인 인자들에 대한 저항성 스트레인의 창출로 이어진다는 것을 밝혔다. 최근에, 8 > 에탄올에서 증가된 성장을 보이는 2 개의 클론 및 10 개의 삼투-저항성 클론들이 SGK0 라이브러리의 스크리닝올 통해 동정되었다 (Yoshikawa, et al., 2009). 특히， 본 연구는 특정 스트레스 인자에 대한 저항성 (민감하지 않은)을 가지는 스트레인의 양성적 (또는 직접적인) 분리를 위해 트랜스포존 또는 SGK0를 이용하여 구축된 결실 돌연변이 라이브러리의 이용하였다.
어떠한 라이브러리를 이용하는 것이 현재 주된 이슈이다. 각 라이브러리는 대조적인 장점 및 단점들을 가지는데， 트랜스포존 돌연변이 라이브러리는 다양한 유전적 백그라운드를 가진 스트레인들에서 쉽게 구축될 수 있다. 상향- 또는 하향-조절된 유전자들을 가지는 돌연변이체들은 조절성 부위， 특히 발현 레벨에 있어서 중요한 부위 (예컨대， 치사 유전자들)로의 트랜스포존 삽입에 의해 발생될 수 있다. 한편， 이러한 방법은 해당 유전자의 최종 동정을 위한 추가적인 단계 (예컨대， 지놈
DNAs 에 의해 풀탱킹된 트랜스포존의 회복)를 필요로 한다. 종종， 하나 이상의 유전자들이 영향 받을 수 있다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 상세한 설명】
본 발명자들은 고에탄올-저항성을 보유한 효모 균주를 개발하고자 노력하였다. 그 결과， 본 발명자들은 효모에서 트랜스포존-매개된 유전자 상동 재조합으로 효모 염색체 내에 돌연변이를 유발함으로써 에탄올-저항성， 또는 에탄올 _/열-저항성, 또는 에탄올 -/열 -/퍼퓨랄-저항성 효모 형질전환체를 동정하였으며, 이들이 고농도 에탄올 (예컨대， 10%， 12.5%, 15% 에탄올)， 고온 (예컨대, 42°C, 43 °C) 또는 고농도 퍼퓨랄 (예컨대， 15 mM, 20 mM, 30 mM, 40 mM, 50 mM)에서 성장할 수 있다는 것올 확인함으로써， 본 발명을 완성하게 되었다. 따라서, 본 발명의 목적은 에탄을-저항성 효모 균주 및 이와 관련된 유전자를 제공하는 데 있다.
본 발명의 다른 목적은 에탄올- 및 열-저항성 효모 균주 및 이와 관련된 유전자를 제공하는 데 있다.
본 발명의 또 다른 목적은 퍼퓨랄-저항성 효모 균주 및 이와 관련된 유전자를 제공하는 데 있다.
본 발명의 또 다른 목적은 에탄올 생산방법을 제공하는 데 있다. 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 청구범위 및 도면에 의해 보다 명확하게 된다. 본 발명의 일 양태에 따르면， 본 발명은 불활성화된 (inactivated) CMP2 또는 IMD4 유전자 (Tn-1); DLD3 유전자 (Tn_4); 또는 MSN2 유전자 (Tn- 5)를 포함하는 에탄올-저항성 형질변형 효모 균주를 제공한다. 본 발명자들은 고에탄올―저항성올 보유한 효모 균주를 개발하고자 노력하였다. 그 결과， 본 발명자들은 효모에서 트랜스포존-매개된 유전자 상동 재조합으로 효모 염색체 내에 돌연변이를 유발함으로써 에탄올-저항성， 또는 에탄올 -/열-저항성， 또는 에탄올 -/열 -/퍼퓨랄-저항성 효모 형질전환체를 동정하였으며， 이들이 고농도 에탄올 (예컨대， 10%, 12.5%, 15% 에탄올)， 고온 (예컨대， 42°C, 43 °C) 또는 고농도 퍼퓨랄 (예컨대, 15 mM, 20 mM, 30 mM, 40 mM, 50 mM)에서 성장할 수 있다는 것을 확인하였다.
발화성, 휘발성 무색 액체인 에탄올은 가장 널리 이용되는 용매이다. 산업적으로， 에탄올은 자동차 연료 및 연료 첨가제로서 이용되며， 향수 (scents), 향료 (flavorings), 착색제 (color ings) 및 의약품 (medicines)으로도 이용된다. 또한， 에탄올은 알코올 음료 내 주요 정신활성 구성성분으로 중추신경계에 진정 효능을 가진다. 에탄올은 에틸렌의 수화를 통해 석유화학적으로 생산될 수 있으며， 효모를 이용하여 당을 발효시킴으로써 생물학적으로 생산될 수 있는데， 이러한 생물학적 생산은 석유 및 곡물 사료제의 가격에 의존적인 석유화학적 과정에 의한 생산보다 훨씬 경제적이다. 따라서， 생물학적 에탄을의 생산을 위한 효모 균주의 개발은 매우 중요하다.
트랜스포존 돌연변이유발법은 여러 연구들에서 세포 형태학에 포함된 유전자들을 분석하기 위해 이용되었고， 유전자 파괴 돌연변이들의 생존이 유지된 유전자들을 포괄적으로 스크리닝하기 위해 효과적인 수단을 제공한다. 본 연구의 목적은 임의적 트랜스포존 삽입에 의해 에탄을-저항성 효모 균주를 직접적으로 구축하고 이에 관계된 타겟 유전자들을 동정하는 것이다.
본 발명은 효모에서 트랜스포존-매개된 돌연변이에 의해 에탄올- 저항성이 증가된 형질변형 효모 균주를 제공한다.
본 명세서의 용어 "트랜스포존 (transposon)" 은 단일 세포의 지놈 내에서 다른 위치로 이동 (transposition)할 수 있는 DNA 서열로， 돌연변이를 유발하는 DNA 서열을 의미한다. 점핑 유전자로 불리는 트랜스포존은 모바일 유전성 엘리먼트의 좋은 예이다. 다양한 종류의 모바일 유전성 엘리먼트들은 트랜스포지션 기작에 따라 다음과 같이 분류될 수 있다: (a) 그룹 I 레트로트랜스포존, RNA로 전사된 후 DNA로 역전사되어 이동해 가는 트랜스포존; 및 (b) 그룹 II 점핑 트랜스포존， 트랜스포사제에 의해 DNA 의 한 위치에서 다른 위치로 점핑 ( "cut and paste" )하는 트랜스포존. 본 발명에서 이용된 트랜스포존 컨스트럭트는 m n3- J acZ/LEU2 컨스트럭트로 유전자 상동 재조합 (Homologous recombinat ion)을 통해 효모 염색체 내로 도입된다.
본 발명은 (a) 효모 염색체에 돌연변이 (mutations)를 유발시키는 단계; 및 (b) 상기 돌연변이된 효모를 고농도 에탄을 포함 배지에서 배양시키는 단계를 포함하는 에탄올-저항성이 증가된 형질변형 효모 균주의 스크리닝 방법을 제공한다.
상기 (a) 단계는 다양한 방법， 바람직하게는 트랜스포존을 이용하여 실시한다. 본 발명자들은 예일지놈분석센터 (Yale Genome Analysis Center, New Haven , CT: http://ygac .med.yale.edu/mtn/reagent )로부터 얻어진 mln3-JacZ/LEU2 컨스트럭트를 포함하는 효모 (5. cerevisiae) 라이브러리 풀을 이용하였다 (참고: 도 1). 제한효소를 이용하여 트랜스포존 컨스트럭트를 플라스미드 DNA 로부터 절단하고 그 단편을 효모 염색체로 유전자 상동 재조합을 통해 형질전환시킴으로써 돌연변이를 유발시켰다. 일반적인 재조합 과정으로 알려진 유전자 상동 재조합은 유사한 또는 동일한 두 개의 DNA 가닥 사이에서 발생하는 뉴클레오타이드 서열의 교환을 지칭하는 유전 재조합의 한 형태로， 대부분의 생명체에서 이용된다.
이후， 상기 (b) 단계에서 형질전환된 효모 균주를 고농도 에탄올에서 배양하여 성장이 가능한 균주를 분리 /동정한다. 본 발명에서는 다양한 농도의 에탄을 (10%, 12.5%, 15% 에탄올)에서 대조군과 함께 형질변형된 효모 균주에 대한 성장 어세이 (spot assay)를 실시하여 최종적으로 에탄올- 저항성 형질변형 효모 균주를 선택한다.
본 발명은 불활성화된 (inactivated) CMP2 또는 IMD4 유전자 (Tn-1); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)를 포함하는 에탄올-저항성 효모 균주들을 분리 /동정하였다. 본 명세서의 용어 "불활성화된 (inactivated)" 은 타겟 유전자의 기능이 차단되면 불활성화되었다고 표현하며， 예를 들어 트랜스포존-유발된 돌연변이， 점 돌연변이， 넌센스 돌연변이， 미스센스 돌연변이， 대체 돌연변이， 결실 돌연변이， 등을 포함하는 돌연변이에 의해서 유발된 타겟 유전자의 불활성화를 포함한다. 바람직하게는， 본 발명의 불활성화는 트랜스포존에 의해 유발된 돌연변이를 통한 불활성화를 의미한다.
본 발명의 바람직한 구현예에 따르면, 상술한 타겟 유전자의 불활성화는 트랜스포존에 의해 유발된다.
상술한 타겟 유전자들， 즉 CMP2, IMD4, DLD3 및 MSN2 유전자의 뉴클레오타이드 서열 및 아미노산 서열은 각각 서열목록 제 1 서열， 제 2서열， 제 6서열 및 제 7서열， 그리고 서열목록 제 8서열, 제 9서열， 제 13 서열 및 제 14 서열에 기재되어 있으며， 상기 유전자들의 아미노산을 인코딩하는 뉴클레오타이드 서열 및 이의 변형체도 이용될 수 있음은 당업계에서 자명하다.
본 발명의 바람직한 구현예에 따르면， 상술한 효모 균주는 5-15% 에탄올， 보다 바람직하게는 10-15% 에탄올， 및 가장 바람직하게는 12.5-15% 에탄올 배양 조건에서 성장할 수 있다.
본 발명의 바람직한 구현예에 따르면， 상술한 효모 균주는 사카로마이세스 종 Saccharomyces spp.), 시조사카로마이세스 ( Schizosaccharomyces spp.), 피키 ό ^{Pichia spp.), 파피 ό 종 0¾///a spp.), 클루이베로미세스 종 UUuyveromyces spp.), 칸디다 ^ Candida spp.), 탈라로미세스 종 Talaromyces spp.), 브레타노미세스 ( Bret tanomyces spp.), 파키솔렌 ^{Pachysolen spp. ) 또는 데바리오미세스 종 Debaryomyces spp.) 효모 균주이며, 보다 바람직하게는 사카로마이세스 종이고， 가장 바람직하게는 사카로마이세스 세레비지에 L32620K 7- a ura3~52 leu2-3, 112 his4-34)이다 . 본 발명의 다른 양태에 따르면, 본 발명은 불활성화된 (inactivated) SSK2 또는 PPG1 유전자를 포함하는 에탄을- 및 열-저항성 형질변형 효모 균주를 제공한다. 본 발명의 다른 양태에 따르면， 본 발명은 불활성화된 (inactivated) PAM1 유전자를 포함하는 에탄을- 및 열-저항성 효모 균주를 제공한다.
본 발명의 방법은 상술한 트랜스포존을 이용한 방법을 포함하기 때문에， 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
형질전환된 효모 균주를 고농도 에탄올에서 배양하여 성장이 가능한 균주를 분리 /동정한다. 본 발명에서는 다양한 농도의 에탄올 (10%, 12.5%, 15% 에탄올)에서 효모 균주의 성장 어세이 (spot assay)를 실시하였다. 선택된 에탄올-저항성 균주들올 대조군과 함께 30°C 또는 42°C에서 배양하여 대조군과 비교하여 고온 (42°C)에서도 성장할 수 있는 균주들을 에탄올- 및 열-저항성 형질변형 효모 균주로 선택하였다.
본 발명은 불활성화된 (inactivated) SSK2 또는 PPG1 유전자, 또는 PAM1 유전자를 포함하는 에탄올- 및 열-저항성 효모 균주들을 분리 /동정하였다.
본 발명의 바람직한 구현예에 따르면, 상술한 타켓 유전자의 불활성화는 트랜스포존에 의해 유발된다. 상술한 타겟 유전자들, 즉 SSK2, PPG1 및 PAM1 유전자의 뉴클레오타이드 서열 및 아미노산 서열은 각각 서열목록 제 3 서열， 제 4서열 및 제 5서열, 그리고 서열목록 제 10 서열, 제 11 서열 및 제 12 서열에 기재되어 있으며， 상기 유전자들의 아미노산을 인코딩하는 뉴클레오타이드 서열 및 이의 변형체도 이용될 수 있음은 당업계에서 자명하다.
본 발명의 바람직한 구현예에 따르면， 상술한 효모 균주는 5-15% 에탄올， 보다 바람직하게는 10-15% 에탄올 및 가장 바람직하게는 12.5-15% 에탄올 배양 조건에서 성장할 수 있다.
본 발명의 바람직한 구현예에 따르면， 상술한 효모 균주는 30-43 °C, 보다 바람직하게는 37-43°C, 보다 더 바람직하게는 40-43°C 및 가장 바람직하게는 42-43 °C 온도 조건에서 성장할 수 있다. 본 발명의 또 다른 양태에 따르면， 본 발명은 불활성화된 (inactivated) 5 유전자를 포함하는 퍼퓨랄 (furfural)-저항성 형질변형 효모 균주를 제공한다. 본 .발명의 방법은 상술한 트랜스포존을 이용한 방법을 포함하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
형질전환된 효모 균주를 고농도 에탄올에서 배양하여 성장이 가능한 균주를 분리 /동정한다. 본 발명에서는 다양한 농도의 에탄올 (10%, 12.5%, 15% 에탄올)에서 효모 균주의 성장 어세이 (spot assay)를 실시하였다. 선택된 에탄을-저항성 균주들을 대조군과 함께 30°C 또는 42°C에서 배양하여 대조군과 비교하여 고온 (42°C)에서도 성장할 수 있는 균주들을 에탄을- 및 열-저항성 형질변형. 효모 균주로 선택하였다. 더 나아가， 선택된 에탄올-저항성 균주들을 대조군과 함께 다양한 농도의 퍼류랄 하에서 배양하여 대조군과 비교하여 고농도 퍼퓨랄 (15 mM, 20 mM, 30 mM, 40 mM 또는 50 mM)에서도 성장할 수 있는 균주들을 에탄올-, 열- 및 퍼퓨랄-저항성 형질변형 효모 균주로 선택하였다.
본 발명의 바람직한 구현예에 따르면， 상술한 타켓 유전자의 불활성화는 트랜스포존에 의해 유발되며， 상술한 타겟 유전자인 SSK2 유전자의 뉴클레오타이드 서열 및 아미노산 서열은 각각 서열목록 제 3서열 및 서열목록 제 10 서열에 기재되어 있으며， 상기 유전자들의 아미노산을 인코딩하는 뉴클레오타이드 서열 및 이의 변형체도 이용될 수 있음은 당업계에서 자명하다.
퍼퓨랄은 옥수수， 귀리， 밀기을 및 톱밥 같은 다양한 농산 부산물들로부터 유래된 유기 화합물로써, 하기의 화학식 I (0C4¾CH0)로 표시되는 링 구조를 가진 방향족 알데하이드이다:
Figure imgf000012_0001
퍼퓨랄은 아몬드 향을 가진 무색의 오일 액체이지만， 공기 중에 노출되면 빠르게 노란색으로 변한다. 보통， 퍼퓨랄은 다른 하이드로카본으로부터 디엔을 추출하는 석유화학적 정체 과정에서 용매로서 이용된다. 퍼퓨랄 및 이의 알코올 유도체들은 페놀， 아세톤 또는 우레아와 함께 고형 레진을 제조하는 데 이용된다. 이러한 레진들은 섬유유리， 비행기 구성성분 및 자동브레이크에 이용된다. 퍼퓨랄은 효모세포의 ADH, PDH, ALDH 등의 효소를 억제하고 해당과정을 억제하여 효모의 성장을 저해하는 활성올 지니는 억제인자로써， 효모를 이용한 에탄올 생산에 있어서 이에 대한 저항성을 가지는 스트레인을 개발하는 것이 매우 중요하다.
본 발명은 효모에서 트랜스포존-매개된 돌연변이에 의해 에탄올-， 열- 및 퍼퓨랄-저항성이 증가된 형질변형 효모 균주를 제공한다.
본 발명의 바람직한 구현예에 따르면， 상술한 효모 균주는 5-100 mM 퍼퓨랄， 보다 바람직하게는 10-75 mM 퍼퓨랄 및 가장 바람직하게는 15-50 mM 퍼퓨랄 배양 조건에서 성장할 수 있다.
본 발명의 바람직한 구현예에 따르면, 상술한 효모 균주는 5-15% 에탄을， 보다 바람직하게는 10-15% 에탄올 및 가장 바람직하게는 12.5-15% 에탄올 배양 조건에서 성장할 수 있다.
본 발명의 바람직한 구현예에 따르면， 상술한 효모 균주는 30-43T， 보다 바람직하게는 37-43°C, 보다 더 바람직하게는 40-43°C 및 가장 바람직하게는 42-43°C 온도 조건에서 성장할 수 있다. 본 발명의 다른 양태에 따르면， 본 발명은 상술한 불활성화된 효모 균주들， 예컨대， 상술한 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn-2); PAM1 유전자 (Tn_3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn— 5)가 삽입된 호모 균주를 에탄올로 대사될 수 있는 하나 이상의 기질을 포함하는 배양배지에서 배양하는 단계를 포함하는 에탄올 생산방법을 제공한다.
보다 바람직하게는， 상술한 불활성화된 효모 균주들， 예컨대, 상술한 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn_2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn_5) 가 삽입된 효모 균주를 이용하여 기존의 비효율적인 다단계 공정을 극복하는 통합공정에 필요한 고 에탄올 조건에서 보다 효율적으로 에탄올올 생산할 수 있는 방법을 제공한다.
본 발명의 방법은 상술한 본 발명의 상술한 불활성화된 효모 균주들， 예컨대, 상술한 CMP2 또는 IMD4 유전자 (Tn-1); SS 2 또는 PPG1 유전자 (Tn- 2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)로 형질전환된 효모 균주를 유효성분으로 포함하기 때문에， 둘 사이에 중복된 내용은 중복 기재에 따른 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
또한， 본 발명은 상술한 효모 균주에 돌연변이를 유발하는 단계를 포함하는 에탄을-저항성 효모 균주 제조방법으로서 이용될 수 있다.
본 발명은 상술한 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn-2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)를 포함하는 재조합 백터 또는 그의 전사체에 의해 감염된 세포 및 유전자 도입에 의한 형질전환된 세포를 제공한다. 또한， 본 발명은 상술한 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); . SSK2 또는 PPG1 유전자 (Tn-2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)를 포함하는 재조합 백터， 또는 상술한 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn— 2); PAM1 유전자 (Τη— 3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)에 의해 형질전환된 형질전환체를 제공한다.
본 발명의 바람직한 구현예에 따르면， 상기 에탄올로 대사될 수 있는 기질은 C6 당 (sugars)을 포함하고， 본 발명의 보다 바람직한 구현예에 따르면, 상기 C6 당은 글루코오스를 포함하지만， 이에 한정되는 것은 아니다.
본 발명의 재조합 백터는 상술한 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn_2); PAM1 유전자 (Tn_3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)의 아미노산 서열을 코딩하는 뉴클레오타이드 서열 또는 이의 상보적인 뉴클레오타이드 서열을 포함한다. 본 발명의 백터는 전형적으로 클로닝을 위한 백터 또는 발현을 위한 백터로서 구축될 수 있다. 또한， 본 발명의 백터는 원핵세포 및 진핵세포를 숙주로 하여 구축될 수 있다. 예를 들어， 원핵세포는 박테리아 세포 및 고세균을 포함하며， 진핵세포는 효모세포, 포유동물세포, 식물세포， 곤층세포， 즐기세포 및 곰광이를 포함하고, 가장 바람직하게는 효모세포이다. 바람직하게는， 본 발명의 재조합 백터는 ( i ) 상술한 본 발명의 발현대상물질을 인코딩하는 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포， 바람직하게는 효모세포에서 작용하여 RNA 분자를 형성시키는 프로모터를 포함하며, 보다 바람직하게는 ( i ) 상술한 본 발명의 상술한 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn-2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)의 아미노산 서열을 코딩하는 뉴클레오타이드 서열 또는 이의 상보적인 뉴클레오타이드 서열; (ii) 상기 ( i )의 뉴클레오타이드 서열에 작동적으로 연결되며 동물세포, 바람직하게는 효모세포에서 작용하여 RNA 분자를 형성시키는 프로모터; 및 (iii) 상기 동물세포, 바람직하게는 효모세포에서 작용하여 상기 RNA 분자의 3'-말단의 폴리아데닐화를 야기시키는 3'-비-해독화 부위를 포함하는 재조합 발현백터를 포함한다.
바람직하게는， 상술한 발현대상물질은 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn_2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)를 포함하지만， 이에 한정되는 것은 아니다.
본 명세서에서 용어 "프로모터" 는 코딩 서열 또는 기능적 RNA 의 발현을 조절하는 DNA 서열을 의미한다. 본 발명의 제조합 발현백터에서 발현대상물질 -코딩 뉴클레오타이드 서열은 상기 프로모터에 작동적으로 연결된다. 본 명세서에서 용어 "작동적으로 결합된 (operatively linked)" 은 핵산 발현 조절 서열 (예: 프로모터 서열, 시그널 서열， 또는 전사조절인자 결합 위치의 어레이 )과 다른 핵산 서열 사이의 기능적인 결합을 의미하며， 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및 /또는 번역을 조절하게 된다.
본 발명의 백터가 원핵 세포를 숙주로 하는 경우에는， 전사를 진행시킬 수 있는 강력한 프로모터 (예컨대， tac 프로모터, lac 프로모터， lac UV5 프로모터 , Ipp 프로모터， pL x 프로모터 , ρκ λ 프로모터， rad^ 프로모터， 卿 프로모터， recA 프로모터， SP6 프로머터， trp 프로모터 , T7 프로모터， 등)， 해독의 개시를 위한 라이보좀 결합 자리 및 전사 /해독 종결 서열을 포함하는 것이 일반적이다. 보다 더 바람직하게는, 본 발명에서 이용되는 숙주 세포는 E. coli이며， 가장 바람직하게는 E. coli DH5a이다. 또한， 숙주 세포로서 Ε· coli 가 이용되는 경우, E. coli 트립토판 생합성 경로의 프로모터 및 오퍼레이터 부위 (Yanofsky, C. , J. Bacteriol. , 158： 1018-1024(1984)) 그리고 파아지 λ의 좌향 프로모터 ( λ 프로모터， Herskowitz, I. and Hagen, D.， Ann. Rev. Genet., 14： 399-445 (1980))가 조절 부위로서 이용될 수 있다. 한편， 본 발명에 이용될 수 있는 백터는 당업계에서 종종 사용되는 플라스미드 (예: pRS316, pSClOl, ColEl, pBR322, pUC8/9, PHC79, pUC19, pET 등)， 파지 (예 : Xgt4. λΒ, λ -Charon, λ Δζΐ 및 M13 등) 또는 바이러스 (예: SV40 등)를 조작하여 제작될 수 있다.
또한， 본 발명의 재조합 백터가 진핵세포， 바람직하게는 효모 세포에 적용되는 경우, 이용될 수 있는 프로모터는, 본 발명의 발현대상물질의 전사를 조절할 수 있는 것으로서， 효모 세포에서 유래된 프로모터， 포유동물 바이러스로부터 유래된 프로모터 및 포유동물 세포의 지놈으로부터 유래된 프로모터를 포함하며, 예컨대， 효모 (5. cerevisiae) GAPDHCGlyceraldehyde 3-phosphate dehydrogenase) 프로모터， 효모 (5. cerevisiae) GAL1 내지 GAL10 프로모터, 효 S Pidn'a pastor is) A0X1 또는 A0X2 프로모터， CMV(cyt omega lo virus) 프로모터， 아데노바이러스 후기 프로모터， 백시니아 바이러스 7.5K 프로모터, SV40 프로모터， HSV 의 tk 프로모터, RSV 프로모터， EF1 알파 프로모터， 메탈로티오닌 프로모터， 베타 -액틴 프로모터， 인간 IL-2 유전자의 프로모터, 인간 IFN 유전자의 프로모터 , 인간 IL-4 유전자의 프로모터 , 인간 림포톡신 유전자의 프로모터 및 인간 GM-CSF 유전자의 프로모터를 포함하나， 이에 한정되는 것은 아니다. 바람직하게는， 본 발명에 이용되는 발현 컨스트럭트는 폴리 아네닐화 서열을 포함한다 (예: 소성장 호르몬 터미네이터 및 SV40 유래 폴리 아데닐화 서열).
본 발명의 백터를 숙주 세포 내로 운반하는 방법은 당업계에 공지된 다양한 방법들을 이용할 수 있으며， 예를 들어 숙주 세포가 원핵 세포인 경우， CaCl2 방법 (Cohen, et al . , Proc. Natl. Acac. Sci. USA, 9：2110- 2114(1973)), 하나한 방법 (Cohen, et al. , Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)； 및 Hanahan, J. Mo J. Biol., 166 :557-580 (1983)) 및 전기 천공 방법 (Dower, et al . , Nucleic. Acids Res. , 16:6127-6145(1988)) 등에 의해 실시될 수 있으며， 진핵세포인 경우， 트랜스덕션 (transduction), 전기천공법 (electroporation), 리포펙션 (lipofection), 마이크로인젝션， 유전자총 (particle bombardment ) , YAC 에서 이용되는 효모 구형질체 /세포 융합， 식물세포에서 이용되는 아그로박테리움-매개된 형질전환 등을 이용하여 실시할 수 있다.
본 발명의 바람직한 구현예에 따르면， 본 발명에 이용되는 발현대상물질-인코딩 뉴클레오타이드 서열은 "프로모터-발현대상물질 인코딩 뉴클레오타이드 서열 -폴리 아데닐화 서열" 의 구조를 갖는다.
본 발명의 백터 시스템은 당업계에 공지된 다양한 방법을 통해 구축될 수 있으며， 이에 대한 구체적인 방법은 Sambrook et al . , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press(2001)에 개시되어 있으며， 이 문헌은 본 명세서에 참조로서 삽입된다. 본 발명의 재조합 발현백터를 이용하여 형질전환된 효모 세포의 제조는 당업계에 통상적으로 공지된 유전자 전이방법에 의해 실시될 수 있다. 예를 들어， 전기천공법 (electroporation), 리튬 아세테이트 /DMS0 방법 (Hi 11， et al. , (1991), DMSO— enhanced whole cell yeast transformation. Nucleic Acids Res. 19， 5791), 리포좀 -매개 전이방법 (Wong, et al., 1980), 레트로바이러스 -매개 전이방법 (Chen, et al.， (1990), J. Reprod. Fert . 41:173-182; Kopchick, et al., (1991) Methods for the introduction of recombinant DNA into chicken embryos . In Transgenic Animals, ed. N.L. First & F.P. Haseltine, pp.275-293， Boston; But t erwor t h-He i nemann； Lee, M.-R. and Shuman , R. (1990) Proc. 4th World Congr . Genet . Appl. Livestock Prod. 16, 107-110) 등을 이용하여 실시하며， 가장 바람직하게는 리튬 아세테이트 /DMS0 방법을 이용하여 실시한다.
한편, 본 발명의 발현대상물질 단백질을 유효성분으로써 유전자 도입에 이용하기 위해 발현대상물질 단백질이 효과적으로 세포 내로 침투할 수 있어야 한다. 예를 들어， 상술한 불활성화된 CMP2 또는 IMD4 유전자 (Tn- 1)； SSK2 또는 PPG1 유전자 (Tn-2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)을 유효성분으로 이용하는 경우， 단백질 운반 도메인 (PTD: protein transduction domain)을 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn-2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)에 부착시키는 것이 바람직하다. 즉， 유효성분으로서 본 발명의 불활성화된 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1유전자 (Tn-2); PAM1 유전자 (Tn-3); DLD3유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)을 세포 내로 도입 (permeable peptide transduct ion)하기 위하여 단백질 운반 도메인 (PTD: protein transduction domain)을 상기 단백질과 융합하여 융합 단백질을 만든다. 상기 단백질 운반 도메인 (PTD)은 라이신 /아르기닌 등 기본 아미노산 잔기들을 주로 포함하고 있어서 이와 융합된 단백질들을 세포막을 투과하여 세포내로 침투시키는 역할을 한다. 상기 단백질 운반 도메인 (PTD)은 바람직하게는 HIV-1 Tat 단백질， 드로소필라 안테나페디아의 homeodomain, HSV VP22 전사조절단백질， vFGF 에서 유도된 MTS 펩타이드， 페네트라틴, 트랜스포탄 또는 Pep-1 펩타이드에서 유래된 서열을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 불활성화된 효모 균주들， 예컨대， 상술한 CMP2 또는 IMD4 유전자 (Tn-1); SSK2 또는 PPG1 유전자 (Tn-2); PAM1 유전자 (Tn-3); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)를 포함하는 에탄올-저항성 또는 에탄올 -/열-저항성， 또는 에탄올 -/열 -/퍼퓨랄 형질변형 효모 균주 및 이의 용도에 관한 것이다.
(b) 본 발명의 효모 균주들은 고농도 에탄올， 바람직하게는 10-15¾> 에탄올에서 성장할 수 있는 효모 균주다.
(c) 또한， 본 발명의 효모 균주들은 고온 (예컨대， 42°C)에서 성장할 수 있는 효모 균주들이다.
(d) 본 발명의 효모 균주는 고에탄올- 및 열-저항성 효모균주들 중에서 고농도 퍼퓨랄 (예컨대， 15-50 mM)에서도 성장할 수 있는 효모균주이며 여기에는 불활성화된 55 ^유전자를 포함하는 효모균주이다.
(e) 본 발명의 효모 균주들은 고 에탄올 저항성을 보유함으로써 향후 통합공정에서 에탄올을 보다 효율적으로 생산할 수 있다.
【도면의 간단한 설명】 도 1 은 트랜스포존에 의해 돌연변이 유발된 효모 DNA 라이브러리를 이용한 사카로마이세스 세레지비에 L3262 의 형질전환 과정을 나타내는 도식이다.
도 2 는 사카로마이세스 세레지비에 트랜스포존 돌연변이체들의 에탄올 또는 열 저항성을 조사하기 위한 성장 어세이 결과이다. 도 2a-2b는 에탄올-저항성을 조사하기 위한 성장 어세이 결과이다. 도 2c 는 열 - 저항성을 조사하기 위한 성장 어세이 결과이다.
도 3 은 트랜스포존 삽입 위치를 나타내는 도식이다. 트랜스포존 삽입 위치는 5 개의 에탄올-저항성 또는 에탄올 -/열-저항성 스트레인으로부터 회복된 트랜스포존의 시퀀싱을 통해 결정하였다. 주변 유전자 위치 (genetic loci)가 보여진다.
도 4 는 트랜스포존에 의해 영향받은 유전자들의 발현을 나타내는 결과이다. 대조군 L3262 로부터 추출한 총 RNA 를 이용하여 노던 블롯 분석을 실시하였다. 스캐닝 밀도측정기 (scanning densitometer )를 이용하여 시그널을 상대적으로 정량하고 ACT1 으로 표준화하였으며， > 대조군으로 제시하였다.
도 5 는 SGK0돌연변이체들의 에탄올-저항성을 나타내는 성장 어세이 결과이다. 도 5a 및 도 5b 는 10 배씩 연속적으로 희석된 SGK0 돌연변이체들을 0%, 10%, 12.5% 및 15% 에탄올을 포함하는 YPD 플레이트에 스팟팅한 후, 30°C에서 1 일 (0%)， 3 일 (10%), 4 일 (12.5%) 또는 5 일 (15%) 동안 성장시킨 결과이다. 도 5c 는 스팟된 YPD 플레이트를 1 일 (30°C) 또는
3일 (43°C) 동안 성장시킨 결과이다.
도 6 은 보충 (complement at ion)에 의한 스트레스 민감성 회복을 보여주는 성장 어세이 결과이다. 도 6a 및 도 6b 는 10 배씩 연속적으로 희석된 보층된 스트레인들을 0% 및 10% 에탄올을 포함하는 YPD 플레이트에 스팟팅한 후， 30°C에서 1 일 (0%) 또는 4 일 (10%) 동안 성장시킨 결과이다. 도 6c는 스팟된 YPD플레이트를 1 일 (30°C) 또는 4 일 (42°C) 동안 성장시킨 결과이다. 대조군 스트레인들은 pRS316 을 Tn 돌연변이체들에 형질전환시킴으로써 제조하였다.
도 7 은 스트레스 민감성에 대한 과다-발현의 효과를 관찰한 결과이다. 도 7a 및 도 7b 는 10 배씩 연속적으로 회석된 과다 -발현 스트레인들을 0¾ 및 10% 에탄올을 포함하는 YPD 플레이트에 스팟팅한 후, 30°C에서 1일 (0%) 또는 4일 (10%) 동안 성장시킨 결과이다. 도 7c는 스팟된 YPD 플레이트를 1 일 (30°C) 또는 4 일 (42°C) 동안 성장시킨 결과이다. 대조군 스트레인들은 pRS316-GAPDH 을 L3262 에 형질전환시킴으로써 제조하였다.
도 8 은 Tn 돌연변이체들의 발효 프로파일을 보여주는 그래프이다. 도 8a-8d 는 지수적으로 성장하는 세포 (0.5 0D600)를 30°C에서 30% 글루코오스 및 6¾， 에탄올이 보충된 YPD 배지에서 성장시킨 결과이다. 발효 동안 세포 성장 (도 8a 및 도 8c) 및 에탄올 생산 (도 8b 및 도 8d)을 모니터링하였다. 도 8e-8f 는 에탄올이 없는 상태에서 실시한 유사한 실험을 42°C에서 실시하여 발효 동안 세포 성장 (도 8e) 및 에탄올 생산 (도 8f)을 모니터링한 결과이다. 심볼: L3262, 빈 삼각형; Tnl, 채워진 삼각형; Tn2, 채워진 원; Τη3, 채워진 사각형; 4， 채워진 다이아몬드; 및 Τη5, 빈 다이아몬드ᅳ
도 9 는 Τη-2 돌연변이체의 퍼퓨랄 저항성을 보여주는 성장 어세이 결과이다. 10 배씩 연속적으로 희석된 Τη2 돌연변이체를 15 mM, 20 mM, 30 mM, 40 mM 및 50 mM 퍼퓨랄이 보층된 YPD 플레이트에 스팟팅한 후, 30°C에서 1 일 (00， 4 일 (15 mM), 5 일 (20 mM), 7 일 (30 mM), 9 일 (40 mM) 또는 11일 (50 mM) 동안 성장시킨 결과이다.
도 10 은 SGK0 돌연변이체들의 퍼퓨랄-저항성을 나타내는 성장 어세이 결과이다. 10 배씩 연속적으로 회석된 SGK0 돌연변이체들을 0 mM 및 20 mM 퍼퓨랄을 포함하는 YPD플레이트에 스팟팅한 후， 30°C에서 1 일 (0 mM) 또는 7일 (20 mM) 동안 성장시킨 결과이다.
도 11 은 보층 (complement at ion)에 의한 스트레스 민감성 회복을 보여주는 성장 어세이 결과이다. 10 배씩 연속적으로 희석된 SGK0 돌연변이체들을 0 mM 및 20 mM 퍼퓨랄올 포함하는 YPD 플레이트에 스팟팅한 후， 30°C에서 1 일 (0 mM) 또는 7 일 (20 mM) 동안 성장시킨 결과이다. 대조군 스트레인들은 pRS316을 Tn-2 돌연변이체에 형질전환시킴으로써 제조하였다. 도 12 는 스트레스 민감성에 대한 과다-발현의 효과를 관찰한 결과이다. 10 배씩 연속적으로 희석된 SGK0 돌연변이체들을 0 mM 및 20 mM 퍼퓨랄을 포함하는 YPD 플레이트에 스팟팅한 후, 3C C에서 1 일 (0 mM) 또는 7 일 (20 mM) 동안 성장시킨 결과이다. 대조군 스트레인은 pRS316-GAPDH 을 L3262에 형질전환시킴으로써 제조하였다.
【실시예】
이하， 실시예를 통하여 본 발명올 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서， 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 실시예 실험재료 및 실험방법
균주， 배지 및 배양조건
본 연구에서 균주， 파괴된 유전자 및 트랜스포존 -삽입위치는 표 1 및 도 3 에 기재되어 있다. 사카로미세스 세레비지에 (5acc?a/ /¾Kces cerevisiae) 32 & 2{MAT- a ura3-52 leu2~3, 112 his4-34: 한국생명공학연구원 제공)를 숙주 균주로 이용하였다. 사카로미세스 세레지비에를 YPD 배지 (1% 박토 효모 추출물， 2¾ 박토 펩톤， 2% 덱스트로오스， w/v; Difco, MI)에서 30°C로 배양하였다. 사카로미세스 세레지비에 형질전환체를 SD-루이신 배지 [0.67% Difco YNB(yeast nitrogen base; 아미노산 부재)， 2% 글루코오스, 0.069% 보충 흔합물 (complete supplement mixture, CSM)_leu; MP, OH]에서 선택하였다. 플라스미드 구축을 위해 , E. coli DH5a (Stratagene, CA)를 숙주로 이용하여 100 mg/1 의 암피실린 (Sigma-Aldrich, M0)이 보충된 루리아-베르타니 배지 (LB; Difco, MI)에서 37 °C 배양시켰다. 트랜스포존 돌연변이법
트랜스포존의 임의적 삽입 (random insert ion)에 의해 m¾3- lacZlLEU2 를 가지는 사카로미세스 세레지비에 지놈 라이브러리 풀을 예일지놈분석센터 (Yale Genome Analysis Center, New Haven, CT: http: //ygac .med.yale. edu/mtn/reagent )로부터 얻었다. mTn3-돌연변이된 지놈 라이브러리 풀로부터 추출한 플라스미드 DNA 를 Not\ 으로 절단하여 사카로미세스 세레지비에 L3262 의 형질전환을 위해 이용하였다. 효모 형질전환을 리튬 아세테이트 방법으로 실시하였다. 형질전환체를 SI)-루이신 배지에서 선택하였다 (도 1). 에탄올—저항성 (tolerant) 돌연변이체의 분리
형질전환체들을 YPD 배지 및 12. 에탄올을 포함한 YPD 배지 플레이트에 두 쌍으로 (replica) 플레이팅하여 30°C에서 48 시간 동안 배양하였다. 모든 배지 조건에서 잘 자랄 수 있는 돌연변이체들을 선택하였다. 이들 돌연변이체들을 선택하기 위해 YPD 배지에서 OD6oo 값 1 까지 배양한 후, 살균 수로 연속적으로 10 배씩 희석시켰다. 각 희석액의 분취액 (5 을 에탄올이 없거나, 또는 10%， 12.5%, 15% 에탄올을 함유한 YPD 아가 (Difco, MI) 에 플레이팅하고 30°C에서 3-6 일 동안 배양하였다. 성장 어세이를 세 번에 걸쳐서 (triplicate) 실시하였다. 대조군 균주와 비교하여 에탄올을 함유한 YPD 플레이트에서 잘 자랄 수 있는 돌연변이체들을 에탄올-저항성 돌연변이체로 최종적으로 선택하였다. 이후, 돌연변이체들을 YPD플레이트에 플레이팅하여 30t에서 배양하였다. 에탄올 -/열-저항성 돌연변이체의 분리
상술한 방법에 따라 동정된 에탄올 저항성 돌연변이체들을 42°C에서 4 일 동안 배양하여 잘 성장하는 돌연변이체들을 선택하였다. 이들 돌연변이체들을 확인하기 위해， 돌연변이체들을 YPD 배지에서 0D600값 1까지 배양한 후， 살균 수로 연속적으로 10 배씩 희석시켰다. 각 회석액의 분취액 (5 을 에탄올이 없거나， 또는 10%, 12.5%, 15% 에탄올을 함유한 YPD 아가 폴레이트에 플레이팅하고, 30°C 또는 42°C에서 3-6 일 동안 배양하였다. 성장 어세이를 세 번에 걸쳐서 (triplicate) 실시하였다. 대표적인 실험 결과들이 제시되었다. 대조군 스트레인과 비교하여 10¾， 12.5%, 15% 에탄올을 포함한 YPD 아가 플레이트와 42°C에서 잘 자랄 수 있는 돌연변이체들을 에탄올- 및 열-저항성 돌연변이체로 최종적으로 선택하였다. 에탄올 -/열 -/퍼류랄-저항성 (tolerant) 돌연변이체의 분리
상술한 방법에 따라 선택된 에탄올- 및 열-저항성 돌연변이체들의 배양액으로부터 회석액을 얻고 이들의 분취액 (5 /^)을 퍼퓨랄 (furfural)이 없거나, 또는 15 mM, 20 mM, 30 mM, 40 mM 또는 50 mM 퍼퓨랄을 함유한 YPD 아가 플레이트에 플레이팅하고， 30°C에서 4-11 일 동안 배양하였다. 성장 어세이를 세 번에 걸쳐서 (triplicate) 실시하였다. 대표적인 실험 결과들이 제시되었다. 대조군 스트레인과 비교하여 10%, 12.5%, 15% 에탄올을 포함하거나 또는 15 mM, 20 mM, 30 mM, 40 mM 또는 50 mM 퍼퓨랄을 포함한 YPD 아가 플레이트에서 잘 자랄 수 있는 돌연변이체를 에탄을ᅳ/열 _/퍼류랄- 저항성 돌연변이체로 최종적으로 선택하였다. 에탄올-저항성, 에탄올 -/열-저항성， 또는 에탄올 -/열-퍼퓨랄 표현형에 관련된 유전자의 동정
에탄올-저항성 돌연변이체에서 lacZ 서열에 인접한 lacZ 서열을 이용한 풀라스미드 회수 (plasmid rescuring)에 의해 m n3- 1 acZ/ LEU2 삽입 위치를 결정하였다. 복제 원점 (origin of replication; σ/ )을 도입하기 위해， 腿3 로 표시된 플라스미드 (회수 플라스미드; PRSQ2-URA3, 예일지놈분석센터 제공)가 lacZ 서열의 플라스미드 -유래 (borne) 카피 및 트랜스포존 -유래 카피 간의 재조합에 의해 트랜스포존의 일부로 대체된다. 이들 형질전환체로부터 효모 DNA 를 회수하여 적절한 효소 Sail, HindlU, Pstl 또는 KpnV) — 절단하였다. 이후 절단된 단편들을 원형화시켜 E. col/ DH5a에서 회복시켰다. 얻어진 플라스미드를 트랜스포존의 5' 말단에 상보적인 lacZ 프라이머를 이용하여 시뭔싱하였으며 이용된 프라이머 서열은 다음과 같다: 5' -GTTTTCCCAGTCACGAC-3 ' . 사카로미세스 지놈 데이터베이스의 BLAST 서버 (ht tp： //www, yeast genome . org/ )를 이용하여 트랜스포존이 삽입된 유전자들을 분석하였다. 노던 블롯 분석
총 RNAs 가 추출되어 15 /g을 이용하였다. 프로브로 이용된 단편들은 L3263 게놈 DNA로부터 적절한 유전자-특이적 프라이머들을 。 PCR 을 통해 제조하였다. 정제된 PCR 단편들은 랜덤 프라이머를 이용하여 32P-dCTP(GE Healthcare, Buckinghamshire, UK)로 표지되었다. 이후 과정들은 이전에 기재된 바와 같이 실시하였다 (Adams, A., D. E. Gottschl ing, C. A. Kaiser , and T. Stearns. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor , NY. (1997)). ACT1 은 내적 대조군으로 이용하였다. 밴드 강도는 NIH image J, version 1.61 을 이용하여 정량하였다. 각 유전자에 대한 실험들은 세 번에 걸쳐서 실시하였다. 유전자 클로닝 및 분석 방법들
과다발현 실험을 위해， 동정된 유전자들의 0RFs(open reading frames)가 pRS316-GAPDH ( g 1 ycer a 1 dehyde 3-phosphate dehydrogenase) 내로 클로닝되었다. 보충 실험 (complementation experiments)을 위해, 프로모터 및 종결 서열 (terminator sequences)과 융합된 ORFs 을 pRS316 백터에 서브클로닝하였다. 증폭된 산물 및 백터를 적합한 제한 효소로 절단한 후， E. coli DH5a에 형질전환시켰다. 이용된 프라이머 쌍 및 얻어진 플라스미드는 표 2에 기재되어 있다. 클론들은 시뭔싱을 통해 확인하였으며， 사카로미세스 세레비지에 (5. cerevisiae) L3262 또는 상응하는 트랜스포존 돌연변이체들에 형질전환시켰다.
유전자들은 표준 프로토콜에 의해 제조된 게놈 DNA 를 템플레이트로 이용하여 pfu DNA 폴리머라제에 의해 PCR-증폭되었다 (Adams, A., D. E. Gottschl ing, C. A. Kaiser , and T. Stearns. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor , NY. (1997)). PCR 단편들을 QIAquick 젤 추출 키트 (Qiagen, Valencia, CA)로 정제하였다. 모든 PCR 컨스트럭트를 시뭔싱하여 확인하였다. 0RF 중간에 존재하는 인트론으로 인하여, IMD4 의 0RF 는 역전사 (Reverse transcription, RT)- PCR 을 통해 제조하였다. 이후， 단일 -가닥 cDNA 는 분리된 총 RNA 로부터 AMV(Avian Myeloblastosis virus) 역전 효소 (Promega, Madson, WI)에 의해 합성하였다. 일 /g의 총 RNA, IX 역전사 완충액 [10 mM Tris-HCKpH 9.0)， 50 mM KC1, 0.1% 트라이톤 X—100] , 1 mM 디옥시뉴클레오시드 트리포스페이트 (dNTPs), 0.5 유니트의 RNase 억제제， 100 pmol/ 의 특이적인 다운스트림 프라이머 (IMD4-R; 표 1)올 포함하는 20 ^의 역전사 반웅 흔합물과 15 유니트의 AMV 역전사 효소를 42°C에서 15 분 동안 반응시키고， 99°C에서 5 분 동안 열올 가한 후， 0-5°C에서 5 분 동안 반응시켰다. PCR 조건은 다음과 같이 실시하였다: 95°C에서 3 분 동안 변성시키는 단계; 35 사이클 (95°C에서 1 분 동안 변성， 65°C에서 1 분 동안 어닐링， 및 72°C에서 2 분 동안 연장하는 단계로 구성된 한 사이클)을 실시하는 단계; 및 72°C에서 10 분 동안 최종적으로 연장하는 단계. 세포 성장은 Beckman DU730 분광광도계 (Beckman Coulter, Fullerton, CA)를 이용하여 600 nm 에서 측정하였으며， 혈구계측기 (hemocytometry)로 모니터링하였다. 발효
지수적으로 성장하는 세포를 수득하여 100 ml 의 YPD30E6[30% 글루코오스 및 6¾(v/v) 에탄올로 보충된 YP]로 옮겼다. 시작 세포 밀도는 0.3 의 0D600 값으로 조정하였다. 세포를 120 rpm 으로 흔들면서 30°C에서 배양하였다. 시료를 12 시간 마다 취한 후， 세포 성장 및 에탄올 농도를 각각 세포 밀도 측정 및 HPLC(high-pressure liquid chromatography)를 이용하여 결정하였다. 시료를 60°C로 세팅된 Aminex HPX-87H 컬럼 (Bio-Rad, Hercules, CA, USA)에 로딩하였다. 글루코오스 및 에탄올을 0.5 mM S04를 이용하여 0.6 ml/분의 유동속도로 용출시켰다. 피크들은 굴절율 (refractory index)에 의해 검출되고 지연시간 (retent ion time)에 따라 동정되어 표준 곡선에 따라 정량화되었다. 세포 성장은 600 nm 에서 광학밀도를 측정함으로써 모니터링하였다. 실험결과
에탄올-저항성 돌연변이체들의 선택
약 3,000 개의 형질전환체들을 루이신 원영양체 (prototroph)로서 선택하였으며 (도 1), YPD 배지 및 10% 에탄올을 포함한 YPD 배지 플레이트에 두 쌍으로 (replica) 플레이팅하였다. 선택된 약 40 개의 돌연변이체들을 30°C에서 3 일 동안 배양한 후 대조군 균주 (사카로미세스 세레비지에 L3262)과 비교하여 10% 에탄올을 포함한 YPD 플레이트에서 잘 성장한 돌연변이체들을 에탄올-저항성 스트레인으로 선택하였다. 선택된
40 개의 돌연변이체들을 확인해 본 결과， 5 개의 돌연변이체들이 에탄올- 저항성 돌연변이체들로 최종 선택되어 Tnl 내지 Tn5 로 명명되었다. 이들 돌연변이체들은 모두 대조군 균주와 비교하여 10%, 12.5% 또는 15% 에탄올을 포함한 YPD플레이트에서 잘 성장하였다 (도 2a 및 도 2b). 에탄올 -/열-저항성 돌연변이체들의 선택
본 발명자들은 고온 (42°C)에서 에탄올-저항성 돌연변이체들의 성장을 조사하였다. 도 2c 에서 확인할 수 있듯이， 두 개의 돌연변이체들 (Tn-2 및 Τη-3)이 대조군 균주와 비교하여 42°C YPD 플레이트에서 성장할 수 있었다. 따라서， 이들 두 개의 돌연변이체들은 15% 에탄올 스트레스 및 42°C까지 고온 스트레스 양자에 대해서 동시에 저항성을 나타낼 수 있었다. 저항성 돌연변이체들에서 트랜스포존 삽입 위치의 동정
각 저항성 돌연변이체들로부터 트랜스포존에 인접한 효모 염색체
DNA 를 대장균에서 회수하여 시퀀싱 (마크로젠, 한국)하였다. 동정된 유전자들의 트랜스포존 삽입 위치 및 기능을 표 1 및 도 3 에 요약하여 기재하였다.
【표 1】
에탄을-저항성 표현형올 야기할 수 있는 동정된 유전자들.
Figure imgf000026_0001
단계를 촉매하는 단백질로， 사카로미세스 세레비지에에서는 4 개의 유전자 패밀 리가 존재하여 항상 발현된다.
SS 2: H0G1 마이토젠-활성화된 시그널링
-552 bp
경로의 MAP(mi togen-act ivated protein) 키나제 키나제 키나제로 Pbs2p 를 인산화시키는 Ssklp 와 상호작용하여
Ssk2p 의 자가인산화 및 활성화를
YNR031C/SSK2
야기하며, 삼투 스트레스로부터 액틴
Tn-2
사이토스켈레톤 회복 (recovery)도 YNR032W/PPG1
매개한다.
-25 bp PPG1: 글라이코겐 축적에 필요한 잠재적인 세린 /스레오닌 단백질 포스파타제로， 다른 단백질 포스파타제와 결합하여 조절하는 Tap42p 와 상호작용한다.
PA 1: 기능이 알려지지 않은 필수 단백질; 콜로니 형성과정 동안 다양한
Tn-3 PAM1 발현 양상을 나타내고， 과다발현시킨
778 bp
경우， 단백질 포스파타제 2A 결핍에도 생존할 수 있게 하며， 성장을 억제하고 섬유성 표현형을 유발한다. 946 bpb RMD6-- 포자형성에 필요한 단백질
-994 bp DLD3: D—락테이트 디하이드로게나제；
YEL072WRMD6 레트로등급 레글론의 한 부분으로，
Tn-4
마이토콘드리아 손상에 의해 자극되고 YEL071W/DLD3 글루타메이트가 유일한 질소원인 조건에서 성장한 세포에서 감소되는 세포질 유전자들로 구성되어 있다.
Msn4p 에 관계된 전사 활성인자; 스트레스 조건에서 활성화되며， 그 결과 세포질에서 핵으로
Tn-5 YMR037C/MSN2
1152 bp 전이 (trans location)되며, 스트레스- 반웅성 유전자들의 DNA 내 반웅 엘리먼트에 결합하여 이들의 발현을 유도한다.
a: 삽입 위치는 각 코딩 서열의 개시 ATG로부터의 위치이다.
b: 삽입 위치는 각 코딩 서열의 종결 코돈으로부터의 위치이다.
c: 효모 지놈 데이터베이스 (YGD)의 주석. 파괴된 유전자들의 동정
트랜스포존이 삽입된 위치는 다음과 같았다: Tnl, CMP2 의 종결 부위 및 IMD4 의 종결 부위 ; Tn2, SSK2 의 프로모터 부위 및 PPG1 의 프로모터 부위 ; Tn3, PAMl 의 ORF 부위 ; Tn4, RMD6 의 종결 부위 및 DLD3 의 프로모터 부위 ; 및 Tn5, MSN2 의 0RF 부위. Tnl, Tn2 및 Τη4 에서 영향받은 유전자를 결정하고 Τη3 및 Τη5 에서 이의 파괴를 확인하기 위해， CMP2, IMD4, SSK2, PPG1, PAMl, RMD6, DLD3 및 MSN2 의 발현 레벨을 노던 블롯 분석을 통해 조사하였다 (도 4a 및 도 4b) · 대조군과 비교하여， CMP2 및 IMD4 의 레벨은 각각 약 10% 및 20% 정도 더 낮았다. 대조군과 비교하여， SSK2 및 PPG1 의 레벨은 각각 약 20% 및 50% 정도 더 낮았는데， 이는 PPG1 이 SSK2 보다 더 큰 정도로 영향을 받았다는 것을 의미한다. 대조군과 비교하여， DLD3 의 레벨은 약 2 정도 더 낮았지만， RMD6 의 레벨은 변화가 없었기 때문에 RMD6 는 향후 실험에서 제외시켰다. 예상한 바와 같이， PAM1 및 MSN2 의 발현은 검출되지 않았다. 따라서， 트랜스포존 삽입은 CMP2, IMD4, SSK2, PPG1 및 DLD3 의 발현에 부분적으로 영향을 미쳤으며， PAM1 및 MSN2 의 발현을 완전하게 억제시켰다.
【표 2】
본 연구에서 이용된 올리고뉴클레오타이드.
Figure imgf000029_0001
PAM1-RL CGGGTCGACOTCGGCAACGTTTTCAATGG
DLD3-FU CGCGGATCCCTTTAAAGTGCTATG
DLD3-RL CGGGTCGACTAGTCGCTTTAAAGT
MSN2-FU CGCGGATCCCGGCCCGGAACGTACCTAAAG
MSN2-RL CGCGGCCGCAAGCGCCATATAAAACATTGA
* 밑줄 친 서열은 제한효소 위치이다. 에탄올-저항성에 대한 기여
상술한 결과에 따르면， Tnl 에서 CMP2 및 IMD4 이 동시에 하향- 조절 (co-down-regulation)되며， Tn2 에서 SSK2 및 PPG1 이 동시에 하향- 조절되고， Τη4 에서 DLD3 이 하향 -조절되며， Τη3 및 Τη5 에서 각각 PAM1 및 MSN2 이 파괴되었음을 확인할 수 있었다. CMP2, IMD4, SSK2, PPG1, PAM1, DLD3 및 MSN2 의 하향 -조절 또는 결실의 에탄올- 및 /또는 열-저항성에 대한 기여도를 알아보기 위해, BY4741 백그라운드의 S. 세레비지에 단일 유전자 넉 -아웃 (SGK0) 라이브러리 (collection library)로부터 얻어진 7 개 유전자에 대한 넉 -아웃 돌연변이체들을 이용하여 개별적으로 조사하였다. 상기 라이브러리가 허원기 박사 (Seoul National University, Seoul , Korea)로부터 친절하게도 제공되었으며， 동정된 유전자의 확인에 이용되었다. S. 세레비지에 BY4741 스트레인이 상술한 결실 돌연변이체들의 모 스트레인 (mother strain)이었다. t":mp2, Mwd4, Ass 2, Appgl, t^paml, Mld3 및 讓2 의 배양물을 10%, 12.5% 및 15% 에탄올을 포함하는 YPD 플레이트에서 성장 (spot-assay)시켰을 경우， 모든 결실 돌연변이체들의 성장이 대조군 BY4741 스트레인과 비교하여 조사된 모든 에탄올 농도에서 증대되었다 (도 5a 및 도 5b). 스팟된 YPD 플레이트가 43°C에서 성장된 경우， Tnl 내지 Tn5가성장할 수 없는 온도에서 ssk2, Appgl및 예 1이 증가된 성장을 나타냈다 (도 5c). 하지만， 상기 돌연변이체들은 44°C에서 성장하지 않았다 (결과를 보이지 않음). 성장에 대한 최대 온도에서 1 도의 차이는 BY4741 이 L3262 보다 더 열-저항성 스트레인이기 때문일 수 있다 (결과를 보이지 않음). 그러므로， 7 개의 유전자에 대한 SGKOs 이 에탄을-저항성을 가졌으며， SSK2, PPG1 및 PAM1 에 대한 SGKOs 이 열-저항성도 나타냈다. SS 2 또는 PPG1, 또는 양 유전자의 하향-조절은 에탄올 및 열 모두에 대한 저항성을 부여하였다는 것이 중요하다. 또한， CMP2 및 /또는 IMD4 및 DLD3 추가적인 하향-조절이 에탄올 저항성에 중요하였다. 상술한 결과들은 RNA 발현 레벨 및 아마도 단백질 레벨 (비록 확인되지 않았을 지라도)이 에탄올- 및 열-저항성을 부여하는 데 중요하다는 것을 의미한다. 보충 (complement at ion)에 의한 저항성 확인
Tnl-Tn5 가 특정 유전자들의 결실 또는 동시에 하향-조절을 통해 에탄올- 및 /또는 열-저항성을 획득한다는 사실은 상술한 유전자들의 보충이 상기 스트레스에 대한 세포의 민감성을 나타낼 수 있다는 것을 의미한다. 이러한 고찰을 확인하기 위해, 프로모터， 0RF 및 종결자 (0RF +/- 700 bp)를 포함하는 증폭된 DNA 단편들올 pRS316 백터에 클로닝하여 상웅하는 Tnl-Tn5 돌연변이체에 형질전화시킴으로써， IMD4 를 제외한 각 유전자들올 자가적으로 발현시켰다. 0RF 중간에 존재하는 인트론을 가지는 IMD4의 경우, RT-PCT 을 실시하여 pRS316-GAPDH 에 클로닝함으로써 전체 0RF 를 얻은 후， GAPDH 프로모터의 조절 하에서 클로닝된 DNA 를 과다발현시켰다. 대조군은 PRS316 백터를 형질전환시킴으로써 구축하였다. 스팟 어세이가 10% 에탄올을 포함하는 YPD 아가에서 실시하는 경우， 보충된 세포의 저항성은 Τη 돌연변이체들과 비교하여 현저하게 감소하였다 (도 6a 및 도 6b) · SSK2 및 PPG1 으로 개별적으로 보충된 Tn2 및 PAM1 으로 보층된 Τη3 이 42°C에서 배양된 경우， 감소된 열-저항성이 관찰되었다 (도 6c).
CMP2 1OT까지)， IMD4(20%까지)， SSK2(20%까지) 및 PPG1(50%까지)의 동시 하향-조절, 그리고 DLD3 의 하향—조절이 에탄올 저항성을 부여하고， SSK2 및 PPG1 의 동시 하향-조절이 열-저항성을 부여한다는 사실은 스트레스 저항성이 특정 유전자 (들)의 발현 레벨이 중요하다는 것으로 추측될 수 있다. 이를 위해, IMD4 를 제외한 각 유전자의 0RF 를 PCR-증폭되고 과다발현용 pRS316-GAPDH 백터로 클로닝되어 L3262 스트레인으로 형질전환시켰다. pRS316-GAPDH 백터는 대조군으로서 형질전환되었다. 에탄올 (도 7a 및 도 7b) 및 열 (도 7c)에 대한 스팟 어세이를 실시한 경우， 과다발현된 스트레인들은 일반적으로 대조군보다 에탄올 및 열 모두에 대해 더 민감하였는데, 이는 에탄을- 및 /또는 열-민감성에 대한 유전자량 효과 (dosage effect)를 의미한다. Tn돌연변이체들의 에탄올 또는 열에 대한 발효 능력
일반적으로 에탄올-저항성 세포들은 고농도의 에탄을에서 세포 생존율이 높기 때문에 비-저항성 스트레인에 비해 더 많은 에탄을을 생산한다는 것으로 알려져 있다. 발효능력 (fermentation capacity)을 30% 글루코오스를 포함하는 배치 배양에서 30°C로 조사하였을 때， 돌연변이체들의 증가된 성장 (약 20¾ 에도 불구하고 부모와 Tnl-Tn5 간에 유의한 차이점이 발견되지 않았다 (결과를 보이지 않음). 부모 스트레인은 기본적으로 30% 글루코오스로부터 최대 약 의 에탄올을 생산할 수 있을 것으로 판단되며， 이는 증가된 에탄을 저항성의 효과로 보기 어렵다. 따라서， 최종적인 에탄올 역가 (titer)가 9%를 초과하는 조건올 확립하는 것이 필요하였다. 이러한 면에서， 본 발명자들은 0.5 의 0D600 값을 가지는 개시 세포 및 6% 에탄올을 포함하는 배양액에서 발효를 시작하였다. 도 8a- 8d 에서 볼 수 있듯이, Tn 돌연변이체들은 대조군과 비교하여 보다 빠르게 성장하였으며 더 많은 에탄올을 생산하였다. 이들 중, Tn2 는 11% 에탄을을 생산하는 가장 효율적인 스트레인임을 확인할 수 있었다. 따라서， Τη2 의 에탄올 생산 효율은 대조군과 비교하여 22%까지 개선되었다.
본 발명자들은 42°C에서 열-저항성 스트레인인 Tn2 및 Τη3 의 에탄올 생산 능력을 조사하였다. 상기 온도에서 에탄올 증발이 최종 역가에 영향을 미칠 수 있기 때문에， 배치 발효 도중 증발된 에탄올의 양이 4-10& 에탄올을 표준으로 제작된 보정곡선 ( calibration curve)에 따라 산출되었다. 에탄올의 농도가 4%인 경우 천천히 증발되는 반면에， «를 초과하는 경우는 빠르게 증발하였다. 예를 들어， 8¾에탄올은 2 일 째에 3.7%로 감소하였으며， 10% 에탄올은 보다 더 현저하게 감소하였다 (결과를 보이지 않음). 발효 프로파일이 42°C에서 산출된 경우， Tn2 및 Τη3 는 대조군에 비해 더 빠르게 성장하였다 (도 8e). Tn2 의 가장 높은 에탄올 역가는 2.8%였는데， 이는 42°C에서 에탄올 증발을 고려하지 않은 경우에도 대조군 스트레인보다 더 높은 수치였다 (도 8f). 열에 의해 야기되는 증발 및 손상된 성장 때문에， 에탄을의 농도는 3일 후에 지속적으로 감소하였다. 에탄올 -/열 -/퍼퓨랄-저항성 돌연변이체들의 선택 또한， 본 발명자들은 퍼퓨랄에 대한 저항성을 조사하였다. 도
10에서 볼 수 있듯이， 하나의 돌연변이체 (Tn-2)가 15 mM, 20 mM, 30 mM, 40 mM 및 50 mM 퍼퓨랄이 보충된 YPD 플레이트에서 성장할 수 있었다. 결론적으로， 1 개의 돌연변이체 (Tn-2)가 에탄올-， 열- 및 퍼퓨랄-스트레스 모두에 대한 저항성을 동시에 가졌다 (도 9). 에탄올 -/열 -/퍼퓨랄-저항성에 대한 기여
상술한 결과에 따르면， Tn-2 에서 SSK2 및 PPG1 이 동시에 하향- 조절됨을 확인할 수 있었다. SSK2 ^ PPG1 의 하향-조절의 퍼퓨랄-저항성에 대한 기여도를 알아보기 위해, BY4741 백그라운드의 사카로미세스 세레비지에 단일 유전자 넉 -아웃 single gene knockout (SGKO) 라이브러리 (collection library)로부터 얻어진 2 개 유전자에 대한 넉 -아웃 돌연변이체들을 이용하여 개별적으로 조사하였다. 상기 라이브러리가 허원기 박사 (Seoul National University, Seoul , Korea)로부터 친절하게도 제공되었으며, 동정된 유전자의 확인에 이용되었다. 사카로미세스 세레비지에 BY4741 스트레인이 상술한 결실 돌연변이체들의 모 스트레인 (mother strain)이었다. Assk2 및 예 의 배양물을 20 mM 퍼퓨랄을 포함하는 YPD 플레이트에서 성장 (spot-assay)시켰을 경우, SSK2 결실 돌연변이체의 성장이 대조군 BY4741 스트레인과 비교하여 조사된 모든 퍼퓨랄 농도에서 증대되었다 (도 10). 반면 PPG1 결실 돌연변이체의 경우는 대조군과 차이가 없었다. 그러므로， 55 에 대한 SGKOs 이 에탄올- 및 열- 저항성 뿐 아니라, 퍼퓨랄-저항성도 나타냈다. SSK2유전자의 하향-조절은 에탄올, 열 및 퍼퓨랄 모두에 대한 저항성을 부여하였다는 것이 중요하다. 상술한 결과들은 RNA 발현 레벨 및 아마도 단백질 레벨 (비록 확인되지 않았을 지라도)이 에탄을-， 열- 및 퍼퓨랄-저항성을 부여하는 데 중요하다는 것을 의미한다. 보충 (complement at ion)에 의한 퍼퓨랄-저항성 확인
Tn-2 가 특정 유전자들의 결실 또는 동시에 하향-조절을 통해 에탄올-, 열- 및 퍼퓨랄-저항성을 획득한다는 사실은 상술한 유전자들의 보충이 상기 스트레스에 대한 세포의 민감성으로 다시 나타낼 수 있다는 것을 의미한다. 이러한 고찰을 확인하기 위해， 프로모터， SSK2 0RF 및 종결자 (0RF +/- 700 bp)를 포함하는 증폭된 DNA 단편들을 pRS316 백터에 클로닝하여 상응하는 Tn-2 돌연변이체에 형질전화시킴으로써， 유전자를 자가적으로 발현시켰다. pRS316 백터를 형질전환시킴으로써 구축하였다. 스팟 어세이 (Spot assay)가 20 mM 의 퍼퓨랄을 포함하는 YPD 아가에서 실시하는 경우， 보충된 세포의 저항성은 Tn 돌연변이체와 비교하여 현저하게 감소하였다 (도 11). 55 의 하향-조절이 에탄올 및 열 저항성 뿐 아니라 퍼퓨랄-저항성을 부여한다는 사실은 스트레스 저항성이 특정 유전자 (들)의 발현 레벨이 중요하다는 것으로 추측될 수 있다. 이를 위해， SSK2 유전자의 0RF 를 PCR-증폭되고 과다발현용 pRS316-GAPDH 백터로 클로닝되어 L3262 스트레인으로 형질전환시켰다. pRS316-GAPDH 백터는 대조군으로서 L3262 스트레인에 형질전환되었다. 20 mM 농도의 퍼퓨랄 (도 12)에 대한 스팟 어세이를 실시한 경우， 과다발현된 스트레인은 일반적으로 대조군보다 퍼퓨랄에 대해 더 민감하였는데, 이는 에탄올-, 열- 및 퍼퓨랄 민감성에 대한 유전자량 효과 (dosage effect)를 의미한다. 추가논의사항
효모 및 다른 생명체에서， 스트레스에 대한 대부분의 세포내 경로는 조절되는 많은 유전자들로 재프로그래밍된다 (Kiiltz, 2005) . 현재까지 많은 수의 연관 유전자들이 동정되었올 지라도， 시그널링 경로의 관점에서 에탄올, 열 및 퍼퓨랄을 포함하는 많은 스트레스 유발자들에 대한 저항성이 어떻게 획득되는 지에 대해서 거의 알려져 있지 않다. 일반적으로， 에탄을- 또는 열-저항성의 기작은 매우 복잡하고 전체적으로 조절되며， 연관된 경로들의 포괄적 관점올 통해 이해될 필요가 있는 것으로 받아들여 진다 (Ma, et al., 2010； Yoshikawa, et al., 2009). 에탄올 및 열 스트레스 모두는 세포막 지질 조성을 유사하게 변화 (Okuyama, et al . , 1979； Suutari, et al., 1994)시키고 세포막 H+-ATPase 활성 (Coote, et al . , 1994) 열충격 단백질들을 인코딩하는 유전자들의 상향 -조절 (Ma, et al., 2010)을 감소시키다. 상술한 결과들은 에탄올-저항성에 필요한 경로들이 열- 저항성에 필요한 경로들과 중첩된다는 것을 나타낸다. 하지만， 지놈 전반에 걸친 (genome-wide) 분석에 기반하여 제조된 스트레인들은 일치되지 않는 에탄올-저항성 또는 열-저항성을 나타냈다 (Teixeira, et al . , 2009； Yoshikawa, et al., 2009) . 본 연구에서， 본 발명자들은 3,000 개의 트랜스포존-매개된 파괴 돌연변이들을 스크리닝하여 에탄올에 대한 증가된 저항성올 가지는 스트레인들을 분리하였다. 이후, 두 개의 돌연변이들이 열에 대하여도 증가된 저항성을 가진다는 것을 발견하였으며 또한, 이중 한 개의 돌연변이가 퍼퓨랄에 대하여도 저항성을 가짐을 발견하였다. 상기 스트레인은 에탄올-저항성, 열-저항성 및 퍼퓨랄 저항성간의 가능한 연결점 (interconnection)을 설명하는 데 유용할 것이다.
본 발명자들은 증가된 에탄올-저항성을 책임지는 일곱 개의 유전자들 (CMP2, IMD4, SSK2, PPG1, PAM1, DLD3 및 MSN2), 그리고 트랜스포존 돌연변이유발법 및 SGK0 돌연변이체들의 조합을 통해 증가된 열-저항성을 나타내는 세 개의 유전자들 (SSK2, PPG1 및 PAM1)을 동정하였으며 , 1 개의 유전자 5^에 의한 퍼퓨랄에 대한 저항성을 추가로 확인하였다. 또한, SSK2및 /또는 PPG1 의 하향-조절은 에탄올 및 열에 대한 저항성을 부여하였다. 이중에서 SSK2유전자의 하향-조절은 에탄올， 열 및 퍼퓨랄 모두에 대한 저항성을 부여하였다.
도 3 에서 볼 수 있듯이， 트랜스포존은 영향받은 유전자들의 예상되는 조절 부위에 삽입되었다. 이는 트랜스포존 돌연변이유발법에 의해 발생된 라이브러리는 이론적으로 ORFs 에만 영향을 가지는 SGK0 컬렉션에 포함된 클론의 수와 유사한 4,500 개 이상의 클론들로 구성된다는 것을 의미한다. 본 연구에서， 본 발명자들은 이론적으로 필요한 클론 수보다 더 적은 3,000 개의 클론으로 구성된 라이브러리를 이용하여 증가된 에탄올 저항성을 가지는 다섯 개의 스트레인 (Tnl-5)을 분리하였다. 따라서, 적절한 클론 수를 포함하는 라이브러리를 스크리닝한다면， 증가된 저항성을 가지는 더 많은 수의 스트레인을 분리하는 것이 가능할 것이다. 영향받은 유전자들의 하향-조절을 나타내는 Tnl, Tn2 및 Τη4의 분리는 SGK0 컬렉션을 이용하지 않았다면 불가능했을 것이다. 본 발명자들의 지식으로는, 본 발명자들의 연구가 RNA 레벨이 에탄올- 및 /또는 열-저항성에 대한 결정 인자라는 것을 처음으로 규명한 것이다.
하향-조절되는 Tnl 의 경우， 본 발명자들은 하나의 유전자만 하향- 조절되는 스트레인의 부재로 인해， 상기 유전자가 실제로 스트레스 저항성을 담당하는 지 여부를 결정할 수 없었다. CMP2 유전자는 Crzlp (스트레스 -반응 전사인자)를 조절하는 Ca2V칼모들린-의존성 포스파타제의 활성 서브유니트의 이소형인 칼시뉴린 A(calcineurin A)를 인코딩한다. 칼시뉴린은 Crzlp를 탈인산화시켜 세포질로부터 핵으로의 빠른 전이 (translocation)을 야기한다. 이후， Crzlp 는 세포 생존과 관련된 유전자들의 전사를 활성화시킨다 (Cyert, 2003； Panadero, et al. , 2007). CRZ1 은 에탄올-유도된 칼시뉴린 /Crzl 경로에서의 기능올 통해 에탄올 스트레스 하에서 세포 성장에 중요하다 (Araki, et al., 2009). 한편， 칼시뉴린은 Msn2p 의 분해를 증가시켜 스트레스 -반응 엘리먼트 (stress- response element, STRE)를 가지는 유전자들의 불충분한 유도를 야기한다 (Takatsume, et al . , 2010). 따라서， 칼시뉴린 -Crzlp 경로가 효모에서 에탄올-보호성 기작으로 기능하는 지 여부는 논쟁의 여지가 있다. CMP2 넉-아웃이 증가된 에탄올 저항성을 초래한다는 본 발명의 결과는 후자를 지지한다. 한편, IMD4 는 GMP 생합성의 첫 번째 단계를 촉매하는 이노신 모노포스페이트 디하이드로게나제 (IMPDH)의 이소자임을 인코딩한다. S. 세레비지에의 에탄올 저항성에 관련된 IMD4에 대한 보고는 없다. 하지만, 젖산 박테리아인 오에노코커스 오에니 oe/?/)에서 에탄올 스트레스는 IMPDH 의 레벨을 감소시켜 니코틴아미드 뉴클레오타이드의 생산을 감소시킴으로써 글루타티온 환원효소의 유도를 초래하여 NADPH 레벨의 감소를 야기한다 (39). 이는 레독스 밸런스의 유지가 에탄올 적웅 (ethanol adaptation)에 중요한 역할을 한다는 것을 의미한다 (9， 39). 따라서， 비록 IMD4의 기능이 S. 세레비지에에서 확인될 필요가 있을 지라도 CMP2 및 IMD4모두가 에탄올 저항성에 중요할 것이다.
하향-조절되는 Tn2 의 경우도， 본 발명자들은 하나의 유전자만 하향- 조절되는 스트레인의 부재로 인해， 상기 유전자가 실제로 스트레스 저항성을 담당하는 지 여부를 결정할 수 없었다. SSK2 는 H0G1 경로의 미토겐-활성화된 단백질 키나제 키나제 키나제 (ΜΑΡΚΚΚ)를 인코딩하는데 (Posas, et al., 1998), 이는 고삼투압올 포함하는 다양한 환경 스트레스들에 대한 효모 생존에 필수적이다 (Albertyn, 1994； Brewster, et al., 1993). H0G1 경로는 두 개의 막-결합된 삼투센서 (osmosensor) 단백질인 Slnlp 및 Sholp 에 의해 서로 독립적으로 조절된다. Slnlp 에 의해 발생된 시그널들이 S 나 2p 로 전달되는 반면에， Sholp 에 의해 발생된 시그널들은 MAPKKK 인 Stellp 로 전달된 후， 두 개의 경로는 다운스트림 Pbs2p 로 합쳐진다 (Winkler, et al., 2002). 에탄을 스트레스에서 SSK2 의 포함은 거의 기술되어 있지 않다. 반면에， 열 스트레스는 SSK2 와는 무관한 SH01 경로를 포함한다 (Winkler, et al., 2002). 상술한 사실을 고려해볼 때， SSK2 의 파괴가 어떻게 에탄을- 및 열-저항성을 유도하는 지가 주요 관심사이다. 본 발명자들의 가설은 SSK2 파괴에 의해 야기된 SLN1 경로의 차단이 열에 대한 또 다른 경로인 SH01 경로의 시그널링 기능을 증가시킨다는 것이다. 에탄올 저항성이 SH01 경로에 의해 매개되는 지 여부는 홍미로운 주제일 것이다. PPG1 은 글라이코겐 축적에 필요한 잠재적인 세린 /트레오닌 단백질 포스파타제를 인코딩한다 (Posas, et al . , 1993). 글라이코겐 생합성 유전자들은 에탄올 충격에 반응하여 고발현된다 (Hirasawa, et al . , 2007) . PPG1 에 대한 관련 데이터는 본 연구에서 제시되지 않았기 때문에， PPG1 의 파괴가 에탄올 및 열 모두에 대한 저항성을 부여하는 본 발명자들의 데이터와의 불일치성을 고려하는 것은 시기상조이다.
한편 , 歷 의 넉 -아웃은 에탄올 및 열 모두에 대한 저항성올 부여하였고 醒 은 기능이 알려지지 않은 필수 단백질을 인코딩하는 데 , 이는 아마도 단백질 포스파타제 2A 멀티카피 억제인자 (suppressor)일 것으로 판단된다. 이 유전자의 과다-발현은 성장을 억제하고 세포형태를 조절하는 조절 경로를 방해함으로써 섬유성 표현형 (filamentous phenotype)을 유발한다 (Hu, et al., 1994). 아직까지， 상술한 유전자들이 스트레스 저항성과 연관되어 있다는 어떠한 증거도 없었다.
DLD3 는 마이토콘드리아 손상에 의해 자극되어 발현되는 유전자들로 구성된 레트로등급 레귤론의 한 부분으로， D-락테이트 디하이드로게나제를 인코딩 한다. 현재까지 스트레스 저항성에 대한 이 유전자의 관련성에 대한 보고는 없다.
MSN2 는 일반적인 스트레스 반응을 조절하는 전사인자를 인코딩한다 (Martinez-Pastor, et al. , 1996； Schmitt, et al. , 1996). Msn2p 와 41%의 동일성을 가지는 Msn4p 와 연계하여 Msn2p 는 열 및 고농도 에탄올을 포함한 여러 스트레스에 반응하는 약 200 개의 유전자들의 발현을 이들 유전자들의 프로모터에 위치한 스트레스 -반웅 엘리먼트 (Stress- response element, STRE)에 결합함으로써 조절한다 (Causton, et al. , 2001； Gasch, et al. , 2000； Martinez-Pastor, et al . , 1996). MSN4 유전자 발현은 스트레스에 의해 유도되는 반면에， MSN2 유전자는 항상 발현된다 (Gasch, et al., 2000). msn2 및 msn4의 단일염기 결실 돌연변이는 어떠한 표현형도 나타내지 않지만， msn2 및 msn4 이중 널 돌연변이 (double null mutants)는 탄소원 결핍 (starvat ion)， 열충격, 삼투 스트레스 및 산화 스트레스에 과민반응성을 나타낸다. MSN2 및 MSN4 유전자의 과다-발현은 결핍 및 열 스트레스에 대한 민감성을 감소시킨다 (Estruch, et al., 1993). 따라서， MSN2 및 MSN4는 비록 각각 특이 유전자들 및 특정 스트레스 조건에 따라 다를 지라도, 많은 생물학적 반응들에서 한 팀으로 기능한다 (Fuji ta, et al., 2006) . 에탄올 저항성과 관련하여， MSN2 의 과다-발현은 세이크 효모 스트레인에서 에탄올 저항성을 촉진시키고 발효능을 증진시킨다 (Watanabe, et al., 2009). 본 연구에서， MSN2 넉-아웃은 이전 연구들과는 상층하는 표현형 (증가된 에탄을 저항성)을 나타냈다. Msn2p 는 에탄올 저항성과 관련된 유전자들에 대한 음성 조절자로서 기능하는 것이 가능하다. 또한， Msn2p 및 Msn4p 는 스트레스 반웅에서 부분적으로 중복된 (redundant) 기능을 가진다 (Estruch, et al., 1993). 이런 맥락에서， 본 발명자들은 MSN4가 MSN2 넉 -아웃 스트레인에서 MSN2 를 대신하여 에탄을 스트레스 반응을 조절한다는 것을 제안한다.
본 연구는 증가된 에탄올-저항성을 책임지는 일곱 개의 유전자들 (CMP2, IMD4, SSK2, PPG1, PAM1, DLD3 및 MSN2), 그리고 증가된 열-저항성을 나타내는 세 개의 유전자들 (SSK2, PPG1 및 PAM1)을 밝혔다. 상술한 표현형을 나타낸다는 보고는 아직까지 없었다. 상술한 유전들 간의 내적연관성 (interrelationship)은 기재된 (annotated) 기능들로부터 유추될 수 없었다. 하지만， CMP2, SS 2 및 MSN2 는 세포 경로에 포함되어 있는 것으로 알려져 있으며， 이를 통해 에탄올 저항성에 관계된 분자 기작을 이해하는 데 도움을 줄 수 있을 것이다. 특히， 동정된 유일한 전사인자인 Msn2p 는 에탄을 저항성을 책임지는 유전자들을 음적으로 조절하기 때문에 관심의 대상이다. 또한， SSK2, PPG1 및 PAM1 에 대한 연구는 어떻게 에탄을- 및 열-저항성을 동시에 획득할 수 있는 지를 분자 레벨에서 이해하는 데 도움을 줄 수 있을 것이다.
결론적으로， 에탄올-， 열- 또는 퍼퓨랄 -스트레스에 대한 증가된 저항성을 가지는 스트레인을 개발하고자 하는 목적들 중 하나는 스트레스에 대한 저항성에 포함된 기작을 이해하는 것 이외에 산업적 적용에 대한 정보를 제공하는 것이다. 본 연구에서 동정된 신규한 유전자들은 에탄올 생산 능력의 측면에서 산업적 효모 스트레인을 개선하는 데 유용할 것이다. 또한, 본 연구는 트랜스포존 돌연변이유발법이 발현 레벨이 저항성 결정인자 (tolerance determinan)인 유전자들의 동정에 특히 유용하다는 것을 실증하였다. 이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바， 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며， 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서， 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. 참조 문헌
Abdel-Banat, B.M. , H. Hoshida, A. Ano, S. Nonklang, and R. Akada. 2010. High-temperature fermentation: how can process for ethanol product ion at high temperatures become superior to the traditional process using mesophilic yeast? Appl. Microbiol. Biotechnol. , 85： 861-867(2010).
Albertyn, J. , S. Hohraann, J. M. Thevelein, and B. A. Prior. GPD1, which encodes g lycer o 1 -3-phosphat e dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. , 14： 4135-4144(1994).
Alper , H. , J. Moxley, E. Nevoigt , G. R. Fink, and G. Stephanopoulos . Engineering yeast transcription machinery for improved ethanol tolerance and production. Science, 314: 1565-1568(2006) . Araki, Y.， H. Wu, H. Kitagaki, T. Akao, H. Takagi , and H. Shimoi . Ethanol stress stimulates the Ca2+一 mediated calcineur in/Crzl pathway in Saccharomyces cerevisiae, J. BioscL Bioeng. , 107: 1-6(2009) .
Auesukaree, C.， et al.， Genome-wide identification of genes involved in tolerance to various environmental stresses in Saccharomyces cerevisiae. J Appl Genet, 50(3): 301-310(2009).
Brewster, J. L. , T. de Valoir , N. D. Dwyer , E. Winter, and M. C.
Gust in. An osmosensing signal transduction pathway in yeast . Science,
259： 1760-1763(1993).
Bro, C.， B. Regenberg, J . Forster， and J . Nielsen. In si 1 ico aided metabol ic engineering of Saccharomyces cerevisiae for improved bioethanol production. Metab. Eng.， 8: 102-111(2006).
Casey, G. P., et al., ETHANOL TOLERANCE IN YEASTS. Critical Reviews in
Microbiology, Vol 13(3)： 219-280(1986).
Causton, H. C. , B. Ren, S. S. Koh, C. T. Harbison, E. Kanin, E. G.
Jennings， T. I . Lee， H. L. True， E . S . Lander， and R. A. Young .
Remodel ing of yeast genome expression in response to environmental changes. Mol. Biol. Cell, 12: 323-337(2001).
Coote, P. J. , M. V. Jones , I. J. Seymour , D. L. Rowe, D. P. Ferdinando, A. J. McArthur , and M. B. Cole. Activity of the plasma membrane H+一
ATPase is a key physiological determinant of thermotolerance in
Saccharomyces cerevisiae. Microbiology, 140: 1881-1890(1994) .
Cyer t， M. S. Calci neur in si gna 1 ing in Saccharomyces cerevisiae： how yeast go crazy in response to stress. Biochem. Biophys. Res. Conmun. , 311： 1143-1150(2003).
Edgar do, A.， P. Carol ina, R. Manuel， F. Juani ta, and B. Jaime.
Select ion of thermotolerant yeast strains Saccharomyces cerevisiae for bioethanol production. Enzyme Microb. Techno 1. , 43: 120-123(2008) .
Estruch， F .， and M . Car 1 son . Two homo 1 ogous zinc f i nger genes identified by multicopy suppression in a SNFl protein kinase mutant of
Saccharomyces cerevisiae. Mo J. Cell. Biol. , 13: 3872-3881(1993) . Fuj ita, K. , A. Mat suyama , A. Kobayashi , and H. Iwahashi . The genome- wide screening of yeast de let ion mutants to identify the genes required for tolerance to ethanol and other alcohols. FEMS Yeast Res. , 6: 744-750(2006).
Gasch, A. P., P. T. Spel lman, C. M. Kao, 0. Carmel-Harel , M. B. El isen G. Storz, D. Botstein, and P. 0. Brown. Genomic expression programs in the response of yeast eel Is to environmental changes . Mol . Biol. Cell, 11: 4241-4257(2000) .
Gorsich, S. W. , B. S. Dien, N. N. Nichols, P. J. Slininger, Z. L. Liu, and C. D. Skory. Tolerance to furfural-induced stress is associated with pentose phosphate pathway genes ZW1, GND1, RPE1, and TKL1 in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol . , 71: 339-349 (2006).
Hirasawa, T. , et al . , Identification of target genes conferring ethanol stress tolerance to Saccharomyces cerevisiae based on DNA microarray data analysis. Journal of Biotechnology, 131: 34-44(2007) . Hou, L. Improved product ion of ethanol by novel genome shuffling in Saccharomyces cerevisiae. Appl . Biochem. Biotechnol . , 160: 1084- 1093(2010).
Hu, G. Z. , and H. Ronne. Overexpression of yeast PAM1 gene permits survival without protein phosphatase 2A and induces a fi lament ous phenotype. J. Biol. Chem. , 269: 3429-3435(1994).
Inoue , T. , et al . , Cloning and Characterization of a Gene Com lement ing the Mutation of an E t hano 1 - s ens i t i ve Mutant of Sake Yeast . Biosci. Biotechnol. Biochem. , 64(2)： 229-236(2000).
Kaj iwara, S. , et al. , Overexpression of the OLEl gene enhances ethanol ferment at ion by Saccharomyces cerevisiae. Appl Microbiol Biotechnol , 53: 568-574(2000).
Kim, J. , et al . , Disruption of the Yeast ATH1 Gene Confers Better Survival after Dehydrat ion, Freezing, and Ethanol Shock： Potential Co瞧 ercial Applications. APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Vol 62(5)： 1563-1569(1996).
ubota, S. , I. Takeo, K. ume, M. Kanai , A. Shitamukai , M. Mizunuma, T Miyakawa, H. Shimoi , H. Lefuj i , and D. Hirata. Effect of ethanol on cell growth of budding yeast: genes that are important for cell growth in the presence of ethanol . Biosci. BiotechnoL Biochem. , 68： 968- 972(2004).
Kultz, D. Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol. , 67： 225-257(2005).
Lynd, L. R. , W. H. van Zyl , J. E. McBride, and M. Laser . Consolidated bioprocessing of eel lulosic biomass： an update. Curr. Opin. BiotechnoL , 16： 577-583(2005)
Ma, M. , and Z. L. Liu. Mechanisms of ethanol tolerance in Saccharomyces cerevisiae. Appl. Microbiol . BiotechnoL , 87: 829- 845(2010).
Mobini -Dehkordi , M. , I . Nahvi , H. Zarkesh-Esfahani , . Ghaedi , M. Tavassol i , and R. Akada. I sol at ion of a novel mutant strain of Saccharomyces cerevisiae by an ethyl methane sul fonate- induced mutagenesis approach as a high producer of bioethanol . J. Biosci. Bioeng. , 105： 403-408(2008).
Okuyama , H. , and M. Saito. Regulation by temperature of the chain length of fatty acids in yeast . J. Biol. Chem. , 254： 12281-12284(1979). Panadero, J., M. J. Hernandez-Lopez , J . A. Pr ieto, and F. Randez-Gi 1. Overexpression of the calcineurin target CRZ1 provides freeze tolerance and enhances the fermentative capacity of baker' s yeast . Appl. Environ. Microbiol. , 73: 4824-4831(2007) .
Posas , F. , J . Clotet , M. T. Muns , J . Corominas , A. Casamayor , and J . Ar i no . The gene PPG encodes a novel yeast protein phosphate involved in glycogen accumulation. J. Biol. Chem. , 268： 1349-1354(1993). Posas , F. , and H. Saito. Activation of the yeast SS 2 MAP kinase kinase kinase by the SSK1 two-component response regulator . EMBO J. , 17： 1385-1394 (1998).
Sanchez , Y. , et al . , Hspl04 is required for tolerance to many forms of stress. EMBO J., 11(6)： 2357-2364(1992).
Schmitt , A. P. , and K. McEntee. Msn2 , a zinc finger DNAᅳ binding protein, is the transcriptional activator of the mult istress response in Saccharomyces cerevisiae. Proc. Natl . Acad. Sci . USA, 93: 577그 5782(1996).
Schubert , C. Can biofuels finally take center stage? Nat - Biotechnol . 24:777-784 (2006).
Shimoda, C. , A. Itadani , A. Sugino, and M. Furusawa . I sol at ion of thermotolerant mutants by using proofreading-deficient DNA polymerase as an effective mutator in Saccharomyces cerevisiae. Genes Genet. Syst. 81:391-397(2006).
Si lveira, M. G. , M. Baumgartner , F. M. Rombout s , and T. Abee. Effects of adapt at ion to ethanol on cyto lasmic and membrane protein profiles of Oenococcus oeni . Appl . Environ. Microbiol. , 70: 2748-2755(2004). Sr i dhar , M. , N. Kiran Sree, and L. Venkateswar Rao. Effect of UV radiation on thermotolerance, ethanol tolerance and osmotolerance of Saccharomyces cerevisiae VSl and VS3 strains . Bioresource Techno 1. , 83: 199-202(2002) .
Stanley, D. , S. Fraser , P. J . Chambers, P. Rogers, and G. A. Stanley. Generation and characterization of stable ethanol -tolerant mutants of Saccharomyces cerevisiae. J . Ind. Microbiol. Biotechnol . , 37: 139ᅳ 149(2010).
Suutari, M. , K. Liukkonen, and S. Laakso. Temperature adapt at ion in yeast： the role of fatty acids. J . Gen. Microbiol . 136: 1469ᅳ 1474(1990).
Suutari , M. and S. Laakso . Microbial Fatty Acids and Thermal Adaptation. Crit. Rev. Microbiol., 20(4)： 255-328(1994). Takagi , H. , M. Takaoka , A. Kawaguchi , and Y. Kubo. Effect of Lᅳ proline on sake brewing and ethanol stress in Saccharomyces cerevisiae. App Environ. Microbiol., 71： 8656-8662(2005).
Takahashi , T.， H. Shimoi， and K. It으 Identification of genes required for growth under ethanol stress using transposon mutagenesis in
Saccharomyces cerevisiae. Mo Genet. Genomics t 265:1112-1119(2001).
Takatsume, Y. , T. Ohdate, K. Maeta, W. Nomura, S. Izawa, and Y. Inoue.
Calcineur in/Crzl destabilizes Msn2 and Msn4 in the nucleus in response to Ga2+ in Saccharomyces cerevisiae. Biochem. J., 427: 275-287(2010) . Teixeira, MC.， et aL， Genome-Wide Identification of Saccharomyces cerevisiae Genes Required for Maximal Tolerance to Ethanol. APPLIED AND
ENVIRONMENTAL MICROBIOLOGY, Vol 75(18): 5761-5772(2009).
van Voorst , F.， J. Houghtonᅳ Lar sen, L. J ø nson, M. C. Kiel landᅳ Brandt， and A. Brandt . 2006. Genome-wide identification of genes required for growth of Saccharomyces cerevisiae under ethanol stressᅳ Yeast, 23:
351-359(2006).
Watanabe, M. , D. Watanabe, T. Akao, and H. Shimoi . Overexpression of MSN2 in a sake yeast strain promotes ethanol tolerance and increases ethanol product ion in sake brewing. J . Biosci. Bioeng. , 107: 516- 518(2009).
Weber , C. , A. Farwick, F. Benisch, D. Brat , H. Dietz, T. Subtil, and E. Boles . Trends and chal lenges in the microbial product ion of 1 i gnoce 1 lulosic bioal coho 1 fuels. Appl . Microbiol . Biotechnol .， 87： 1303-1315(2010).
Winkler, A. , C. Arkind, C. P. Mat ti son, A. Burkholder , K. Knoche, and I . Ota. Heat stress act ivates the yeast high-osmolarity glycerol mitogen一 act ivated protein kinase pathway, and protein tyrosine phosphatases are essential under heat stress. Eukaryot . Cell, 1: 163一 173(2002). Yazawa , H. , H. Iwahashi , and H. Uemura. Disruption of URA7 and GAL6 improves the ethanol tolerance and ferment at ion capacity of Saccharomyces cerevisiae. Yeast, 24： 551-560(2007) .
Yoshikawa, K. , et al . , Genome-Wide Analysis of the Effects of Location and Number of Stress Response Elements on Gene Expression in Saccharomyces cerevisiae. JOURNAL OF BIOSCIENCE AND BIOENGINEERING, vol 106(5)： 507-510(2008).
Yoshikawa, K. , T. Tadamasa, C. Furusawa, K. Nagahisa, T. Hirasawa, and H. Shimizu. Comprehensive phenoty ic analysis for identification of genes affecting growth under ethanol stress in Saccharomyces cerevisiae. FEMS Yeast Res. , 9:32-44(2009).
You, K. M. , et al . , Ethanol Tolerance in the Yeast Saccharomyces cerevisiae Is Dependent on Cellular Oleic Acid Content. APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Vol 69(3)： 1499-1503(2003).

Claims

【청구의 범위】
【청구항 1】
불활성화된 (inactivated) CMP2 또는 IMD4 유전자 (Tn-1); DLD3 유전자 (Tn-4); 또는 MSN2 유전자 (Tn-5)를 포함하는 에탄올-저항성 형질변형 효모 균주 .
【청구항 2】
제 1 항에 있어서， 상기 불활성화는 트랜스포존에 의해 유발되는 것을 특징으로 하는 효모 균주.
【청구항 3】
제 1 항에 있어서， 상기 형질변형 효모 균주는 5-15% 에탄올 농도 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 4】
제 3 항에 있어서， 상기 형질변형 효모 균주는 12.5-15% 에탄올 농도 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 5】
제 1 항에 있어서， 상기 형질변형은 사카로마이세스 종 ( Saccharomyces spp . )， 시 3^^\^ °\지스 종 ( Schi zosaccharomyces spp.), 피키아 쫓 Pichia spp.), 파피아 ^ Paffia spp.), 클루이베로미세스 종 Khiyveromyces spp.), 칸디다 ^{Candida spp.), 탈라로미세스 종 alaromyces spp.), 브레타노미세스 종 Brettanomyces spp.), 파키솔렌 종 Pachysolen spp.) 또는 데바리오미세스 종 U)ebaryomyces spp.) 효모 균주에서 실시하는 것을 특징으로 하는 효모 균주.
【청구항 6]
제 5 항에 있어서, 상기 형질변형은 사카로마이세스 종에서 실시하는 것올 특징으로 하는 효모 균주.
【청구항 7】
불활성화된 (inactivated) SSK2 또는 PPG1 유전자를 포함하는 에탄웁ᅳ 및 열-저항성 형질변형 효모 균주.
【청구항 8】
제 7 항에 있어서， 상기 SSK2 또는 PPG1 유전자의 불활성화는 트랜스포존에 의해 유발되는 것을 특징으로 하는 효모 균주.
【청구항 9]
제 7 항에 있어서, 상기 효모 균주는 5-15% 에탄올 배양 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 10]
제 9 항에 있어서， 상기 효모 균주는 12.5-15% 에탄올 배양 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 111
제 7 항에 있어서， 상기 효모 균주는 30— 43°C 온도 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 12】
제 7 항에 있어서, 상기 효모 균주는 사카로마이세스 ( Saccharo yces spp . ) , 시조 }카로 ]·이세스 ( Schi zosaccharowyces spp.), 피키아 종 Pichia spp.), 파피아 종 (/¾//7a spp.), 클루이베로미세스 종 Kluyveromyces spp.), 칸디다 종 {Candida spp.), 탈라로미세스 종 alaromyces spp.), 브레타노미세스 ^ Brettanomyces spp.), 파키솔렌 종 Pachysolen spp.) 또는 데바리오미세스 종 Debaryomyces spp.) 효모 균주인 것을 특징으로 하는 효모 균주.
【청구항 13】
제 12 항에 있어서， 상기 효모 균주는 사카로마이세스 종인 것을 특징으로 하는 효모 균주 .
【청구항 14]
불활성화된 (inactivated) PAM1 유전자를 포함하는 에탄올- 및 열- 저항성 형질변형 효모 균주.
【청구항 15]
제 14 항에 있어서， 상기 PAM1 유전자의 돌연변이는 트랜스포존에 의해 유발되는 것올 특징으로 하는 효모 균주.
【청구항 16】
제 14 항에 있어서， 상기 효모 균주는 5-15% 에탄올 배양 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 17】
제 16 항에 있어서， 상기 효모 균주는 12.5-15% 에탄올 배양 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 18】
제 14항에 있어서， 상기 효모 균주는 30-42°C 온도 조건에서 성장할 수 있는 것올 특징으로 하는 효모 균주.
【청구항 191
제 14 항에 있어서， 상기 효모 균주는 사카로마이세스 종， 시조사카로마이세스 종， 피키아 종, 파피아 종， 클루이베로미세스 종， 칸디다 종， 탈라로미세스 종， 브레타노미세스 종， 파키솔렌 종 또는 데바리오미세스 종 효모 균주인 것을 특징으로 하는 효모 균주.
【청구항 20】
제 19 항에 있어서， 상기 효모 균주는 사카로마이세스 종인 것을 특징으로 하는 효모 균주.
【청구항 21]
불활성화된 (inactivated) SSK2 유전자를 포함하는 퍼퓨랄 (furfural )- 저항성 형질변형 효모 균주.
【청구항 22】
제 21 항에 있어서， 상기 SSK2 유전자의 불활성화는 트랜스포존에 의해 유발되는 것을 특징으로 하는 효모 균주.
【청구항 23]
제 21 항에 있어서， 상기 효모 균주는 15-50 mM 퍼퓨랄 배양 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 24]
제 21 항에 있어서， 상기 효모 균주는 에탄올 및 열에 대한 저항성을 추가적으로 가지는 것을 특징으로 하는 효모 균주.
【청구항 25]
제 21 항에 있어서, 상기 효모 균주는 5-15% 에탄올 배양 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 26】
제 25 항에 있어서， 상기 효모 균주는 12.5-15% 에탄올 배양 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 27】
제 21 항에 있어서， 상기 효모 균주는 30-43°C 온도 조건에서 성장할 수 있는 것을 특징으로 하는 효모 균주.
【청구항 28】
제 21 항에 있어서, 상기 효모 균주는 사카로마이세스 종 ( Saccharomyces sp . ) , 人】조 ]· ^로口} 01세스 종 ( Schi zosaccharomyces spp.), 피키아 ^{Pichia spp.), 파피아 종 (/¾//7a spp.), 클루이베로미세스 종 Kluyveromyces spp.), 칸디다 ^ Candida spp.), 탈라로미세스 종 Talaromyces spp.), 브레타노미세스 종 Brettanomyces spp.), 파키솔렌 종 Pachysolen spp.) 또는 데바리오미세스 ^^Debaryomyces spp.) 효모 균주인 것을 특징으로 하는 효모 균주.
【청구항 29]
제 28 항에 있어서， 상기 효모 균주는 사카로마이세스 종인 것을 특징으로 하는 효모 균주.
【청구항 30】
제 1 항, 제 7 항, 제 14 항 또는 제 21 항의 효모 균주를 에탄올로 대사될 수 있는 하나 이상의 기질올 포함하는 배양배지에서 배양하는 단계를 포함하는 에탄올 생산방법 .
【청구항 31]
제 30 항에 있어서， 상기 에탄올로 대사될 수 있는 기질은 C6 당 (sugars)을 포함하는 것을 특징으로 하는 방법. 【청구항 32】
제 31 항에 있어서， 상기 C6 당은 글루코오스인 것을 특징으로 하는 방법.
PCT/KR2010/007863 2010-04-23 2010-11-09 에탄올-, 열- 또는 퍼퓨랄-저항성 효모 균주, 및 이의 유전자 Ceased WO2011132835A2 (ko)

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
KR10-2010-0038140 2010-04-23
KR10-2010-0038126 2010-04-23
KR20100038140 2010-04-23
KR20100038126 2010-04-23
KR1020100101747A KR101182752B1 (ko) 2010-04-23 2010-10-19 에탄올? 및 열?저항성 효모 균주, 및 이의 유전자
KR1020100101754A KR101243903B1 (ko) 2010-04-23 2010-10-19 에탄올―저항성 효모 균주 및 이의 유전자
KR10-2010-0101754 2010-10-19
KR10-2010-0101747 2010-10-19
KR10-2010-0110215 2010-11-08
KR1020100110215A KR101165733B1 (ko) 2010-11-08 2010-11-08 에탄올―, 열― 및 퍼퓨랄―저항성 효모 균주, 및 이의 유전자

Publications (2)

Publication Number Publication Date
WO2011132835A2 true WO2011132835A2 (ko) 2011-10-27
WO2011132835A3 WO2011132835A3 (ko) 2011-12-22

Family

ID=44834576

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/007863 Ceased WO2011132835A2 (ko) 2010-04-23 2010-11-09 에탄올-, 열- 또는 퍼퓨랄-저항성 효모 균주, 및 이의 유전자

Country Status (1)

Country Link
WO (1) WO2011132835A2 (ko)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HIRASAWA ET AL.: 'Identification of target genes conferring ethanol stress to lerance to Saccharomyces cerevisiae based on DNA microarray data analysis.' JOURNAL OF BIOTECHNOLOGY. vol. 131, no. 1, 24 May 2007, pages 34 - 44 *
KRAUSE, E. L. ET AL.: 'Determining the effects of inositol supplementation and the opil mutation on ethanol tolerance of Saccharomyces cerevisiae' INDUSTRIAL BIOTECHNOLOGY. vol. 3, no. 3, 07 November 2007, pages 260 - 268 *
TAKAHASHI ET AL.: 'Identification of genes required for growth under ethanol stress using transposon mutagenesis in Saccharomyces cerevisiae' MOLECULAR GENETICS AND GENOMICS vol. 256, no. 6, 06 June 2001, pages 1112 - 1119 *
TEIXEIRA, M. C. ET AL.: 'Genome-wide identification of Saccharomyces cerevisiae genes required for maximal tolerance to ethanol' APPLIED AND ENVIRONMENTAL MICROBIOLOGY. vol. 75, no. 18, 24 July 2009, pages 5761 - 5772 *
VAN VOORST ET AL.: 'Genome-wide identification of genes required for growth of Saccharomyces cerevisiae under ethanol stress' YEAST. vol. 23, no. 5, 15 April 2006, pages 351 - 359 *

Also Published As

Publication number Publication date
WO2011132835A3 (ko) 2011-12-22

Similar Documents

Publication Publication Date Title
US11624057B2 (en) Glycerol free ethanol production
CN109536398B (zh) 用于产量增加的方法中的重组体微生物
KR102159691B1 (ko) 아세틸-코엔자임 a 유래 화합물을 생산하기 위한 포스포케톨라제 및 포스포트랜스아세틸라제의 용도
Barrientos et al. Mss51p and Cox14p jointly regulate mitochondrial Cox1p expression in Saccharomyces cerevisiae
Garrido et al. The induction of sexual development and virulence in the smut fungus Ustilago maydis depends on Crk1, a novel MAPK protein
US20240294951A1 (en) Glycerol free ethanol production
Goetz et al. Ergot cluster-encoded catalase is required for synthesis of chanoclavine-I in Aspergillus fumigatus
Kim et al. Identification of novel genes responsible for ethanol and/or thermotolerance by transposon mutagenesis in Saccharomyces cerevisiae
Kuanyshev et al. Domesticating a food spoilage yeast into an organic acid‐tolerant metabolic engineering host: Lactic acid production by engineered Zygosaccharomyces bailii
Rodríguez-Colman et al. The FOX transcription factor Hcm1 regulates oxidative metabolism in response to early nutrient limitation in yeast. Role of Snf1 and Tor1/Sch9 kinases
KR20200026261A (ko) 엑토인-생산 효모
CN108676766A (zh) 基因修饰的应用及其获得的菌株
González‐Siso et al. Improved bioethanol production in an engineered K luyveromyces lactis strain shifted from respiratory to fermentative metabolism by deletion of NDI 1
CN110892073A (zh) 增强型代谢物生产酵母
Mojardín et al. Lack of the NAD+-dependent glycerol 3-phosphate dehydrogenase impairs the function of transcription factors Sip4 and Cat8 required for ethanol utilization in Kluyveromyces lactis
KR101165733B1 (ko) 에탄올―, 열― 및 퍼퓨랄―저항성 효모 균주, 및 이의 유전자
WO2016105405A1 (en) Improved methods for making marker free microbial host cells
US9309542B2 (en) Recombinant Caldicellulosiruptor bescii and methods of use
Dmytruk et al. Autophagy-related gene ATG13 is involved in control of xylose alcoholic fermentation in the thermotolerant methylotrophic yeast Ogataea polymorpha
KR101182752B1 (ko) 에탄올? 및 열?저항성 효모 균주, 및 이의 유전자
KR101243903B1 (ko) 에탄올―저항성 효모 균주 및 이의 유전자
WO2011132835A2 (ko) 에탄올-, 열- 또는 퍼퓨랄-저항성 효모 균주, 및 이의 유전자
Nakazawa et al. Oxidative stress tolerance of a spore clone isolated from Shirakami kodama yeast depends on altered regulation of Msn2 leading to enhanced expression of ROS-degrading enzymes
Berezka et al. Insertional tagging of the Scheffersomyces stipitis gene HEM25 involved in regulation of glucose and xylose alcoholic fermentation
Wang et al. Single-cell genetic models to evaluate orphan gene function: The case of QQS regulating carbon and nitrogen allocation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10850318

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10850318

Country of ref document: EP

Kind code of ref document: A2