WO2011131146A1

WO2011131146A1 - Specific primers and liquid chips for detecting braf gene mutation

Info

Publication number: WO2011131146A1
Application number: PCT/CN2011/073214
Authority: WO
Inventors: 许嘉森; 李国强; 余刚; 秦会娟
Original assignee: 广州益善生物技术有限公司
Priority date: 2010-04-23
Filing date: 2011-04-23
Publication date: 2011-10-27
Also published as: CN102234684A; CN102234684B

Abstract

Liquid chips for detecting BRAF gene mutation are disclosed. The liquid chip mainly comprises: (A) wild type and mutant type ASPE primer pairs respectively designed for V600E mutation site of BRAF gene, wherein each primer consists of a tag sequence at 5' end and a specific primer directed to mutation site of target gene at 3' end; (B) two microspheres coated respectively with specific anti-tag sequence, wherein each microsphere has codes of different colors; (C) amplification primers for amplifying target sequence with V600E mutation site of BRAF.

Description

BRAF gene mutation detection specific primer and liquid phase chip

The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to BRAF gene mutation detection specific primers and liquid phase chips. technical background

The murine sarcoma viral oncogene homolog Bl (BRAF) gene, located in human chromosome 7q34, has a functional coding region consisting of 2510 pairs of bases, encoding the MAPK pathway. A serine threonine protein kinase that transduces a signal from Ras to MEK1/2 and is involved in the regulation of various biological events in cells. Studies have shown that BRAF mainly has two types of mutations: 1 11% of the mutations are located in the glycine loop on exon 11, such as G463, G465, G468 and other point mutations; 2 89% of the mutations occur in exon 15 activation The region, of which approximately 92% is located at nucleotide position 1799 (T mutation is A), results in its encoded glutamic acid being replaced by proline (V600E).

At present, the established BRAF gene mutation detection technology is mainly PCR-sequencing and real-time fluorescent quantitative PCR detection technology. PCR-sequencing has the advantage of being able to determine the range and type of mutations. It is currently widely used, but the sensitivity of sequencing is only 20%-25%, which is far from meeting the needs of practical applications, especially for heterogeneity. Mutations in tumor somatic cells, low sensitivity will lead to a large number of missed tests. At the same time, the sequencing method has complicated detection operation and poor timeliness. The limitations of sequencing methods have been highlighted for the practical application of high timeliness and high sensitivity. The real-time fluorescent quantitative PCR detection technology has high detection efficiency and strong timeliness, but its false positive rate is also a problem for practical applications. Based on the problems of the above detection techniques, the "BRAF gene mutation detection probe, liquid phase chip and its detection method" successfully developed by the applicant in the previous period (Application No.: 200910037357.6) The detection method is simple, and a large number of enzyme digestion enrichment is excluded. The interference caused by the wild-type sequence has good specificity, high sensitivity and accuracy of more than 99%, but the method involves two rounds of PCR operation, which is easy to cause pollution, and the hybridization detection step probe is relatively close (only the mutation sites are different) ), it is not convenient to detect multiple gene mutation sites in parallel. Summary of the invention

One of the objects of the present invention is to provide a BRAF gene mutation detection liquid phase chip. This liquid phase chip can be used to detect the normal genotype of the BRAF gene and the V600E mutant.

The technical solution to achieve the above objectives is as follows: A liquid phase chip for detecting BRAF gene mutation, mainly including

(A) Wild-type and mutant pair of ASPE primers designed for the V600E mutation site of BRAF: Each ASPE primer consists of a tag sequence at the 5' end and a specific primer at the 3' end for the target gene mutation site. The tag sequence is selected from any two of SEQ ID N0.25 - SEQ ID NO. 30; the specific primer is derived from SEQ ID N0.1 and SEQ ID N0.2 or a reverse complement thereof a base sequence in SEQ ID N0.13 and SEQ ID NO. 14, and one of the last three bases of the 3' end of the specific primer is a mutation site or a corresponding wild type site thereof, The specific primer has a Tm value between 52 and 58 ° C;

(B) two kinds of microspheres having different color codes, each having a specific anti-tag sequence, wherein the anti-tag sequence is selected from the sequences in SEQ ID N0.31 to SEQ ID N0.36, and The anti-tag sequence can be complementarily paired with the tag sequence selected in (A);

(C) Amplification primers for amplifying a BRAF gene sequence containing the target detection site _C od _O n600.

Preferably, the amplification primers are SEQ ID N0.37 and SEQ ID N0.38.

Preferably, the wild type specific primer is one of SEQ ID N0.3 to SEQ ID N0.7, and the specific primer of the mutant is one of SEQ ID N0.8 to SEQ ID N0.12 Or the specific primer of the wild type is one of SEQ ID N0.15 to SEQ ID N0.19, and the specific primer of the mutant is one of SEQ ID NO. 20 to SEQ ID N0.24.

Preferably, the anti-tag sequence is further provided with a spacer arm sequence in the middle of the microsphere connection; the spacer arm sequence is 5-10! ¹ .

Another object of the present invention is to provide a specific primer for the detection of mutation of the BRAF gene.

The specific technical solutions are as follows:

Specific primers for detection of the BRAF gene V600E mutation, which are derived from SEQ ID N0.1 and SEQ ID N0.2 or its reverse complement SEQ ID NO. 13 and SEQ ID NO. a base sequence in which one of the last 3 bases of the 3' end of the specific primer is a mutation site or a corresponding wild type site thereof, and the specific primer has a Tm value of 52 to 58°. Between C. The main advantages of the invention are:

1. The BRAF gene mutation detecting liquid phase chip prepared by the invention has a very good signal-to-noise ratio, and substantially no cross reaction exists between the designed probe and the anti-tag sequence, and multiple mutation sites can be realized. Parallel detection.

2. The specific ASPE primer designed for wild type and mutant type according to the invention can perform hybridization reaction under uniform reaction conditions, and there is no non-specific binding between the probes, and the detection specificity and accuracy are high, and the detection result is high. And sequencing The coincidence rate reached 100%.

3. The detection system of the invention has stable and reliable effects, and the combination of specific primers, Tag sequences and amplification primers enables the liquid phase chip and the detection method to form a system with good detection effect. detailed description

Example 1 The BRAF gene mutation detection liquid phase chip mainly includes:

First, ASPE primers

Wild-type and mutant ASPE primer pairs were designed for the V600E mutation site of BRAF.

The design points of the ASPE bow for BRAF gene mutation detection are:

The ASPE primer consists of a "Tag + specific primer sequence". Among them, the 5' end is a Tag sequence designed based on BRAF gene mutation detection. The designed Tag sequence can avoid the secondary structure that ASPE primers may form in the reaction system to the maximum extent, and the Tag sequence and Tag sequence, Tag sequence and specificity. There is no cross-reactivity between the sex primer sequences. The Tag sequence and the specific primer sequence form a complete ASPE primer, and all ASPE primers can be synchronized in a uniform reaction system (ie, the buffering environment of the same reaction, the same reaction temperature, etc.) to complete the parallel detection. The designed Tag sequence is shown in Table 5. The 3' end is a specific primer sequence designed according to the BRAF gene mutation detection, and the specific primer has a Tm value between 52 and 58 ° C; wherein the specific primer sequence for the V600E mutant type, the 3' end of the last One of the three bases should be a mutation site; one of the last three bases of the 3' end of the specific primer sequence of the V600E wild type is a wild type site corresponding to the mutation site. The Tm value is calculated as Tm = ( G + C) χ 4 + ( Α + Τ ) χ 2 - 4. Table 1 One of the source sequences of BRAF gene mutation detection specific primers

From the above table sequence, A in the italic part is the mutation site, and T is the wild type site corresponding to the mutation site A.

According to the design points of the specific primer sequences in the above ASPE primers, a series of specific primer sequences were designed, and some wild type and mutant specific primers were exemplified, as shown in Table 2: BRAF gene mutation-specific primer sequence

Similarly, the reverse complement of the source sequence of the BRAF gene mutation-specific primers in Table 1 can also be used to design specific primers for ASPE. The specific source sequences are shown in Table 3:

Table 3 BRAF gene mutation detection specific primers

BRAF gene mutation detection specific primer sequence two

SEQIDNO. Type Specific Primer (5'-3') Tm (°C)

15 V600E w GATTTTGGTCTAGCTACAGr 52

16 (wild type)

TGATTTTGGTCTAGCTACAGJ 54

17 GTGATTTTGGTCTAGCTACAGJ 58 18 GATTTTGGTCTAGCTACAGJG 56

19 GATTTTGGTCTAGCTACAGJGA 58

20 GATTTTGGTCTAGCTACA04 52

21 TGATTTTGGTCTAGCTACAG4 54

V600E -m

22 GTGATTTTGGTCTAGCTACAG4 58

(mutant type)

23 GATTTTGGTCTAGCTACA04G 56

24 GATTTTGGTCTAGCTACAG GA 58

Table 5 Tag sequence

Each ASPE primer consists of two parts, the 5' end is a specific tag sequence for the anti-tag sequence on the corresponding microsphere (as shown in Table 5 above), and the 3' end is a mutant or wild type specific primer sequence ( As shown in Tables 2 and 4 above). All ASPE primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd. Each of the synthesized primers was formulated into a storage solution of 100 pmol/mL with 10 mmol/L Tris Buffer.

Second, the anti-tag sequence coated microspheres

According to the designed ASPE-specific primers, select the tag sequence to minimize the secondary structure of the anti-tag sequences of each microsphere and the possible formation of the tag sequence and ASPE-specific primers, the selected microsphere number and microspheres. The corresponding anti-tag sequence is shown in Table 6: Microsphere number and corresponding anti-tag sequence on the microsphere

The six microspheres selected were purchased from Luminex, USA, and the anti-tag sequence was coated on the microspheres. The anti-tag sequence and the microspheres are connected with a 5-10 T-spacer sequence, that is, a 5-10 T-spacer sequence is added before each anti-tag sequence, and the anti-tag sequence is generated by Shanghai. Engineering Bioengineering Technology Services Co., Ltd. Synthesis. The synthetic anti-tag sequences with sterile ddH ₂ 0 stock solution was formulated 100nmol / ml of. The spacer arm is a sequence for spacing the anti-tag from the surface of the microsphere or placing the anti-tag in a hydrophilic environment. By setting an appropriate length of the spacer sequence between the anti-tag sequence and the microspheres, the steric hindrance can be reduced, the efficiency of the hybridization reaction, and the specificity of the hybridization reaction can be improved. Common spacer sequences include poly dT, BPpoly (dT), oligotetraethylene glycol, and (CH2) n spacer arms (n ≥ 3), such as (CH2) 12, (CH2) 18 and the like. In addition, if poly (dA) interference is present, poly (TTG) can also be used as the spacer arm. The spacer arm of the present invention is preferably 5 to 10 butyl.

The process of microsphere coating is as follows:

5x10 ⁶ carboxylated microspheres of the above number (purchased from Luminex) were suspended in 50 ul of 0.1 mol/L MES solution (pH 4.5), and 10 μl of synthetic anti-tag molecule (100 nmol/ml) was added. . A 10 ng/ml EDC (N-(3-Dimethylaminopropyl)-N-ethylcarbodiimide) (purchased from Pierce Chemical) working solution was prepared. Add 2.5 ul of EDC working solution to the microsphere suspension, incubate for 30 minutes at constant temperature, add 2.5 ul of EDC working solution, and incubate for 30 minutes at constant temperature. After the reaction was completed, it was washed once with 0.02% Tween-20 and once with 0.1% SDS solution. The washed microspheres coated with the anti-tag sequence were resuspended in 100 μl of Tris-EDTA solution [10 mmol/L Tris (pH 8.0), 1 mmol/L EDTA], and stored at 2-8 ° C in the dark.

3. Amplifying the primer of the target sequence containing the detection site

Target detection of the BRAF gene V600E site. A pair of primers (see Table 7) were designed using Primer 5.0 to amplify the target sequence containing the detection site. Primer that amplifies a target sequence having a mutation site

All primers were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd. Each primer after synthesis is used separately

10 mmol/L Tris Buffer was formulated into a 100 pmol/mL stock solution.

Example 2 Detection of samples by liquid phase chip using BRAF gene mutation detection

The formulations of the various solutions are as follows:

50 mM MES Buffer (pH 5.0) Formulation (250ml):

2xTm hybridization buffer

Filtered and stored at 4 °C. The ExoSAP-IT kit was purchased from the US USB company.

Biotin-labeled dCTP was purchased from Shanghai Shenggong Bioengineering Technology Service Co., Ltd.

First, the sample DNA extraction:

The DNA to be detected is obtained by referring to the method of DNA extraction in Molecular Cloning.

2. PCR amplification of the sample to be tested

Using Primer5.0 designed primers, the target sequence containing the detection site was amplified by PCR, and the product size was 190 bp. The bow sequence (SEQ N0.37-38) is shown in Table 7 above.

First, prepare the PCR primer working solution: Take the primer storage solution of SEQ NO. 37-38, respectively, lOOul in a 1.5 ml microcentrifuge tube, and mix well to be the PCR primer working solution. The PCR reaction system is as follows: 10x buffer (containing Mg ²⁺ ) 5ul

dNTP (2.5mmol/L each) 4 ul

Taq enzyme (5U/ul) 0.5 ul

PCR primer working solution (16.17pmol/mL each) 6 ul

Template DNA (lOng/ul) 1 ul

ddH ₂ 0 33.5 ul

50 ul in total

The PCR amplification procedure was: 95 ° C for 3 min; 94 ° C for 20 s, 56 ° C for 30 s, 72 ° C for 30 s, 30 cycles; 72 ° C for 10 min; 4 ° C for storage.

Third, the enzyme product digestion treatment

The detailed steps are as follows:

1. Take 7.5 ul of PCR product, add 3 ul of ExoSAP-IT enzyme;

2. Incubate for 15 min at 37 °C. Incubate at 80 ° C for 15 min to inactivate excess enzyme. The digested product was used directly in the subsequent ASPE primer extension reaction.

Site-specific primer extension reaction (ASPE)

Primer extension reaction was carried out using the designed ASPE primer, and biotin-labeled dCTP was incorporated during the reaction, so that the product after the reaction was labeled with multiple biotin labels.

First, prepare mixed ASPE primer working solution: Take V600E corresponding wild type and mutant ASPE primers (specifically shown in Table 8). Store lOul in 3 different 1.5ml microcentrifuge tubes and add 10mmol/L Tris respectively. The Buffer is supplemented to 200 ul, and the mixture is evenly mixed, which is the ASPE mixed primer working solution. Liquid chip preparation design

Experimental group genotype specific primer Tag sequence anti-tag sequence 歹 [J

V600E-wl SEQIDN0.3 SEQID NO.25 SEQIDN0.31

Group 1

V600E-ml SEQIDN0.8 SEQID NO.26 SEQIDN0.32

V600E-w2 SEQIDN0.5 SEQID NO.27 SEQIDN0.33

Group2

V600E-m2 SEQID NO.10 SEQID NO.28 SEQIDN0.34

V600E-w3 SEQIDN0.7 SEQID NO.29 SEQIDN0.35

Group3

V600E-m3 SEQID NO.12 SEQIDNO.30 SEQIDN0.36 The ASPE reaction system is as follows:

10 χ buffer 2 ul

MgCl ₂ ( 50mmol/L) 0.5 ul

Biotin-dCTP (400umol/L) 0.25 ul dATP, dGTP, dTTP mixture (each lOOumol/L) 1 ul

Tsp enzyme (5U/ul) 0.25 ul mixed ASPE primer working solution (500nmol/L each) 1 ul Digested PCR amplification product 5 ul ddH ₂ 0 10. ul 20 ul

Three independent systems were carried out in the same extension reaction procedure. The procedure was: 96 ° C for 2 min; 94 ° C for 30 s, 52 ° C for lmin, 72 ° C for 2 min, 30 cycles; 4 ° C for storage.

Five, hybridization reaction

1. According to the designed ASPE primers, select the corresponding optimal 2 kinds of microspheres for each group (the concentration of microspheres is 2.5χ 10 ⁵ /ml); 2. Take each microsphere of each number in 1.5ml In a microcentrifuge tube;

3. The microspheres are centrifuged at ≥ 10000g for l-2min;

4. Discard the supernatant and resuspend the microspheres in lOOul of 2xTm hybridization buffer and vortex to mix;

5. Take 25 ul of the above microsphere suspension in the corresponding well of a 96-well filter plate, and add 25 ul of ddH ₂ 0 to the control well;

6. Take 5-25 ul of ASPE reaction solution in the corresponding wells, make up to 50 ul with ddH ₂ 0;

7. Wrap the 96-well plate in foil to protect it from light, 95 V 60s, 37 V for 15 min incubation;

8. The hybridized microspheres are centrifuged for ≥ 3000 _§ 2-5 min;

9. Remove the supernatant and resuspend the microspheres in 75 ul of I xTm hybridization buffer;

10. The microspheres are centrifuged at ≥3000g for 2-4 minutes;

11 Resuspend the microspheres in 75 ul of I xTm hybridization buffer and add 15 ul of streptavidin-phycoerythrin (SA-PE) at a concentration of 10 ug/ml;

12. Incubate at 37 ° C for 15 min and test on a Luminex instrument.

Sixth, results detection and data analysis

The reacted product was detected by a Luminex series of analytical instruments. The mutant detection fluorescence value (MFI) is greater than 100 as a cut-off value. When the MFI value of the mutant detection is greater than 100, the sample is determined to be a V600E mutation in the presence of exon 15, otherwise the sample is determined to be wild type, detection The results are shown in Tables 9 and 10. The BRAF gene mutation of a large number of samples was detected by the method, and the coincidence rate of the detection results of the method provided by the present invention was calculated by the sequencing method and the liquid phase chip result. The method detects that the BRAF gene mutation detection result of 20 samples is 100% coincident with the sequencing result. It can be seen that the BRAF gene mutation detection liquid chip provided by the invention can accurately detect the mutation type of the BRAF gene, and the result is stable and reliable.

Table 9 Sample test results (MFI)

Group 1 Group2 Group3

No. NO.

Wild type mutant wild type mutant wild type mutant negative control 6 8 16 14 13 16

1 2486 21 2407 20 1639 7

2 1524 22 1753 20 1683 18

3 2434 28 2184 67 1723 55

4 1888 42 1682 38 2331 77

5 2215 15 2060 29 2041 60

6 1696 34 1913 68 2408 77

7 2203 34 2397 51 2316 69

8 2155 674 1964 680 2250 699

9 2208 291 2007 322 1952 342

10 2011 43 1609 35 2355 39

11 2088 49 2408 46 1506 75

12 2103 38 2341 45 1559 69

13 1970 457 2238 465 1619 490

14 1897 24 2244 49 2458 70

15 2495 32 2441 20 2279 21

16 2289 35 2312 50 1956 47

17 1652 30 2020 38 1702 60

18 1580 37 1716 62 1698 81

19 2165 43 1658 62 2350 74

20 2004 30 1543 29 2394 61 Table 10 Analysis of sample BRAF gene mutation detection results

The detection of the samples by the three sets of ASPE primers for the same mutation site achieved consistent detection results. Different liquid phase chips designed according to the above-mentioned ASPE primer design points have different specific primer sequences, and the detection results are consistent. Specific test data for other similar situations is omitted. Example 3 Selection of wild-type and mutant-specific primer sequences

I. Design of liquid phase chip preparation (selection of wild-type and mutant-specific primer sequences) Taking the detection liquid phase chip of BRAF gene V600E site mutation as an example, the specific primer sequence of the 3' end of ASPE primer was designed for V600E wild type, and the specific primer sequence was derived from SEQ ID N0.1 and SEQ ID N0.13, respectively. The specific primer sequences at the 3' end of the mutant ASPE are correspondingly derived from SEQ ID N0.2 and SEQ ID N0.14, respectively, and the Tag sequences at the 5' end of the wild type and mutant ASPE primers are respectively fixed as SEQ ID N0. .25 and SEQ ID N0.26, correspondingly, the anti-tag sequences that are complementary to the corresponding tag sequences coated on the microspheres are SEQ ID N0.31 and SEQ ID N0.32, respectively. The specific design is shown in the following table (Table 11). The synthesis of ASPE primers, anti-tag sequence-coated microspheres, amplification primers, detection methods, and the like are as described in Example 1 and Example 2.

Table 11 Design of liquid phase chip preparation

Sample detection

Using the liquid phase chip prepared by the above design, the samples 21-40 were examined according to the detection process and method described in Example 2 as follows: Table 12 Sample test results (MFI)

No. Group 1 Group2 Group3 Group4 Group5 Group6

NO. wild type mutant wild type mutant wild type mutant wild type mutant wild type mutant wild type mutant negative

12 25 18 19 20 13 17 19 24 25 20 19

21 2931 49 1910 53 2230 66 2891 66 2905 56 1801 51

22 2349 69 1675 57 1973 35 1523 74 2678 71 2403 66

23 2755 68 2899 54 2673 48 2072 36 1632 51 2468 54 1810 59 2857 70 2240 40 1524 71 2476 69 1520 49

1983 58 1603 53 2457 46 1688 35 2459 41 1737 58

2664 40 1831 36 2381 55 2037 52 2856 50 2911 44

2063 50 1998 34 2457 37 2482 46 2402 68 2301 53

2662 164 1617 134 1922 169 2630 139 1802 169 2797 150

1617 40 2352 38 2160 58 2434 39 2148 64 1794 42

2934 58 2096 34 2964 64 2530 56 1713 70 2871 74

1592 30 1816 55 2719 56 1793 39 2387 39 2771 56

1725 53 1742 34 2939 35 2371 66 2582 39 2807 62

2328 38 2506 56 1733 36 2614 61 2143 73 2599 58

1594 52 1922 37 1588 50 2472 57 1748 35 1745 30

2431 361 2943 363 1748 359 1746 332 2744 372 1860 351

2541 45 1980 61 2890 48 2552 40 1504 36 1689 70

1907 41 1732 35 2699 33 2696 45 1996 31 2280 67

1518 65 2732 43 1718 60 2483 68 2892 31 2435 73

2835 48 2619 57 2621 55 2486 63 1882 35 2827 60

2731 35 2735 31 2128 63 2599 36 2016 34 2117 41 Table 13 Sample liquid phase microarray test results gene polymorphism analysis

Liquid chip test results

Sample number

Grou 1 Group2 Group3 Group4 Group5 Group6

21 wild type wild type wild type wild type wild type wild type

22 wild type wild type wild type wild type wild type wild type

23 wild type wild type wild type wild type wild type wild type

24 wild type wild type wild type wild type wild type wild type

25 wild type wild type wild type wild type wild type wild type

26 wild type wild type wild type wild type wild type wild type

27 wild type wild type wild type wild type wild type wild type

28 V600E mutation V600E mutation V600E mutation V600E mutation V600E mutation V600E mutation 29 wild type wild type wild type wild type wild type wild type

30 wild type wild type wild type wild type wild type wild type

31 wild type wild type wild type wild type wild type wild type

32 wild type wild type wild type wild type wild type wild type

33 wild type wild type wild type wild type wild type wild type

34 wild type wild type wild type wild type wild type wild type

35 V600E mutation V600E mutation V600E mutation V600E mutation V600E mutation V600E mutation

36 wild type wild type wild type wild type wild type wild type

37 wild type wild type wild type wild type wild type wild type

38 wild type wild type wild type wild type wild type wild type

39 wild type wild type wild type wild type wild type wild type

40 wild type wild type wild type wild type wild type wild type

Table 14 Sample Sequencing Results and Gene Polymorphism Analysis

Sequencing result

Sample number

Grou 1 Group2 Group3 Group4 Group5 Group6

21 wild type wild type wild type wild type wild type wild type

22 wild type wild type wild type wild type wild type wild type

23 wild type wild type wild type wild type wild type wild type

24 wild type wild type wild type wild type wild type wild type

25 wild type wild type wild type wild type wild type wild type

26 wild type wild type wild type wild type wild type wild type

27 wild type wild type wild type wild type wild type wild type

28 V600E mutation V600E mutation V600E mutation V600E mutation V600E mutation V600E mutation

29 wild type wild type wild type wild type wild type wild type

30 wild type wild type wild type wild type wild type wild type

31 wild type wild type wild type wild type wild type wild type

32 wild type wild type wild type wild type wild type wild type

33 wild type wild type wild type wild type wild type wild type 34 wild type wild type wild type wild type wild type wild type

36 wild type wild type wild type wild type wild type wild type

37 wild type wild type wild type wild type wild type wild type

38 wild type wild type wild type wild type wild type wild type

39 wild type wild type wild type wild type wild type wild type

Wild type and mutant specific primer sequences targeting the same mutation site of wild type wild type wild type wild type wild type (wild type and mutant specific primers are derived from SEQ ID N0.1 and SEQ ID N0, respectively) .2, or from 8£0 10 ^ 3.13 and 8 £ 0 10 ^ 3.14 respectively) can meet the above-mentioned ASPE primer design, can be tested, and the test results are consistent, the results are stable and reliable, the specific data is omitted. Example 4 Selection of Tag Sequence and Anti-Tag Sequence

First, the design of liquid phase chip preparation (the selection of Tag sequence and Anti-Tag sequence)

Taking the detection of the BRAF gene V600E site mutation as an example, the specific primer sequence of the 3' end of the ASPE primer was designed for the wild type and mutant of V600E, and the Tag sequence of the 5' end of the ASPE primer was selected from SEQ ID N0.25. - 6 of SEQ ID NO. 30, correspondingly, the anti-tag sequence coated on the microsphere complementary to the corresponding tag sequence selects SEQ ID N0.31-SEQ ID N0.36. The specific design is shown in the following table (Table 15). The synthesis of ASPE primers, anti-tag sequence-coated microspheres, amplification primers, detection methods, and the like are as described in Example 1 and Example 2.

Table 15 Design of liquid chip preparation

Second, sample testing Using the liquid phase chip prepared by the above design, the test results of the samples 41-60 were tested as follows according to the detection process and method described in Example 2:

Table 16 Sample Test Results (MFI)

Group 1 Group2 Group3

Sample number

Wild type mutant wild type mutant wild type mutant negative pair

22 17 19 24 16 21 Photo,

41 2806 42 2720 54 2788 48

42 2406 35 2174 47 2380 37

43 2070 44 1629 45 1924 49

44 1865 34 1574 37 1861 34

45 2979 55 2829 61 2847 57

46 2803 29 2500 43 2745 40

47 2803 27 2640 37 2693 36

48 2108 262 1932 261 1956 250

49 3254 48 2906 54 3102 49

50 3143 37 2971 40 3037 44

51 2672 47 2223 48 2485 47

52 2704 54 2496 58 2671 58

53 2550 26 2210 40 2419 39

54 2555 41 2105 41 2401 45

55 1962 54 1647 56 1889 68

56 1927 566 1565 564 1748 541

57 3015 60 2868 67 2985 65

58 2997 52 2591 57 2814 67

59 2646 43 2521 55 2564 47

60 2156 46 1923 49 1987 49 Table 17 Sample Detection Gene Polymorphism Analysis

The above results show that the detection sequence is different, the detection specificity and accuracy are high, and the detection results are reliable, but the first group has the best signal-to-noise ratio.

Other liquid-phase chips for different mutation sites, ASPE primers use different Tag sequences, and the results are still stable and reliable, and the specific data is omitted.

The above is a detailed description of the possible embodiments of the present invention, but the embodiments are not intended to limit the scope of the invention, and the equivalents of the invention are included in the scope of the invention.

Claims

Claim

1. A BRAF gene mutation detecting liquid phase chip, characterized in that it mainly includes

(A) Wild-type and mutant ASPE primer pairs designed for the V600E mutation site of BRAF: Each ASPE primer consists of a tag sequence at the 5' end and a specific primer at the 3' end for the target gene mutation site. The tag sequence is selected from the group consisting of SEQ ID

N0.25 SEQ ID NO. 30; the specific primer is a base sequence derived from SEQ ID N0.1 and SEQ ID NO. 2 or a reverse complement thereof, and the specific primer One of the last three bases of the 3' end is a mutation site or a corresponding wild type site thereof, and the specific primer has a Tm value between 52 and 58 ° C;

(B) two kinds of microspheres having different color codes respectively coated with a specific anti-tag sequence, and the anti-tag sequence is selected from the sequences of SEQ ID N0.31 to SEQ ID N0.36, and The anti-tag sequence can be complementarily paired with the tag sequence selected in (A);

The BRAF gene mutation detecting liquid phase chip according to claim 1, wherein the amplification primers are SEQ ID N0.37 and SEQ ID N0.38.

The BRAF gene mutation detecting liquid phase chip according to claim 1, wherein the wild type specific primer is one of SEQ ID N0.3 to SEQ ID N0.7, and the mutant type The specific primer is one of SEQ ID N0.8 to SEQ ID N0.12; or the specific primer of the wild type is one of SEQ ID N0.15 to SEQ ID N0.19, the specificity of the mutant The primers are one of SEQ ID NO. 20 to SEQ ID N 0.24.

The BRAF gene mutation detecting liquid phase chip according to any one of claims 1 to 3, wherein the tag sequence is SEQ ID N0.25 and SEQ ID N0.26.

The BRAF gene mutation detecting liquid phase chip according to any one of claims 1 to 3, wherein a spacer arm sequence is further provided between the anti-tag sequence and the microsphere.

The BRAF gene mutation detecting liquid phase chip according to claim 5, wherein the spacer arm sequence is 5-10

7. A specific primer for detecting a BRAF gene V600E mutation, characterized in that the specific primer is a base sequence derived from SEQ ID NO. 1 and SEQ ID N0.2 or a reverse complement thereof, and One of the last three bases of the 3' end of the specific primer is a mutation site or a corresponding wild type site thereof, and the specific primer has a Tm value between 52 and 58 °C.

The specific primer for detecting a BRAF gene V600E mutation according to claim 7, wherein the wild type specific primer is one of SEQ ID N0.3 to SEQ IDN 0.7, and the mutation The specific primer of the type is one of SEQ IDN0.8 to SEQ IDN0.12; or the specific primer of the wild type is one of SEQ ID N0.15 to SEQ ID NO. 19, the specific primer of the mutant It is one of SEQ ID NO. 20 to SEQ ID NO.