WO2011131975A1 - Microsomal prostaglandin e syntase-1 inhibitors - Google Patents

Microsomal prostaglandin e syntase-1 inhibitors Download PDF

Info

Publication number
WO2011131975A1
WO2011131975A1 PCT/GB2011/050767 GB2011050767W WO2011131975A1 WO 2011131975 A1 WO2011131975 A1 WO 2011131975A1 GB 2011050767 W GB2011050767 W GB 2011050767W WO 2011131975 A1 WO2011131975 A1 WO 2011131975A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
formula
ethyl
aminosulfonyl
piperidinecarboxamide
Prior art date
Application number
PCT/GB2011/050767
Other languages
French (fr)
Inventor
Benjamin Richard BELLENIE
Irene Farre-Gutierrez
Original Assignee
Convergence Pharmaceuticals Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Convergence Pharmaceuticals Limited filed Critical Convergence Pharmaceuticals Limited
Priority to JP2013505542A priority Critical patent/JP2013525339A/en
Publication of WO2011131975A1 publication Critical patent/WO2011131975A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
    • C07D417/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • This invention relates to piperidine derivatives, to processes for their preparation, to pharmaceutical compositions containing them and to their use in medicine.
  • the compounds of the present invention are microsomal Prostaglandin E Synthase-1 (mPGES-1 ) inhibitors.
  • Prostaglandin E2 synthesis and secretion the role ofPGE synthases, Park et al, Clin Immunol, (2006), 1 19, 229-240.
  • Prostaglandins are produced from membrane phospholipid derived
  • arachidonic acid AA
  • COX1 and COX2 cyclooxygenase enzymes
  • PGH2a cyclooxygenase enzymes
  • PGE2 PGI2
  • PGD2 Schottyrene-like PGs
  • PGE2 is a key mediator of inflammation and inflammatory mediated pain.
  • PGH2 is converted by constitutive Prostaglandin E Synthase (cPGES) and microsomal PGES (mPGES) to PGE2.
  • cPGES Prostaglandin E Synthase
  • mPGES microsomal PGES
  • COX2 and mPGES are upregulated in inflammatory conditions, whereas COX1 and cPGES are not, suggesting that they produce PGE2 involved in homeostatic mechanisms, and COX2 and mPGES are more closely involved with pathological conditions in which PGE2 is elevated.
  • mPGES knockout mice demonstrate impaired inflammatory and pain responses (Trebino et al, Proc Natl Acad Sci USA, (2003), 100(15), 9044-9049).
  • Selective mPGES inhibitors may therefore be useful in the treatment of pain and inflammation in a variety of conditions including osteoarthritis, rheumatoid arthritis, ankylosing spondilitis, and acute pain or chronic pain.
  • the present invention provides the use of a compound of formula (I) or a
  • a compound of formula (I) or a pharmaceutically acceptable derivative thereof for the manufacture of a medicament for the treatment or prevention of a condition such as a pain, inflammatory, immunological, bone, neurodegenerative or renal disorder.
  • Ri represents Ci -4 alkyl, halo, Ci -4 haloalkyl, Ci -4 alkoxy, Ci -4 haloalkoxy, or nitro
  • R 2 represents Ci -4 alkyl, halo, Ci -4 haloalkyl, Ci -4 alkoxy, Ci -4 haloalkoxy, or nitro
  • X represents O or S;
  • n 1 or 2;
  • p 0 or 1. According to a further embodiment the invention, there is provided a compound of formula (I) or a pharmaceutically acceptable derivative thereof for use in human or veterinary medicine.
  • a compound of formula (I) or a pharmaceutically acceptable derivative thereof for use in the treatment or prevention of a condition which is mediated by the action of mPGES-1 .
  • a compound of formula (I) or a pharmaceutically acceptable derivative thereof for use in the treatment or prevention of a condition such as a pain, inflammatory, immunological, bone, neurodegenerative or renal disorder.
  • a method of treating a human or animal subject suffering from a condition which is mediated by the action of mPGES-1 which comprises administering to said subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable derivative thereof.
  • Ri represents Ci -4 alkyl, halo, Ci -4 haloalkyl, Ci -4 alkoxy, Ci -4 haloalkoxy, or nitro
  • R 2 represents Ci -4 alkyl, halo, Ci -4 haloalkyl, Ci -4 alkoxy, Ci -4 haloalkoxy, or nitro
  • X represents O or S;
  • n 1 or 2;
  • p 0 or 1 ;
  • X is O. In another embodiment of the invention X is S.
  • p represents 0 and Ri represents Ci -4 alkyl (e.g. methyl), halo (e.g. chlorine), Ci -4 alkoxy (e.g. methoxy or ethoxy) or nitro.
  • p represents 0 and Ri represents methyl, chlorine, methoxy, ethoxy or nitro.
  • p represents 1 and Ri and R 2 both represent Ci -4 alkyl (e.g. methyl). In a further embodiment, p represents 1 and Ri and R 2 both represent methyl. In one embodiment of the invention p is 0 and Ri is methyl.
  • p is 0 and Ri is methyl, and is in the 4 position on the bicyclic ring.
  • p is 0 and Ri is methyl, and is in the 6 position on the bicyclic ring.
  • p is 1
  • Ri is methyl
  • R 2 is methyl
  • p is 1
  • Ri is methyl
  • R 2 is methyl and said methyl groups are on the 4 and 6 positions of the bicyclic ring.
  • p is 1
  • Ri is methyl
  • R 2 is methyl and said methyl groups are on the 5 and 7 positions of the bicyclic ring.
  • p is 0 and Ri is chloro.
  • p is 0 and Ri is chloro and said chloro group is on the 4 position of the bicyclic ring.
  • p is 0 and Ri is chloro and said chloro group is on the 5 position of the bicyclic ring.
  • p is 0 and Ri is chloro and said chloro group is on the 6 position of the bicyclic ring.
  • p is 0 and Ri is methyloxy.
  • p is 0 and Ri is methyloxy and said methyloxy group is in the 6 position on the bicyclic ring. In one embodiment of the invention p is 0 and Ri is ethyloxy.
  • p is 0 and Ri is ethyloxy and said ethyloxy group is in the 6 position on the bicyclic ring.
  • p is 0 and Ri is nitro.
  • p is 0 and Ri is nitro and said nitro group is in the 6 position on the bicyclic ring.
  • m is 2 and X is S.
  • the compound is selected from the group consisting of: N- ⁇ 2-[4-(Aminosulfonyl)phenyl]ethyl ⁇ - -(5,7-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 );
  • the term 'Ci_ 4 alkyl' includes straight chain and branched chain alkyl groups containing 1 to 4 carbon atoms, such as methyl, ethyl, n-propyl, / ' so-propyl, n- butyl and 2-methylpropyl.
  • the term 'Ci -4 alkoxy' includes those with straight and branched alkyl chains containing 1 to 4 carbon atoms, such as methyloxy, ethyloxy, n-propyloxy, iso- propyloxy, n-butyloxy and 2-methylpropyloxy.
  • 'halo Ci -4 alkyl' includes straight and branched chain alkyl groups containing 1 to 4 carbon atoms substituted by one or more halo atoms, for example fluoromethyl, difluoromethyl and trifluoromethyl.
  • 'halo Ci -4 alkoxy' includes straight and branched chain alkoxy groups substituted by one or more halo atoms, for example fluoromethyloxy, difluoromethyloxy and trifluoromethyloxy.
  • halo means fluoro, chloro, bromo, or iodo.
  • nitro means N0 2 .
  • pharmaceutically acceptable derivative any pharmaceutically acceptable salt or any other compound which upon administration to the recipient is capable of providing (directly or indirectly) a compound of formula (I) or an active metabolite or residue thereof.
  • compounds of formula (I) may be modified to provide pharmaceutically acceptable derivatives thereof at any of the functional groups in the compounds, and that the compounds of formula (I) may be derivatised at more than one position.
  • salts referred to above will be the pharmaceutically acceptable salts, but other salts may find use, for example in the preparation of compounds of formula (I) and the pharmaceutically acceptable salts thereof.
  • Pharmaceutically acceptable salts include those described by Berge, Bighley and Monkhouse, J. Pharm. Sci., 1977, 66, 1 -19.
  • the term "pharmaceutically acceptable salts” includes salts prepared from pharmaceutically acceptable bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc, and the like. Salts derived from pharmaceutically acceptable organic bases include salts of primary, secondary, and tertiary amines; substituted amines including naturally occurring substituted amines; and cyclic amines.
  • Particular pharmaceutically acceptable organic bases include arginine, betaine, caffeine, choline, N,N'-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethyl-morpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, procaine, purines, theobromine, triethylamine, trimethylamine, tripropyl amine, tris(hydroxymethyl)aminomethane, and the like.
  • Salts may also be formed from basic ion exchange resins, for example polyamine resins.
  • salts may be prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids. Such acids include acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, p-toluenesulfonic acid, and the like.
  • acids include acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, male
  • salts include the ammonium, calcium, magnesium, potassium, and sodium salts, and those formed from maleic, fumaric, benzoic, ascorbic, pamoic, succinic, hydrochloric, sulfuric, bismethylenesalicylic, methanesulfonic, ethanedisulfonic, propionic, tartaric, salicylic, citric, gluconic, aspartic, stearic, palmitic, itaconic, glycolic, p-aminobenzoic, glutamic,
  • the compounds of formula (I) may be produced in vivo by metabolism of a suitable prodrug.
  • suitable prodrug may be for example physiologically acceptable metabolically labile acylsulfonamides of compounds of formula (I) as shown in formula (II). These may be formed by N-acylation of the sulfonamide group in the parent compound of formula (I) with, where appropriate, prior protection of any other reactive groups present in the molecule followed by deprotection if required.
  • Metabolically labile N-alkyl-N-acylsulfonamides of compounds of formula (I) may also be useful as prodrugs, for example N-methyl-N-acylsulfonamide where acyl groups include those previously defined, as described by J.D. Larsen and H. Bundgaard, Int. J. Pharm. 37 (1987), pp. 87-95 and J.D. Larsen, H. Bundgaard and V.H.L. Lee. Int. J. Pharm. 47 (1988), pp. 103-1 10.
  • Metabolically labile N-sulphonyl imidates of compounds of formula (I), as shown in formula (III), may also be useful as prodrugs, as described by H. Bundgaard and J.D. Larsen J. Med. Chem. 31 (1988), pp. 2066-2069.
  • racemic compounds of the invention encompasses all isomers of the compounds of formula (I) and their pharmaceutically acceptable derivatives, including all geometric, tautomeric and optical forms, and mixtures thereof (e.g. racemic mixtures).
  • racemic compounds of the invention include the compounds of Examples 2 and 1 1 which exist in enantiomeric forms, such as E2a, E2b, E1 1 a and E1 1 b.
  • the compounds of formula (I) are intended for use in pharmaceutical compositions, it will be understood that they are each provided in substantially pure form, for example at least 50% pure, at least 75% pure and at least 95% pure (% are on a wt/wt basis). Impure preparations of the compounds of formula (I) may be used for preparing the more pure forms used in the pharmaceutical compositions.
  • solvent of crystallisation may be present in the crystalline product.
  • This invention includes within its scope such solvates, including solvates of the free acid molecule and solvates of salts derived from the free base molecule.
  • some of the compounds of this invention may be crystallised or recrystallised from solvents containing water. In such cases water of hydration may be formed.
  • This invention includes within its scope stoichiometric hydrates as well as compounds containing variable amounts of water that may be produced by processes such as lyophilisation.
  • This invention also includes within its scope anhydrous forms of the compounds of formula (I).
  • the present invention also includes within its scope all isotopically-labelled compounds of formula (I). Such compounds are identical to those recited above except that one or more atoms therein are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
  • isotopes that can be incorporated into compounds of formula (I) and pharmaceutically acceptable derivatives thereof include isotopes of hydrogen, carbon, nitrogen, oxygen and fluorine, such as 2H, 3H, 1 1 C, 13C, 14C, 15N, 170, 180 and 18F.
  • Isotopically-labelled compounds of formula (I), for example those into which radioactive isotopes such as 3H, 14C are incorporated, are useful in drug and/or substrate tissue distribution assays. Tritiated, i.e., 3H, and carbon-14, i.e., 14C, isotopes are particularly preferred for their ease of preparation and detectability. 1 1 C and 18F isotopes are particularly useful in PET (positron emission tomography), and are useful in brain imaging. Further substitution with heavier isotopes such as deuterium, i.e., 2H, can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances.
  • Isotopically labelled compounds of formula (I) may be prepared by carrying out the synthetic procedures disclosed in the Schemes and/or in the Examples below, by substituting a readily available isotopically labelled reagent for a non-isotopically labelled reagent.
  • the compounds of formula (I) are mPGES inhibitors and may therefore be useful in treating mPGES mediated diseases.
  • the compounds of formula (I) may be useful in the treatment of pain, for example, acute pain; chronic articular pain (e.g. rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis) including the property of disease modification and joint structure preservation; musculoskeletal pain; lower back and neck pain; sprains and strains; neuropathic pain; sympathetically maintained pain; myositis; pain associated with cancer and fibromyalgia; pain associated with migraine, tension headache and cluster headaches; pain associated with influenza or other viral infections, such as the common cold; rheumatic fever; pain associated with functional bowel disorders such as non-ulcer dyspepsia, non- cardiac chest pain and irritable bowel syndrome; pain associated with myocardial ischemia; post operative pain; headache; toothache; and dysmenorrhea.
  • chronic articular pain e.g. rheumatoid arthritis, osteoarthriti
  • the compounds of formula (I) may be particularly useful in the treatment of neuropathic pain and symptoms associated therewith.
  • Neuropathic pain syndromes include: diabetic neuropathy; sciatica; non-specific lower back pain; multiple sclerosis pain; fibromyalgia; HIV-related neuropathy; post-herpetic neuralgia; trigeminal neuralgia; and pain resulting from physical trauma, amputation, cancer, toxins or chronic inflammatory conditions.
  • Symptoms of neuropathic pain include: diabetic neuropathy; sciatica; non-specific lower back pain; multiple sclerosis pain; fibromyalgia; HIV-related neuropathy; post-herpetic neuralgia; trigeminal neuralgia; and pain resulting from physical trauma, amputation, cancer, toxins or chronic inflammatory conditions.
  • Symptoms of neuropathic pain include
  • pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static or thermal allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation
  • the compounds of formula (I) may also be useful in the treatment of inflammation, for example in the treatment of skin conditions (e.g. sunburn, burns, eczema, dermatitis, psoriasis); ophthalmic diseases such as glaucoma, retinitis, retinopathies, uveitis and of acute injury to the eye tissue (e.g. conjunctivitis); lung disorders (e.g. asthma, bronchitis, emphysema, allergic rhinitis, respiratory distress syndrome, pigeon fancier's disease, farmer's lung, COPD; gastrointestinal tract disorders (e.g.
  • organs aphthous ulcer, Crohn's disease, atopic gastritis, gastritis varialoforme, ulcerative colitis, coeliac disease, regional ileitis, irritable bowel syndrome, inflammatory bowel disease, gastrointestinal reflux disease, diarrhoea, constipation); organ
  • vascular disease migraine, periarteritis nodosa, thyroiditis, aplastic anaemia, Hodgkin's disease, sclerodoma, myaesthenia gravis, multiple sclerosis, sorcoidosis, nephrotic syndrome, Bechet's syndrome, polymyositis, gingivitis, myocardial ischemia, pyrexia, systemic lupus erythematosus, polymyositis, tendinitis, bursitis, and Sjogren's syndrome.
  • an inflammatory component such as vascular disease, migraine, periarteritis nodosa, thyroiditis, aplastic anaemia, Hodgkin's disease, sclerodoma, myaesthenia gravis, multiple sclerosis, sorcoidosis, nephrotic syndrome, Bechet's syndrome, polymyositis, gingivitis, myocardial ischemia, pyrexia, systemic
  • the compounds of formula (I) may also be useful in the treatment of fever.
  • the compounds of formula (I) may also be useful in the treatment of immunological diseases such as autoimmune diseases, immunological deficiency diseases or organ transplantation.
  • the compounds of formula (I) may also be effective in increasing the latency of HIV infection.
  • the compounds of formula (I) may also be useful in the treatment of diseases of excessive or unwanted platelet activation such as intermittent claudication, unstable angina, stroke, and acute coronary syndrome (e.g. occlusive vascular diseases).
  • the compounds of formula (I) may also be useful as a drug with diuretic action, or may be useful to treat overactive bladder syndrome.
  • the compounds of formula (I) may also be useful in the treatment of impotence or erectile dysfunction.
  • the compounds of formula (I) may also be useful in the treatment of bone disease characterised by abnormal bone metabolism or resorption such as osteoporosis (especially postmenopausal osteoporosis), hyper-calcemia, hyperparathyroidism, Paget's bone diseases, osteolysis, hypercalcemia of malignancy with or without bone metastases, rheumatoid arthritis, periodontitis, osteoarthritis, ostealgia, osteopenia, cancer cacchexia, calculosis, lithiasis (especially urolithiasis), solid carcinoma, gout and ankylosing spondylitis, tendinitis and bursitis.
  • osteoporosis especially postmenopausal osteoporosis
  • hyper-calcemia hyperparathyroidism
  • Paget's bone diseases osteolysis
  • hypercalcemia of malignancy with or without bone metastases rheumatoid arthritis
  • periodontitis osteoarthritis
  • osteoarthritis
  • the compounds of formula (I) may also be useful in bone remodelling and/or promoting bone generation and/or promoting fracture healing.
  • the compounds of formula (I) may also be useful in the treatment of tinnitus.
  • the compounds of formula (I) may also be useful in the treatment of cardiovascular diseases such as hypertension or myocardial ischemia; functional or organic venous insufficiency; varicose therapy; and haemorrhoids.
  • the compounds of formula (I) may also be useful in the treatment of
  • neurodegenerative diseases and neurodegeneration such as dementia, particularly degenerative dementia (including senile dementia, Alzheimer's disease, Pick's disease, Huntingdon's chorea, Parkinson's disease and Creutzfeldt-Jakob disease, ALS, motor neuron disease); vascular dementia (including multi-infarct dementia); as well as dementia associated with intracranial space occupying lesions; trauma;
  • degenerative dementia including senile dementia, Alzheimer's disease, Pick's disease, Huntingdon's chorea, Parkinson's disease and Creutzfeldt-Jakob disease, ALS, motor neuron disease
  • vascular dementia including multi-infarct dementia
  • dementia associated with intracranial space occupying lesions trauma;
  • infections and related conditions including HIV infection
  • metabolism toxins
  • anoxia and vitamin deficiency toxins
  • mild cognitive impairment associated with ageing particularly Age Associated Memory Impairment.
  • the compounds of formula (I) may also be useful in the treatment of neurological disorders and may be useful as neuroprotecting agents.
  • the compounds of the invention may also be useful in the treatment of neurodegeneration following stroke, cardiac arrest, pulmonary bypass, traumatic brain injury, spinal cord injury or the like.
  • the compounds of formula (I) may also be useful in the treatment of complications of Type 1 diabetes (e.g. diabetic microangiopathy, diabetic retinopathy, diabetic nephropathy, macular degeneration, glaucoma), nephrotic syndrome, aplastic anaemia, uveitis, Kawasaki disease and sarcoidosis.
  • Type 1 diabetes e.g. diabetic microangiopathy, diabetic retinopathy, diabetic nephropathy, macular degeneration, glaucoma
  • nephrotic syndrome e.g. diabetic microangiopathy, diabetic retinopathy, diabetic nephropathy, macular degeneration, glaucoma
  • nephrotic syndrome e.g. diabetic microangiopathy, diabetic retinopathy, diabetic nephropathy, macular degeneration, glaucoma
  • nephrotic syndrome e.g. diabetic microangiopathy, diabetic retinopathy, diabetic ne
  • the compounds of formula (I) may also be useful in the treatment of kidney dysfunction (nephritis, particularly mesangial proliferative glomerulonephritis, nephritic syndrome), liver dysfunction (hepatitis, cirrhosis) and gastrointestinal dysfunction (diarrhoea).
  • kidney dysfunction nephritis, particularly mesangial proliferative glomerulonephritis, nephritic syndrome
  • liver dysfunction hepatitis, cirrhosis
  • gastrointestinal dysfunction diarrhoea
  • the compounds of formula (I) may also be useful in the treatment of dependence on a dependence-inducing agent such as opiods (e.g. morphine), CNS depressants (e.g. ethanol), psychostimulants (e.g. cocaine) and nicotine.
  • opiods e.g. morphine
  • CNS depressants e.g. ethanol
  • psychostimulants e.g. cocaine
  • nicotine e.g. a dependence-inducing agent
  • the compounds of formula (I) may also be useful in the treatment of autoimmune disorders, respiratory disorders, cancer, cardiovascular disorders associated with atherosclerosis, treatment and/or prevention of pre-term labour and tumour angiogenesis.
  • any reference to treatment includes both treatment of established symptoms and prophylactic treatment.
  • compositions are conveniently administered in the form of pharmaceutical compositions.
  • Such compositions may conveniently be presented for use in conventional manner in admixture with one or more physiologically acceptable carriers or excipients.
  • a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable derivative thereof adapted for use in human or veterinary medicine.
  • the compounds of formula (I) or a pharmaceutically acceptable derivative thereof While it is possible for the compounds of formula (I) or a pharmaceutically acceptable derivative thereof to be administered as the raw chemical, it is preferable to present it as a pharmaceutical formulation.
  • the formulations of the present invention comprise the compounds of formula (I) or a pharmaceutically acceptable derivative thereof together with one or more acceptable carriers or diluents therefore and optionally other therapeutic ingredients.
  • the carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
  • the invention provides a
  • composition comprising a compound of formula (I) or a
  • the formulations include those suitable for oral, parenteral (including subcutaneous e.g. by injection or by depot tablet, intradermal, intrathecal, intramuscular e.g. by depot and intravenous), rectal and topical (including dermal, buccal and sublingual) administration although the most suitable route may depend upon for example the condition and disorder of the recipient.
  • parenteral including subcutaneous e.g. by injection or by depot tablet, intradermal, intrathecal, intramuscular e.g. by depot and intravenous
  • rectal and topical including dermal, buccal and sublingual
  • topical including dermal, buccal and sublingual
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy (see for example methods disclosed in 'Remington - The Science and Practice of Pharmacy', 21 st Edition, Lippincott, Williams & Wilkins, USA, 2005 and references therein).
  • All methods include the step of bringing into association the compound of formula (I) or a pharmaceutically acceptable derivative thereof ("active ingredient”) with the carrier which constitutes one or more accessory ingredients.
  • active ingredient a pharmaceutically acceptable derivative thereof
  • the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both and then, if necessary, shaping the product into the desired formulation.
  • Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets (e.g. chewable tablets in particular for paediatric administration) each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion.
  • the active ingredient may also be presented as a bolus, electuary or paste.
  • a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent.
  • Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein.
  • Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of a sterile liquid carrier, for example, water-for-injection, immediately prior to use.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
  • Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter, hard fat or polyethylene glycol.
  • Formulations for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis such as sucrose and acacia or tragacanth, and pastilles comprising the active ingredient in a basis such as gelatin and glycerin or sucrose and acacia.
  • the compounds of formula (I) may also be formulated as depot preparations. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the compounds of formula (I) may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • the formulations may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.
  • COX-2 inhibitors such as celecoxib, rofecoxib, valdecoxib or parecoxib
  • 5-lipoxygenase inhibitors such as paracetamol
  • NSAID's such as diclofenac, indomethacin, nabumetone, naproxen or ibuprofen
  • leukotriene receptor antagonists leukotriene receptor antagonists
  • DMARD's such as methotrexate
  • sodium channel blockers such as lamotrigine
  • N-type calcium channel antagonists such as NMDA receptor modulators, such as glycine receptor antagonists
  • gabapentin, pregabalin and related compounds tricyclic antidepressants such as amitriptyline
  • neurone stabilising antiepileptic drugs such as venlafaxine
  • opioid analgesics such as venlafaxine
  • 5HT1 agonists such as trip
  • the compounds When the compounds are used in combination with other therapeutic agents, the compounds may be administered either sequentially or simultaneously by any convenient route.
  • the invention thus provides, in a further embodiment, a combination comprising a compound of formula (I) or a pharmaceutically acceptable derivative thereof together with a further therapeutic agent or agents.
  • the combinations referred to above may conveniently be presented for use in the form of a pharmaceutical formulation and thus pharmaceutical formulations comprising a combination as defined above together with a pharmaceutically acceptable carrier or diluent comprise a further aspect of the invention.
  • the individual components of such combinations may be administered either sequentially or simultaneously in separate or combined pharmaceutical formulations.
  • each compound may differ from that when the compound is used alone. Appropriate doses will be readily appreciated by those skilled in the art.
  • a method of treating a human or animal subject suffering from a condition which is mediated by the action of mPGES-1 which comprises administering to said subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable derivative thereof and another therapeutic agent.
  • a proposed daily dosage of compounds of formula (I) or their pharmaceutically acceptable salts for the treatment of man is from 0.001 to 30 mg/kg body weight per day and more particularly 0.1 to 3 mg/kg body weight per day, calculated as the free base, which may be administered as a single or divided dose, for example one to four times per day.
  • the dose range for adult human beings is generally from 0.1 to 1000 mg/day, such as from 10 to 800 mg/day, preferably 10 to 200 mg/day, calculated as the free base.
  • the precise amount of the compounds of formula (I) administered to a host, particularly a human patient, will be the responsibility of the attendant physician. However, the dose employed will depend on a number of factors including the age and sex of the patient, the precise condition being treated and its severity, the route of administration, and any possible combination therapy that may be being undertaken.
  • the present invention also provides a process for preparing the compounds of formula (I) and pharmaceutically acceptable derivatives thereof.
  • Scheme 1 illustrates two alternative processes for the preparation of compounds for formula (I), (II), (III), (VI), (IX).
  • Alk represents an alkyl chain.
  • PG represents a suitable protecting group.
  • Step A a compound of formula (III) is prepared by reacting a compound of formula
  • a compound of formula (III) can also be prepared in accordance with methods known in the art for example those reviewed in Charles, M. et al., Organic Letters 2005, 7, 18, 3965-3968.
  • carboxylate can be purchased from Sigma-Aldrich Co. Ltd.).
  • Compounds of formula (V) are commercially available (for example 2,6- dichlorobenzothiazole can be purchased from Sigma-Aldrich Co. Ltd.) or they may be prepared in accordance with different methods known in the art.
  • 2,5-dichlorobenzothiazole may also be prepared by reacting 5-chloromercaptobenzothiazole (commercially available e.g. from Sigma- Aldrich Co. Ltd.) with chlorine gas at low temperature.
  • 5-chloromercaptobenzothiazole commercially available e.g. from Sigma- Aldrich Co. Ltd.
  • Step B a compound of formula (II) is prepared by hydrolysing a compound of formula (III). This can be carried out using any of a number of procedures known in the art. Typically, (III) can be hydrolysed by using lithium hydroxide in a suitable solvent mixture (for example tetrahydrofuran:methanol 4:1 ) at ambient or elevated temperature.
  • a suitable solvent mixture for example tetrahydrofuran:methanol 4:1
  • amide (I) is prepared by reacting acid of formula (II) with amine of formula (VII) by methods such as those described for step D.
  • a compound of formula (I) can also be prepared in accordance with step F, in scheme 1 , by methods such as those described for scheme 1 , step A.
  • amide of formula (VI) is formed from a suitable N-protected aminoacid (VIII) and an amine (VII).
  • Step E protecting group is removed to form compound (IX).
  • compound of formula (I) can either be formed using step F or step C.
  • R-i , R 2 , p and X are as defined hereinbefore and L-i represents a suitable leaving group such as chlorine;
  • Process (a) may typically be performed as defined hereinbefore for step C in Scheme 1 .
  • Process (b) may typically be performed as defined hereinbefore for step F in Scheme 1 .
  • Process (c) typically comprises any suitable deprotection reaction, the conditions of which will depend upon the nature of the protecting group. In most instances such a deprotection reaction will typically comprise the use of a suitable acid.
  • the acid may suitably comprise trifluoroacetic acid, HCI in EtOAc, HCI in 1 ,4-dioxane or HCI in methanol.
  • Process (d) typically comprises interconversion procedures known by one skilled in the art.
  • the present invention provides an assay for the identification of mPGES-1 inhibitor compounds. This assay is described in detail in Example 1 1 .
  • 2,6-Dichloro-1 ,3-benzoxazole is commercially availiable but the compound that was used in the synthesis of example 7 was prepared in-house. Analysis of the in-house material showed by LCMS that 14% was 2,6-dichloro-1 ,3-benzoxazole and 81 % was -chloro-1 ,3-benzoxazol-2(3/-/)-one (structure showed below) :
  • Step 1 Ethyl (3S)-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylate
  • Step 2 (3S)-1 -(6-Chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylic acid
  • Step 3 (3S)-N- ⁇ 2-r4-(Aminosulfonyl)phenyllethyl)-1 -(6-chloro-1 ,3-benzothiazol-2-vD- 3-piperidinecarboxamide
  • DIPEA (0.213 ml, 1 .222 mmol) was added to a mixture of (3S)-1 -(6-chloro-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxylic acid (0.076 g, 0.255 mmol), 4-(2- aminoethyl)benzenesulfonamide (0.051 g, 0.255 mmol), HATU (0.1 16 g, 0.306 mmol) and aza-HOBt (0.021 g, 0.153 mmol) in ⁇ , ⁇ -Dimethylformamide (DMF) (2.25 ml). The reaction was stirred at room temperature overnight. LCMS showed a good conversion to the desired product.
  • Step 1 Ethyl (3R)-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylate
  • Step 2 (3R)-1 -(6-Chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylic acid
  • Step 3 (3R)-N- ⁇ 2-r4-(Aminosulfonyl)phenyllethyl)-1 -(6-chloro-1 ,3-benzothiazol-2-vD- 3-piperidinecarboxamide
  • DIPEA (0.252 ml, 1.440 mmol) was added to a mixture of (3R)-1 -(6-chloro-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxylic acid (0.107 g, 0.360 mmol), 4-(2- aminoethyl)benzenesulfonamide (0.060 g, 0.3 mmol), HATU (0.1 14 g, 0.300 mmol) and aza-HOBt (0.025 g, 0.180 mmol) in ⁇ , ⁇ -dimethylformamide (DMF) (2.5 ml). The reaction was stirred at room temperature overnight. LCMS showed a good conversion to the desired product. The DMF was evaporated and the crude was purified via MDAP High PH to have the free base of the desired product.
  • Example 11 W- ⁇ 2-[4-(Aminosulfonyl)phenyl]ethyl ⁇ -1 -(4,6-dimethyl-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxamide (E11)
  • the compound of E1 1 is commercially available and may be obtained from commercial sources (e.g.
  • the racemic compound of E1 1 was separated by chiral preparative chromatography using Chiralcel OJ (20mm x 250mm, ⁇ ⁇ ); mobile phase of Heptane : absolute Ethanol 50:50 v/v pump-mixed at a flow rate of 17.0mls/min and detected at U.V. Absorbance of 215nm to afford a fast running isomer (enantiomer 1 ) 36mg. LCMS m/z (ES): 473 [M+H] + . 96.2% ee.
  • the compound of E12 is commercially available and may be obtained from commercial sources (e.g. ChemDiv, Inc.). Biological activity
  • the mPGES-1 assay has been configured as a coupled product detection// ' /! situ substrate generation format where COX2 is utilized to generate prostaglandin H 2 (PGH 2 ), the mPGES-1 substrate. This is due to the instability of the PGH 2 , which spontaneously converts to prostaglandin E 2 (PGE 2 ).
  • This coupled assay is particularly suited to use in a high throughout screen, unlike mPGES-1 assays documented in previous applications (for example
  • mPGES-1 Human microsomal prostaglandin E synthase-1 coding region was PCR amplified with an optimised Kozak sequence from human bladder cDNA and then cloned into pcDNA3.1/v5/HisTOPO (Invitrogen) in the correct orientation for expression using the following oligonucleotide primers:
  • the insert matches the published mPGES cDNA sequence (AF027740) except for a single silent base change t(183)c, a SNP present in both forms among mPGES ESTs (Unigene Hs.146688).
  • a further round of PCR was carried out to add unique BamHI and Xhol endonuclease restriction sites to enable efficient cloning into pFASTBac HTB to give an N-term his tag fusion which was expressed in the baculovirus/Sf9 insect cell system for which the following oligonucleotide primers were used:
  • Cells were cultured in the CSR at 27 degrees Celsius and at a dissolved oxygen concentration of 30%. Medium was added to accordingly to keep the cells in logarithmic growth phase until the final desired volume was achieved with a cell concentration of 3.5-4xe6 cells/ml. The cultivation was then infected with HmPGE-1 baculovirus at a viral multiplicity of infection of 3. The infected cells were cultured for a further 48 hours. The cells were then harvested by a Carr Viafuge (Carr) continuous centrifugation at 2500g with a flow rate of 80 litres/hour.
  • Carr Viafuge Carr
  • the pellets were retained and were re- suspended in 80ml 10mM potassium phosphate, 10%glycerol, 0.1 mM EDTA, 1 mM GSH, 1.5% n-octyl glucopyranoside, pH7.
  • the tubes were mixed for 1 hour at 4C.
  • the mixture was centrifuged at 100,000g for 60min. in balanced tubes.
  • the supernatant was retained and assayed for protein. Protein was supplied as a solution 10mg/ml. To determine an appropriate concentration for screening, the protein was titrated into the assay to give a total protein concentration generating 2.5 mins linearity of production of fluorescent signal.
  • COX-2- FLAG C-terminal FLAG tag
  • Cells were infected with recombinant COX-2-FLAG baculovirus at a multiplicity of infection of 5 and harvested by centrifugation 72 hours post-infection and the cell pellet stored at -80°C until required. All purification procedures were performed at + 4°C. Cells were thawed on ice and resuspended in 5 volumes of buffer A (50 mM Tris pH7.5, 150mM NaCI, 5 mM EDTA, 1 .3 % (w/v) octylglucoside) and cell lysis/protein solubilisation achieved by sonication followed by stirring on ice for 2 hours. Particulate material was removed by ultracentrifugation at 100 OOOg for 90 min at 4°C.
  • buffer A 50 mM Tris pH7.5, 150mM NaCI, 5 mM EDTA, 1 .3 % (w/v) octylglucoside
  • the supernatant was made to 1 % (w/v) with respect to octylglucoside by the addition of buffer B (20m M Tris pH 7.4, 150mM NaCI, 0.1 mM EDTA). The supernatant was then incubated overnight on a roller with anti-FLAG M2 agarose that had been equilibrated with buffer C (20mM Tris pH 7.4, 150mM NaCI, 0.1 mM EDTA, 1 % (w/v) octylglucoside. The beads were packed into a column and washed with 10 column volumes of buffer C. Bound proteins were eluted with Buffer C containing 0.1 mg/ml of triple FLAG peptide. Protein was supplied as a solution 2mg/ml.
  • the resulting Lysate SN was harvested and contacted with a 200ml Glutathione Sepharose FF column using an AKTA purifier 100 at a flow rate of 1 ml/min.
  • the column was washed back to base line with PBS, 1 mM EDTA, 5mM DTT, 10% Glycerol, pH7.4 and then eluted
  • the activity of the solubilised mPGES-1 was assessed using a fluorescence intensity assay.
  • COX-2 (0.55 ⁇ final), 15-PGDH (70 nM final), mPGES-1 (50 pg/ml total protein final), NAD+ (1 mM final), reduced glutathione (100 ⁇ final), Diaphorase (1 U/ml final, Sigma #D5540) and Resazurin (10 ⁇ final) in assay buffer (50mM Tris-CI pH 7.5, 1 mM EDTA, 0.1 % pluronic F-127) were added (5 ⁇ ) to wells containing 10Onl of typically 100uM - 1 .7nM of test compound or DMSO vehicle (1 % final) in Greiner 384 well low volume black plate.
  • the reaction was initiated by the addition of 2.5 ⁇ hemin in 50mM Tris-CI pH 7.5, 1 mM EDTA (1 ⁇ final) followed by 2.5 ⁇ arachidonic acid in 1 mM NaOH (20 ⁇ final) to give a total volume of 10 ⁇ .
  • the plate was immediately transferred to a Viewlux (Perkin-Elmer Life Sciences, Pangbourne, UK) and the fluorescence intensity was measured kinetically at 15 second intervals for 2.5 minutes at excitation 525 nm and emission 598 nm. Data analysis was carried out via determination of the rate of fluorescence increase.
  • the assay was also formatted to run in a Greiner 1536 black plate using concentrations of reagents as stated above and volume additions at 50% of those stated above.
  • COX-2 The activity of the solubilised COX-2 was assessed using a fluorescence intensity assay.
  • COX-2 (5 nM final) in assay buffer (50mM Tris-CI pH 7.5, 1 mM EDTA, 0.1 % pluronic F-127) was added (5 ⁇ ) to wells containing 10Onl of typically 100uM - 1.7nM of test compound or DMSO vehicle (1 % final) in Greiner 384 well low volume black plate.
  • the reaction was initiated by the addition of 4 ⁇ hemin in 50mM Tris-CI pH 7.5, 1 mM EDTA (250 nM final) followed by 2 ⁇ arachidonic acid (2.5 ⁇ final),
  • Diacetyldichlorofluorescin (DCF, Sigma #D6883, 5 ⁇ final) in 1 mM NaOH to give a total volume of 10 ⁇ .
  • the plate was immediately transferred to a Viewlux (Perkin- Elmer Life Sciences, Pangbourne, UK) and the fluorescence intensity was measured kinetically at 15 second intervals for 2.5 minutes at excitation 480 nm and emission 540 nm. Data analysis was carried out via determination of the rate of fluorescence increase.
  • the assay was also formatted to run in a Greiner 1536 black plate using concentrations of reagents as stated above and volume additions at 50% of those stated above.
  • 15-PGDH The activity of the 15-PGDH was assessed using a fluorescence intensity assay.
  • the reaction was initiated by the addition of 5 ⁇ Prostaglandin E2 in 1 mM NaOH (10 ⁇ final) to give a total volume of 10 ⁇ .
  • the plate was immediately transferred to a Viewlux (Perkin-Elmer Life Sciences, Pangbourne, UK) and the fluorescence intensity was measured kinetically at 15 second intervals for 5 minutes at excitation 525 nm and emission 598 nm. Data analysis was carried out via determination of the rate of fluorescence increase.
  • the assay was also formatted to run in a Greiner 1536 black plate using concentrations of reagents as stated above and volume additions at 50% of those stated above.
  • Compounds of the invention (namely Examples 1 -2, 2a, 2b, 3-10, 1 1 , 1 1 a, 1 1 b and 12 have specific activity at human mPGES with an average plC 50 value of 5.6 or higher.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Neurosurgery (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)

Abstract

This invention relates to piperidine derivatives, to processes for their preparation, to pharmaceutical compositions containing them and to their use in medicine.

Description

MICROSOMAL PROSTAGLANDIN E SYNTASE-1 INHIBITORS
This invention relates to piperidine derivatives, to processes for their preparation, to pharmaceutical compositions containing them and to their use in medicine.
The compounds of the present invention are microsomal Prostaglandin E Synthase-1 (mPGES-1 ) inhibitors.
A number of review articles describe the characterization and therapeutic relevance of mPGES: Prostaglandin E synthase in the pathophysiology of arthritis Kojima et al,
Fundam & Clin Pharmacol (2005), 19, 255-216; Membrane Prostaglandin E synthase-1 : A novel therapeutic target, Samuelsson et al Pharmacol Rev, (2007), 59, 207-224;
Prostaglandin E2 synthesis and secretion: the role ofPGE synthases, Park et al, Clin Immunol, (2006), 1 19, 229-240.
Manipulation of prostaglandin levels is the premise behind anti-inflammatory and analgesic therapies that target cyclooxygenase (COX1/2) enzymes non-selectively (non steroidal anti inflammatory drugs; NSAIDS), or selectively (COX2 inhibitors). Prostaglandins (PGs) are produced from membrane phospholipid derived
arachidonic acid (AA). Through conversion of AA via cyclooxygenase enzymes COX1 and COX2 to PGH2, and subsequent conversion of PGH2 by terminal synthase enzymes, a variety of PGs are produced: PGF2a, Tx (thromboxane) A2, PGE2, PGI2 and PGD2 (Scholich & Geisslinger, TiPS (2006), 27(8), 399-401 ).
PGE2 is a key mediator of inflammation and inflammatory mediated pain. PGH2 is converted by constitutive Prostaglandin E Synthase (cPGES) and microsomal PGES (mPGES) to PGE2. Both COX2 and mPGES are upregulated in inflammatory conditions, whereas COX1 and cPGES are not, suggesting that they produce PGE2 involved in homeostatic mechanisms, and COX2 and mPGES are more closely involved with pathological conditions in which PGE2 is elevated. mPGES knockout mice demonstrate impaired inflammatory and pain responses (Trebino et al, Proc Natl Acad Sci USA, (2003), 100(15), 9044-9049). Inhibition of COX enzymes, as produced by non steroidal anti-inflammatory drugs (NSAIDS) and COX2 inhibitors, is potentially associated with side effects, possibly because there is a broad inhibition of prostaglandins. PGE2 is produced by the action of cPGES and mPGES enzymes. By selectively inhibiting mPGES, other PGs, and homeostatic PGE2 (produced by cPGES) will be left intact, thus reducing potential side effects, whilst maintaining analgesic efficacy. mPGES-1 deletion in mice has been shown to enhance PGI2 levels and retard atherogenesis (Wang et al, Proc Natl Acad Sci USA, (2006), 103(39), 14507-14512).
Selective mPGES inhibitors may therefore be useful in the treatment of pain and inflammation in a variety of conditions including osteoarthritis, rheumatoid arthritis, ankylosing spondilitis, and acute pain or chronic pain.
Compounds exhibiting mPGES-1 inhibitory activity and their uses have been described in, for example, WO2005/005415, WO2005/123674, WO2006/063466, WO2006/077364, WO2006/077365, WO2006/077366, WO2006/077367,
WO2006/077401 , WO2006/077412, WO2007/014687, WO2007/042816,
WO2007/042817, WO2007/059610, WO2007/05961 1 , WO2007/061853,
WO2007/095753.
The present invention provides the use of a compound of formula (I) or a
pharmaceutically acceptable derivative thereof for the manufacture of a medicament for the treatment of a condition which is mediated by the action of mPGES-1 .
According to another embodiment of the invention there is provided the use of a compound of formula (I) or a pharmaceutically acceptable derivative thereof for the manufacture of a medicament for the treatment or prevention of a condition such as a pain, inflammatory, immunological, bone, neurodegenerative or renal disorder.
Examples of such conditions are indicated herein below.
Compounds of formula (I) are as follows:
Figure imgf000003_0001
(I) wherein:
Ri represents Ci-4 alkyl, halo, Ci-4 haloalkyl, Ci-4 alkoxy, Ci-4 haloalkoxy, or nitro; R2 represents Ci-4 alkyl, halo, Ci-4 haloalkyl, Ci-4 alkoxy, Ci-4 haloalkoxy, or nitro; X represents O or S;
m represents 1 or 2; and
p represents 0 or 1. According to a further embodiment the invention, there is provided a compound of formula (I) or a pharmaceutically acceptable derivative thereof for use in human or veterinary medicine.
According to another embodiment of the invention, there is provided a compound of formula (I) or a pharmaceutically acceptable derivative thereof for use in the treatment or prevention of a condition which is mediated by the action of mPGES-1 .
According to another embodiment of the invention, there is provided a compound of formula (I) or a pharmaceutically acceptable derivative thereof for use in the treatment or prevention of a condition such as a pain, inflammatory, immunological, bone, neurodegenerative or renal disorder.
According to a further embodiment of the invention, there is provided a method of treating a human or animal subject suffering from a condition which is mediated by the action of mPGES-1 which comprises administering to said subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable derivative thereof.
According to a further embodiment of the invention there is provided a method of treating a human or animal subject suffering from a pain, inflammatory,
immunological, bone, neurodegenerative or renal disorder, which method comprises administering to said subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable derivative thereof. Certain compounds of formula (I) are novel, and form another aspect of the invention. In this embodiment of the invention, there is provided compounds of formula (I) or pharmaceutically acceptable derivatives thereof,
Figure imgf000005_0001
wherein:
Ri represents Ci-4 alkyl, halo, Ci-4 haloalkyl, Ci-4 alkoxy, Ci-4 haloalkoxy, or nitro; R2 represents Ci-4 alkyl, halo, Ci-4 haloalkyl, Ci-4 alkoxy, Ci-4 haloalkoxy, or nitro; X represents O or S;
m represents 1 or 2; and
p represents 0 or 1 ;
with the proviso that the compound is not /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-1 -(4,6- dimethyl-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxamide or
/V-{2-[4-(aminosulfonyl)phenyl]ethyl}-1 -[6-(ethyloxy)-1 ,3-benzothiazol-2-yl]-3- piperidinecarboxamide.
The following embodiments refer to both compounds of formula (I) and the uses thereof in the treatment of diseases.
In one embodiment of the invention X is O. In another embodiment of the invention X is S.
In one embodiment, p represents 0 and Ri represents Ci-4 alkyl (e.g. methyl), halo (e.g. chlorine), Ci-4 alkoxy (e.g. methoxy or ethoxy) or nitro. In a further embodiment, p represents 0 and Ri represents methyl, chlorine, methoxy, ethoxy or nitro.
In one embodiment, p represents 1 and Ri and R2 both represent Ci-4 alkyl (e.g. methyl). In a further embodiment, p represents 1 and Ri and R2 both represent methyl. In one embodiment of the invention p is 0 and Ri is methyl.
In a further embodiment of the invention p is 0 and Ri is methyl, and is in the 4 position on the bicyclic ring.
In a yet further embodiment of the invention p is 0 and Ri is methyl, and is in the 6 position on the bicyclic ring.
In another embodiment of the invention, p is 1 , Ri is methyl and R2 is methyl.
In a further embodiment of the invention, p is 1 , Ri is methyl, R2 is methyl and said methyl groups are on the 4 and 6 positions of the bicyclic ring.
In a still further embodiment of the invention, p is 1 , Ri is methyl, R2 is methyl and said methyl groups are on the 5 and 7 positions of the bicyclic ring.
In one embodiment of the invention p is 0 and Ri is chloro.
In a still further embodiment of the invention p is 0 and Ri is chloro and said chloro group is on the 4 position of the bicyclic ring.
In a yet further embodiment of the invention p is 0 and Ri is chloro and said chloro group is on the 5 position of the bicyclic ring.
In another embodiment of the invention p is 0 and Ri is chloro and said chloro group is on the 6 position of the bicyclic ring.
In a further embodiment of the invention p is 0 and Ri is methyloxy.
In a still further embodiment of the invention p is 0 and Ri is methyloxy and said methyloxy group is in the 6 position on the bicyclic ring. In one embodiment of the invention p is 0 and Ri is ethyloxy.
In a further embodiment of the invention p is 0 and Ri is ethyloxy and said ethyloxy group is in the 6 position on the bicyclic ring.
In one embodiment of the invention p is 0 and Ri is nitro.
In a further embodiment of the invention p is 0 and Ri is nitro and said nitro group is in the 6 position on the bicyclic ring.
In one embodiment of the invention m is 2 and X is S. In one embodiment of the invention the compound is selected from the group consisting of: N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(5,7-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 );
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(6-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E2);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(5-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E3);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(6-methyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E4);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -[6-(methyloxy)-1 ,3-benzothiazol-2-yl]-3- piperidinecarboxamide (E5);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(4-methyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E6);
/V-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(6-chloro-1 ,3-benzoxazol-2-yl)-3- piperidinecarboxamide (E7);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(6-nitro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E8);
N-{[4-(Aminosulfonyl)phenyl]methyl}-' -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E9) and
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}- -(4-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E10).
In one embodiment of the invention the compound is selected from the group consisting of:
(3S)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E2a);
(3R)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E2b);
(3S)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 1 a); and
(3R)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 1 b).
As used herein, the term 'Ci_4 alkyl' includes straight chain and branched chain alkyl groups containing 1 to 4 carbon atoms, such as methyl, ethyl, n-propyl, /'so-propyl, n- butyl and 2-methylpropyl. As used herein, the term 'Ci-4 alkoxy' includes those with straight and branched alkyl chains containing 1 to 4 carbon atoms, such as methyloxy, ethyloxy, n-propyloxy, iso- propyloxy, n-butyloxy and 2-methylpropyloxy. As used herein, the term 'halo Ci-4 alkyl' includes straight and branched chain alkyl groups containing 1 to 4 carbon atoms substituted by one or more halo atoms, for example fluoromethyl, difluoromethyl and trifluoromethyl.
As used herein, the term 'halo Ci-4 alkoxy' includes straight and branched chain alkoxy groups substituted by one or more halo atoms, for example fluoromethyloxy, difluoromethyloxy and trifluoromethyloxy.
As used herein, the term halo means fluoro, chloro, bromo, or iodo. As used herein, the term nitro means N02.
By pharmaceutically acceptable derivative is meant any pharmaceutically acceptable salt or any other compound which upon administration to the recipient is capable of providing (directly or indirectly) a compound of formula (I) or an active metabolite or residue thereof.
It will be appreciated by those skilled in the art that compounds of formula (I) may be modified to provide pharmaceutically acceptable derivatives thereof at any of the functional groups in the compounds, and that the compounds of formula (I) may be derivatised at more than one position.
It will be appreciated that, for pharmaceutical use, the salts referred to above will be the pharmaceutically acceptable salts, but other salts may find use, for example in the preparation of compounds of formula (I) and the pharmaceutically acceptable salts thereof.
Pharmaceutically acceptable salts include those described by Berge, Bighley and Monkhouse, J. Pharm. Sci., 1977, 66, 1 -19. The term "pharmaceutically acceptable salts" includes salts prepared from pharmaceutically acceptable bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc, and the like. Salts derived from pharmaceutically acceptable organic bases include salts of primary, secondary, and tertiary amines; substituted amines including naturally occurring substituted amines; and cyclic amines. Particular pharmaceutically acceptable organic bases include arginine, betaine, caffeine, choline, N,N'-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethyl-morpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, procaine, purines, theobromine, triethylamine, trimethylamine, tripropyl amine, tris(hydroxymethyl)aminomethane, and the like. Salts may also be formed from basic ion exchange resins, for example polyamine resins. When a compound of the present invention is basic, salts may be prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids. Such acids include acetic, benzenesulfonic, benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric, p-toluenesulfonic acid, and the like.
Examples of pharmaceutically acceptable salts include the ammonium, calcium, magnesium, potassium, and sodium salts, and those formed from maleic, fumaric, benzoic, ascorbic, pamoic, succinic, hydrochloric, sulfuric, bismethylenesalicylic, methanesulfonic, ethanedisulfonic, propionic, tartaric, salicylic, citric, gluconic, aspartic, stearic, palmitic, itaconic, glycolic, p-aminobenzoic, glutamic,
benzenesulfonic, cyclohexylsulfamic, phosphoric and nitric acids. It will be appreciated that the compounds of formula (I) may be produced in vivo by metabolism of a suitable prodrug. Such prodrugs may be for example physiologically acceptable metabolically labile acylsulfonamides of compounds of formula (I) as shown in formula (II). These may be formed by N-acylation of the sulfonamide group in the parent compound of formula (I) with, where appropriate, prior protection of any other reactive groups present in the molecule followed by deprotection if required.
Figure imgf000010_0001
Examples of such metabolically labile acyl groups include linear or branched alkyl (for example R3 = methyl, ethyl, propyl), and such chains substituted with solubilising groups such as amino, carboxyl, alkoxyl and hydroxyl (for example R3 =
aminomethyl, 2-(morpholin-4-yl)ethyl, 2-(4-methylpiperazin-1 -yl)ethyl, CH2CH2CO2H, CH2OCH2CH2OCH3, CH2CH2C(0)OCH2CH3, CH(NH2)CH2OH), as described by S. Huang, P.J. Connolly, R. Lin, S. Emanuel and S.A. Middleton, Bioorg. Med. Chem. Lett. 16 (2006), pp. 3639-3641 .
Metabolically labile N-alkyl-N-acylsulfonamides of compounds of formula (I) may also be useful as prodrugs, for example N-methyl-N-acylsulfonamide where acyl groups include those previously defined, as described by J.D. Larsen and H. Bundgaard, Int. J. Pharm. 37 (1987), pp. 87-95 and J.D. Larsen, H. Bundgaard and V.H.L. Lee. Int. J. Pharm. 47 (1988), pp. 103-1 10.
Metabolically labile N-sulphonyl imidates of compounds of formula (I), as shown in formula (III), may also be useful as prodrugs, as described by H. Bundgaard and J.D. Larsen J. Med. Chem. 31 (1988), pp. 2066-2069.
Figure imgf000011_0001
It is to be understood that the present invention encompasses all isomers of the compounds of formula (I) and their pharmaceutically acceptable derivatives, including all geometric, tautomeric and optical forms, and mixtures thereof (e.g. racemic mixtures). Examples of racemic compounds of the invention include the compounds of Examples 2 and 1 1 which exist in enantiomeric forms, such as E2a, E2b, E1 1 a and E1 1 b.
Since the compounds of formula (I) are intended for use in pharmaceutical compositions, it will be understood that they are each provided in substantially pure form, for example at least 50% pure, at least 75% pure and at least 95% pure (% are on a wt/wt basis). Impure preparations of the compounds of formula (I) may be used for preparing the more pure forms used in the pharmaceutical compositions.
Although the purity of intermediate compounds of the present invention is less critical, it will be readily understood that the substantially pure form is preferred as for the compounds of formula (I). Whenever possible, the compounds of the present invention are obtained in crystalline form.
When some of the compounds of this invention are allowed to crystallise or are recrystallised from organic solvents, solvent of crystallisation may be present in the crystalline product. This invention includes within its scope such solvates, including solvates of the free acid molecule and solvates of salts derived from the free base molecule. Similarly, some of the compounds of this invention may be crystallised or recrystallised from solvents containing water. In such cases water of hydration may be formed. This invention includes within its scope stoichiometric hydrates as well as compounds containing variable amounts of water that may be produced by processes such as lyophilisation. This invention also includes within its scope anhydrous forms of the compounds of formula (I).
In addition, different crystallisation conditions may lead to the formation of different polymorphic forms of crystalline products. This invention includes within its scope all polymorphic forms of the compounds of formula (I).
The present invention also includes within its scope all isotopically-labelled compounds of formula (I). Such compounds are identical to those recited above except that one or more atoms therein are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into compounds of formula (I) and pharmaceutically acceptable derivatives thereof include isotopes of hydrogen, carbon, nitrogen, oxygen and fluorine, such as 2H, 3H, 1 1 C, 13C, 14C, 15N, 170, 180 and 18F.
Isotopically-labelled compounds of formula (I), for example those into which radioactive isotopes such as 3H, 14C are incorporated, are useful in drug and/or substrate tissue distribution assays. Tritiated, i.e., 3H, and carbon-14, i.e., 14C, isotopes are particularly preferred for their ease of preparation and detectability. 1 1 C and 18F isotopes are particularly useful in PET (positron emission tomography), and are useful in brain imaging. Further substitution with heavier isotopes such as deuterium, i.e., 2H, can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances. Isotopically labelled compounds of formula (I) may be prepared by carrying out the synthetic procedures disclosed in the Schemes and/or in the Examples below, by substituting a readily available isotopically labelled reagent for a non-isotopically labelled reagent. The compounds of formula (I) are mPGES inhibitors and may therefore be useful in treating mPGES mediated diseases.
It will be appreciated that the compounds within the proviso, namely, Λ/-{2-[4- (aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 1 ) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-1 -[6-
(ethyloxy)-l ,3-benzothiazol-2-yl]-3-piperidinecarboxamide (E12) are commercially available compounds which have no associated utility. Therefore, the proviso for the compound claims do not apply to the use claims of the invention.
In particular the compounds of formula (I) may be useful in the treatment of pain, for example, acute pain; chronic articular pain (e.g. rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis and juvenile arthritis) including the property of disease modification and joint structure preservation; musculoskeletal pain; lower back and neck pain; sprains and strains; neuropathic pain; sympathetically maintained pain; myositis; pain associated with cancer and fibromyalgia; pain associated with migraine, tension headache and cluster headaches; pain associated with influenza or other viral infections, such as the common cold; rheumatic fever; pain associated with functional bowel disorders such as non-ulcer dyspepsia, non- cardiac chest pain and irritable bowel syndrome; pain associated with myocardial ischemia; post operative pain; headache; toothache; and dysmenorrhea.
The compounds of formula (I) may be particularly useful in the treatment of neuropathic pain and symptoms associated therewith. Neuropathic pain syndromes include: diabetic neuropathy; sciatica; non-specific lower back pain; multiple sclerosis pain; fibromyalgia; HIV-related neuropathy; post-herpetic neuralgia; trigeminal neuralgia; and pain resulting from physical trauma, amputation, cancer, toxins or chronic inflammatory conditions. Symptoms of neuropathic pain include
spontaneous shooting and lancinating pain, or ongoing, burning pain. In addition, there is included pain associated with normally non-painful sensations such as "pins and needles" (paraesthesias and dysesthesias), increased sensitivity to touch (hyperesthesia), painful sensation following innocuous stimulation (dynamic, static or thermal allodynia), increased sensitivity to noxious stimuli (thermal, cold, mechanical hyperalgesia), continuing pain sensation after removal of the stimulation
(hyperpathia) or an absence of or deficit in selective sensory pathways (hypoalgesia). The compounds of formula (I) may also be useful in the treatment of inflammation, for example in the treatment of skin conditions (e.g. sunburn, burns, eczema, dermatitis, psoriasis); ophthalmic diseases such as glaucoma, retinitis, retinopathies, uveitis and of acute injury to the eye tissue (e.g. conjunctivitis); lung disorders (e.g. asthma, bronchitis, emphysema, allergic rhinitis, respiratory distress syndrome, pigeon fancier's disease, farmer's lung, COPD; gastrointestinal tract disorders (e.g.
aphthous ulcer, Crohn's disease, atopic gastritis, gastritis varialoforme, ulcerative colitis, coeliac disease, regional ileitis, irritable bowel syndrome, inflammatory bowel disease, gastrointestinal reflux disease, diarrhoea, constipation); organ
transplantation; other conditions with an inflammatory component such as vascular disease, migraine, periarteritis nodosa, thyroiditis, aplastic anaemia, Hodgkin's disease, sclerodoma, myaesthenia gravis, multiple sclerosis, sorcoidosis, nephrotic syndrome, Bechet's syndrome, polymyositis, gingivitis, myocardial ischemia, pyrexia, systemic lupus erythematosus, polymyositis, tendinitis, bursitis, and Sjogren's syndrome.
The compounds of formula (I) may also be useful in the treatment of fever.
The compounds of formula (I) may also be useful in the treatment of immunological diseases such as autoimmune diseases, immunological deficiency diseases or organ transplantation. The compounds of formula (I) may also be effective in increasing the latency of HIV infection.
The compounds of formula (I) may also be useful in the treatment of diseases of excessive or unwanted platelet activation such as intermittent claudication, unstable angina, stroke, and acute coronary syndrome (e.g. occlusive vascular diseases). The compounds of formula (I) may also be useful as a drug with diuretic action, or may be useful to treat overactive bladder syndrome.
The compounds of formula (I) may also be useful in the treatment of impotence or erectile dysfunction.
The compounds of formula (I) may also be useful in the treatment of bone disease characterised by abnormal bone metabolism or resorption such as osteoporosis (especially postmenopausal osteoporosis), hyper-calcemia, hyperparathyroidism, Paget's bone diseases, osteolysis, hypercalcemia of malignancy with or without bone metastases, rheumatoid arthritis, periodontitis, osteoarthritis, ostealgia, osteopenia, cancer cacchexia, calculosis, lithiasis (especially urolithiasis), solid carcinoma, gout and ankylosing spondylitis, tendinitis and bursitis.
The compounds of formula (I) may also be useful in bone remodelling and/or promoting bone generation and/or promoting fracture healing.
The compounds of formula (I) may also be useful in the treatment of tinnitus. The compounds of formula (I) may also be useful in the treatment of cardiovascular diseases such as hypertension or myocardial ischemia; functional or organic venous insufficiency; varicose therapy; and haemorrhoids.
The compounds of formula (I) may also be useful in the treatment of
neurodegenerative diseases and neurodegeneration such as dementia, particularly degenerative dementia (including senile dementia, Alzheimer's disease, Pick's disease, Huntingdon's chorea, Parkinson's disease and Creutzfeldt-Jakob disease, ALS, motor neuron disease); vascular dementia (including multi-infarct dementia); as well as dementia associated with intracranial space occupying lesions; trauma;
infections and related conditions (including HIV infection); metabolism; toxins; anoxia and vitamin deficiency; and mild cognitive impairment associated with ageing, particularly Age Associated Memory Impairment.
The compounds of formula (I) may also be useful in the treatment of neurological disorders and may be useful as neuroprotecting agents. The compounds of the invention may also be useful in the treatment of neurodegeneration following stroke, cardiac arrest, pulmonary bypass, traumatic brain injury, spinal cord injury or the like.
The compounds of formula (I) may also be useful in the treatment of complications of Type 1 diabetes (e.g. diabetic microangiopathy, diabetic retinopathy, diabetic nephropathy, macular degeneration, glaucoma), nephrotic syndrome, aplastic anaemia, uveitis, Kawasaki disease and sarcoidosis.
The compounds of formula (I) may also be useful in the treatment of kidney dysfunction (nephritis, particularly mesangial proliferative glomerulonephritis, nephritic syndrome), liver dysfunction (hepatitis, cirrhosis) and gastrointestinal dysfunction (diarrhoea).
The compounds of formula (I) may also be useful in the treatment of dependence on a dependence-inducing agent such as opiods (e.g. morphine), CNS depressants (e.g. ethanol), psychostimulants (e.g. cocaine) and nicotine. The compounds of formula (I) may also be useful in the treatment of autoimmune disorders, respiratory disorders, cancer, cardiovascular disorders associated with atherosclerosis, treatment and/or prevention of pre-term labour and tumour angiogenesis.
It is to be understood that as used herein any reference to treatment includes both treatment of established symptoms and prophylactic treatment.
The compounds of formula (I) and their pharmaceutically acceptable derivatives are conveniently administered in the form of pharmaceutical compositions. Such compositions may conveniently be presented for use in conventional manner in admixture with one or more physiologically acceptable carriers or excipients.
Thus, in another aspect of the invention, there is provided a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable derivative thereof adapted for use in human or veterinary medicine.
While it is possible for the compounds of formula (I) or a pharmaceutically acceptable derivative thereof to be administered as the raw chemical, it is preferable to present it as a pharmaceutical formulation. The formulations of the present invention comprise the compounds of formula (I) or a pharmaceutically acceptable derivative thereof together with one or more acceptable carriers or diluents therefore and optionally other therapeutic ingredients. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. Thus, in one embodiment the invention provides a
pharmaceutical composition comprising a compound of formula (I) or a
pharmaceutically acceptable derivative thereof and a pharmaceutically acceptable carrier or diluent therefore.
The formulations include those suitable for oral, parenteral (including subcutaneous e.g. by injection or by depot tablet, intradermal, intrathecal, intramuscular e.g. by depot and intravenous), rectal and topical (including dermal, buccal and sublingual) administration although the most suitable route may depend upon for example the condition and disorder of the recipient. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy (see for example methods disclosed in 'Remington - The Science and Practice of Pharmacy', 21st Edition, Lippincott, Williams & Wilkins, USA, 2005 and references therein). All methods include the step of bringing into association the compound of formula (I) or a pharmaceutically acceptable derivative thereof ("active ingredient") with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both and then, if necessary, shaping the product into the desired formulation.
Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets (e.g. chewable tablets in particular for paediatric administration) each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.
A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein. Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of a sterile liquid carrier, for example, water-for-injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
Formulations for rectal administration may be presented as a suppository with the usual carriers such as cocoa butter, hard fat or polyethylene glycol. Formulations for topical administration in the mouth, for example buccally or sublingually, include lozenges comprising the active ingredient in a flavoured basis such as sucrose and acacia or tragacanth, and pastilles comprising the active ingredient in a basis such as gelatin and glycerin or sucrose and acacia.
The compounds of formula (I) may also be formulated as depot preparations. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds of formula (I) may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. In addition to the ingredients particularly mentioned above, the formulations may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents. The compounds of formula (I) may be used in combination with other therapeutic agents, for example COX-2 inhibitors, such as celecoxib, rofecoxib, valdecoxib or parecoxib; 5-lipoxygenase inhibitors; analgesics such as paracetamol; NSAID's, such as diclofenac, indomethacin, nabumetone, naproxen or ibuprofen; leukotriene receptor antagonists; DMARD's such as methotrexate; sodium channel blockers, such as lamotrigine; N-type calcium channel antagonists; NMDA receptor modulators, such as glycine receptor antagonists; gabapentin, pregabalin and related compounds; tricyclic antidepressants such as amitriptyline; neurone stabilising antiepileptic drugs; mono-aminergic uptake inhibitors such as venlafaxine; opioid analgesics; local anaesthetics; 5HT1 agonists, such as triptans, for example sumatriptan, naratriptan, zolmitriptan, eletriptan, frovatriptan, almotriptan or rizatriptan; EP1 receptor ligands; EP2 receptor ligands; EP3 receptor ligands; EP4 receptor ligands; EP1 antagonists; EP2 antagonists; EP3 antagonists; EP4 antagonists; cannabinoid receptor agonists; VR1 antagonists. When the compounds are used in combination with other therapeutic agents, the compounds may be administered either sequentially or simultaneously by any convenient route. The invention thus provides, in a further embodiment, a combination comprising a compound of formula (I) or a pharmaceutically acceptable derivative thereof together with a further therapeutic agent or agents. The combinations referred to above may conveniently be presented for use in the form of a pharmaceutical formulation and thus pharmaceutical formulations comprising a combination as defined above together with a pharmaceutically acceptable carrier or diluent comprise a further aspect of the invention. The individual components of such combinations may be administered either sequentially or simultaneously in separate or combined pharmaceutical formulations.
When a compound of formula (I) or a pharmaceutically acceptable derivative thereof is used in combination with a second therapeutic agent active against the same disease, the dose of each compound may differ from that when the compound is used alone. Appropriate doses will be readily appreciated by those skilled in the art.
In one embodiment of the invention there is provided a method of treating a human or animal subject suffering from a condition which is mediated by the action of mPGES-1 which comprises administering to said subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable derivative thereof and another therapeutic agent.
A proposed daily dosage of compounds of formula (I) or their pharmaceutically acceptable salts for the treatment of man is from 0.001 to 30 mg/kg body weight per day and more particularly 0.1 to 3 mg/kg body weight per day, calculated as the free base, which may be administered as a single or divided dose, for example one to four times per day. The dose range for adult human beings is generally from 0.1 to 1000 mg/day, such as from 10 to 800 mg/day, preferably 10 to 200 mg/day, calculated as the free base.
The precise amount of the compounds of formula (I) administered to a host, particularly a human patient, will be the responsibility of the attendant physician. However, the dose employed will depend on a number of factors including the age and sex of the patient, the precise condition being treated and its severity, the route of administration, and any possible combination therapy that may be being undertaken. The present invention also provides a process for preparing the compounds of formula (I) and pharmaceutically acceptable derivatives thereof.
Compounds of formula (I) may be prepared using methods well known to the skilled person, using starting materials that are readily available or which can be synthesised using well established methods and techniques. For example, compounds of formula (I) may be made according to scheme 1 .
Scheme 1 illustrates two alternative processes for the preparation of compounds for formula (I), (II), (III), (VI), (IX).
Scheme 1
Figure imgf000021_0001
(V)
Alk represents an alkyl chain. PG represents a suitable protecting group.
In Step A, a compound of formula (III) is prepared by reacting a compound of formula
(V) with amine of formula (IV) at elevated temperature (for example 200 °C using microwave heating) in a suitable solvent mixture (for example 2-pentanol:acetonitrile 4:1 ). A compound of formula (III) can also be prepared in accordance with methods known in the art for example those reviewed in Charles, M. et al., Organic Letters 2005, 7, 18, 3965-3968.
Compounds of formula (IV) are commercially available or may be prepared in accordance with methods known in the art (for example ethyl 3-piperidine
carboxylate can be purchased from Sigma-Aldrich Co. Ltd.). Compounds of formula (V) are commercially available (for example 2,6- dichlorobenzothiazole can be purchased from Sigma-Aldrich Co. Ltd.) or they may be prepared in accordance with different methods known in the art. For example, a compound of formula (V) where X=S may be prepared as reviewed in Zhu,L et al., Journal of Heterocyclic Chemistry 2005, 42, 727. Alternatively, methods for the preparation of compounds of formula (V) ,where X=0, are illustrated in Chen Wen- Bin et al. Heteroatom Chemistry, 2001 , 12, 3, 151 -155.
Other methods known in the art to prepare, for example, 2,5-dichlorobenzothiazole are those disclosed in EP18080. 2,5-dichlorobenzothiazole may also be prepared by reacting 5-chloromercaptobenzothiazole (commercially available e.g. from Sigma- Aldrich Co. Ltd.) with chlorine gas at low temperature.
In Step B, a compound of formula (II) is prepared by hydrolysing a compound of formula (III). This can be carried out using any of a number of procedures known in the art. Typically, (III) can be hydrolysed by using lithium hydroxide in a suitable solvent mixture (for example tetrahydrofuran:methanol 4:1 ) at ambient or elevated temperature.
In Step C, amide (I) is prepared by reacting acid of formula (II) with amine of formula (VII) by methods such as those described for step D.
A compound of formula (I) can also be prepared in accordance with step F, in scheme 1 , by methods such as those described for scheme 1 , step A.
In Step D, amide of formula (VI) is formed from a suitable N-protected aminoacid (VIII) and an amine (VII).
Numerous methods for this amide formation are known in the art, for example those reviewed in Montalbetti et al., Tetrahedron 2005, 61, 10827-10852. Typically acid is activated using suitable reagents (e.g. EDC, HOAt) in an appropriate solvent mixture (for example 1 :1 dichloromethane:tetrahydrofuran), then reacted with amine at ambient temperature.
Compounds of formula (VIII) are commercially available (for example1 -boc- piperidine-3-carboxylic acid can be purchased from Sigma-Aldrich Co. Ltd.) or they can be prepared from the free aminoacid following any of a number of procedures known in the art. Suitable protecting groups known in the art for (VIII) include those described in Greene's Protecting Groups in Organic Synthesis (Wuts and Greene, Wiley 2007).
Compounds of formula (VII) are commercially available (for example 4-(2- aminoethyl)benzenesulfonamide can be purchased from Sigma-Aldrich Co. Ltd.).
In Step E, protecting group is removed to form compound (IX). Where PG=Boc (t- butoxycarbonyl), this step is carried out using a suitable acid (e.g. 4M HCI/1 ,4- dioxane) in an appropriate solvent such as methanol.
In scheme 1 , compound of formula (I) can either be formed using step F or step C.
/V-{2-[4-(aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-1 -[6-(ethyloxy)-1 ,3- benzothiazol-2-yl]-3-piperidinecarboxamide are available from ChemDiv, Inc.
(http://www.chemdiv.com).
According to a further aspect of the invention, there is provided a process for preparing a compound of formula (I) as hereinbefore defined which comprises:
(a) reacting a compound of formula (II):
Figure imgf000023_0001
(II)
wherein R-ι, R2, p and X are as defined hereinbefore, with a compound of formula (VII):
Figure imgf000024_0001
(VII)
wherein m is as defined hereinbefore;
(b) reacting a compound of formula (IX):
Figure imgf000024_0002
(IX)
wherein m is as defined hereinbefore, with a compound of formula (V):
Figure imgf000024_0003
wherein R-i , R2, p and X are as defined hereinbefore and L-i represents a suitable leaving group such as chlorine;
(c) deprotection of a protected derivative of a compound of formula (I);
(d) interconversion of a compound of formula (I) to a further compound of formula (I)-
Process (a) may typically be performed as defined hereinbefore for step C in Scheme 1 .
Process (b) may typically be performed as defined hereinbefore for step F in Scheme 1 .
Process (c) typically comprises any suitable deprotection reaction, the conditions of which will depend upon the nature of the protecting group. In most instances such a deprotection reaction will typically comprise the use of a suitable acid. For example, when the protecting group represents tBoc, the acid may suitably comprise trifluoroacetic acid, HCI in EtOAc, HCI in 1 ,4-dioxane or HCI in methanol.
Process (d) typically comprises interconversion procedures known by one skilled in the art.
In a further aspect, the present invention provides an assay for the identification of mPGES-1 inhibitor compounds. This assay is described in detail in Example 1 1 .
The following Descriptions and Examples illustrate the preparation of compounds of formula (I). Descriptions refer to intermediate compounds and Examples refer to compounds of formula (I). The starting material for the preparation of intermediates may not necessarily have been prepared from the batch referred to. The
intermediates for the preparation of the examples may not necessarily have been prepared from the batch referred to.
Abbreviations
Boc t-butoxycarbonyl
CDCI3 Chloroform-D
DMSO Dimethylsulfoxide
EDC /V-[3-(dimethylamino)propyl]-/V-ethylcarbodiimide
HCI Hydrochloric acid
HOAt 1 -hydroxy-7-azabenzotriazole
LCMS Liquid chromatography/Mass spectroscopy
MeOD Methanol-D4
MDAP Mass Directed Auto Purification
NMR Nuclear Magnetic Resonance
sex Strong Cation Exchange
2D Two dimensional Descriptions
Description 1 : 1 ,1 -Dimethylethyl 3-[({2-[4-
(aminosulfonyl)phenyl]ethyl}amino)carbonyl]-1 -piperidinecarboxylate
Figure imgf000026_0001
A mixture of 1 -Boc-piperidine-3-carboxylic acid (commercially available) (500mg, 2.18mmol), 4-(2-aminoethyl)benzenesulfonamide (commercially available) (524mg, 2.62mmol), pol. DCC (2g, 4.36mmol) and 1 -hydroxy-7-azabenzotriazole (59mg, 0.43mmol) in dichloromethane : tetrahydrofuran (1 :1 , v/v, 20ml) was gently stirred at room temperature overnight.
The mixture was filtered and the filtrates were evaporated to give the title compound as yellow foam (682mg, 76%). No further purification was done, it was taken as a crude to the following step.
LCMS m/z (ES): 412, 356, 312 [M+H]+ ulfonyl)phenyl]ethyl}-3-piperidinecarboxamide
Figure imgf000026_0002
1 ,1 -Dimethylethyl-3-[({2-[4-(aminosulfonyl)phenyl]ethyl}amino)carbonyl]-1 - piperidinecarboxylate (for a method of preparation see, for example, Description 1 ) (682mg, 1 .66mmol) was dissolved in 4M HCI/1 ,4-dioxane:methanol (1 :1 , v/v, 20ml) and the mixture was stirred at room temperature under argon for 2h.
The solvent was then removed in vacuo and the resulting yellowish solid was triturated several times with diethyl ether. This residue was re-dissolved in methanol and it was purified in a 5g SCX cartridge. The basic fractions were combined and evaporated to give the title compound as a yellow gum. This gum was then triturated several times with diethyl ether and it was left in the high vacuum over the weekend to give the title compound as yellowish foam (462mg, 89%).
1 H NMR (400 MHz, MeOD): δ 1 .50-1.68 (3H, m), 1 .78-1 .83 (1 H, m), 2.23-2.30 (1 H, m), 2.53 (1 H, t, J=12.0), 2.63 (1 H, t, J=1 1.4), 2.87 (4H, m), 3.45 (2H,t, J can not be calculated due to the overlapping of this signal with the solvent signal), 7.87 (2H, d, J=8.4), 7.82 (2H, d, J=8.4). LCMS m/z (ES): 312, 313 [M+H]+.
Description 3 : 2,5-Dichloro-1 ,3-benzothiazole
Figure imgf000027_0001
Chlorine gas was bubbled through a mixture of 5-chloro-2-mercaptobenzothiazole (commercially available) (4.54g, 22.5mmol) in concentrated HCI (20ml) at 0 °C for 3 hours. The reaction mixture was decanted and it was extracted with ethyl acetate (100ml). The organics were washed with water and dried with brine to give the title compound as a white solid (4.2g).
NMR (400 MHz, CDCI3): δ 7.40 (1 H, d), 7.70 (1 H, d) , -7.94 (1 H, s). -Dichloro-1 ,3-benzoxazole
Figure imgf000027_0002
2,6-Dichloro-1 ,3-benzoxazole is commercially availiable but the compound that was used in the synthesis of example 7 was prepared in-house. Analysis of the in-house material showed by LCMS that 14% was 2,6-dichloro-1 ,3-benzoxazole and 81 % was -chloro-1 ,3-benzoxazol-2(3/-/)-one (structure showed below) :
Figure imgf000027_0003
1 H NMR (400 MHz, DMSO): δ 7.09 (1 H, d, J=8.3), 7.20 (1 H, dd, J=8.3, 2.0), 7.48 (1 H, d, J=1 .9), 1 1 .81 (1 H, broad s).
LCMS m/z (ES): 168 [M+H]" 81 % of 6-chloro-1 ,3-benzoxazol-2(3H)-one
m/z (ES): 186 [M+H]" 14% of 2,6-dichloro-1 ,3-benzoxazole.
Description 5 : Ethyl 1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxylate
Figure imgf000027_0004
A mixture of 2-chloro-5,6-dimethyl-1 ,3-benzothiazole (commercially available) (500mg, 2.50mmol) and ethyl 3-piperidinecarboxylate (commercially available) (582μΙ, 3.70mmol) in 2-pentanol:acetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance. The solvent of the mixture was then removed in vacuo. The resulting residue was dissolved in methanol and it was purified on a 5g SCX cartridge. The basic fractions were combined and the solvent was removed in vacuo to give the title compound as crude (760 mg, 95%). LCMS m/z (ES): 321 , 322 [M+H]+. Description 6 : 1 -(4,6-Dimethyl-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylic acid
Figure imgf000028_0001
A mixture of ethyl 1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylate (for a method of preparation see, for example Description 5) (760mg, 2.37mmol) and lithium hydroxide (1 14mg, 4.74mmol) in tetrahydrofuran:methanol (4:1 , v/v, 25ml) was heated at 68 °C for 1 h. Then lithium hydroxide (-50 mg) was added and the mixture was refluxed overnight. The mixture was allowed to cool at room
temperature and it was neutralised with 2N HCI. The solvent was removed in vacuo. The resulting residue was re-dissolved in DMSO and a solid precipitated which was collected by filtration and it was washed several times with water to give the title compound as a white solid which was left in the vacuum oven for 3h (150mg).
1 H NMR (400 MHz, DMSO): δ 1 .35-1 .49 (2H, m), 1 .69-1 .72 (1 H, m), 1 .97-1.99 (2H, m), 2.28 (3H, s), 2.40 (3H, s), 2.95-3.04 (2H, m), 3.96-3.99 (2H, m), 6.88 (1 H, s), 7.32 (1 H, s).
LCMS m/z (ES): 291 , 292 [M+H]+.
The filtrates were evaporated and the resulting residue was purified in the SP4 reverse phase. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as a white solid which was left in the vacuum oven for 4 hours. (160 mg) (total yield= 45%). 1 H NMR (400 MHz, DMSO): δ 1 .55-1 .70 (2H, m), 1 .76 (1 H, m), 1 .99 (1 H, m), 2.29 (3H,s), 2.41 (3H, s), -2.50 (assumed 1 H underneath the solvent signal), 3.21 -3.30 (2H, m), 3.77 (1 H, d, J=12.8), 4.06 (1 H, d, J=12.8), 6.92 (1 H, s), 7.36 (1 H, s).
LCMS m/z (ES): 291 , 292 [M+H]+.
Example 1 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(5,7-dimethyl-1 ,3- carboxamide (E1 )
Figure imgf000029_0001
A mixture of 2-chloro-5,7-dimethyl-1 ,3-benzothiazole (commercially available) (25mg, 0.13mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (for a method of preparation see, for example, Description 2) (40mg, 0.13mmol) in 2- pentanohacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance.
The solvent of the mixture was then removed in vacuo and the resulting residue was purified using MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as a white solid (10mg, 16%). 1 H NMR (400 MHz, DMSO): δ 1 .48-1 .67 (2H, m), 1 .76 (1 H, d, J=12.8), 1.84 (1 H, d, J=13.2), 2.31 (3H, s), 2.35 (3H, s), 2.37-2.43 (1 H, m), 2.80 (2H, t, J=7.0), 3.09-3.20 (2H, m), 3.34 (2H, m), 3.93 (1 H, d, J=13.6), 4.05 (1 H,d, J= 16.4), 6.73 (1 H, s), 7.12 (1 H, s), 7.29 (2H, s), 7.40 (2H, d, J= 8.0), 7.76 (2H, d, J=8.4), 8.07 (1 H, t, J=5.4) LCMS m/z (ES): 473, 474 [M+H]+.
Example 2 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzothiazol- 2-yl)-3-piperidinecarboxamide (E2)
Figure imgf000030_0001
A mixture of 2,6-dichloro-1 ,3-benzothiazole (commercially available) (26mg, 0.13mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (for a method of preparation see, for example, Description 2) (59mg, 0.19mmol) in 2- pentanohacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance.
The solvent of the mixture was then removed in vacuo and the resulting residue was purified using MDAP. - A solid precipitated in one of the MDAP fractions which contained product and it was collected by filtration to give the title compound as a white solid (13mg, 21 %). 1 H NMR (400 MHz, DMSO): δ 1 .45-1 .54 (1 H,m), 1.63 (1 H, q, J=12.0), 1 .77 (1 H, d, J=9.8), 1.84 (1 H, d, J=10.8), 2.40 (1 H,m), 2.80 (2H, t, J=7.0), 3.13-3.19 (2H, m), -3.30 (assumed 2H underneath the solvent signal, seen in 2D-NMR), 3.90 (1 H, d, 13.2), 3.99 (1 H, d, J=10.8), 7.27-7.30 (3H, m), 7.39-7.43 (3H, m), 7.76 (2H, d, 8.4), 7.89 (1 H, d, J=2.4), 8.07 (1 H, t, 5.4).
LCMS m/z (ES): 479 [M+H]+.
- The rest of the fractions containing product were poured onto a 2g SCX cartridge. All the basic fractions were combined and the solvent was removed in vacuo to give the title compound as a white solid (8.5 mg, 14%).
1 H NMR (400 MHz, DMSO): δ 1 .48-1 .64 (2H, m), 1 .74-1 .87 (2H, m), 2.40 (1 H, m), 2.80 (2H, t, J=7.0), -3.15 (assumed 2H underneath solvent signal), -3.30 (assumed 2H underneath solvent signal), 3.87-4.01 (2H, m), 7.27-7.30 (3H, m), 7.39-7.43 (3H, m), 7.76 (2H, d, J=8.4), 7.89 (1 H, d, J=2.4), 8.07 (1 H, t, J=4.0)
LCMS m/z (ES): 479 [M+H]+.
Example 2a: (3S)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxamide (E2a)
Step 1 : Ethyl (3S)-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylate A mixture of ethyl (3S)-3-piperidinecarboxylate (0.582 g, 3.7 mmol) and 2,6-dichloro- 1 ,3- benzothiazole (0.510 g, 2.5 mmol) in acetonitrile (0.4 ml),2-pentanol (1.600 ml) was microwaved at 200°C during 10 min on high absorbance. The solvent of the mixture was then removed in vacuo. The resulting residue was dissolved in methanol and it was purified on a 5g SCX cartridge.The solvent was removed in vacuo to give the title compound but only 65% pure. Therefore the crude was purified again by normal phase using a mixture 1 :1 of ethyl acetate: Isohexane and then checked by LCMS and NMR. 0.496g; 61.1 %.
LCMS: ES+ M+ 324.8
Step 2: (3S)-1 -(6-Chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylic acid
A solution of LiOH (0.073 g, 3.05 mmol) in water (3.60 ml) was added to a solution of ethyl (3S)-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylate in
tetrahydrofuran (THF) (3.6 ml) and the mixture stirred at rt for 18 hrs. LCMS indicated reaction complete. HCI (3.82 ml, 7.63 mmol) was added to the reaction mixture, then the free acid was extracted using DCM to give the title product, 440mg; yield=97% LCMS: ES+ MH+ 296.8
Step 3: (3S)-N-{2-r4-(Aminosulfonyl)phenyllethyl)-1 -(6-chloro-1 ,3-benzothiazol-2-vD- 3-piperidinecarboxamide
DIPEA (0.213 ml, 1 .222 mmol) was added to a mixture of (3S)-1 -(6-chloro-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxylic acid (0.076 g, 0.255 mmol), 4-(2- aminoethyl)benzenesulfonamide (0.051 g, 0.255 mmol), HATU (0.1 16 g, 0.306 mmol) and aza-HOBt (0.021 g, 0.153 mmol) in Ν,Ν-Dimethylformamide (DMF) (2.25 ml). The reaction was stirred at room temperature overnight. LCMS showed a good conversion to the desired product. The DMF was evaporated and the crude was purified via MDAP. using a TFA method. The product was purified again by MDAP High PH to have the free base of the desired product. 55mg, 45%. . LCMS m/z (ES): 479 [M+H]+. 1 H NMR (400 MHz, DMSO): δ 1.47-1 .56 (2H, m), 1 .70-1.85 (2H, m), 2.39 (1 H, m), 2.80 (2H, t, J=6.8), 3.1 1 -3.22 (2H, m), -3.33 (assumed 2H underneath solvent signal), 3.85-4.05 (2H, m), 7.25 (2H, m), 7.40 (2H, m), 7.57 (1 H, m), 7.75 (2H, d, J=8.4), 7.90 (1 H, s) 8.08 (1 H, m).
Example 2b: (3R)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxamide (E2b)
Step 1 : Ethyl (3R)-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylate
A mixture of ethyl (3R)-3-piperidinecarboxylate (0.582 g, 3.70 mmol) and 2,6- dichloro-1 ,3-benzothiazole (0.510 g, 2.5 mmol) in acetonitrile (0.4 ml),2-pentanol (1 .600 ml) was microwaved at 150°C during 30 min on high absorbance. The solvent of the mixture was then removed in vacuo. The crude was purified again by normal phase using a mixture 1 :1 of ethyl acetate: Isohexane and then checked by LCMS and NMR. 497mg; 61 %.
LCMS: ES+ MH+ 324.8
Step 2: (3R)-1 -(6-Chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylic acid
A solution of LiOH (0.073 g, 3.06 mmol) in water (3.60 ml) was added to a solution of ethyl (3R)-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylate (0.497 g, 1 .530 mmol) in tetrahydrofuran (THF) (3.6 ml) and the mixture stirred at rt for 18 hrs. LCMS indicated reaction complete. HCI (in Et20) (3.83 ml, 7.65 mmol) was added to the reaction mixture,
then the free acid was extracted using DCM to give the title product.
0.366g, 81 %
LCMS: ES+ MH+ 296.8
Step 3: (3R)-N-{2-r4-(Aminosulfonyl)phenyllethyl)-1 -(6-chloro-1 ,3-benzothiazol-2-vD- 3-piperidinecarboxamide
DIPEA (0.252 ml, 1.440 mmol) was added to a mixture of (3R)-1 -(6-chloro-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxylic acid (0.107 g, 0.360 mmol), 4-(2- aminoethyl)benzenesulfonamide (0.060 g, 0.3 mmol), HATU (0.1 14 g, 0.300 mmol) and aza-HOBt (0.025 g, 0.180 mmol) in Ν,Ν-dimethylformamide (DMF) (2.5 ml). The reaction was stirred at room temperature overnight. LCMS showed a good conversion to the desired product. The DMF was evaporated and the crude was purified via MDAP High PH to have the free base of the desired product.
m=60mg;n=0.125mmol;yield=42% LCMS m/z (ES): 479 [M+H]+. 1 H NMR (400 MHz, DMSO): δ 1 .47-1 .56 (2H, m), 1 .70-1 .85 (2H, m), 2.39 (1 H, m), 2.80 (2H, t, J=6.8), 3.1 1 -3.22 (2H, m), -3.33 (assumed 2H underneath solvent signal), 3.85-4.05 (2H, m), 7.25 (2H, m), 7.40 (2H, m), 7.57 (1 H, m), 7.75 (2H, d, J=8.4), 7.90 (1 H, s) 8.08 (1 H, m).
Example 3 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(5-chloro-1 ,3-benzothiazol- 2-yl)-3-piperidinecarboxamide (E3)
Figure imgf000033_0001
A mixture of 2,5-dichloro-1 ,3-benzothiazole (for a method of preparation, see for example, Description 3) (25mg, 0.12mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}- 3-piperidinecarboxamide (intermediate 1 a) (57mg, 0.18mmol) in 2- pentanohacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance. Then one equivalent more of Λ/-{2-[4- (aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (25mg, 0.12mmol)
(intermediate 1 a) was added and the mixture was heated again in the microwave at 200°C for 10 minutes on high absorbance.
The solvent of the mixture was then removed in vacuo and the resulting residue was purified using MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as white solid which was left in the vacuum oven overnight (24mg, 42%).
1 H NMR (400 MHz, DMSO): δ 1 .48-1 .68 (2H, m), 1 .75-1.86 (2H, m), 2.38 (1 H, m ), 2.80 (2H, t, J=7.0), 3.15-3.23 (2H, m), -3.30 (2H assumed underneath the solvent signal), 3.91 (1 H, d, J=12.8), 3.99 (1 H, d, J=1 1 .6), 7.08 (1 H, dd, J=8.4, 2), 7.30 (2H, s), 7.40 (2H, d, J=8.0), 7.47 (1 H, d, J=2.0), 7.75-7.78 (3H, m), 8.07 (1 H, t, J=5.6). LCMS m/z (ES): 479 [M+H]+. Example 4 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-methyl-1 ,3-benzothiazol- 2-yl)-3-piperidinecarboxamide (E4)
Figure imgf000033_0002
A mixture of 2-chloro-6-methyl-1 ,3-benzothiazole (commercially available) (25mg, 0.14mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (for a method of preparation see, for example, Description 2) (43mg, 0.14mmol) in 2- pentanohacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance. The solvent of the mixture was then removed in vacuo and the resulting residue was purified using the MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as a white solid which was left in the vacuum oven for 2h (9mg, 9%).
1 H NMR (400 MHz, DMSO): δ 1 .48-1 .66 (2H, m), 1 .76 (1 H, d, J=12.8), 1.84 (1 H, d, J=12.8), 2.33 (3H, s), 2.40 (1 H, m), 2.80 (2H, t, J=7.0), 3.08-3.17 (2H, m), -3.30 (assumed 2H underneath the solvent signal, seen in 2D NMR), 3.87-4.01 (2H, m), 7.07 (1 H, d, J=8.0), 7.17 (2H, br), 7.33 (1 H, d, J=8.4), 7.40 (2H, d, J=8.0), 7.55 (1 H, s), 7.76 (2H, d, J=8.4), 8.09 (1 H, t, J=5.8).
LCMS m/z (ES): 459, 460 [M+H]+.
Example 5 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -[6-(methyloxy)-1 ,3- ridinecarboxamide (E5)
Figure imgf000034_0001
A mixture of 2-chloro-6-methoxy-1 ,3-benzothiazole (commercially available) (25mg, 0.12mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (for a method of preparation see, for example, Description 2) (59mg, 0.19mmol) in 2- pentanohacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance. The solvent of the mixture was then removed in vacuo and the resulting residue was purified using MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound (20mg, 35%).
1 H NMR (400 MHz, DMSO): δ 1 .48-1 .66 (2H, m), 1 .75 (1 H, d, J=12.4), 1.83 (1 H, d, J=1 1 .2), 2.38 (1 H, m), 2.80 (2H, t, J=7.0), 3.06-3.15 (2H, m), -3.30 (assumed 2H underneath the solvent signal, seen in 2D NMR), 3.75 (3H, s), 3.86 (1 H, d, J=12.4), 3.96 (1 H, d, J=12.8), 6.87 (1 H, dd, J=8.8, 2.4), 7.30 (2H, s), 7.35-7.41 (4H, m), 7.76 (2H, d, J=8.4), 8.06 (1 H, t, J=5.4).
LCMS m/z (ES): 475, 476 [M+H]+. Example 6 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4-methyl-1 ,3-benzothiazol- -yl)-3-piperidinecarboxamide (E6)
Figure imgf000035_0001
A mixture of 2-chloro-4-methyl-1 ,3-benzothiazole (commercially available) (25mg, 0.14mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (for a method of preparation see, for example, Description 2) (62mg, 0.20mmol) in 2- pentanohacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance. The solvent of the mixture was then removed in vacuo and the resulting residue was purified using MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as a white solid which was left in the vacuum oven over the weekend (30mg, 47%).
1 H NMR (400 MHz, DMSO): δ 1 .49-1 .66 (2H, m), 1 .77 (1 H, d, J=13.2), 1.85 (1 H, d, J=12.4), 2.37-2.44 (1 H, m), 2.46 (3H, s), 2.80 (2H, t, J=7.0), 3.09-3.19 (2H, m), -3.30 (assumed 2H underneath solvent signal, seen in 2D NMR), 3.94 (1 H, d,
J=12.0), 4.03 (1 H, d, J=10.4), 6.96 (1 H, t, J=7.8), 7.10 (1 H, d, J=7.2), 7.30 (2H, br), 7.40 (2H, d, J=8.4), 7.56 (1 H, d, J=8.0), 7.76 (2H, J=8.0), 8.08 (1 H, t, J=5.6).
LCMS m/z (ES): 459, 460 [M+H]+. Example 7 : yV-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzoxazol-2- -3-piperidinecarboxamide formate (E7)
Figure imgf000035_0002
A mixture of 2,6-dichloro-1 ,3-benzoxazole (for a method of preparation see, for example, Description 4) (53mg, 0.28mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}- 3-piperidinecarboxamide (for a method of preparation see, for example, Description 2 B) (60mg, 0.19mmol) in 2-pentanol:acetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C a total of 45 minutes on normal absorbance.
The solvent of the mixture was then removed in vacuo and the resulting residue was purified using MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as a brown-beige solid (2mg, 2%). 1 H NMR (400 MHz, DMSO): δ 1 .47-1 .63 (2H, m), 1 .74-1 .85 (2H, m), 2.39 (1 H, m), 2.80 (2H, t, J=6.8), 3.09-3.20 (2H, m), -3.33 (assumed 2H underneath solvent signal), 4.04-4.07 (2H, m), 7.19 (1 H, m), 7.26 (1 H, m), 7.30 (2H, s), 7.39 (2H, d, J=8.0), 7.57 (1 H, m), 7.75 (2H, d, J=8.4), 8.08 (1 H, m).
LCMS m/z (ES): 463 [M+H]+.
Example 8 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-nitro-1 ,3-benzothiazol-2- - -piperidinecarboxamide (E8)
Figure imgf000036_0001
A mixture of 2-chloro-6-nitro-1 ,3-benzothiazole (commercially available) (23mg,
0.1 1 mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (for a method of preparation see, for example, Description 2) (51 mg, 0.16mmol) in 2- pentanohacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance. The solvent of the mixture was then removed in vacuo. The resulting residue was re-dissolved in a mixture 1 :1 acetonitrile:DMSO and a solid precipitated which was collected by filtration to give the title compound as a yellow solid which was left in the vacuum oven for 5h. (18 mg, 33%).
1 H NMR (400 MHz, DMSO): δ 1 .51 -1 .56 (1 H, m), 1 .62-1 .71 (1 H, m), 1 .79-1.88 (2H, m), 2.43 (1 H, m), 2.81 (2H, t, J=7.0), -3.25 (assumed 2H underneath the solvent signal, seen in 2D NMR), -3.35 (assumed 2H underneath the solvent signal, seen in 2D NMR), 3.99-4.09 (2H, m), 7.31 (2H, s), 7.40 (2H, d, J=8.4), 7.52 (1 H, d, J=8.8), 7.76 (2H, d, J=8.0), 8.09 (1 H, t, J=5.4), 8.14 (1 H, dd, J=9.2, 2.4), 8.80 (1 H, d, J=2.4). LCMS m/z (ES): 490, 491 [M+H]+. Example 9 : N-{[4-(Aminosulfonyl)phenyl]methyl}-1 -(4,6-dimethyl-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxamide (E9)
Figure imgf000037_0001
A mixture of 1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxylic acid (for a method of preparation see, for example, Description 5) (25mg, 0.09mmol), 4- (aminomethyl)benzenesulfonamide hydrochloride (commercially available) (23mg, O.I Ommol), ), EDC hydrochloride (35mg, 0.18mmol) and 1 -hydroxy-7- azabenzotriazole (2mg, 0.018mmol) in dichloromethane : tetrahydrofuran (1 :1 , v/v, 6ml) was stirred at room temperature under argon for 3h. Then 15 mg of 4- (aminomethyl)benzenesulfonamide hydrochloride were added and the mixture was left under the same conditions overnight. The solvent was then removed in vacuo and the resulting residue was purified by MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as a white solid which was left in the high-vacuum overnight (6mg, 15%).
1 H NMR (400 MHz, DMSO): δ 1 .53-1 .72 (2H,m), 1.80 (1 H, d, J=12.8), 1 .97 (1 H, d, J=10.0), 2.29 (3H,s), 2.41 (3H,s), 3.10-3.27 (3H, m), 3.92 (1 H, d, J=1 1 .6), 4.09 (1 H, d, J=1 1 .2), 4.29-4.42 (2H, m), 6.92 (1 H, s), 7.31 (2H, s), 7.36 (1 H, s), 7.43 (2H, d, J=8.4), 7.77 (2H, d, J=8.0), 8.60 (1 H, t, J=6.0).
LCMS m/z (ES): 459, 460 [M+H]+.
Example 10 : N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4-chloro-1 ,3-benzothiazol- -yl)-3-piperidinecarboxamide (E10)
Figure imgf000037_0002
A mixture of 2,4-dichloro-1 ,3-benzothiazole (commercially available) (26mg,
0.13mmol) and /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-3-piperidinecarboxamide (for a method of preparation see, for example, Description 2) (59mg, 0.19mmol) in 2- pentanokacetonitrile (4:1 v/v, 2ml) was heated in the microwave at 200°C for 10 minutes on high absorbance.
The solvent of the mixture was then removed in vacuo and the resulting residue was purified using MDAP. Fractions containing product were combined and the solvent was removed in vacuo to give the title compound as a white solid which was left in the vacuum oven for 3h (28mg, 45%).
1 H NMR (400 MHz, DMSO): δ ~1.48-1 .68 (2H, m), 1 .75-1 .90 (2H, m), 2.40 (1 H, m), 2.81 (2H, 7.0), 3.16-3.19 (2H, m), -3.32 (assumed 2H underneath the solvent signal, seen in 2D NMR), ~3.90-4.09 (2H, m), 7.04 (1 H, t, J=7.8), 7.30 (2H, s), 7.34 (1 H, dd, J=7.8, 1 .0), 7.40 (2H, d, J=8.4), 7.71 -7.77 (3H, m), 8.10 (1 H, t).
LCMS m/z (ES): 479 [M+H]+.
Example 11 : W-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3- benzothiazol-2-yl)-3-piperidinecarboxamide (E11)The compound of E1 1 is commercially available and may be obtained from commercial sources (e.g.
ChemDiv, Inc.).
Examples 11a and 11 b: (3S)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4,6- dimethyl-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxamide (E11 a); and
(3R)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2- yl)-3-piperidinecarboxamide (E11 b)
The racemic compound of E1 1 was separated by chiral preparative chromatography using Chiralcel OJ (20mm x 250mm, Ι Ομηη); mobile phase of Heptane : absolute Ethanol 50:50 v/v pump-mixed at a flow rate of 17.0mls/min and detected at U.V. Absorbance of 215nm to afford a fast running isomer (enantiomer 1 ) 36mg. LCMS m/z (ES): 473 [M+H]+. 96.2% ee.
And slow running isomer (enantiomer 2) 36mg. LCMS m/z (ES): 473 [M+H]+. 96.2% ee Example 12: yV-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -[6-(ethyloxy)-1 ,3- benzothiazol-2-yl]-3-piperidinecarboxamide (E12)
The compound of E12 is commercially available and may be obtained from commercial sources (e.g. ChemDiv, Inc.). Biological activity
The mPGES-1 assay has been configured as a coupled product detection//'/! situ substrate generation format where COX2 is utilized to generate prostaglandin H2 (PGH2), the mPGES-1 substrate. This is due to the instability of the PGH2, which spontaneously converts to prostaglandin E2 (PGE2).
To enable a sensitive detection of mPGES-1 activity in the coupled assay the following considerations were taken into account:
• mPGES-1 step must be rate limiting
• 15-PGDH must not turnover PGH2
• COX2 step should generate a burst of PGH2 at -Km (-10 μΜ)
• PGH2 converts spontaneously to PGE2 (t1/2 - 10min at 20C)
This coupled assay is particularly suited to use in a high throughout screen, unlike mPGES-1 assays documented in previous applications (for example
WO2005/005415 and WO2006/063466) as these require multiple addition steps and give non-homogeneous results due to the instability of PGH2.
Figure imgf000039_0001
Resorufin ' Diaphorase Resazurin
Where AA = arachidonic acid The assay was monitored via the conversion of resazurin (blue) to resorufin (pink) which fluoresces at Aem 582nm. A reduction in fluorescence indicates inhibition within the mPGES-1 coupled assay, which could be attributed to any of the 4 enzymes present. To de-convolute the inhibitory activity observed in the mPGES-1 coupled assay, 2 secondary assays (A and B) were configured for COX2 and 15-PGDH.
Figure imgf000040_0001
Diacetyldichlorofluorescin Dichlorofluorescin
A. Schematic visualization of the COX2 secondary assay
^^r- 15-PGDH , ,
PGE2 ► 15-keto PGE2
NA (\ NADH
Figure imgf000040_0002
Resorufin Diaphorase Resazurin
B. Schematic visualisation of the 15-PGDH secondary assay
Compounds were determined to be mPGES-1 inhibitors where a profile was observed of activity in the mPGES-1 coupled assay and no activity in the COX2 or 15-PGDH secondary assays. Activity was defined by the dose concentration limit of the test compound (typically 100 μΜ), i.e. the minimum plC50 which could be determined was 4 (IC50 = 100 μΜ).
Protein production:
Human microsomal prostaglandin E synthase-1 (mPGES-1 ) coding region was PCR amplified with an optimised Kozak sequence from human bladder cDNA and then cloned into pcDNA3.1/v5/HisTOPO (Invitrogen) in the correct orientation for expression using the following oligonucleotide primers:
Forward: 5' CACCATGCCTGCCCACAGCCTGG 3' (SEQ ID NO: 1 )
Reverse: 5' AG GAG G CATCAG CTG CTG GTC 3' (SEQ ID NO: 2)
The insert matches the published mPGES cDNA sequence (AF027740) except for a single silent base change t(183)c, a SNP present in both forms among mPGES ESTs (Unigene Hs.146688). A further round of PCR was carried out to add unique BamHI and Xhol endonuclease restriction sites to enable efficient cloning into pFASTBac HTB to give an N-term his tag fusion which was expressed in the baculovirus/Sf9 insect cell system for which the following oligonucleotide primers were used:
Forward: 5' GGATCCATGCCTGCCCACAGCCTGGTGATGAGCAG 3' (SEQ ID NO: 3)
Reverse: 5' CTCGAGTCACAGGTGGCGGGCCGCTTCCCAGAGGA 3' (SEQ ID NO: 4)
1 ml of Sf9 cells at 1 .8xe7 cells/ml were recovered from cryostorage into 10ml of Excell 420 serum free media (SAFC Biosciences) in an Erlenmyer flask (Corning). The culture was counted by the image analysis cell counter Vicell XR (Beckman Coulter) and then diluted to a cell concentration of 5xe5 cells/ml. The cells were cultured in suspension on a shaker at 27 degrees Celsius, 90 RPM. The cells were kept in logarithmic growth phase (4xe5 - 8xe6 cells/ml) until a sufficient cell number was present to inoculate a Continuously Stirred Reactor (CSR) at 4xe5 cells/ml. Cells were cultured in the CSR at 27 degrees Celsius and at a dissolved oxygen concentration of 30%. Medium was added to accordingly to keep the cells in logarithmic growth phase until the final desired volume was achieved with a cell concentration of 3.5-4xe6 cells/ml. The cultivation was then infected with HmPGE-1 baculovirus at a viral multiplicity of infection of 3. The infected cells were cultured for a further 48 hours. The cells were then harvested by a Carr Viafuge (Carr) continuous centrifugation at 2500g with a flow rate of 80 litres/hour. The
concentrated suspension from the continuous centrifuge was then centrifuged at 2500g for 30 minutes to pellet the cells. These were then frozen at -80 degrees Celsius. Frozen Sf9 cells were defrosted and re-suspended in 15mM Tris-HCI, 0.25M sucrose, 0.1 mM EDTA, 1 mM GSH, pH 8.0. The mixture was sonicated at 40% amplitude using a ½ inch probe for 5 minutes of 9.9sec on/off cycles packed in melting ice. The homogenate was transferred to balanced centrifuge tubes and spun at 4C for 10min at 5000g. The supernatant was retained and re-centrifuged at 100,000g in balanced tubes at 4C for 60min. The pellets were retained and were re- suspended in 80ml 10mM potassium phosphate, 10%glycerol, 0.1 mM EDTA, 1 mM GSH, 1.5% n-octyl glucopyranoside, pH7. The tubes were mixed for 1 hour at 4C. The mixture was centrifuged at 100,000g for 60min. in balanced tubes. The supernatant was retained and assayed for protein. Protein was supplied as a solution 10mg/ml. To determine an appropriate concentration for screening, the protein was titrated into the assay to give a total protein concentration generating 2.5 mins linearity of production of fluorescent signal. Recombinant human COX-2 was expressed with a C-terminal FLAG tag (COX-2- FLAG) in the baculovirus/Sf9 insect cell system. A full-length COX-2 cDNA clone was amplified by PCR using the following primers;
5'-ATGAATTCACCATGCTCGCCCGCGCCCTGCTGCTGT-3' (SEQ ID NO: 5) 5 -
ATAAGCTTCTACTTGTCATCGTCATCCTTATAGTCACCCAGTTCAGTCGAACGTT CTTTTAGTAGTACTGTGG-3' (SEQ ID NO: 6)
which introduced, respectively, a 5' EcoR1 cloning site and a 3' Hind 111 cloning site and FLAG tag sequence. The resultant PCR product was cloned into the multiple cloning site of pFastBad as an EcoRI - Hindi 11 fragment. Recombinant baculovirus was generated according to the manufacturer's instructions. Super Sf9 cells were grown at 28°C to a density of 1 .0 - 1.5 x 106 cells per ml in 100 litre wavebags using EX420 medium. Cells were infected with recombinant COX-2-FLAG baculovirus at a multiplicity of infection of 5 and harvested by centrifugation 72 hours post-infection and the cell pellet stored at -80°C until required. All purification procedures were performed at + 4°C. Cells were thawed on ice and resuspended in 5 volumes of buffer A (50 mM Tris pH7.5, 150mM NaCI, 5 mM EDTA, 1 .3 % (w/v) octylglucoside) and cell lysis/protein solubilisation achieved by sonication followed by stirring on ice for 2 hours. Particulate material was removed by ultracentrifugation at 100 OOOg for 90 min at 4°C. The supernatant was made to 1 % (w/v) with respect to octylglucoside by the addition of buffer B (20m M Tris pH 7.4, 150mM NaCI, 0.1 mM EDTA). The supernatant was then incubated overnight on a roller with anti-FLAG M2 agarose that had been equilibrated with buffer C (20mM Tris pH 7.4, 150mM NaCI, 0.1 mM EDTA, 1 % (w/v) octylglucoside. The beads were packed into a column and washed with 10 column volumes of buffer C. Bound proteins were eluted with Buffer C containing 0.1 mg/ml of triple FLAG peptide. Protein was supplied as a solution 2mg/ml.
Human 15-hydroxyprostaglandin dehydrogenase (15-PGDH) was PCR amplified and cloned into pGEX6PI to give a N-terminal GST fusion which was expressed in E.coli with the oligonucleotide primers:
Forward: 5' GGATCCATGTCCCCTATACTAGGTTATTGGAAAATTAAG 3' (SEQ ID NO: 7)
Reverse: 5' CTCG AGTCATTG GGTTTTTG CTTG AAATG G AG 3' (SEQ ID NO: 8) A frozen E.coli cell pellet (380gs) from a 20L 15-PGDH expression culture was thawed an resuspended in PBS , 1 mM EDTA , 5mM DTT ,10% Glycerol , 1 mg/ml lysozyme , 1 ul/ml BLAP , pH7.4 and left to stir at 4°C . This suspension was sonicated on ice for 15 minutes (10secs on, 10secs off cycles) and then clarified by ultracentrifugation (30,000 rpm for 60 minutes). The resulting Lysate SN was harvested and contacted with a 200ml Glutathione Sepharose FF column using an AKTA purifier 100 at a flow rate of 1 ml/min. The column was washed back to base line with PBS, 1 mM EDTA, 5mM DTT, 10% Glycerol, pH7.4 and then eluted
Isocratically with 50mM Tris, 1 mM EDTA, 5mM DTT 10% Glycerol, 20mM (Reduced) Glutathione, pH8.0 collecting 10ml fractions. These fractions were analysed by SDS PAGE, LC/MS and MALDI-TOF. Protein was supplied as a solution 0.8mg/ml
Assays:
The activity of the solubilised mPGES-1 was assessed using a fluorescence intensity assay. COX-2 (0.55 μΜ final), 15-PGDH (70 nM final), mPGES-1 (50 pg/ml total protein final), NAD+ (1 mM final), reduced glutathione (100 μΜ final), Diaphorase (1 U/ml final, Sigma #D5540) and Resazurin (10 μΜ final) in assay buffer (50mM Tris-CI pH 7.5, 1 mM EDTA, 0.1 % pluronic F-127) were added (5 μΙ) to wells containing 10Onl of typically 100uM - 1 .7nM of test compound or DMSO vehicle (1 % final) in Greiner 384 well low volume black plate. The reaction was initiated by the addition of 2.5 μΙ hemin in 50mM Tris-CI pH 7.5, 1 mM EDTA (1 μΜ final) followed by 2.5 μΙ arachidonic acid in 1 mM NaOH (20 μΜ final) to give a total volume of 10 μΙ. The plate was immediately transferred to a Viewlux (Perkin-Elmer Life Sciences, Pangbourne, UK) and the fluorescence intensity was measured kinetically at 15 second intervals for 2.5 minutes at excitation 525 nm and emission 598 nm. Data analysis was carried out via determination of the rate of fluorescence increase. The assay was also formatted to run in a Greiner 1536 black plate using concentrations of reagents as stated above and volume additions at 50% of those stated above.
The activity of the solubilised COX-2 was assessed using a fluorescence intensity assay. COX-2 (5 nM final) in assay buffer (50mM Tris-CI pH 7.5, 1 mM EDTA, 0.1 % pluronic F-127) was added (5 μΙ) to wells containing 10Onl of typically 100uM - 1.7nM of test compound or DMSO vehicle (1 % final) in Greiner 384 well low volume black plate. The reaction was initiated by the addition of 4 μΙ hemin in 50mM Tris-CI pH 7.5, 1 mM EDTA (250 nM final) followed by 2 μΙ arachidonic acid (2.5 μΜ final),
Diacetyldichlorofluorescin (DCF, Sigma #D6883, 5 μΜ final) in 1 mM NaOH to give a total volume of 10 μΙ. The plate was immediately transferred to a Viewlux (Perkin- Elmer Life Sciences, Pangbourne, UK) and the fluorescence intensity was measured kinetically at 15 second intervals for 2.5 minutes at excitation 480 nm and emission 540 nm. Data analysis was carried out via determination of the rate of fluorescence increase. The assay was also formatted to run in a Greiner 1536 black plate using concentrations of reagents as stated above and volume additions at 50% of those stated above.
The activity of the 15-PGDH was assessed using a fluorescence intensity assay. 15- PGDH (7 nM final), NAD+ (1 mM final), Diaphorase (1 U/ml final, Sigma #D5540) and Resazurin (10 μΜ final) in assay buffer (50mM Tris-CI pH 7.5, 1 mM EDTA, 0.1 % pluronic F-127) were added (5 μΙ) to wells containing 10Onl of typically 100uM - 1 .7nM of test compound or DMSO vehicle (1 % final) in Greiner 384 well low volume black plate. The reaction was initiated by the addition of 5 μΙ Prostaglandin E2 in 1 mM NaOH (10 μΜ final) to give a total volume of 10 μΙ. The plate was immediately transferred to a Viewlux (Perkin-Elmer Life Sciences, Pangbourne, UK) and the fluorescence intensity was measured kinetically at 15 second intervals for 5 minutes at excitation 525 nm and emission 598 nm. Data analysis was carried out via determination of the rate of fluorescence increase. The assay was also formatted to run in a Greiner 1536 black plate using concentrations of reagents as stated above and volume additions at 50% of those stated above.
Compounds of the invention were also tested in mPGES-1 assays derived from Ouellet, Protein Expression and Purification 26 (2002) 489-495, and Thoren, Eur. J. Biochem Parmacol. 2002, 63, 1 183.
Compounds of the invention (namely Examples 1 -2, 2a, 2b, 3-10, 1 1 , 1 1 a, 1 1 b and 12 have specific activity at human mPGES with an average plC50 value of 5.6 or higher.

Claims

1 . A compound of formula (I) or a pharmaceutically acceptable salt thereof:
Figure imgf000045_0001
(I) wherein:
Ri represents Ci-4 alkyl, halo, Ci-4 haloalkyl, Ci-4 alkoxy, Ci-4 haloalkoxy, or nitro,; R2 represents Ci-4 alkyl, halo, Ci-4 haloalkyl, Ci-4 alkoxy, Ci-4 haloalkoxy, or nitro; X represents O or S;
m represents 1 or 2; and
p represents 0 or 1 ;
with the proviso that the compound is not /V-{2-[4-(aminosulfonyl)phenyl]ethyl}-1 -(4,6- dimethyl-1 ,3-benzothiazol-2-yl)-3-piperidinecarboxamide or
/V-{2-[4-(aminosulfonyl)phenyl]ethyl}-1 -[6-(ethyloxy)-1 ,3-benzothiazol-2-yl]-3- piperidinecarboxamide.
2. A compound as defined in claim 1 , wherein p represents 0 and Ri represents Ci-4 alkyl, halo, Ci-4 alkoxy or nitro.
3. A compound as defined in claim 2, wherein p represents 0 and Ri represents methyl, chlorine, methoxy, ethoxy or nitro.
4. A compound as defined in any of claims 1 to 3, wherein p represents 1 and Ri and R2 both represent Ci-4 alkyl, such as methyl.
5. A compound as defined in any of claims 1 to 4, wherein X represents S.
6. A compound as defined in any of claims 1 to 4, wherein X represents O.
7. A compound as defined in any of claims 1 to 6, wherein m represents 1 .
8. A compound as defined in any of claims 1 to 6, wherein m represents 2.
9. A compound as defined in any of claims 1 to 8, wherein m represents 2 and X represents S.
10. A compound of formula (I) as defined in claim 1 , which is:
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(5,7-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 );
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E2);
(3S)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E2a);
(3R)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E2b).
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(5-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E3);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-methyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E4);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -[6-(methyloxy)-1 ,3-benzothiazol-2-yl]-3- piperidinecarboxamide (E5);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4-methyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E6);
/V-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-chloro-1 ,3-benzoxazol-2-yl)-3- piperidinecarboxamide (E7);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(6-nitro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E8);
N-{[4-(Aminosulfonyl)phenyl]methyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E9);
N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4-chloro-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E10);
(3S)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 1 a); and
(3R)-N-{2-[4-(Aminosulfonyl)phenyl]ethyl}-1 -(4,6-dimethyl-1 ,3-benzothiazol-2-yl)-3- piperidinecarboxamide (E1 1 b).
1 1 . A pharmaceutical composition comprising a compound of formula (I) as defined in any of claims 1 to 10 in admixture with one or more physiologically acceptable carriers or excipients.
12. A compound of formula (I) as defined in any of claims 1 to 10 for use in therapy.
13. A compound of formula (I) as defined in any of claims 1 to 10 without the proviso for use in the treatment or prevention of a condition such as a pain, inflammatory, immunological, bone, neurodegenerative or renal disorder.
14. Use of a compound of formula (I) as defined in any of claims 1 to 10 without the proviso for the manufacture of a medicament for the treatment or prevention of a condition such as a pain, inflammatory, immunological, bone, neurodegenerative or renal disorder.
15. A process for preparing a compound of formula (I) as defined in claim 1 which comprises:
(a) reacting a compound of formula (II):
Figure imgf000047_0001
(II)
wherein R-i , R2, p and X are as defined hereinbefore, with a compound of formula (VII):
Figure imgf000048_0001
(VII)
wherein m is as defined hereinbefore;
(b) reacting a compound of formula (IX):
Figure imgf000048_0002
(IX)
wherein m is as defined hereinbefore, with a compound of formula (V):
Figure imgf000048_0003
(V)
wherein R-i , R2, p and X are as defined hereinbefore and L-i represents a suitable leaving group such as chlorine;
(c) deprotection of a protected derivative of a compound of formula (I);
(d) interconversion of a compound of formula (I) to a further compound of formula
(I)-
PCT/GB2011/050767 2010-04-23 2011-04-19 Microsomal prostaglandin e syntase-1 inhibitors WO2011131975A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2013505542A JP2013525339A (en) 2010-04-23 2011-04-19 Microsomal prostaglandin E synthase-1 inhibitor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1006846.8 2010-04-23
GBGB1006846.8A GB201006846D0 (en) 2010-04-23 2010-04-23 Novel compounds

Publications (1)

Publication Number Publication Date
WO2011131975A1 true WO2011131975A1 (en) 2011-10-27

Family

ID=42270760

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2011/050767 WO2011131975A1 (en) 2010-04-23 2011-04-19 Microsomal prostaglandin e syntase-1 inhibitors

Country Status (3)

Country Link
JP (1) JP2013525339A (en)
GB (1) GB201006846D0 (en)
WO (1) WO2011131975A1 (en)

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0018080A1 (en) 1979-03-19 1980-10-29 Ici Australia Limited Herbicidal compounds, their preparation, compositions and process for the use thereof
WO2005005415A1 (en) 2003-07-09 2005-01-20 Biolipox Ab Indoles useful in the treatment of inflammation
WO2005123674A1 (en) 2004-06-18 2005-12-29 Biolipox Ab Indoles useful in the treatment of inflammation
WO2006063466A1 (en) 2004-12-17 2006-06-22 Merck Frosst Canada Ltd. 2-(phenyl or heterocyclic)-1h-phenantrho[9,10-d]imidazoles as mpges-1 inhibitors
WO2006077401A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Pyrrolopyridines useful in the treatment of inflammation
WO2006077366A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflammation
WO2006077364A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflammation
WO2006077412A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Thienopyrroles useful in the treatment of inflammation
WO2006077365A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflammation
WO2006077367A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflamation
WO2007014687A1 (en) 2005-08-03 2007-02-08 Aziende Chimiche Riunite Angelini Francesco A.C.R.A.F. S.P.A. 3-aminocarbazole compounds, pharmaceutical composition containing the same and method for the preparation thereof
WO2007042817A1 (en) 2005-10-13 2007-04-19 Biolipox Ab Naphthalene-disulfonamides useful for the treatment of inflammation
WO2007042816A1 (en) 2005-10-12 2007-04-19 Biolipox Ab Benzoxazoles useful in the treatment of inflammation
WO2007059611A1 (en) 2005-11-23 2007-05-31 Merck Frosst Canada Ltd. 2-(phenyl or heterocyclic)-1h-phenantrho[9,10-d]imidazoles as mpges-1 inhibitors
WO2007061853A2 (en) 2005-11-23 2007-05-31 Merck & Co., Inc. Process for synthesizing 2-phenyl-1h-phenantrho[9,10-d]imidazole derivative
WO2007095753A1 (en) 2006-02-24 2007-08-30 Merck Frosst Canada Ltd. 2-(phenyl or heterocyclic) - 1h-phenanthro [9,10-d] imidazoles
WO2008084218A1 (en) * 2007-01-12 2008-07-17 Boehringer Ingelheim International Gmbh Benzazole derivatives for the treatment of inflammations

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0018080A1 (en) 1979-03-19 1980-10-29 Ici Australia Limited Herbicidal compounds, their preparation, compositions and process for the use thereof
WO2005005415A1 (en) 2003-07-09 2005-01-20 Biolipox Ab Indoles useful in the treatment of inflammation
WO2005123674A1 (en) 2004-06-18 2005-12-29 Biolipox Ab Indoles useful in the treatment of inflammation
WO2006063466A1 (en) 2004-12-17 2006-06-22 Merck Frosst Canada Ltd. 2-(phenyl or heterocyclic)-1h-phenantrho[9,10-d]imidazoles as mpges-1 inhibitors
WO2006077365A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflammation
WO2006077364A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflammation
WO2006077412A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Thienopyrroles useful in the treatment of inflammation
WO2006077401A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Pyrrolopyridines useful in the treatment of inflammation
WO2006077367A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflamation
WO2006077366A1 (en) 2005-01-19 2006-07-27 Biolipox Ab Indoles useful in the treatment of inflammation
WO2007014687A1 (en) 2005-08-03 2007-02-08 Aziende Chimiche Riunite Angelini Francesco A.C.R.A.F. S.P.A. 3-aminocarbazole compounds, pharmaceutical composition containing the same and method for the preparation thereof
WO2007042816A1 (en) 2005-10-12 2007-04-19 Biolipox Ab Benzoxazoles useful in the treatment of inflammation
WO2007042817A1 (en) 2005-10-13 2007-04-19 Biolipox Ab Naphthalene-disulfonamides useful for the treatment of inflammation
WO2007059611A1 (en) 2005-11-23 2007-05-31 Merck Frosst Canada Ltd. 2-(phenyl or heterocyclic)-1h-phenantrho[9,10-d]imidazoles as mpges-1 inhibitors
WO2007059610A1 (en) 2005-11-23 2007-05-31 Merck Frosst Canada Ltd. 2-(phenyl or heterocyclic)-1h-phenantrho[9,10-d]imidazoles as mpges-1 inhibitors
WO2007061853A2 (en) 2005-11-23 2007-05-31 Merck & Co., Inc. Process for synthesizing 2-phenyl-1h-phenantrho[9,10-d]imidazole derivative
WO2007095753A1 (en) 2006-02-24 2007-08-30 Merck Frosst Canada Ltd. 2-(phenyl or heterocyclic) - 1h-phenanthro [9,10-d] imidazoles
WO2008084218A1 (en) * 2007-01-12 2008-07-17 Boehringer Ingelheim International Gmbh Benzazole derivatives for the treatment of inflammations

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
"Remington - The Science and Practice of Pharmacy", 2005, LIPPINCOTT, WILLIAMS & WILKINS
BERGE, BIGHLEY, MONKHOUSE, J. PHARM. SCI., vol. 66, 1977, pages 1 - 19
CHARLES, M. ET AL., ORGANIC LETTERS, vol. 7, no. 18, 2005, pages 3965 - 3968
CHEN WEN-BIN ET AL., HETEROATOM CHEMISTRY, vol. 12, no. 3, 2001, pages 151 - 155
DATABASE REGISTRY [Online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 21 August 2006 (2006-08-21), XP002648078, retrieved from stn accession no. 902939-72-4 Database accession no. 902939-72-4 *
DATABASE REGISTRY [Online] CHEMICAL ABSTRACTS SERVICE, COLUMBUS, OHIO, US; 21 August 2006 (2006-08-21), XP002648079, retrieved from stn accession no. 902896-51-9 Database accession no. 902896-51-9 *
H. BUNDGAARD, J.D. LARSEN, J. MED. CHEM., vol. 31, 1988, pages 2066 - 2069
J.D. LARSEN, H. BUNDGAARD, INT. J. PHARM., vol. 37, 1987, pages 87 - 95
J.D. LARSEN, H. BUNDGAARD, V.H.L. LEE, INT. J. PHARM., vol. 47, 1988, pages 103 - 110
KOJIMA ET AL., FUNDAM & CLIN PHARMACOL, vol. 19, 2005, pages 255 - 216
MONTALBETTI ET AL., TETRAHEDRON, vol. 61, 2005, pages 10827 - 10852
OUELLET, PROTEIN EXPRESSION AND PURIFICATION, vol. 26, 2002, pages 489 - 495
PARK ET AL.: "Prostaglandin E2 synthesis and secretion: the role of PGE synthases", CLIN IMMUNOL, vol. 119, 2006, pages 229 - 240
S. HUANG, P.J. CONNOLLY, R. LIN, S. EMANUEL, S.A. MIDDLETON, BIOORG. MED. CHEM. LETT., vol. 16, 2006, pages 3639 - 3641
SAMUELSSON ET AL.: "Membrane Prostaglandin E synthase-1: A novel therapeutic target", PHARMACOL REV, vol. 59, 2007, pages 207 - 224, XP002528252, DOI: doi:10.1124/PR.59.3.1
SCHOLICH, GEISSLINGER, TIPS, vol. 27, no. 8, 2006, pages 399 - 401
THOREN, EUR. J. BIOCHEM PARMACOL., vol. 63, 2002, pages 1183
TREBINO ET AL., PROC NATL ACAD SCI USA, vol. 100, no. 15, 2003, pages 9044 - 9049
WANG ET AL., PROC NATL ACAD SCI USA, vol. 103, no. 39, 2006, pages 14507 - 14512
WUTS, GREENE: "Greene's Protecting Groups in Organic Synthesis", 2007, WILEY
ZHU,L ET AL., JOURNAL OF HETEROCYCLIC CHEMISTRY, vol. 42, 2005, pages 727

Also Published As

Publication number Publication date
JP2013525339A (en) 2013-06-20
GB201006846D0 (en) 2010-06-09

Similar Documents

Publication Publication Date Title
US8314147B2 (en) Benzamide derivatives as EP4 receptor agonists
CA2820109C (en) Pyridine amide derivatives as ep4 receptor antagonists
ES2321535T3 (en) PIRIDINE COMPOUNDS FOR THE TREATMENT OF DISEASES MEDIATED BY PROSTAGLANDINAS.
CN104854087B (en) Indole carboxamide derivatives as P2X7 receptor antagonists
CN110959008A (en) Penicillin binding protein inhibitors
CN1031053C (en) Azaoxindole derivatives
AU2007260529A1 (en) Indoline amide derivatives as EP4 receptor ligands
US20100016371A1 (en) Indole Compounds
CN112469725A (en) Penicillin binding protein inhibitors
EP2041127A2 (en) Indole compounds
CN1013274B (en) Prepn. of cephalosporin derivatives
WO2007088190A1 (en) Benzo (f) isoindol-2-ylphenyl acetic acid derivatives as ep4 receptor agonists
KR0130467B1 (en) Azabicycloalianes
US20090281152A1 (en) Indole Compounds Having Affinity to the EP1 Receptor
EP2220029B1 (en) Benzamide compounds and their use as prostaglandin E4 receptor agonists
WO2011131975A1 (en) Microsomal prostaglandin e syntase-1 inhibitors
TWI753418B (en) Novel oxalyl piperazines active against the hepatitis b virus (hbv)
CN1377269A (en) Vitronectin receptor antagonists
CN1048856A (en) Cephalosporins derivatives and preparation method thereof
KR20230152016A (en) 4-Alkoxy-6-oxo-pyridazine derivatives that modulate NLRP3
JP2007513140A (en) Method for producing compound useful as protease inhibitor
Gaiba et al. Benzamide derivatives as EP 4 receptor agonists
CN117015528A (en) Indole derivatives as kinase inhibitors
WO2006090698A1 (en) Kinase inhibitor and use thereof
WO2008020055A1 (en) Novel isoindol derivatives as ep4 receptor agonists

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11715730

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2013505542

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11715730

Country of ref document: EP

Kind code of ref document: A1