WO2011127297A1

WO2011127297A1 - Method of treating tumor resistant to herceptin or paclitaxel using foxm1 inhibitors and detecting same

Info

Publication number: WO2011127297A1
Application number: PCT/US2011/031599
Authority: WO
Inventors: Pradip Raychaudhuri; Janai Carr
Original assignee: University of Illinois at Urbana Champaign; University of Illinois System
Current assignee: University of Illinois at Urbana Champaign; University of Illinois System
Priority date: 2010-04-07
Filing date: 2011-04-07
Publication date: 2011-10-13
Anticipated expiration: 2012-10-07
Also published as: US20130142784A1

Abstract

The invention provides methods of treating cancer, especially breast cancer, and in particular HER2/ErbB2 positive breast cancer using a FoxMl inhibitor in conjunction with trastuzumab and/or paclitaxel. Pharmaceutical compositions comprising a FoxMl inhibitor in the presence of trastuzumab and/or paclitaxel are also provided. The invention further provides methods of identifying and treating trastuzumab resistant and/or paclitaxel resistant cancer. Also provided are methods of promoting breast tumor cell differentiation.

Description

METHOD OF TREATING TUMOR RESISTANT TO HERCEPTIN OR PACLITAXEL USING FOXM1 INHIBITORS AND DETECTING SAME [001] This invention relates to and claims the benefit of priority from U.S. Provisional Application Serial Number 61/321,586, filed on April 7, 2010, the disclosure of which is incorporated herein by reference in its entirety.

[002] This invention was made with government support under grant numbers R01 CA124488 and F31 CA136183 awarded by the National Institute of Health. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

[003] Breast cancer is the most common female malignancy in most industrialized countries, as it is estimated to affect about 10% of the female population during their lifespan. Although its mortality has not increased along with its incidence, due to earlier diagnosis and improved treatment, it is still one of the predominant causes of death in women.

[004] The mammary gland is a dynamic organ that undergoes continuous cycles of proliferation, differentiation, and apoptosis. During puberty, the rudimentary mammary gland invades the surrounding fat pad and undergoes extensive growth resulting in ductal expansion and formation of a mature branched mammary structure. In early pregnancy, the gland undergoes further growth and tertiary branching to create alveoli or bud-like structures to support milk production. Throughout pregnancy, the epithelium continues to proliferate. After weaning, widespread apoptosis and angiogenic remodeling result in reestablishment of the mature gland (Hennighausen and Robinson, 2005, "Information networks in the mammary gland," Nat Rev Mol Cell Biol 6:715-25). Thus, dysregulation of proliferation, differentiation and apoptosis in the breast tissue can lead to uncontrolled growth and cancer.

[005] Management of breast cancer currently relies on a combination of early diagnosis and aggressive treatment, which can include one or more treatments such as surgery, radiation therapy, chemotherapy, and hormone therapy. HERCEPTIN (trastuzumab) was developed as a targeted therapy for HER2/ErbB2 positive breast cancer cells, often used in conjunction with other therapies, including the mitotic inhibitor paclitaxel (sold under the trade name TAXOL).

[006] HER2/ErbB2 (also known as HER2, neu, CD340 and pi 85) stands for human epidermal growth factor receptor 2, encoded by the ERBB2 gene. It is a cell surface receptor tyrosine kinase with no known ligand and functions by forming heterodimers with other family members to promote intracellular signaling (Le et ah, 2005, "HER2-targeting antibodies modulate the cyclin-dependent kinase inhibitor p27Kipl via multiple signaling pathways," Cell Cycle 4: 87-95). Heterodimerized HER2/ErbB2 normally is involved in signal transduction pathways that include numerous components, such as those in the AKT/PI3K pathway, many of which are also involved in cancer formation and other diseases. Breast tumors with amplified HER2/ErbB2 are characterized by aggressive growth and poor prognosis, which leave patients with few treatment options. HERCEPTIN (trastuzumab) functions to disrupt the interaction between HER2/ErbB2 and its binding partners (Junttila et ah, 2009, "Ligand-independent HER2/HER3/PI3K complex is disrupted by trastuzumab and is effectively inhibited by the PI3K inhibitor GDC-0941" Cancer Cell 15: 429-40). However, the mechanisms of the action of trastuzumab are not fully understood (Valabrega et ah, 2007, Annals Oncology 18:977-984).

[007] The efficacy of HERCEPTIN as a monotherapy is estimated to be less than 30%; combinatorial treatment with microtubule stabilizing drugs such as paclitaxel increases efficacy to approximately 60% (Burris, HA, 3rd., 2000, "Docetaxel (Taxotere) in HER-2- positive patients and in combination with trastuzumab (HERCEPTIN)" Semin Oncol 27: 19- 23). Treatment with HERCEPTIN results in accumulation of the Cdk inhibitor p27 and subsequent Gl/S cell cycle arrest, and paclitaxel stalls the entry of mitosis which can lead to cell death. In spite of great promise, however, high doses of HERCEPTIN or paclitaxel result in undesirable side effects. Further, the cancer often develops resistance to HERCEPTIN and/or paclitaxel.

[008] Paclitaxel is used in the treatment of multiple tumor types and has shown particular success in treatment of metastatic breast cancer. Insensitivity to paclitaxel has been shown in cells that overexpress HER2/ErbB2; on average, cells with HER2/ErbB2 amplification require a 100-fold higher dose of paclitaxel to produce the same effect. (Azambuja et ah, 2008, "HER-2 overexpression/amplification and its interaction with taxane- based therapy in breast cancer," Ann Oncol 19: 223-32). Resistance to paclitaxel has also been seen in other non-breast tumors.

[009] Resistance to HERCEPTIN develops quickly and is thought to stem from compensated signaling by other EGF family members or dysregulation of downstream pathways such as PI3K/Akt (Nahta et ah, 2004, "P27(kipl) down-regulation is associated with trastuzumab resistance in breast cancer cells," Cancer Res 64: 3981-6; Pohlmann et ah, 2009, "Resistance to Trastuzumab in Breast Cancer," Clin Cancer Res j_5: 7479-7491). HER2/ErbB2 functions upstream of several cell cycle regulating proteins, among which is the oncogenic transcription factor FoxMl . Overexpression or silencing of HER2/ErbB2 directly correlates with FoxMl levels in mammary cell lines and in transgenic mice (Francis et ah, 2009, "FoxMl is a downstream target and marker of HER2 overexpression in breast cancer" Int J Oncol 35: 57-68; Bektas et ah, 2008, "Tight correlation between expression of the Forkhead transcription factor FOXMl and HER2 in human breast cancer" BMC Cancer 8:42). [0010] FoxMl is overexpressed not only in breast tumors but also in a broad range of tumor types, including those of neural, gastrointestinal, and reproductive origin (see Bektas et ah, supra; Nakamura et ah, 2004, "Genome-wide cDNA microarray analysis of gene expression profiles in pancreatic cancers using populations of tumor cells and normal ductal epithelial cells selected for purity by laser microdissection" Oncogene 23 : 2385-400; Pilarsky et ah, 2004, "Identification and validation of commonly over-expressed genes in solid tumors by comparison of microarray data," Neoplasia 6: 744-50; Liu et ah, 2006, "FoxMlB is overexpressed in human glioblastomas and critically regulates the tumorigenicity of glioma cells," Cancer Res 66: 3593-602). This expression pattern of FoxMl is attributed to the ability of FoxMl to transactivate genes required for cell cycle progression (Wang et ah, 2002, "The Forkhead Box mlb transcription factor is essential for hepatocyte DNA replication and mitosis during mouse liver regeneration," Proc Natl Acad Sci U S A 99: 16881-6; Leung et ah, 2001, "Over-expression of FoxMl stimulates cyclin B l expression," FEBS Lett 507: 59-66). Increased nuclear staining of FoxMlB found in human basal cell carcinomas suggests that FoxMl is required for cellular proliferation in human cancers (Teh et ah, 2002, Cancer Res. 62: 4773-80). The detailed role of FoxMl in establishing or facilitating tumor progression and disease management has not been fully elucidated, however. [001 1] While significant advances in breast cancer treatment have been made, side effects and both inherent and acquired resistance to existing treatments leave an unmet need for better cancer treatment.

SUMMARY OF THE INVENTION [0012] Provided herein are compositions and pharmaceutical compositions and methods for therapeutic treatment of breast cancer. Specifically, the invention provides methods for treating breast cancer by administering to a patient a pharmaceutical composition of a FoxMl inhibitor together with HERCEPTIN (trastuzumab) or paclitaxel. The invention further provides methods for promoting breast tumor cell differentiation by inhibiting FoxMl activity or expression.

[0013] As set forth herein, pharmaceutical compositions in a therapeutically effective amount are provided for inhibiting tumor growth comprising a combination of a FoxMl inhibitorand either trastuzumab or paclitaxel, wherein the combination is in a therapeutically effective amount, and a pharmaceutically acceptable excipient, diluent or carrier. In certain particular embodiments the pharmaceutical composition comprises a FoxMl inhibitor and trastuzumab. In certain other embodiments the pharmaceutical composition comprises a FoxMl inhibitor and paclitaxel. In yet certain other embodiments the pharmaceutical composition comprises a FoxMl inhibitor and trastuzumab and paclitaxel. In particular embodiments the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7. In other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: l 1. In other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor is an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP). These embodiments are suitable for use in every aspect of the invention described herein. [0014] In another aspect, the invention provides compositions or kits for inhibiting tumor growth comprising a combination of a FoxMl inhibitor and either trastuzumab or paclitaxel. In certain particular embodiments the compositions or kits comprise a FoxMl inhibitor and trastuzumab. In certain other embodiments the compositions or kits comprise a FoxMl inhibitor and paclitaxel. In yet other certain embodiments the compositions or kits comprises a FoxMl inhibitor and trastuzumab and paclitaxel. In further embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7. In certain other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 1 1. In further embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, specifically siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20- tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

[0015] In another aspect, the invention provides methods for treating breast cancer in a patient comprising the step of administering to a patient in need thereof a pharmaceutical composition comprising a combination of a FoxMl inhibitor and either trastuzumab or paclitaxel or both, and a pharmaceutically acceptable excipient, diluent or carrier, wherein the breast cancer cell is HER2/ErbB2 positive. In certain particular embodiments the pharmaceutical composition comprises a FoxMl inhibitor and trastuzumab. In certain other embodiments the pharmaceutical composition comprises a FoxMl inhibitor and paclitaxel. In yet other embodiments the pharmaceutical composition comprises a FoxMl inhibitor and trastuzumab and paclitaxel. In yet another aspect, the invention provides methods for treating breast cancer in a patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor and either trastuzumab or paclitaxel or both trastuzumab and paclitaxel, wherein the breast cancer cell is HER2/ErbB2 positive. In embodiments of the above aspects, the breast cancer is resistant to trastuzumab treatment and/or paclitaxel treatment. In other embodiments the breast cancer is sensitive to trastuzumab treatment and/or paclitaxel treatment. In certain other embodiments, the breast cancer is sensitive to trastuzumab treatment and resistant to paclitaxel treatment; and in yet other embodiments, the breast cancer is resistant to trastuzumab and sensitive to paclitaxel treatment. In certain particular embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7. Yet in other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 1 1. In certain other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other certain embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6- tetramethylpiperidine- 1 -oxyl (Tempol), or manganese(III)-5, 10,15,20-tetrakis(N- methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

[0016] In a further aspect, the invention provides methods for treating HER2/ErbB2 positive cancer in a patient comprising the steps of (a) obtaining a breast cancer tissue sample from a patient in need of the treatment, wherein the breast cancer tissue sample is HER2/ErbB2 positive; (b) detecting FoxMl expression in the breast cancer tissue sample using a reagent that specifically detects FoxMl; and (c) administering to the patient a FoxMl inhibitor and either trastuzumab or paclitaxel or both trastuzumab and paclitaxel if FoxMl expression is detected in the breast cancer tissue sample. In certain particular embodiments, the FoxMl expression is detected in the nucleus of the cells of the breast cancer tissue sample. In other embodiments, the method further comprises the steps of obtaining a control breast tissue sample, detecting FoxMl expression in the control breast tissue sample, wherein in step (c) a FoxMl inhibitor is administered to the patient with trastuzumab or paclitaxel if FoxMl expression is higher in the breast cancer tissue sample than in the control breast tissue sample. In yet other embodiments, step (c) includes administering to the patient a FoxMl inhibitor and trastuzumab and paclitaxel. In certain embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7. In other certain embodiments, the FoxMl inhibitor comprises a FoxMl -specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11. In other certain embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other certain embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)- 5, 10, 15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP). [0017] In yet another aspect, the invention provides methods of identifying trastuzumab- resistant and/or paclitaxel-resistant breast cancer in a patient, wherein the breast cancer is HER2/ErbB2 positive, comprising the steps of (a) obtaining a breast cancer tissue sample from a patient having breast cancer that is HER2/ErbB2 positive; and (b) detecting FoxMl expression in the breast cancer tissue sample using a reagent that specifically detects FoxMl, wherein detection of FoxMl expression in the breast cancer tissue sample indicates that the breast cancer is resistant to trastuzumab treatment. In particular embodiments, FoxMl expression is detected in the nucleus of the cancer cell. In other embodiments, the method further comprises the steps of obtaining a control breast tissue sample, and detecting FoxMl expression in the control breast tissue sample, wherein the breast cancer is resistant to trastuzumab treatment and/or paclitaxel treatment if FoxMl expression in the breast cancer tissue sample is greater than FoxMl expression in the control breast tissue sample. In certain embodiments, the reagent comprises one or more FoxMl specific primers, and the level of FoxMl expression is determined by reverse-transcriptase polymerase chain reaction (RT- PCR). In other certain embodiments the reagent is a FoxMl specific antibody and the level of FoxMl expression is determined by an immunoassay.

[0018] In yet another aspect, the invention provides methods of reducing the risk of developing trastuzumab resistance and/or paclitaxel resistance in a patient with breast cancer comprising the step of administering to a patient in need thereof a FoxMl inhibitor, wherein the breast cancer is HER2/ErbB2 positive. In a further aspect the invention provides methods of treating paclitaxel-resistant breast tumor in a patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor and paclitaxel, wherein the combination of the FoxMl inhibitor and paclitaxel effectively inhibits paclitaxel-resistant breast tumor. In yet another aspect the invention provides methods of treating trastuzumab-resistant breast tumor in a patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor and trastuzumab, wherein the combination of the FoxMl inhibitor and trastuzumab effectively inhibits trastuzumab-resistant breast tumor, and wherein the breast tumor is HER2/ErbB2 positive. In certain embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7. In certain other embodiments, the FoxMl inhibitor comprises a FoxMl- specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11. In other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6- tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10,15,20-tetrakis(N- methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP). [0019] In another aspect, the invention provides methods of treating cancer in a patient comprising administering to a patient in need thereof a FoxMl inhibitor and paclitaxel. In yet another aspect, the invention provides methods of reducing the risk of developing paclitaxel-resistance in a cancer patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor. In certain embodiments, the patient is administered a FoxMl inhibitor and paclitaxel.

[0020] In another aspect, the invention provides methods of treating paclitaxel-resistant cancer in a patient comprising the steps of (a) obtaining a cancer tissue sample from a patient in need of the treatment; (b) detecting FoxMl expression in the cancer tissue sample using a reagent that specifically detects FoxMl ; (c) obtaining a control tissue sample; and (d) detecting FoxMl expression in the control tissue sample, wherein a FoxMl inhibitor is administered to the patient with paclitaxel if FoxMl expression in the cancer tissue sample is greater than FoxMl expression in the control tissue sample. In certain embodiments the reagent comprises one or more FoxMl specific primers, and the level of FoxMl expression is determined by reverse-transcriptase polymerase chain reaction (RT-PCR). In certain other embodiments, the reagent is a FoxMl specific antibody and the level of FoxMl expression is determined by an immunoassay. In particular embodiments of the invention the cancer is ovarian cancer, breast cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, malignant peripheral nerve sheath tumors, cervical cancer, leukemia, prostate, Kaposi's sarcoma, metastatic melanoma, pancreatic cancer, head and neck tumors, meningiomas, basal cell carcinoma, and gliomas. In certain particular embodiments, the cancer is ovarian cancer, breast cancer, small cell lung cancer, non-small cell lung cancer, or Kaposi's sarcoma. In certain particular embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7. In certain other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siR A including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 1 1. In other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20- tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP). [0021] In another aspect, the invention provides methods of identifying paclitaxel- resistant cancer in a patient comprising the steps of (a) obtaining a cancer tissue sample from a patient (b) detecting FoxMl expression in the cancer tissue sample using a reagent that specifically detects FoxMl, wherein detecting FoxMl expression in the cancer tissue sample indicates that the cancer is resistant to paclitaxel treatment. In particular embodiments the FoxMl expression is detected in the nucleus of the cells in the cancer tissue sample. In other embodiments, the method further comprises the steps of obtaining a control tissue sample, and detecting FoxMl expression in the control tissue sample, wherein the cancer is resistant to paclitaxel treatment if FoxMl expression in the cancer tissue sample is greater than FoxMl expression in the control tissue sample. In certain embodiments the reagent comprises one or more FoxMl specific primers, and the level of FoxMl expression is determined by reverse- transcriptase polymerase chain reaction (RT-PCR). In other certain embodiment, the reagent is a FoxMl specific antibody and the level of FoxMl expression is determined by an immunoassay. In certain embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO: 7. In other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: l 1. In certain other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6- tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10,15,20-tetrakis(N- methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

[0022] In yet another aspect, the invention provides methods of promoting breast tumor cell differentiation by reducing the FoxMl activity or level of FoxMl expression comprising the step of contacting the breast tumor with a FoxMl inhibitor. In another aspect, the invention provides methods of promoting breast tumor cell differentiation that reduces GATA3 promoter methylation comprising the step of contacting the breast tumor with a FoxMl inhibitor. In a further aspect, the invention provides methods of promoting breast tumor cell differentiation that reduces interactions between FoxMl and Rb interaction comprising the step of contacting the breast tumor cell with a FoxMl inhibitor. In certain embodiments, the breast tumor cell proliferation is inhibited by increased differentiation. In other certain embodiments, the breast tumor cell is contacted with the FoxMl inhibitor when a patient with a breast tumor is administered the FoxMl inhibitor. In certain embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7. In other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11. In certain other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L- cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

[0023] In yet another aspect, the invention provides uses of a combination of a FoxMl inhibitor together with trastuzumab or paclitaxel, present in a therapeutically effective amount, for the preparation of a medicament for inhibiting breast tumor growth in a mammal. In certain particular embodiments the composition comprises a FoxMl inhibitor and trastuzumab. In certain other embodiments the composition comprises a FoxMl inhibitor and paclitaxel. In yet other embodiments the composition further comprises a FoxMl inhibitor and trastuzumab and paclitaxel. In certain embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7. In other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siRNA including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11. In certain other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20- tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

[0024] In a further aspect, the invention provides compositions for use in the inhibition of breast tumor growth in a mammal, wherein the compositions comprise a FoxMl inhibitor and further comprises trastuzumab or paclitaxel. In certain particular embodiments the composition comprises a FoxMl inhibitor and trastuzumab. In certain other embodiments the composition comprises a FoxMl inhibitor and paclitaxel. In yet other embodiments the composition comprises a FoxMl inhibitor and trastuzumab and paclitaxel. In certain embodiments, the FoxMl inhibitor comprises an inhibitory P19ARF peptide including without limitation a peptide having the sequence of SEQ ID NO:6 or SEQ ID NO:7. In other embodiments, the FoxMl inhibitor comprises a FoxMl -specific siR A including without limitation a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 1 1. In certain other embodiments, the FoxMl inhibitor comprises a thiazole antibiotic, including without limitation siomycin A or thiostrepton. In yet other embodiments the FoxMl inhibitor comprises an antioxidant including without limitation N- acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

[0025] Specific embodiments of the present invention will become evident from the following more detailed description of certain preferred embodiments and the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figures 1A-1C demonstrate that overexpression of FoxMl renders multiple HER2/ErbB2 amplified (or HER2/ErbB2 overexpressing) cell lines resistant to the effects of HERCEPTIN treatment. Fig 1A shows the response of SKBR3, MDA-MB-453, and BT474 cell lines to HERCEPTIN tested by colony forming assay. Specifically, Fig 1A shows bar graphs of the number of colonies of pBabe or pBabe-FoxMl -infected cells treated continuously with lOug/ml HERCEPTIN for 14 days, as a percentage of untreated cell lines and a photograph showing representative wells for SKBR3. Fig IB shows graphs of percentage changes in Gl phase in cell lines stably infected with either pBabe or FoxMl following treatment with lOug/ml of HERCEPTIN for 48 hours. Inset shows a picture of relative protein expression in FoxMl versus pBabe stable cell lines. Fig 1C presents a graph showing the percentage of BrdU positive cells compared to DAPI positive cells in SKBR3- pBabe and FoxMl lines either untreated or treated for 72 hours with HERCEPTIN. 500 cells in each experiment were counted. Average values are shown above error bars and representative microphotographs of cells are shown below the graph.

[0027] Figures 2A-2C demonstrate that SKBR3 -FoxMl cell lines fail to accumulate p27 after treatment with HERCEPTIN. Fig 2A shows photographs of western blots of FoxMl and p27 levels in SKBR3-pBabe and FoxMl cell lines treated with increasing doses of HERCEPTIN for 48 hours. Fig 2B shows photographs of western blots of FoxMl and p27 levels for SKBR3 stable cell lines treated with lOug/ml of HERCEPTIN for 24, 48, and 72 hours. Fig 2C shows photographs of western blots of FoxMl and p27 levels in SKBR3- pBabe cells treated with lOug/ml of IgG for indicated periods of time.

[0028] Figures 3A-3C demonstrate that FoxMl expression is higher in resistant lines and that targeted inhibition of FoxMl can resensitize the cells to HERCEPTIN. Fig 3A presents photographs of western blots showing FoxMl protein levels in SKBR3, BT474, and MDA- MB-453 parental and resistant lines obtained by continuously culturing in 5ug/ml of HERCEPTIN for six months. Quantification of FoxMl bands by Image J is shown above the blots, using untreated parental lines for normalization. Fig 3B presents representative images of DNA gel electrophoresis results showing target gene expression levels measured by semi- quantitative RT-PCR using cDNA from either parental or resistant SKBR3 cells. Quantification normalized to GAPDH is shown above each image. Fig 3C shows the number of parental and resistant SKBR3 and MDA-MB-453 cells after HERCEPTIN treatment as a percentage of corresponding untreated cells, wherein all the cells were transfected with either control or FoxMl specific siRNA. [0029] Figures 4A-4D demonstrate that FoxMl expression induces resistance to TAXOL by increasing stathmin expression and activity. Fig 4A, The top panel is a bar graph showing numbers of viable cells determined by luminescent measurement of ATP in SKBR3-pBabe and FoxMl lines treated with 0.1 uM of TAXOL for 7 days. The bottom panel is a line graph measuring cell viability by a luminescence assay where SKBR3 parental cells were treated with control siRNA or FoxMl -specific siRNA for 72 hours followed by TAXOL treatment at indicated doses for 24 hours. Fig 4B shows photographs of western blots of a-tubulin in polymerized and soluble tubulin fractions isolated by centrifugation from untreated and treated SKBR3-pBabe and FoxMl cell lines. Western blot analysis was used to assay a- tubulin and β-tubulin ratios in the polymerized and soluble fractions. Relative percentages are shown above each blot. Fig 4C shows stathmin RNA levels in SKBR3 pBabe and FoxMl lines measured by RT-PCR. Values were normalized against cyclophilin. The inset shows stathmin protein expression in pBabe and FoxMl cells by western blot analysis. Fig. 4D shows representative PCR results from a chromatin immunoprecipitation assay (ChIP) performed in SKBR3 cells using an antibody specific to FoxMl or a non-specific IgG as a control. Also shown is a diagram of the region amplified during ChIP (SEQ ID NO: 14).

[0030] Figures 5A-5C demonstrate that FoxMl protects cells against treatment with HERCEPTIN and TAXOL in combination. Fig 5A shows a graph indicating number of SKBR3 cells as a percentage of untreated cells where the cells were pretreated with 10 ug/ml of HERCEPTIN for 3 days followed by 0.1 uM of TAXOL for 7 days in the presence of HERCEPTIN. Fig 5B shows the number of surviving SKBR3 parental cells, as a percentage of untreated cells, treated with control or FoxMl siRNA for 72 hours followed by 10 ug/ml of HERCEPTIN for 3 days. Equal numbers of cells were treated for 24 hours with increasing amounts of TAXOL and cell viability was measured by an ATP luminescence assay. Fig 5C shows graphs of quantification of MDA-MB-453 and BT474 cells that were either left untreated or pre-treated in 10 ug/ml HERCEPTIN for 72 hours followed by 0.1 μΜ TAXOL treatment for 4 hours. Each graph shows quantification of triplicates from three separate experiments. Also shown are photographs of representative wells of SKBR3-pBabe and FoxMl cells with or without drug treatment.

[0031] Figures 6A-6C demonstrate that targeted inhibition of FoxMl with an ARF- peptide overcame HERCEPTIN resistance and sensitized pBabe or FoxMl cells to HERCEPTIN treatment. Figs 6A and 6B are graphs showing quantitative colony forming assay of parental or resistant SKBR3 and MDA-MB-453 cells treated with either ARF- peptide or mutant peptide (2μΜ). Fig 6C shows bar graphs of surviving SKBR3-pBabe and FoxMl cells, as a percentage of untreated cells, treated with either mutant or ARF -peptide for three days. Also shown below the graphs are images of representative wells of cells from such colony-forming assays. [0032] Figures 7A and 7B show FoxMl expression in human breast tumors. Fig 7A is a graph showing microarray data from Oncomine sorted by tumor grade and FoxMl fold change from normal expression. Fig 7B shows images of wildtype tissue stained with a FoxMl sense or antisense probe by in situ hybridization and immunostained with smooth muscle actin (SMA) or cytokeratin 18. Scale bar represents 100 μΜ. [0033] Figures 8A-8F show FoxMl expression in tumor and normal tissue. Fig 8A shows FoxMl expression in 200 samples of invasive ductal carcinoma by using Oncomine analysis. Samples were organized by grade and fold-change of FoxMl RNA from normal was graphed using a box plot *p<10^"6. Fig 8B shows representative images of immunohistochemistry analysis of FoxMl in normal human mammary tissue as well as grade 1, grade 2, and grade 3 human breast carcinomas. Scale bar represents 200μιη. Fig 8C is a graph showing levels of FoxMl RNA determined by semi-quantitative RT-PCR and Fig 8D is a photograph of western blot showing FoxMl protein levels. For Figs 8C and 8D all samples were collected from inguinal mammary glands at various developmental stages: 5 weeks (puberty), 8 weeks (virgin adult), P6, PI 8 (early and late pregnancy), L10 (lactation), and 16 (involution). 4-7 mice were used for each stage. Fig 8E are photomicrographs of mouse mammary glands from each stage and stained for FoxMl expression using 3,3'- diaminobenzidine (DAB) and hemetoxylin counterstain. Fig 8F shows bar graphs depicting expression of CK18, SMA, and FoxM by quantitative RT-PCR. Data is normalized to the stem cell population, *p<10^~4 **p<0.05.

[0034] Figures 9A-9E show results demonstrating that FoxMl deletion leads to an expansion of differentiated luminal cells. Fig. 9A shows results of FoxMl expression in different type of cells using RT-PCR, *p<0.01 **p<10^"3. Fig 9B shows images of whole mount of inguinal mammary glands from transgenic mice stained with carmine alum stain 15 days after doxycycline treatment. Enlarged images of the boxed regions are shown at higher magnification (3X) to the right. Fig 9C shows images of Hemetoxylin and Eosin staining as well as immunohistochemistry of FoxMl, cytokeratin 18, and estrogen receptor alpha after 15 days of treatment. Scale bar represents ΙΟΟμιη. Fig 9D shows flow cytometry analysis of stem cells, luminal progenitors, and differentiated luminal cells from transgenic mice. A representative plot is shown with cell percentages displayed in each quadrant. Percentage change from four animals is graphed below, *p<0.04 **p<0.05 ***p<0.03. Fig 9E shows RNA levels of markers of luminal differentiation (estrogen receptor alpha, amphiregulin, cytokeratin 18, and cadherin 11) by quantitative RT-PCR normalized to 18S RNA.

[0035] Figures 10A-10E demonstrate that over-expression of FoxMl in mammary gland results in an expansion of progenitors and a loss of differentiation markers. Fig 10A is a schematic representation of experimental design. Fig 10B shows images of green fluorescent protein (GFP) staining of whole mount of mouse mammary glands. Boxed areas are shown in the inset at higher magnification (3X). Fig IOC shows microphotographs of Hemetoxylin and Eosin staining and immunohistochemistry using different antibodies in GFP and FoxMl -GFP glands. Specifically, representative sections from six mice stained for smooth muscle actin (SMA), cytokeratin 18, and estrogen receptor alpha immunostaining are shown. Scale bar represents ΙΟΟμιη. Fig 10D shows images of CD61 immunohistochemistry. Enlarged images of GFP and GFP-FoxMl mice are displayed in the right panel. Fig 10E shows analysis of mammary stem cells, luminal progenitor, and luminal cell pools performed in glands obtained from GFP or FoxMl -GFP expressing mice. Representative dot plots are shown with percentages listed in each box. The bottom panel provides quantification from four mice. The change in percentage of each population is shown relative to the GFP control in the same animal, *p<0.03 **p<0.04 ***p<0.003. Fig 10F shows RNA levels of estrogen receptor alpha, cytokeratin 18, amphiregulin, and cadherin 11 in GFP and GFP-FoxMl glands measured by quantitative RT-PCR analysis. *p<10^~4 **p<0.001 ***p<0.05. [0036] Figures 11 A and 11B shows images of mammary gland sections from GFP or GFP-FoxMl expressing mice. Fig 11A shows images of mammary gland sections from GFP-FoxMl expressing mice stained with hemetoxylin and eosin. Fig 11B presents images of p63 staining of both GFP and GFP-FoxMl mice, which show a normal negative staining pattern for p63 in both GFP and GFP-FoxMl mice. Scale bar, 100 μΜ. [0037] Figures 12A-12E show results demonstrating FoxMl as a negative regulator of GATA-3 in vivo. Fig 12 A shows photographs of western blots of FoxMl and GATA-3 protein levels in WAP-rtTA-Cre, FoxMl FL/+ (control) and WAP-rtTA-Cre, FoxMl FL/FL as well as GFP (control) and GFP-FoxMl expressing animals. Alpha tubulin is shown as a loading control. Fig 12B shows images of immunohistochemical staining of GATA-3 expression by DAB and hematoxylin counterstain. Fig 12C shows results of RT-PCR for GATA-3 expression. Flow cytometry markers were used to sort stem cells, luminal progenitors, and differentiated cells. These populations were analyzed by RT-PCR for GATA-3 expression. The left panel shows data from FoxMl deleted samples, *p<10^~5. Relative GATA-3 expression as compared to control samples is displayed. The right panel shows data from animals over-expressing FoxMl in the mammary gland. Four animals were used for each experiment, *p<10^~3 **p<0.01 ***p<0.05. Fig 12D presents graphs showing relative binding of FoxMl antibody to sequences in the GATA3 promoter regions over an IgG control, *p<10^"9 **p<10^"4 ***p<0.01. Also shown is a diagram of the GATA-3 promoter. Fig 12E shows graphs summarizing the flow cytometry data from control, GATA- 3, FoxMl, and FoxMl-GATA-3 expressing mice. Each group contains three mice and the percentage of each cell type is graphed. For each group, p-values are calculated as compared to control animals. Photographs of western blots showing protein levels are shown to the right, *p<0.05 **p<0.01.

[0038] Figures 13A-13E show results demonstrating that FoxMl transcriptional repression of GATA-3 is methylation-dependent. Fig 13A shows the FoxMl and GATA-3 expression in human breast cancers. The fold changes from normal are graphed and the heat map of individual samples is shown above the graphs, *p<10^~3 **p<10^~5 ***p<10^~n. Fig. 13B shows semi-quantitative PCR results for chromatin immunoprecipitation assay of FoxMl binding to the GATA-3 promoter in human cell line MDA-MB-453. Also shown is a diagram of the GATA-3 promoter. Fig 13C depicts RT-PCR results of GATA-3 expression normalized to GAPDH. (*p<0.01) MDA-MB-453 cells transfected with FoxMl and 4 hours later, either vehicle (PBS) or luM of the methyltransferase inhibitor 5'azacytidine was added to each plate. Fig 13D shows images of western blots of immunoprecipitation results indicating the association of FoxMl with DNMT3a and DNMT3b in cells transiently transfected with FoxMl and myc tag alone or myc tagged DNMT3a or DNMT3b. Fig 13E shows a bar graph depicting binding of DNMT3b to the FoxMl binding sites in the GATA-3 promoter. The results have been normalized to the binding of a non-specific IgG and relative binding is shown, *p<0.01, **p<0.05.

[0039] Figures 14A-14C shows results demonstrating interaction between FoxMl and Rbl (i.e., Rb). Fig 14A is an image of western blot demonstrating the binding of endogenous FoxMl to Rbl in MDA-MB-453 cells. Fig 14B depicts results of western blot analysis of protein lysates from cells grown in media treated with doxycycline (+Dox) and without addition of doxycycline (-Dox). Figl4C shows microphotographs of phase contrast and florescent microscopy of cells grown in the presence or absence of doxycycline.

[0040] Figure 15A-15E presents results demonstrating that methylation of GATA3 promoter by FoxMl is Rb-dependent. Fig 15A shows GATA-3 expression levels measured by RT-PCR normalized to GAPDH, *p<0.05 **p<0.001. Fig 15B shows Rb binding to the GATA-3 promoter determined by real-time PCR, *p<0.05 **p<10^~4. Fig 15C shows methylation-specific PCR analysis of the GATA-3 promoter in the presence and absence of FoxMl expression in Tet-off shRNA cell lines. Fig 15D shows the results of flow cytometry of stem cells, luminal progenitors, and differentiated cells from mice expressing scrambled shRNA, Rb-targeting shRNA, FoxMl, or both FoxMl and Rb-targeting shRNA. Panel to the right shows semi-quantitative RT-PCR of FoxMl, GATA-3 and Rb expression. Cyclophilin is shown as a loading control, *p<10^"4 **p<0.01.

DETAILED DESCRIPTION OF THE INVENTION [0041] The invention provides methods for treating breast cancer, especially HER2/ErbB2 positive breast cancer, that are not hampered by the limitations existing for conventional treatment. In particular, these methods are able to treat breast cancer using a combination of a FoxMl inhibitor and trastuzumab (HERCEPTI ) or a FoxMl inhibitor and paclitaxel (TAXOL), wherein trastuzumab and paclitaxel can each optionally be effectively used at suboptimal amounts, i.e. amounts lower than the currently clinically recommended amounts (thereby, inter alia, reducing side effects associated with such treatment). Advantageously, the inventive methods can overcome, or reduce the risk of developing, breast cancer resistance to trastuzumab and/or paclitaxel, one of the significant drawbacks of trastuzumab and paclitaxel therapy for treating breast cancer.

[0042] All molecular biology and DNA recombination techniques described herein are well known to one of ordinary skill in the art and further described in reference books such as Molecular Cloning: A Laboratory Manual (Sambrook, et al, 1989, Cold Spring Harbor Laboratory Press), which is incorporated herein by reference for any purposes. All references cited throughout the application are herein incorporated by reference in their entireties for any and all purposes.

[0043] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

[0044] HERCEPTIN (trastuzumab) is a humanized monoclonal antibody directed to the extracellular domain of HER2/ErbB2. The binding of trastuzumab with HER2/ErbB2 blocks or reduces downstream signal transduction that leads to cell growth; however, side effects of heart and lung problems, fever, nausea, vomiting, fatigue, low white and red blood cells, muscle pain and serious infusion reactions have been reported in patients receiving trastuzumab therapy. In addition, inherent and acquired resistance to trastuzumab in patients reduces the effectiveness of this antibody for breast cancer treatment.

[0045] Because the mechanisms of action of HERCEPTIN are not yet fully understood, it has been difficult in the field to explain the reasons why some patients are naturally resistant to HERCEPTIN and others have quickly developed resistance during treatment. Several hypotheses have been presented including loss of PTEN (phosphatase and tensin homologue), activation of alternative IGF-R signal transduction pathway, expression of ligands of the EGFR family and receptor masking or epitope inaccessibility (e.g., Valabrega et al., 2007, supra). There has not been a successful solution to restore sensitivity of target breast cancers to HERCEPTIN.

[0046] However, it was unexpectedly discovered by the inventors of the instant application that decreasing FoxMl activity inter alia using FoxMl inhibitors restored sensitivity to trastuzumab in HER2/ErbB2 positive cell. As shown in the examples disclosed herein, FoxMl overexpression was associated with trastuzumab resistance in HER2/ErbB2 positive breast tumor cells, and inhibition of FoxMl in those cells resensitized the cells to trastuzumab. To the best of the knowledge of the inventors, the instant application established for the first time the connection between FoxMl levels and resistance to trastuzumab in HER2/ErbB2 positive cells, and demonstrated for the first time restoration of sensitivity to trastuzumab in the resistant cells by decreasing the levels or activity of FoxMl.

[0047] Accordingly, the instant invention provides improved and advantageous methods for treating HER2/ErbB2 positive breast tumor in a patient comprising the step of administering to a patient in need thereof a pharmaceutical composition comprising a FoxMl inhibitor and trastuzumab. In certain particular embodiments, the breast cancer is resistant to trastuzumab. In certain other embodiments, the breast cancer is sensitive to trastuzumab. In particular, inhibition of FoxMl activity by a FoxMl inhibitor can overcome, and prevent cells from developing, resistance to trastuzumab. Thus, in another advantageous aspect, the invention provides methods of reducing the risk of developing trastuzumab resistance in a patient with HER2/ErbB2 positive breast cancer comprising the step of administering to a patient in need thereof a FoxMl inhibitor and trastuzumab. In a further aspect, the invention provides methods of treating trastuzumab resistant HER2/ErbB2 positive breast cancer comprising the step of administering to a patient in need thereof a FoxMl inhibitor and trastuzumab.

[0048] As used herein, the term "HER2/ErbB2 positive breast tumor cells" or "HER2/ErbB2 positive breast tissue sample" refers to breast tumor cells that express HER2/ErbB2 at a level higher than the breast cells or breast tissue from a control sample. HER2/ErbB2 positive status indicates that HER2/ErbB2 is expressed at elevated levels by events such as chromosomal amplification or upregulation of expression at the mRNA or protein level. Chromosome amplification can be determined by FISH (fluorescent in situ hybridization), and overexpression in the absence of amplification can be determined by IHC (immunohistochemistry). This can be done for example by using a commercially available kit such as HercepTest™ (DAKO), in which a standardized staining protocol and controls for each level of expression are provided. Scoring of the staining is based on a scale of 0-3. A score of 0 (or HER2/ErbB2 negative) indicates that less than 10% of the cells stain "faintly positive." A score of 1 indicates greater than 10% stain "faintly positive." A score of 2 indicates greater than 10% of cells stain "moderately positive," and a score of 3 indicates "strong staining" in greater than 10% of cells. Samples with a score of 2-3 are considered HER2/ErbB2 positive.

[0049] "Treating" or "treatment" as used herein covers the treatment of a disease or disorder described herein, in a patient and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In certain particular embodiments, administering to a HER2/ErbB2 positive breast cancer patient who is resistant to trastuzumab treatment a FoxMl inhibitor can inhibit and/or slow the progression of trastuzumab-resistant breast cancer.

[0050] "Preventing" or "reducing the risk of developing" a disease or condition as used herein refers to (i) inhibiting the onset of a disease or a condition in a patient who may be at risk of or predisposed to developing the disease or condition; and/or (ii) slowing the onset of the pathology or symptom of a disease or condition in a patient who may be at risk of or predisposed to developing the disease or condition. For example, administering to a HER2/ErbB2 positive breast cancer patient a FoxMl inhibitor during the trastuzumab treatment regimen can reduce the risk of the patient in developing resistance to trastuzumab associated with trastuzumab therapy.

[0051] A "patient" or "subject" as used herein refers to a mammal, preferably a human, in need of the treatment of the claimed invention.

[0052] Trastuzumab is frequently administered to a patient in conjunction with other therapeutics such as the microtubule-stabilizing agent paclitaxel. It has been reported that HER2/ErbB2 positive cells can exhibit reduced sensitivity to paclitaxel (Azambuja et ah, 2008, "HER-2 overexpression/amplification and its interaction with taxane-based therapy in breast cancer" Ann Oncol 19: 223-32; Yu et ah, 1998, "Overexpression of ErbB2 blocks Taxol-induced apoptosis by upregulation of p21Cipl, which inhibits p34Cdc2 kinase" Mol Cell 2: 581-91). Further, paclitaxel resistance has been documented in every tumor type where paclitaxel is a cornerstone of treatment, including without limitation ovarian cancer, Kaposi's sarcoma, and non-small cell lung carcinoma. It was further surprisingly discovered by the inventors that elevated FoxMl levels not only led to cell resistance to trastuzumab, but also protected the cells from paclitaxel-induced apoptosis and led to resistance to paclitaxel. [0053] Thus, in certain particular embodiments, the invention provides methods of treating HER2/ErbB2 positive breast cancer in a patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor and paclitaxel. In certain embodiments, the breast cancer is resistant to paclitaxel. In other embodiments, the breast cancer is resistant to trastuzumab and paclitaxel. In certain other embodiments, the breast cancer is sensitive to paclitaxel, and the FoxMl inhibitor reduces the level or activity of FoxMl, thereby reducing the risk of developing resistance to paclitaxel.

[0054] The invention in another aspect provides methods of treating cancer in a patient comprising administering to a patient in need thereof a FoxMl inhibitor and paclitaxel. FoxMl has been implicated in the growth, proliferation, or survival associated with, for example, malignant peripheral nerve sheath tumors (Yu et al., 2011, "Array-Based Comparative Genomic Hybridization Identifies CDK4 and FOXMl Alterations as Independent Predictors of Survival in Malignant Peripheral Nerve Sheath Tumor" Clin Cancer Res 17: 1924-1934), cervical cancer (Guan et al, 2011, "Expression and signifcance of FOXMl in human cervical cancer: A tissue micro-array study," Clin Invest Med 34:E1- E7), leukemia (Nakamura et al, 2010, "The FOXMl transcriptional factor promotes the proliferation of leukemia cells through modulation of cell cycle progression in acute myeloid leukemia" Carcinogenesis 3J_:2012-21), prostate (Wang et al, 201 1, "Down-regulation of Notch- 1 is associated with Akt and FoxMl in inducing cell growth inhibition and apoptosis in prostate cancer cells" J Cell Biochem 1 12:78-88), metastatic melanoma (Huynh et al., 2011, "FOXMl expression mediates growth suppression during terminal differentiation of HO-1 human metastatic melanoma cells" J Cell Physiol 226: 194-204), pancreatic cancer (Wang et al., 2010, "FoxMl is a novel target of a natural agent in pancreatic cancer" Pharm Res 27: 1159-68), head and neck tumors (Waseem et al., 2010, "Downstream targets of FOXMl : CEP55 and HELLS are cancer progression markers of head and neck squamous cell carcinoma" Oral Oncol 46:536-42), meningiomas (Laurendeau et al., 2010, "Gene expression profiling of the hedgehog signaling pathway in human meningiomas" Mol Med 16:262-70), basal cell carcinoma (Teh et al., 2002, "FOXMl is a downstream target of Glil in basal cell carcinomas" Cancer Res 62:4773-80), and gliomas (Liu et al., 2006, "FoxMlB is overexpressed in human glioblastomas and critically regulates the tumorigenicity of glioma cells" Cancer Res 66:3593-602).

[0055] In a further aspect, the invention provides methods of reducing the risk of developing paclitaxel-resistance in a cancer patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor. Cancer types that can be treated by the inventive methods include without limitation ovarian cancer, breast cancer, small cell lung cancer, non- small cell lung cancer, colorectal cancer, malignant peripheral nerve sheath tumors, cervical cancer, leukemia, prostate, Kaposi's sarcoma, metastatic melanoma, pancreatic cancer, head and neck tumors, meningiomas, basal cell carcinoma, and gliomas. In certain particular embodiments, the cancer is ovarian cancer, breast cancer, small cell lung cancer, non-small cell lung cancer, or Kaposi's sarcoma.

[0056] It was also unexpectedly discovered by the instant inventors that, in the presence of a FoxMl inhibitor, paclitaxel or trastuzumab effectively inhibited tumor growth at lower doses or achieved greater tumor inhibition effects at the same doses as compared to results obtained in the absence of a FoxMl inhibitor. Advantageously, the claimed invention makes it possible to administer to a patient in need thereof trastuzumab and/or paclitaxel at suboptimal doses, i.e. doses that are less than the therapeutically effective amounts required when the drugs are administered, either alone or in combination, in the absence of a FoxMl inhibitor. In accordance with the invention, in certain particular embodiments of all the aspects disclosed herein, trastuzumab is administered to a patient at a suboptimal amount or dose in conjunction with a FoxMl inhibitor. In certain other particular embodiments, paclitaxel is administered at a suboptimal amount or dose in conjunction with a FoxMl inhibitor. In certain other particular embodiments, both trastuzumab and paclitaxel are administered at suboptimal amounts or doses in conjunction with a FoxMl inhibitor. The determination of a suitable suboptimal yet effective amount of HERCEPTIN or paclitaxel when administered in conjunction with a FoxMl inhibitor is within the knowledge of a skill artisan or physician. In certain particular embodiments, the suboptimal amount of HERCEPTIN is initially less than 4 mg/kg/wk, followed by an amount of less than 2 mg/kg/wk. In certain other embodiments, the suboptimal amount is from 0.5 mg/kg/wk to 3 mg/kg, 1 mg/kg/wk to 2.5 mg/kg/wk, or 1.5 mg/kg/wk to 3 mg/kg/wk. In certain other particular embodiments, the suboptimal amount of paclitaxel is less than 175 mg/m², less than 135 mg/m², from 30-150 mg/m², from 50-130 mg/m², or from 70-100 mg/m².

[0057] Thus, as used herein the term "effective amount" or a "therapeutically effective amount" refers to an amount sufficient to achieve the stated desired result, for example, treating breast cancer or reducing the risk of developing trastuzumab resistance or paclitaxel resistance in a patient with breast cancer. A pharmaceutical composition in a therapeutically effective amount comprising a FoxMl inhibitor, further comprising trastuzumab or paclitaxel means that the pharmaceutical composition when used as a whole provides a therapeutically effective amount for the desired outcome, whereas each individual active pharmaceutical ingredient can be present in suboptimal amounts. Thus, the invention provides methods of treating cancer, in particular trastuzumab-resistant and/or paclitaxel-resistant cancer, comprising administering to a patient in need thereof a combination of a FoxMl inhibitor and either trastuzumab or paclitaxel or both trastuzumab and paclitaxel, wherein the combination effectively inhibits tumor growth.

[0058] In addition, the skilled worker will recognize that these embodiments of the invention are not limited to amounts that are formulated together in a single dose, but comprise any embodiments where the combination of dosages or amounts of FoxMl and trastuzumab or paclitaxel or both are administered to a patient in need thereof in separate dosage forms and at times appropriate to have the desired therapeutic effect. For example, in certain embodiments, the FoxMl inhibitor and trastuzumab and/or paclitaxel are adminisetered to a patient at the same time. In certain other embodiments, the FoxMl inhibitor and trastuzumab and/or paclitaxel are administered to a patient at different time. In additional embodiments, the FoxMl inhibitor and trastuzumab and/or paclitaxel are provided in a single dose or dosage form. In yet other embodiments, the FoxMl inhibitor and trastuzumab and/or paclitaxel are provided in separate doses or dosage forms.

[0059] The term "FoxMl inhibitor" as used herein refers to a chemical compound or biological molecule that reduces expression of FoxMl or inhibits FoxMl activity in a cell. In certain embodiments of all aspects of the invention, the FoxMl inhibitor comprises an inhibitory pl9ARF peptide. Non-limiting exemplary inhibitory pl9ARF peptides are disclosed in co-owned U.S. Patent Nos. 7,635,673 and 7,799,896, which are incorporated herein by reference in their entireties. [0060] The terms "peptide" and "polypeptide" both refer to a protein or a polymer of amino acids linked by peptide bonds. A peptide is generally shorter than a polypeptide; however, both peptide and polypeptide can be used to refer to a full-length protein or a fragment of the full-length protein.

[0061] In certain embodiments, the inhibitory pl9ARF peptide comprises full-length pl9ARF protein as shown in SEQ ID NO: l, also described in U.S. 6,407,062, which is herein incorporated by reference in its entirety. In certain particular embodiments, the inhibitory pl9ARF peptide comprises a fragment of pl9ARF protein, wherein the fragment comprises amino acid residues 26-44 of the pl9ARF protein (SEQ ID NO:2). In certain embodiments, the inhibitory pl9ARF peptide comprising a fragment of full-length pl9ARF protein, wherein the fragment comprises amino acid residues of 26-44 of the full-length protein, and is about 19-80, about 20-60, or about 25-50 amino acids in length. Suitable inhibitory pl9ARF peptide includes without limitation peptides having amino acid residues 26-44 (SEQ ID NO:2) and 26-55 (SEQ ID NO:3). In certain embodiments, the full-length pl9ARF is used.

[0062] In certain particular embodiments, the pl9ARF inhibitory peptide further comprises a cell-penetrating peptide covalently linked to the pl9ARF peptide, either at the N- or C- terminus, but particularly at the N-terminus, to facilitate cellular uptake of the inhibitory peptide. In certain particular embodiments, the cell-penetrating peptide is covalently linked to the pl9ARF peptide at the N- terminus. Peptides that facilitate cellular uptake are well known in the art including without limitation the D-Arginine nona-peptide (SEQ ID NO:4) and the HIV TAT peptide (SEQ ID NO:5). Other suitable cell-penetrating peptides are known in the art and are contemplated for use in the instant invention. (See for example Okuyama et ah, 2007, "Small-molecule mimics of an a-helix for efficient transport of proteins into cells" Nature Methods 4: 153-159.) In certain embodiments, inhibitory pl9ARF peptide has the sequence of SEQ ID NO: 6. In certain particular embodiments, the pl9ARF inhibitory peptide has the sequence of SEQ ID NO:7. In certain other embodiments, the full-length pl9ARF covalently linked to a cell-penetrating peptide at the N-terminus is used.

[0063] In certain other embodiments, the FoxMl inhibitor comprises an siRNA specific for FoxMl . Suitable FoxMl -specific siRNAs include, without limitation, polynucleotide having sequence of 5'-CAA CAG GAG UCU AAU CAA GUU-3' (SEQ ID NO:8), 5'-GGA CCA CUU UCC CUA CUU UUU-3' (SEQ ID NO:9), 5'-GUA GUG GGC CCA ACA AAU UUU-3' (SEQ ID NO: 10), or 5'-GCU GGG AUC AAG AUU AUU AUU-3' (SEQ ID NO: 11). In certain particular embodiments, the FoxMl -specific siRNA comprises a polynucleotide having sequence as set forth in SEQ ID NO:9. See U.S. Patent Application, Publication No. 2010-0098663, which is incorporated herein by reference in its entirety. It is understood by an ordinarily skilled artisan that the first 19 nucleotides of any one of SEQ ID NOs:8-l l are FoxMl -specific sequences, and the 3 ' end UU overhang is not. In certain embodiments, suitable FoxMl siRNAs may comprise the 19 FoxMl -specific nucleotides of any one of SEQ ID NOs:8-l 1, and additional FoxMl sequence, with the UU at the 3' end. [0064] In yet other particular embodiments, the FoxMl inhibitors suitable for use in the instant invention comprise a thiazole antibiotic, including but not limited to Siomycin A, thiostrepton, sporangiomycin, nosiheptide, multhiomycin, micrococcin or thiocillin. In certain particular embodiments, the thiazole antibiotic is siomycin A or thiostrepton. In certain further embodiments, the FoxMl inhibitor is the EGFR inhibitor Gefitinib that targets FoxMl (McGovern et ah, 2009, "Gefitinib (Iressa) represses FOXM1 expression via FOX03a in breast cancer" Mol Cancer Ther 8:582-91). In certain other embodiments, the FoxMl inhibitor comprises an antioxidant such as N-acetyl-L-cysteine (NAC), catalase, 4- Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20- tetrakis (N-methylpyridinium-2-yl) porphyrin pentachloride (MnTM-2-PyP) (Part et ah, 2009, "FoxMl, a critical regulator of oxidative stress during oncogenesis" EMBO 28:2908- 2918). In certain other embodiments, the FoxMl inhibitor comprises a proteasome inhibitor such as MG132 (Z-L-leucyl-L-leucyl-L-leucinal), MG1 15 (Z-L-leucyl-L-leucyl-L- norvalinal), VELCADE® (bortezomib, pyrazylcarbony-phenylalanyl-leucyl-boronate, Millennium Pharmaceuticals, Cambridge, MA), lactacystin, or PSI (N-benzyloxycarbony-Ile- Glu-(O-t-butyl)-Ala-leucinal) (SEQ ID NO: 13), NPI-0052 (Salinsporamide-A), and ALLN (Acetyl-L-Leucyl-L-Leucyl-L-Norleucinal) (Bhat et ah, 2009, "FoxMl is a general target for proteasome inhibitors" PLoS One 4: e6593). In certain particular embodiments, the proteasome inhibitor is VELCADE®. See co-owned International patent application, Publication No. WO/2009/152462 and U.S. Patent Application Publication No. 2008- 0152618, both of which are incorporated herein by reference in their entireties.

[0065] Nonlimiting examples of FoxMl inhibitors described herein are suitable for use in all aspects and embodiments of the invention. It is within the knowledge of one skilled artisan or physician to choose a FoxMl inhibitor and determine adequate amounts of the FoxMl inhibitor for use in the instant invention.

[0066] In a further aspect, the invention provides methods of treating HER2/ErbB2 positive breast cancer in a patient comprising the steps of (a) obtaining a breast cancer tissue sample from a patient in need of the treatment, wherein the breast cancer tissue sample is HER2/ErbB2 positive; (b) detecting FoxMl expression in the breast cancer tissue sample using a reagent that specifically detects FoxMl ; and (c) administering to the patient a FoxMl inhibitor and trastuzumab or paclitaxel if FoxMl expression is detected in the breast cancer tissue sample. In another aspect, the invention provides methods of identifying trastuzumab- resistant or paclitaxel-resistant breast cancer in a patient, wherein the breast cancer is HER2/ErbB2 positive, comprising the steps of (a) obtaining a breast cancer tissue sample from a patient having breast cancer that is HER2/ErbB2 positive; and (b) detecting FoxMl expression in the breast cancer tissue sample using a reagent that specifically detects FoxMl, wherein detection of FoxMl expression in the breast cancer tissue sample indicates that the breast cancer is resistant to trastuzumab treatment. The level of FoxMl expression in normal breast cell is very low or often undetectable. Thus, detection of FoxMl in breast tumor cells, in particular detection of FoxMl in the nucleus of the breast tumor cells, can serve as an indicator of aggressive tumor that are refractory to trastuzumab or paclitaxel treatment, alone or in combination. [0067] FoxMl expression can be detected by any suitable methods known in the art, including without limitation Northern blot analysis, RT-PCR, in situ hybridization and immunoassays. Nonlimiting examples of immunoassays include western blot analysis, immunofluorescent staining, and immunohistochemical staining. FoxMl -specific antibodies have been previously described (Major et ah, 2004, "Forkhead box M1B transcriptional activity requires binding of Cdk-cyclin complexes for phosphorylation-dependent recruitment of p300/CBP coactivators" Mol Cell Biol 24: 2649-61) and are commercially available from sources such as Santa Cruz Biotechnology, Inc.

[0068] In certain particular embodiments, the methods disclosed herein further comprise the steps of obtaining a control breast tissue sample; and detecting FoxMl expression in the control breast tissue sample, wherein the breast cancer is resistant to trastuzumab treatment or paclitaxel treatment if FoxMl expression in the breast cancer tissue sample is greater than FoxMl expression in the control breast tissue sample.

[0069] FoxMl overexpression is detected not only in breast cancer, but also in a variety of cancer types, and paclitaxel resistance has been seen in different tumor types. In another aspect, the invention provides methods of treating paclitaxel-resistant cancer in a patient comprising the steps of (a) obtaining a cancer tissue sample from a patient in need of the treatment; (b) detecting FoxMl expression in the cancer tissue sample using a reagent that specifically detects FoxMl; (c) obtaining a control tissue sample; (d) detecting FoxMl expression in the control tissue sample; and (e) administering a FoxMl inhibitor to the patient when FoxMl expression in the cancer tissue sample is greater than FoxMl expression in the control tissue sample. In yet another aspect, the invention provides methods of identifying paclitaxel-resistant cancer in a patient comprising the steps of (a) obtaining a cancer tissue sample from a patient; and (b) detecting FoxMl expression in the cancer tissue sample using a reagent that specifically detects FoxMl, wherein detecting FoxMl expression in the cancer tissue sample indicates that the cancer is resistant to paclitaxel treatment. In certain particular embodiments, FoxMl expression is detected in the nucleus of the cells of the cancer tissue sample.

[0070] A "control breast tissue sample" as the term is used herein can be a normal, noncancerous breast tissue sample obtained from a proximal or distal site of the breast tissue from a breast cancer patient. It can also be obtained from an individual that does not have breast cancer. Similarly, the term "control tissue sample" refers to a corresponding tissue sample from an individual that does not have cancer or a non-cancerous tissue sample from a proximal or distal site of the tissue from a cancer patient.

[0071] The mammary gland undergoes continuous cycles of proliferation, differentiation and apoptosis. The cellular plasticity is attributed to a stem cell population in the mammary gland (Kordon et ah, 1998, "An entire functional mammary gland may comprise the progeny from a single cell" Development 125: 1921-30). A pool of pluripotent stem cells in the mammary gland gives rise to lineage restricted progenitor cells that can be further differentiated into mature luminal or myoepithelial cells (Visvader, 2009, "Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis" Genes Dev 23 :2563-77).

[0072] The zinc finger transcription factor GATA-3 is required for proper mammary gland development as well as maintenance of mature luminal cells (Kouros-Mehr et ah, 2006, "GATA-3 links tumor differentiation and dissemination in a luminal breast cancer model" Cancer Cell 13: 141-52; Asselin-Labat et ah, 2007, "Gata-3 is an essential regulator of mammary-gland morphogenesis and luminal-cell differentiation" Nat Cell Biol 9:201-9). It has been shown that as tumor grade increases, GATA-3 expression is silenced by several mechanisms including DNA methylation (Yan et ah, 2000, "CpG island arrays: an application toward deciphering epigenetic signatures of breast cancer" Clin Cancer Res 6: 1432-8). FoxMl expression has been shown to promote cell proliferation; however, FoxMl 's direct role on regulating mammary gland differentiation has not been recognized in the art. [0073] It was unexpectedly discovered by the inventors of the instant application that FoxMl directly binds to the GATA3 promoter, promotes GATA3 promoter methylation in an Rb-dependent manner, and inhibits differentiation of the mammary progenitor cells. Further, as shown in the examples described herein, loss of FoxMl in the adult gland leads to an increase in differentiated cells and a loss of progenitor pool cells. Accordingly, in a further aspect, the invention provides methods of promoting breast tumor cell differentiation by reducing the level of FoxMl expression comprising the step of contacting the breast tumor with a FoxMl inhibitor. In yet another aspect, the invention provides methods of promoting breast tumor cell differentiation that reduces GATA3 promoter methylation comprising the step of contacting the breast tumor with a FoxMl inhibitor. In an additional aspect, the invention provides methods of promoting breast tumor cell differentiation that reduces interactions between FoxMl and Rb interaction comprising the step of contacting the breast tumor cell with a FoxMl inhibitor. This aspect of the invention provides unique methods for preventing or treating breast cancer cell growth with reduced cytotoxicity effects.

[0074] The pharmaceutical compositions of the invention may contain formulation materials for modifying, maintaining, or preserving, in a manner that does not hinder the physiological function of the active pharmaceutical ingredients, for example, pH, osmolarity, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption, or penetration of the composition. Suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine), antimicrobial compounds, antioxidants (such as ascorbic acid, sodium sulfite, or sodium hydrogen-sulfite), buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates, or other organic acids), bulking agents (such as mannitol or glycine), chelating agents (such as ethylenediamine tetraacetic acid (EDTA)), complexing agents (such as caffeine, polyvinylpyrrolidone, betacyclodextrin, or hydroxypropyl-beta-cyclodextrin), fillers, monosaccharides, disaccharides, and other carbohydrates (such as glucose, mannose, or dextrins), proteins (such as serum albumin, gelatin, or immunoglobulins), coloring, flavoring and diluting agents, emulsifying agents, hydrophilic polymers (such as polyvinylpyrrolidone), low molecular weight polypeptides, salt-forming counterions (such as sodium), preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid, or hydrogen peroxide), solvents (such as glycerin, propylene glycol, or polyethylene glycol), sugar alcohols (such as mannitol or sorbitol), suspending agents, surfactants or wetting agents (such as pluronics; PEG; sorbitan esters; polysorbates such as polysorbate 20 or polysorbate 80; triton; trimethamine; lecithin; cholesterol or tyloxapal), stability enhancing agents (such as sucrose or sorbitol), tonicity enhancing agents (such as alkali metal halides— preferably sodium or potassium chloride— or mannitol sorbitol), delivery vehicles, diluents, excipients and/or pharmaceutical adjuvants. See REMINGTON'S PHARMACEUTICAL SCIENCES (18th Ed., A. R. Gennaro, ed., Mack Publishing Company 1990).

[0075] Optimal pharmaceutical compositions can be determined by one skilled in the art depending upon, for example, the intended route of administration, delivery format and desired dosage. See, for example, REMINGTON'S PHARMACEUTICAL SCIENCES, Id. Such compositions may influence the physical state, stability, rate of in vivo release and rate of in vivo clearance of the antibodies of the invention.

[0076] Administration routes for the pharmaceutical compositions of the invention include orally, through injection by intravenous, intraperitoneal, intramuscular, intravascular, intraarterial, intraportal, or intralesional routes; by sustained release systems or by implantation devices. The pharmaceutical compositions may be administered by bolus injection or continuously by infusion, or by implantation device. The pharmaceutical composition also can be administered locally via implantation of a membrane, sponge or another appropriate material onto which the desired molecule has been absorbed or encapsulated. Where an implantation device is used, the device may be implanted into any suitable tissue or organ, and delivery of the desired molecule may be via diffusion, timed- release bolus, or continuous administration.

[0077] Examples that follow are illustrative of specific embodiments of the invention, and various uses thereof. They are set forth for explanatory purposes only, and are not to be taken as limiting the invention.

EXAMPLES

Cell Culture and Chemotherapeutic Agents

[0078] SKBR3 (breast adenocarcinoma), MDA-MB-453 (metastatic breast carcinoma), and BT474 (breast ductal carcinoma) cell lines were obtained from American Type Culture Collection (ATCC), Manassas, VA. Cells were cultured in RPMI 1640 (GIBCO) with 10% fetal bovine serum (FBS) and 100 U (units) penicillin and lOOug streptomycin. Stable cell lines were generated by transfection of pBabe or pBabe-FoxMl retroviral constructs followed by selection in puromycin (pBabe is obtainable from Addgene, Cambridge, MA). Control siRNA as well as siRNA specific to FoxMl or Stathmin (Dharmacon, Lafayette, CO) were transfected using Lipofectamine (Invitrogen, Carlsbad, CA). Mutant and ARF peptide have been described previously (Gusarova et al, 2001 , "A cell-penetrating ARF peptide inhibitor of FoxMl in mouse hepatocellular carcinoma treatment" J Clin Invest 1 17: 99-11 1). See also co-owned U.S. Patent Nos. 7,635,673 and 7,799,896, which are incorporated herein by reference in their entireties. Paclitaxel (Sigma) was dissolved in DMSO. HERCEPTIN (trastuzumab) was dissolved in sterile water (a gift from Genentech, San Francisco, CA). [0079] A recombinant expression construct for expressing FoxMl, termed herein FoxMl - pcDNA3.1 was generated by PCR amplification and cloned into pcDNA3.1 (commercially available from Invitrogen), and the cloned sequence confirmed by sequencing. Myc tagged DNMT3a and 3b were a kind gift of Frederic Chedin. Retroviral scrambled shRNA and Rb shRNA constructs were purchased from Origene (Rockville, MD). Plasmid transfection was done using FUGENE®6 (Roche, Indianapolis, IN). Control siRNA as well as siRNA specific to FoxMl (Dharmacon) was transfected using Lipofectamine (Invitrogen).

Example 1-Effects of FoxMl Overexpression on Trastuzumab Resistance

[0080] To investigate the effects of FoxMl overexpression on trastuzumab resistance in breast tumor cells, FoxMl expression cDNA construct was stably introduced into SKBR3, BT474, and MDA-MB-453 cell lines. All three cell lines have chromosomal amplification of HER2/ErbB2 and only the BT474 cell line expresses estrogen receptor. Drug sensitivity of the FoxMl stably transfected cell lines was tested by colony formation assay. For colony forming assays, 3-5 x 10³ cells were plated in triplicate in 24-well plates. 24 hours later, cells were treated with trastuzumab (lOug/ml) continuously for 14-17 days. After 14-17 days cells were fixed and stained with crystal violet. Quantification was done using Adobe Photoshop (Lehr et al, 1997, "Application of photoshop-based image analysis to quantification of hormone receptor expression in breast cancer," J. Histochem Cytochem 45: 1559-65). All p- values were calculated using Student's t-test. FoxMl overexpression resulted in a three- to seven-fold increase in colony number as compared to cells transfected with pBabe alone (Figure 1A). The results provide evidence that FoxMl confers cells resistance to trastuzumab.

[0081] The percentage of Gl/S arrest in the cell cycle induced by trastuzumab (referred to as HERCEPTIN in the drawings contained herein) was measured by propidium iodide staining followed by flow cytometry (FACS) analysis. Cells were treated with trastuzumab (lOug/ml) for 72 hours and cell cycle profiles examined. For cell cycle analysis, cells were trypsinized, pelleted, and resuspended in propidium iodide (PI) solution (50ug/ml PI, O. lmg/ml RNaseA, 0.05% Triton-X). After 40 minutes of incubation at 37° C, cells were analyzed using a flow cytometer. Synchronization of MDA-MB-453 cells for cell cycle analysis was done by subjecting the cells to serum starvation (0.2% FBS) for 24 hours, followed by incubating the cells in medium containing 10% FBS for 6 hours, and addition of 5 ug/ml of aphidicolin (Calbiochem) for 16 hours.

[0082] The control pBabe lines showed a statistically significant increase in the number of cells in Gl after HERCEPTIN treatment, but the FoxMl -expressing cells did not exhibit any significant increase in the Gl population (Figure IB). None of the cell lines showed an increase in the sub-Gl population (data not shown), consistent with the understanding in the art that HERCEPTIN alone does not induce apoptosis (Nahta et ah, 2004, "P27(kipl) down- regulation is associated with trastuzumab resistance in breast cancer cells," Cancer Res. 64: 3981-6).

[0083] Further, incorporation of BrdU was measured in cells treated with HERCEPTIN (Figure 1C). 5-Bromo-2-Deoxyuridine (BrDU, obtained from Sigma Chemical Co., St. Louis, MO; 10μΜ) was added to the culture media. Cells were fixed and stained with mouse anti- BrdU antibody (1:250, Dako, Carpisteria, CA) followed by FITC-conjugated anti-mouse antibody (Dako) and DAPI (Molecular Probes/Invitrogen). Cell viability was measured using CellTiter-Glo Luminescent assay (Promega, Sunnyvale, CA), which measures the amount of oxygenated oxyluciferin directly correlated to the amount of ATP present. Upon treatment, SKBR3-pBabe showed a substantial (35%) reduction in the number of BrdU-positive cells. FoxMl -expressing cells did not show any significant decrease in BrdU-incorporation (Figure 1C).

[0084] Taken together, these results indicate that FoxMl expression was able to overcome the Gl/S arrest and proliferation defect caused by HERCEPTIN, allowing cells to continue to grow in the presence of the drug. Example 2-FoxMl Prevents HERCEPTIN-Induced Accumulation of p27

[0085] To investigate whether HERCEPTIN resistance observed in FoxMl overexpressing cells resulted from a failure to accumulate p27, SKBR3-pBabe or FoxMl expressing SKBR3 cells were treated with lOug/ml of HERCEPTIN for 0, 24, 48, or 72 hours or with increasing doses of HERCEPTIN (0, 0.1, 1, 5, and 10 μg/ml). Cell extracts were prepared in lysis buffer containing ImM EDTA, 0.15M NaCl, 0.05M Tris-HCl pH 7.5, and 0.5% Triton-X. Phosphatate Inhibitor Cocktail Set II (200 mM imidazole, 100 mM sodium fluoride, 1 15 mM sodium molybdate, 100 mM sodium orthovanadat, and 400 mM sodium tartrate, dehydrate, catalog No. 524625, Calbiochem) and protease inhibitor (Roche, catalog No. 1 1873580001, previously No. 1 15773860001) were added before each experiment. FoxMl protein levels were determined by western blot analysis using a rabbit polyclonal antibody against FoxMl previously described (Major et ah, 2004, "Forkhead Box M1B transcriptional activity requires binding of Cdk-cycline complexes for phosphorylation- dependent recruitment of p300/CBP coactivators," Mol Cell 24: 2649-61). Anti kipl/p27 (1 : 10,000, BD Biosciences), and anti-Cdk2 (1 :200, Santa Cruz Biotech.) antibodies were also used. Quantification was performed using Image J software (NIH). The results as set forth in Figures 2A-2C show that in control SKBR3 cells, FoxMl protein levels decreased and p27 levels accumulated after HERCEPTIN treatment. Interestingly, in SKBR3-FoxMl cell lines, basal expression of p27 was lower than in SKBR3-pBabe cells and these levels remained low even after high-doses of HERCEPTIN (Figure 2A and 2B). Treatment with IgG did not cause changes in FoxMl or p27 levels, therefore these effects were specific to HER2/ErbB2 - related responses and not a general, non-specific antibody-induced response (Figure 2C). Without being limited to particular mechanisms, these results show that FoxMl conferred resistance to HERCEPTIN by preventing the accumulation of p27, the accumulation of which is required for HERCEPTIN induced Gl/S arrest.

Example 3-Sensitizing Resistant Cells to HERCEPTIN Treatment

[0086] To determine whether cells resistant to HERCEPTIN could be resensitized to HERCEPTIN treatment, a cell line resistant to HERCEPTIN was generated. Parental SKBR3, MDA-MB-453, and BT474 lines were cultured continuously in 5ug/ml of HERCEPTIN for six months. At the end of six months, the resistant cells grew at the same rate in the presence or absence of HERCEPTIN and the morphology of the cells was indistinguishable from the parent cells. The source of resistance in these lines was not uniform, as an increase in phosphorylated Akt was only observed in SKBR3 cells. FoxMl levels in parental and resistant lines were assayed by western blot analysis. Extracts were prepared in lysis buffer containing ImM EDTA, 0.15M NaCl, 0.05M Tris-HCl pH 7.5, and 0.5% Triton-X. Phosphatate Inhibitor Cocktail Set II (Calbiochem) and protease inhibitor (Roche) were added before each experiment using the rabbit polyclonal antibody referenced above. Quantification was performed using Image J software (NIH).

[0087] FoxMl levels were higher in all resistant lines (Figure 3 A). This increase was also reflected at the RNA level (Figure 3B). To confirm a higher activity of FoxMl, RNA levels of known FoxMl target genes were assayed by semi-quantitative RT-PCR. RNA was extracted using Trizol (Invitrogen) and cDNA was synthesized using reverse transcriptase (Bio-Rad). Equal amounts of cDNA were used for all PCR reactions (Promega). PCR products were analyzed over a series of cycle numbers in order to ensure that data were produced during the PCR log-scale amplification. Samples were assayed using agarose gel electrophoresis, photographed, and quantified using Image J. The following primers were used:

GAPDH: 5'-ACA CCC ACT CCT CCA CCT TT-3' (SEQ ID NO: 15) and 5'-TTC CTC TTG TGC TCT TGC TG-3' (SEQ ID NO: 16);

FoxMl : 5'-GCA GGC TGC ACT ATC AAC AA-3' (SEQ ID NO: 17) and 5'-TCG AAG GCT CCT CAA CCT TA-3 ' (SEQ ID NO: 18);

CyclinBl : 5 '-AAA GTC TAC CAC CGA ATC CCT A-3' (SEQ ID NO: 19) and 5' -CCA AAA CAC AAA ACC AAA ATG A-3 '(SEQ ID NO:20);

Cks l : 5'-GAA TGG AGG AAT CTT GGC GTT C-3' (SEQ ID NO:21) and 5'-TCT TTG GTT TCTT GGG TAG TGG G-3' (SEQ ID NO:22);

Polo Like Kinase 1 : 5'-TGT AGA GGA TGA GGC GTG TTG AG-3' (SEQ ID NO:23) and 5'-AGC AAG TGG GTG GAC TAT TCG G-3 ' (SEQ ID NO:24);

Skp2: 5'-CAC GAA AAG GGC TGA AAT GTT C-3' (SEQ ID NO:25) and 5'-GGT GTT TGT AAG AGG TGG TAT CGC-3' (SEQ ID NO:26); and

stathmin: 5'-GCC AGT GTC CTT TAC TTT CCC TCC-3 ' (SEQ ID NO:27) and 5'-TTC AGT TTC TCC CCT TAG GCC C-3 ' (SEQ ID NO:28).

[0088] As shown in the SKBR3 resistant line, FoxMl RNA levels were significantly increased (15-fold) as well as levels of the p27 ubiquitin ligase components Skp2 (2.5-fold) and Cksl (5.6-fold). Additionally, levels of cell cycle regulators, Polo-like Kinase 1 (1.5- fold) and Cyclin B l (16.6-fold) were amplified in the resistant line as compared to the parental control line (Figure 3B). GAPDH is used as a loading control to ensure that the same amount of RNA was added to each reaction. All bands are normalized to GAPDH bands from the same sample and then normalized values from parental and resistant cells can be compared. These results confirmed that increased FoxMl levels conferred resistance to HERCEPTIN. Experiments were conducted to determine whether targeting FoxMl could re- sensitize these resistant cells to HERCEPTIN. Knockdown of FoxMl by siRNA in SKBR3 resistant cells led to a more than 75% percent reduction in cell number when used in conjunction with HERCEPTIN (Figure 3C, left panel). The control (5' CAGUCGCGUUUGCGACUGGTT 3', SEQ ID NO: 12) and FoxMl targeting siRNA (5' GGACCACUUUCCCUACUUUUU 3', SEQ ID NO: 9) were both from Dharmacon, and purified using standard desalting methods. Prior to transfection, plates are washed and cells are placed in serum-free media. siRNA was added to a final concentration of 7.5 pm to each plate using Lipofectamine 2000 (Invitrogen) transfection. Four hours after transfection, 30% FBS containing media is added to the plates to bring the final concentration to 10%. This effect was also observed in MDA-MB-453 cells (Figure 3C, right panel). Collectively, these results indicated that FoxMl was up-regulated in resistant lines and that targeted inhibition of FoxMl provided a method of sensitizing resistant cells to HERCEPTIN treatment.

Example 4- Effects of FoxMl Overexpression on Resistance to Paclitaxel

[0089] It has been previously reported that cells that overexpress HER2/ErbB2 display decreased sensitivity to apoptosis caused by Paclitaxel (Azambuja et ah, 2008, "HER2 overexpression/amplification and its interaction with taxane-based therapy in breast cancer," Ann Oncol 19: 223-32; Yu et ah, 1998, "Overexpression of ErbB2 blocks Taxol-induced apoptosis by upregulation of p21Cipl, which inhibits p34Cdc2 kinase," Moh Cell 2: 581-91). To determine whether FoxMl could protect cells from Taxol induced apoptosis, cells overexpressing FoxMl were treated with Taxol (e.g., Paclitaxel).

[0090] After seven days of treatment in a low dose of paclitaxel (TAXOL) (0.1 μΜ), only 25% of SKBR3-pBabe cells survived, while nearly 50% of SKBR3-FoxMl cells survived (Figure 4A). Cell viability was measured using CellTiter-Glo Luminescent assay (Promega, catalog No. G7570), which measures the amount of oxygenated oxyluciferin directly correlated to the amount of ATP present. This effect was also observed in MDA-MB-453 and BT474 FoxMl expressing lines (Figure 5C). Moreover, knockdown of FoxMl by siRNA in SKBR3 cells sensitized the cells to Taxol treatment as evidenced by a reduced IC5₀ value in cells transfected with FoxMl -specific siRNA (0.01 uM) as compared to cells transfected with control siRNA (0.06 uM) (Figure 4A). These results indicate that FoxMl can protect cells from paclitaxel-induced cell death.

[0091] The potential cellular bases by which FoxMl could prevent paclitaxel induced apoptosis was also investigated. Several mechanisms to counteract paclitaxel-induced apoptosis have been reported, for example, up-regulation of MDR1 (multi-drug resistant protein 1), which is a P-Glycoprotein family member that can shuttle toxins out of cells, upregulation of the CIAP (inhibitors of apoptosis) family members including survivin, and altered microtubule dynamics (Orr et ah, 2003, "Mechanisms of Taxol resistance related to microtubules," Oncogene 22: 7280-95). No effect of FoxMl on the levels of MDR1 was detected (data not shown). Also, FoxMl has been known to positively regulate the CIAP family member survivin and increased expression of survivin has been known to protect cells from Taxol. However, an increased expression of survivin was not observed in the mammary tumor cells assayed herein.

[0092] In addition, the possibility that FoxMl induced altered microtubule dynamics was investigated. Paclitaxel has been known to stabilize tubulin, and thus the ratio of polymerized to soluble microtubule fractions was compared. Cell lysates of SKBR3-pBabe and SKBR3 -FoxMl expressing lines untreated or treated with paclitaxel were fractionated to obtain polymerized and soluble tubulin fractions. Separation of polymerized and soluble fractions was done as previously described (Giannakakou et ah, 1997, "Paclitaxel-resistant human ovarian cancer cells have mutant beta-tubulins that exhibit impaired paclitaxel-driven polymerization.," J Biol Chem 272: 17118-25, incorporated by reference in its entirety herein). Briefly, cells were seeded at 80% confluency in 24-well plates, collected in hypotonic buffer (ImM MgCl₂, 2mM EGTA, 0.5% Nonidet P-40, 20mM Tris-HCl pH 6.8) and centrifuged for 10 minutes at room temperature (14,000 rpm). The supernatant was used as the soluble fraction while the pellet was used as the polymerized fraction. Without treatment, cells showed similar tubulin ratios and nearly all detectable tubulins were in the soluble form (Figure 4B). Upon treatment with paclitaxel, SKBR3-pBabe cells showed a dramatic shift towards the polymerized fraction for both a- and β-tubulin. Although FoxMl - expressing cells also showed an increase in polymerized fraction for a-tubulin, the ratio of polymerized:soluble α-tubulin was considerably lower in FoxMl -expressing cells as compared with pBabe cells (0.56: 1 FoxMl vs. 3.76: 1 pBabe) (Figure 4B). And the FoxMl- expressing cells did not show a significant change in the ratio for β-tubulin after paclitaxel treatment.

[0093] It has been previously established that increased expression and activity of the microtubule destabilizing protein stathmin can confer resistance to paclitaxel-induced apoptosis both in patient samples and cell culture (Balachandran et ah, 2003, "Altered levels and regulation of stathmin in paclitaxel-resistant ovarian cancer cells," Oncogene 22: 7280- 05; Alii et ah, 2002, "Effect of stathmin on the sensitivity to antimicrotubule drugs in human breast cancer," Cancer Res 62: 6864-9). The hallmark of increased stathmin activity is a low ratio of polymerized to soluble tubulin as was observed in FoxMl -expressing cells (Giannakakou et ah, 1997, "Paclitaxel-resistant human ovarian cancer cells have mutant beta- tubulins that exhibit impaired paclitaxel;-driven polymerization," J. Biol Chem 272: 17118- 25). To investigate this phenomenon in these cells, stathmin RNA expression in pBabe and FoxMl cell lines was compared. The results showed that the FoxMl -expressing cells expressed 2-fold more stathmin RNA compared to pBabe control cells (Figure 4C). This difference was also noted at the protein level (Figure 4C, inset). In addition, chromatin immunoprecipitation (ChIP) of SKBR3 cells was performed as described previously (Park et al, 2009, "FoxMl, a critical regulator of oxidative stress during oncogenesis," Embo J 28: 2908-18, incorporated by reference in its entirety herein). Briefly, cells were fixed in 1% formaldehyde for 10 minutes to allow crosslinking followed by quenching with 125 nM glycine. Cells were collected and lysed in SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris pH 8, protease and phosphatase inhibitors). Lysates were sonicated, pre-cleared, and incubated with anti-FoxMl antibody followed by purification with Protein-A and Protein-G Sepharose beads in the presence of salmon sperm DNA (Upstate). Beads were washed and DNA extracted using a PCR purification kit (Qiagen). The following primers were used for PCR: 5'-CAA ATG TGC TTG CCT TTT AGC C-3 ' (SEQ ID NO:29) and 5'-TGG GAT TAC AGA TGT GAG CCA CC-3' (SEQ ID NO:30) for -5793 and 5'-CAC GGT CAG ACC AAT TTC T-3' (SEQ ID NO:31) and 5'-TGA TAG GGG AGG AAG AGC AA-3' (SEQ ID NO:32) as a non-specific control.

[0094] ChIP using anti-FoxMl antibody showed enrichment of the stathmin promoter region, indicating that the observed increases in stathmin RNA and protein levels in FoxMl expressing lines were likely due to a direct interaction of FoxMl with the stathmin gene promoter (Figure 4D). Together, these studies demonstrated that SKBR3-FoxMl cell lines resistant to paclitaxel-induced apoptosis up-regulated the microtubule destabilizing protein stathmin. Example 5-FoxMl Overexpression Protects Cells from HERCEPTIN and Paclitaxel in Combination

[0095] While the success of HERCEPTIN as a single agent treating breast cancer is significant, the best therapeutic response is seen when HERCEPTIN is used in conjunction with other chemotherapeutic agents such as TAXOL. Therefore experiments were conducted to determine the role of FoxMl in resistance towards combination therapy.

[0096] Pretreatment of both SKBR3- pBabe and FoxMl cell lines for 72 hours with HERCEPTIN followed by paclitaxel treatment revealed significant differences. FoxMl - expressing cells exhibited resistance to killing by these agents when compared to control pBabe cells. For example, seven days after paclitaxel treatment, only 10-12% of pBabe cells survived, whereas the survival of FoxMl -expressing cells was greater than 40% (Figure 5A). Knockdown of FoxMl expression in SKBR3 cells sensitized these cells to combination treatment, as evidenced by a reduction of IC5₀ value in FoxMl cells transfected with FoxMl- specific siR A compared with control siR A (0.097 uM (siR A Control) vs. 0.028 uM (siRNA FoxMl)) (Figure 5B).

[0097] The effect of FoxMl on long-term combination treatment was also investigated by colony forming assays. Cell viability was measured using CellTiter-Glo Luminescent assay (Promega), which measured the amount of oxygenated oxyluciferin having a direct correlation to ATP present. For colony forming assays, 3-5 x 10³ cells were plated in triplicate in a 24-well plate, and 24 hours later were treated with 10 ug/ml of HERCEPTTN for 72 hours followed by 0.1 μΜ Taxol treatment for 4 hours. The cells were maintained in HERCEPTIN thereafter. After 17 days cells were fixed and stained with crystal violet. Quantification was done using Adobe Photoshop. All p-values were calculated using Student's t-test.

[0098] Quantification of colony numbers showed that approximately 55% of FoxMl - expressing SKBR3 cells survived after combination therapy, whereas only 26% of pBabe lines survived the treatment (Figure 5C). The ability of FoxMl to mediate resistance to combination therapy was observed also in a comparison of pBabe vs. FoxMl -expressing MDA-MB-453 (4.5 vs. 39.6%) and BT474 (2.3 vs. 31%) cell lines (Figure 5C). These results clearly indicated that FoxMl can protect breast cancer cells from treatment with HERCEPTIN and Paclitaxel in combination.

Example 6- An ARF-Derived Peptide Inhibitor of FoxMl Sensitizes Mammary Tumor Cells to HERCEPTIN Treatment

[0099] Studies have shown that FoxMl is inhibited by a small peptide that contains a 19- amino acid region of the pl9ARF protein (residues 26 to 44) (SEQ ID NO:2). This peptide has been shown to reduce proliferation and induce apoptosis of hepatocellular carcinoma cells in vivo (see, U.S. Patent Nos. 7,635,673 and 7,799,896, which are incorporated herein by reference in their entireties; see also, Gusarova et ah, 2007, "A cell-penetrating ARF peptide inhibitor of FoxMl in mouse hepatocellular carcinoma treatment," I. Clin, Invest 117:99-11 1). Treatment with the ARF-derived peptide and trastuzumab led to a 90% reduction in cell numbers in both SKBR3 and MDA-MB-453 resistant cells as measured by colony forming assays (following the same protocol as described above in Example 5) (Figure 6A). Similar results were seen in parental lines treated with the same peptide and trastuzumab (Figure 6A). Treatment of resistant cells with a mutant peptide (SEQ ID NO:79) did not change colony number compared to parental lines receiving the same mutant peptide and therefore was used as a control. [00100] The ability of the ARF -peptide to sensitize FoxMl -expressing cells to treatment was also investigated. Addition of the ARF-peptide to HERCEPTTN, paclitaxel, or combination treatment showed a dramatic reduction in cell number compared to mutant peptide. The ARF peptide sensitized pBabe cells to all treatments, resulting in greater cell killing at the same dosage as compared to the mutant peptide (Figure 6C). Most notably, addition of the ARF-peptide resulted in more than 97% cell killing in FoxMl- expressing cells, i.e., resulted in less than 3% of FoxMl -expressing cells surviving the combination treatment. The data suggested that the addition of the ARF peptides can provide chemotherapeutic and clinical benefits for breast cancer treatment with HERCEPTIN, paclitaxel, or combinations thereof.

Example 7- Characterization of FoxMl Expression in Breast Cancer and Mammary Development

Animal Model

[00101] All animal experiments were preapproved by the UIC institutional animal care and use committee. WAP-rtTA-Cre mice were obtained from the Mouse Repository of the National Cancer Institute (NCI, Frederick, MD). FoxMl FL/FL mice have been previously characterized (Wang et al., 2005, "Forkhead box Ml regulates the transcriptional network of genes essential for mitotic progression and genes encoding the SCF (Skp2-Cksl) ubiquitin ligase," Mol Cell Biol 25, 10875-94). C57BL/6 mice were purchased from Charles River Laboratories (Wilmington, MA). For deletion studies, mice were given 2 mg/mL of doxycycline (Sigma) dissolved in 5% sucrose (Sigma) solution in water bottles.

Tumor Grade Analysis

[00102] Analysis of publicly available microarray data (Oncomine, Compendia Bioscience, Ann Arbor, MI) demonstrated that FoxMl expression increased with tumor grade in human breast cancers (see Figure 7A and Figure 8A, similar results obtained from different datasets). Breast cancer datasets were exported from Oncomine to analyze expression of FoxMl and GATA-3 in human tumor arrays, which were scored by two independent pathologists. All p-values were calculated using Student's t-test. This pattern was further validated using tissue arrays that allow for analysis of expression and localization. While levels of FoxMl were faint and cytoplasmic in normal tissue as well as grade 1 tumors, staining intensity increased and became primarily nuclear in grade 3 tumors, confirming that FoxMl expression was inversely correlated with tumor differentiation (Figure 8B).

[00103] To investigate the role of FoxMl in regulating mammary differentiation, the normal expression pattern throughout key stages of postnatal mammary development was examined using quantitative RT-PCR and western blot analysis. RNA was extracted with Trizol (Invitrogen) and cDNA was synthesized by reverse transcriptase (Bio-Rad). cDNA was amplified using SYBR Green mastermix (Bio-Rad) and analyzed via iCycler software and the delta-delta C_t method. Data from mouse studies was normalized to 18S RNA and from human studies to GAPDH. All primer sequences are shown in Table 1 below. For western blot analysis, tissue protein extracts were homogenized in lysis buffer containing: 50mM Hepes-KOH, 300mM NaCl, ImM EDTA, lmM EGTA, ImM DTT, 0.1% Tween 20, and 10% glycerol. Extracts from cell lines were prepared in lysis buffer containing: ImM EDTA, 0.15M NaCl, 0.05M Tris-HCl pH 7.5, and 0.5% Triton-X. Phosphatate Inhibitor Cocktail Set II (Calbiochem) and protease inhibitor (Roche) were added to lysis buffers before each experiment.

[00104] FoxMl was detected at the RNA (Figure 8C) and protein (Figure 8D) levels during puberty (5 weeks), adulthood (8 weeks), pregnancy (days 6 and 18), lactation, and involution in mice. FoxMl expression levels varied considerably: pregnancy, a period of ductal growth and expansion showed highest levels of expression, while involution, characterized by apoptosis and remodeling, exhibited the lowest expression. This pattern was also reflected at the protein level by immunohistochemistry (Figure 8E). For immunohistochemistry, glands were fixed in modified Davidson's fixative (30% of 37% formaldehyde- 15%) ethanol-5%> acetic acid) for 48 hours, rinsed in PBS, left in 10%> PBS- buffered formalin overnight and embedded in paraffin. For staining, antigen retrieval was done using sodium citrate buffer (lOmM sodium citrate, pH 6.0 and 0.05% Tween) and anti- FoxMl antibodies (Santa Cruz Biotechnology, K-19) were incubated overnight at a 1 :50 dilution. Visualization was done using an avidin-biotin conjugate (ABC) and 3,3'- diaminobenzidine (DAB) and counterstained using Hematoxylin (Polyscientific). [00105] Mammary terminal end buds are present during puberty in the mouse (5-6 weeks of age). This structure is of particular significance because the cap cells or those found in the invading front make up the progenitor cell population (Williams and Daniel, 1983, "Mammary ductal elongation: differentiation of myoepithelium and basal lamina during branching morphogenesis," Dev Biol 97:274-90; Smalley and Ashworth, 2003, "Stem cells and breast cancer: A field in transit," Nat Rev Cancer 3 :832-44). Strong nuclear staining for FoxMl was observed in cap and progenitor cells (Fig. 8E, top left). At all stages of development FoxMl expression was primarily found in cells of luminal lineage.

[00106] To confirm this observation, in situ hybridization was employed to identify FoxMl mRNA followed by immunostaining for luminal and myoepithelial cell types. For in situ hybridization, 322 bp mouse FoxMl probes were amplified from cDNA using the following primers: 5 ' -GCTATCCAACTCCTGGGAAGATTC-3 ' sense (SEQ ID NO:33) and 5 ' -CAATGTCTCCTTGATGGGGGTC-3 ' antisense (SEQ ID NO:34). T7 polymerase (Ambion) and digoxigenin (DIG)-labeled nucleotides (Roche) were used to make labeled RNA probes. Labeling of paraffin-embedded sections was performed using the IsHyb in situ hybridization kit (Biochain). Sections were counterstained in nuclear fast red (Vector Labs) or fixed briefly in paraformaldehyde and stained using antibodies to smooth muscle actin or cytokeratin 18 as indicated.

[00107] The results of these experiments showed a clear overlap of FoxMl antisense probe hybridization and cytokeratin 18 immunostaining, indicating that FoxMl was expressed mainly in luminal cells (Figure 7B). The timing and pattern of expression suggested that FoxMl levels were higher in cells that were less differentiated. Previously defined flow cytometry markers were used to separate mammary stem cells (CD29hi), luminal progenitors (CD291o, CD61+), and differentiated luminal cells (CD291o, CD61-) (Stingl et al, 2006, "Purification and unique properties of mammary epithelial stem cells," Nature 439:993-7; Shackleton et al., 2006, "Generation of a functional mammary gland from a single stem cell," Nature 439:84-8; Asselin-Labat et al., 2007, "Gata-3 is an essential regulator of mammary- gland morphogenesis and luminal-cell differentiation," Nat Cell Biol 9:201-9). These cell types were sorted from 8-week old C57BL/6 mice. Total RNA from sorted cells was analyzed for FoxMl expression using quantitative RT-PCR as described above. The level of FoxMl in stem cells was ten-fold higher than differentiated cells while luminal progenitors showed a nearly 50-fold increase (Figure 8F). Expression of cytokeratin 18 and smooth muscle actin (SMA) were used to determine the purity of luminal and myoepithelial populations respectively (Figure 8F). Taken together, these results demonstrated that FoxMl expression is highest in luminal progenitor cells and decreased upon differentiation. Table 1 Primers Information

Example 8-Acute Loss of FoxMl Results in Expansion of Differentiated Luminal Cells

[00108] FoxMl deletion in mammary tissue in transgenic mice was analyzed to determine if endogenous FoxMl regulates luminal cell differentiation. Transgenic mice harboring mammary-specific doxycycline-inducible Cre construct (WAP-rtTA-Cre) were crossed with transgenic mice harboring the FoxMl gene flanked by LoxP sites (FoxMl FL/FL). The FoxMl FL/+ and FoxMl FL/FL littermates, expressing the inducible Cre, were given doxycycline in their drinking water for 5 or 15 days. After 5 days of treatment, mammary glands were sorted into stem cells, luminal progenitors, and differentiated luminal cells to determine the pattern of FoxMl deletion. An 80% reduction of FoxMl expression in luminal progenitors and 90% in differentiated luminal cells was observed while stem cells did not show a significant reduction (Figure 9A). This pattern was similar to previous reports using the WAP promoter to drive Cre expression for gene knockout studies (Jiang et ah, 2010, "Rb deletion in mouse mammary progenitors induces luminal-B or basal-like/EMT tumor subtypes depending on p53 status," J Clin Invest 120: 3296-309).

[00109] Following 5 days of treatment with doxycycline, FoxMl protein was still detectable by immunohistochemistry. However, after 15 days of doxycycline administration, FoxMl protein was no longer detectable by immunostaining (Figure 9C). Thereafter, mammary glands were removed for carmine alum whole mount staining by spreading the gland on glass slides and placed in Carnoy's fixative (60% ethanol, 30% chloroform and 10% glacial acetic acid) overnight. Glands were hydrated in an alcohol gradient and left in carmine alum (Sigma) overnight then cleared in xylene. For green fluorescent protein (GFP) imaging, glands were removed, spread on a glass slide, fixed in 4% paraformaldehyde overnight, cleared in 50% glycerol in PBS for 4 hours, then 75% glycerol for 4 hours, and then 100% glycerol overnight. Glands were imaged using a fluorescent dissecting microscope. Whole-mount staining using carmine alum showed that FoxMl FL/FL, WAP- rtTA-Cre mice had sparse and narrow ductal branching while FoxMl FL/+ appeared identical to wildtype mice (Figure 9B). Wildtype and WAP-rtTA-Cre expressing mice showed structures and staining patterns indistinguishable from FoxMl FL/+ mice, indicating an absence of Cre toxicity and that FoxMl FL/+ mice were valid controls. On closer examination of recombinant glands by sectioning, FoxMl FL/FL WAP-rtTA-Cre mice showed a loss of FoxMl, confirming that the gene was deleted, while FL/+ mice showed FoxMl staining that mirrored the normal gland. FoxMl FL/FL mice exhibited abnormal histological staining by H&E. Unlike in normal mammaries, glands from FoxMl FL/FL WAP-rtTA-Cre mice were not composed of a single layer of epithelial cells and the lumens were filled with cells that expanded beyond the myoepithelial layer. Staining of cytokeratin 18 and estrogen receptor alpha indicated that these cells were differentiated luminal epithelium, suggesting an expansion of the differentiated pool (Figure 9C).

[001 10] Stem, progenitor, and differentiated pools were analyzed after 15 days of treatment to examine the effects of FoxMl deletion on mammary cell subtypes. There was found an approximate 20% increase in the percentage of differentiated luminal cells in these pools with a concomitant loss in stem and progenitor populations demonstrating that loss of FoxMl in mammary gland resulted in a shift towards the differentiated state (Figure 9D). Consistent with that observation, deletion of FoxMl resulted in an increase in markers of luminal differentiation, including estrogen receptor alpha, amphiregulin, cytokeratin 18, and cadherin 11 (Figure 9E). Taken together, these data demonstrated that loss of FoxMl in the adult gland led to an increase in differentiated cells and a loss of progenitor pools. [001 11] In other experiments, mouse mammary gland was regenerated with elevated levels of FoxMl to examine the consequences of high levels of FoxMl on mammary differentiation. Primary mammary epithelial cells were used to generate mammosphere cultures as previously described (Dontu et ah, 2003, "In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells," Genes Dev 17: 1253-70, incorporated in its entirety by reference herein). Specifically, the No. 4 inguinal mammary glands were removed from 6-8 week old C57BL/6 mice. Glands were digested for 6 hours in collagenase/hyaluronidase, cells collected by centrifugation, red blood cells lysed using a 0.8% ammonium chloride solution, and glands further digested using 0.25% trypsin (Cellgro) and dispase. DNasel (Sigma, lOug/ml) was used to remove DNA from dead cells. Cells were suspended in Hanks' balanced salt solution and 2% FBS and filtered through 0.4 uM strainer (BD Biosciences). Cells were counted and incubated with retrovirus as described below. All reagents were from Stem Cell Technologies unless otherwise noted.

[001 12] The plasmid construct pMigR-FoxMl-EGFP was generated by cloning FoxMl cDNA into the pMigR-EGFP plasmid (Luk Van Parijis et al, 1999, Immunity U_:281). Cells were plated at 40% confluency and infected with retroviral constructs using lipofectamine2000 (Invitrogen). After 24 hours, media were changed to 3% FBS and DMEM and fresh virus was used to infect mammospheres. DMEM with low FBS concentration at 3% was used to minimize the FBS that stem cells were exposed to. Fresh virus in the volume of 2 ml was added to mammosphere cells from above along with lOug/ml polybrene. Cells were incubated with virus at 37°C for 120 minutes and gently mixed every 20 minutes. After 2 hours, cells were centrifuged, supernatant was removed, and cells were resuspended in media containing DMEM/F 12 (Invitrogen/Gibco), serum-free B27 (Gibco), 20ng/mL EGF (Peprotech), 20ng/ml FGF (Peprotech), 4μg/mL Heparin (Sigma), and Penicillin/Streptamycin (Cellgro, 100U of penicillin, lOOug of Streptamycin). Cells were plated at a density of 5 x 10⁵/75cm² flask. Spheres were allowed to form for 7 days.

[001 13] At the end of 7 days spheres were collected, digested in 0.05% trypsin for 10 minutes at 37°C, resuspended in Hanks' balanced salt solution and 2% FBS, centrifuged, and suspended in fresh media at a concentration of 1 x 10⁶/ml. GFP, dsRed (red fluorescent protein), or double positive cells were sorted using Beckman Coulter MoFlo sorter and Summit software. One thousand sorted cells were resuspended in matrigel (BD Biosciences) and were implanted into the cleared mammary fat pad of 3-4 week old C57BL/6 mice as previously described (DeOme et ah, 1959, "Development of mammary tumors from hyperplastic alveolar nodules transplanted into gland-free mammary fat pads of female C3H mice," Cancer Res 19:515-20, incorporated in its entirety by reference herein). All data are shown normalized to the control gland from the same animal. All analyses were performed after 7-8 weeks of regrowth. [001 14] GFP-positive mammosphere cells were identified by sorting and injected into the cleared fat pads of 3-4 week old mice. GFP and GFP-FoxMl positive cells were placed on contralateral sides of the same animal, allowing each animal to function as their own control (Figure 10A). Addition of retrovirus or GFP did not have an effect on mammary development as glands expressing GFP mirrored those of wildtype mice. Carmine alum whole mount staining and GFP staining and imaging were done as described above. On whole mount analysis, GFP-FoxMl glands showed a considerable narrowing in comparison to their GFP counterparts (Figure 10B). Regenerated glands were sectioned and stained to analyze the architecture of individual ducts. GFP glands showed the expected staining pattern, a single layer of epithelial cells surrounded by myoepithelial cells. GFP-FoxMl expressing glands showed two distinct phenotypes within the same gland by H&E staining: hyperplastic features and an "empty lumen." The "empty lumen" was observed less often and was made up of a region where basal cells were present but luminal cells were absent. Hyperplastic regions showed excessive cell infiltration, which led to distorted lumen architecture, with epithelial cells filling the lumen or spreading beyond the basal layer (Figure IOC and Figure 1 1A).

[001 15] To further investigate the altered architecture of FoxMl -expressing glands, sections were stained with markers of myoepithelial and luminal cell lineages. Staining with the basal marker, smooth muscle actin (SMA), revealed that GFP glands, as expected, showed a ring of SMA positive cells surrounding the lumen, FoxMl expressing glands, however, showed SMA-positive cells surrounded by luminal cells (Figure IOC). This phenotype was previously observed in glands expressing shRNA to Cbf-1 (a notch cofactor) and was correlated with an expansion of undifferentiated mammary cells (Bouras et al., 2008, "Notch signaling regulates mammary stem cell function and luminal cell-fate commitment," Cell Stem Cell 3 :429-41). These cells did not stain positive with the basal marker p63, indicating that they were not misplaced myoepithelial cells (Figure 1 IB).

[001 16] Cytokeratin 18 staining shows a uniform luminal restricted staining pattern (Hennighausen, et al., 2005, "Information networks in the mammary gland," Nat Rev Mol Cell Biol 6:715-25). GFP glands exhibited this typical staining pattern, while FoxMl glands showed a punctate pattern distinct from differentiated luminal cells (Figure IOC). The expanded cells did not stain positive for estrogen receptor alpha, indicating an expansion of an undifferentiated cell of luminal origin (Figure IOC). These results were supported by staining for CD61, a marker of luminal progenitors: glands expressing FoxMl exhibited an increased number and intensity of CD61 positive cells as compared to control glands (Figure 10D).

[001 17] To confirm expansion of an undifferentiated cell type in FoxMl -expressing glands, cell populations were analyzed using flow cytometry. For cell cycle analysis by flow cytometry, cells were trypsinized, pelleted, and resuspended in propidium iodide (PI) solution (50ug/ml PI, O. lmg/ml RNaseA, 0.05% Triton-X; all reagents were purchased from Sigma). After 40 minutes of incubation at 37°C, cells were analyzed using a flow cytometer. Glands were processed using sequential enzyme digestion, blocked using an antibody to CD16/CD32 and hematopoietic stem cells were removed using an epithelial cell enrichment kit (Stem Cell Technologies). Cells were stained using CD24-PE (BD Biosciences), CD29-APC (e- Biosciences), CD61-biotin and streptavidin PE-Cy7 (BD Biosciences). Mammary gland comprising two retroviruses (GFP- and dsRed-expressing) were stained using CD24-PE-Cy7 (BD Biosciences), CD29-APC, and CD61-biotin and streptavidin pacific blue (BD Biosciences). Analysis was done using a Beckman-Coulter flow cytometer and Summit software.

[001 18] Comparing FoxMl to paired GFP controls showed a distinct shift away from the differentiated state. The luminal progenitor pool expanded considerably, nearly 20%, with a similar reduction in the percentage of differentiated cells, suggesting that addition of FoxMl resulted in a failure of cells to properly exit the luminal progenitor pool and differentiate fully (Figure 10E). Consistent with this notion, RT-PCR data showed a reduction in estrogen receptor alpha, amphiregulin, cytokeratin 18, and cadherin 1 1, markers of luminal differentiation (Figure 10F). Example 10-FoxMl is a Negative Regulator of GATA-3 in Vivo

[001 19] GATA-3 is considered as a master regulator of mammary differentiation. GATA- 3 expression in both FoxMl deletion and over-expression transgenic mouse models was analyzed to investigate if FoxMl functions as a negative regulator of GATA 3. Protein extracts from mammary tissue were homogenized in lysis buffer containing: 50mM Hepes- KOH, 300mM NaCl, ImM EDTA, ImM EGTA, ImM DTT, 0.1% Tween 20, and 10% glycerol. Extracts from cell lines were prepared in lysis buffer containing: ImM EDTA, 0.15M NaCl, 0.05M Tris-HCl pH 7.5, and 0.5% Triton-X. Phosphatate Inhibitor Cocktail Set II (Calbiochem) and protease inhibitor (Roche) were added to the lysis buffers before each experiment; all reagents are from Sigma-Aldrich unless otherwise noted. Glands in which FoxMl was deleted showed a considerable increase in GATA-3 protein levels by western blot analysis. Conversely, GATA-3 protein levels were significantly decreased in GFP- FoxMl expressing glands compared to their GFP counterparts (Figure 12 A). Immunohistochemical staining also reflected the decrease in protein levels (Figure 12B). GATA-3 generally showed a pattern of strong nuclear staining in luminal cells and that was evident in control glands (Figure 12B). FoxMl deletion resulted in increased staining intensity while over-expression resulted in decreased and diffuse staining pattern for GATA- 3 (Figure 12B)

[00120] GATA-3 RNA expression in sorted populations from glands from FoxMl deleted and over-expressing transgenic mice was analyzed. RNA was extracted with Trizol (Invitrogen) and cDNA was synthesized by reverse transcriptase (Bio-Rad). cDNA was synthesized and amplified as described above. Data from mouse studies were normalized to 18S RNA and from human studies to GAPDH. All primer sequences are shown in Table 1. After Cre- mediated deletion of FoxMl, a five-fold increase in GATA-3 mRNA was observed in differentiated cells. Stem cells did not show any change, which was expected given that FoxMl was not deleted in that population. Additionally, there was a slight (but not significant) increase in GATA-3 in the luminal progenitors (Figure 12C). FoxMl expression in the over-expression transgenic mouse model exhibited increase of FoxMl in all cell types. Accordingly, glands expressing FoxMl displayed a significant reduction in GATA-3 in stem and luminal progenitors, while differentiated cells showed higher expression of GATA-3 (Figure 12C). This unexpected finding in differentiated cells could be attributed to the possibility that when FoxMl was upregulated, an elevated expression of GATA-3 was required for the cells to maintain the differentiated state.

[00121] The mouse GATA-3 promoter contains three FoxMl consensus sequences within 2kb of the transcriptional start site. Whether FoxMl directly regulated GATA-3 at the RNA level was investigated using chromatin immunoprecipitation (ChIP) assay. Cells were fixed in 1% formaldehyde for 10 minutes to allow crosslinking and then quenched with 125nM glycine. For in vivo ChIP assays, single cell suspensions were generated using collagenase/hyaluronidase followed by fixing. Cells were collected and lysed in SDS lysis buffer (1% SDS, lOmM EDTA, 50mM Tris pH 8, protease and phosphatase inhibitors). Lysate was sonicated, pre-cleared, and incubated with antibodies against GFP (Clontech, JL- 8), GATA-3 (Santa Cruz HG3-31), FoxMl (Major et al, 2004, "Forkhead box M1B transcriptional activity requires binding of Cdk-cyclin complexes for phosphorylation- dependent recruitment of p300/CBP coactivators" Mol Cell Biol 24: 2649-61), DNMT3b (Imgenex 52A1018), or Rb (Cell Signaling, 4H1) followed by purification with Protein-A and Protein-G Sepharose beads in the presence of salmon sperm DNA (Upstate). Beads were washed and DNA extracted using a PCR purification kit (Qiagen). PCR products were visualized by gel electrophoresis or analyzed using SYBR Green (Bio-Rad), normalized to the IgG control (Santa Cruz Biotechnology). PCR primer sequences are provided in Table 1.

[00122] In vivo chromatin immunoprecipitation assay showed that FoxMl bound to all of these sites in the regenerated mouse mammary gland (Figure 12D). Taken together, the data indicated that FoxMl can bind and repress transcription of GATA-3 in mice in vivo. [00123] To determine whether inhibition of mammary luminal differentiation by FoxMl was linked to repression of GATA-3, GATA-3 was coexpressed with FoxMl using retroviruses in mammary stem cells. The plasmid construct pMigR-FoxMl-EGFP was generated by cloning FoxMl cDNA into pMigR-EGFP (Luk Van Parijs et ah, supra). The pMigR-dsRed plasmid construct was made by substituting EGFP with dsRed (Clontech) in pMigR, and the GATA-3-dsRed construct was made by cloning PCR amplified GATA-3 cDNA into pMigR-dsRed. After sorting for expression, these cells were used to regenerate mammary epithelium as described schematically in Figure 10A. Reconstituted glands were harvested and cell populations analyzed by FACS analysis. Coexpression of GATA-3 reversed the defects observed in FoxMl- expressing mammary glands. Sorting of glands into stem cells, luminal progenitors, and differentiated cells indicated a significant reversal of the FoxMl phenotype by coexpression of GATA-3 (Figure 12E). These observations suggested that repression of GATA-3 was involved in FoxMl inhibition of mammary progenitor differentiation.

Example 11-FoxMl Promotes GATA-3 Methylation in an Rb-Dependent Manner

[00124] The results set forth in Example 10, showing that FoxMl inhibits GATA-3, suggested an inverse correlation between GATA-3 and FoxMl expression in breast tumor samples. Analyses of publicly available database for FoxMl and GATA-3 expression patterns in human samples were consistent this this expectation (Figure 13 A). In addition, direct binding of FoxMl to human GATA-3 promoter was confirmed. Bioinformatic analysis identified three putative binding sites for FoxMl in the 2kb upstream of the transcriptional start site. Chromatin immunoprecipitation assay (ChIP) (performed under the same protocol described in example 11) showed that FoxMl bound to all three of these sites and not to a non-specific control sequence, indicating that FoxMl could regulate GATA-3 transcriptional levels in human breast cancer cells (Figure 13B).

[00125] Previous studies showed that the promoter of GATA-3 could be targeted for DNA methylation during tumor progression (Yan et ah, 2000, "CpG island arrays: an application toward deciphering epigenetic signatures of breast cancer," Clin Cancer Res 6: 1432-8). To test if GATA-3 repression by FoxMl was methylation dependent, FoxMl binding to and inhibition of GATA-3 was measured in the presence of the methyltransferase inhibitor, 5'azacytidine (5ΆΖΑ). Addition of 5ΆΖΑ ablated repression of GATA-3 by FoxMl in the human breast cancer cell line MDA-MB-453, demonstrating that repression is methylation dependent (Figure 13C). In mammalian systems, methylation patterns are generated and maintained by the DNA methyltransferase family of proteins including, DNMT1, DNMT3a, and DNMT3b (Jones and Baylin, 2002, "The fundamental role of epigenetic events in cancer," Nat Rev Genet 3:415-28). DNMT1 is responsible for replication-associated methylation, while DNMT3a and 3b are considered to be "de novo" methylators, responsible for dynamic changes in cellular methylation patterns. Immunoprecipitation experiments demonstrated that FoxMl bound to both DNMT3a and DNMT3b (Figure 13D). [00126] DNMT3b has been specifically implicated in mammary tumor biology. It was shown to be responsible for the hypermethylated phenotype in mammary tumors and decreased expression of tumor suppressor genes (Girault et al., 2003, "Expression analysis of DNA methyltransferases 1, 3 A, and 3B in sporadic breast carcinomas," Clin Cancer Res 9: 4415-22; Roll et al., 2008, "DNMT3b overexpression contributes to a hypermethylator phenotype in human breast cancer cell lines," Mol Cancer 7: 15). The possibility that FoxMl could function in a complex with DNMT3b and target the GATA-3 promoter for methylation was investigated. ChIP assay was performed as described in previous examples using an antibody specific to DNMT3b. Cells were treated with either siRNA to FoxMl or control siRNA. In the presence of control siRNA, DNMT3b bound to regions of the GATA-3 promoter that contain FoxMl binding sites. The binding was significantly decreased when cells were treated with siRNA to FoxMl, indicating that DNMT3b binds to the GATA-3 promoter at -747 and -1431 in a FoxMl dependent manner (Figure 13E).

[00127] Previous studies indicated that the tumor suppressor Rb can bind to FoxMl (Major et al., 2004, "Forkhead box M1B transcriptional activity requires binding of Cdk- cyclin complexes for phosphorylation-dependent recruitment of p300/CBP coactivators," Mol Cell Biol 24:2649-61 ; Wierstra et al, 2006, "Transcription factor FOXMlc is repressed by RB and activated by cyclin Dl/Cdk4," Biol Chem 387:949-6) and the binding was confirmed by the current studies (Figure 14A). Whether FoxMl requires Rb for repressing GATA-3 transcription was investigated using a doxycycline-inducible shRNA system in MCF7 cells to knockdown Rb expression (Figures 14B and 14C). To produce the inducible knockdown system, MCF7 cells were first infected with viral particles carrying the pRetroX-Tet-off Advanced vector (Clontech) to establish constitutive expression of the tetracycline-controlled trans activator, tTa-Advanced. Cells with stably integrated constructs were selected by using G418 sulfate for two weeks. Isogenic clones were isolated by plating the cells in limiting dilutions on 10cm plates, and tTA-Advanced expression was validated by RT-qPCR. Inducibility was assessed by infecting tTA-Advanced positive cells with retroviral particles comprising the pRetroX-Tight-Pur-Luc construct that expresses a tTA-inducible luciferase reporter. Infection continued for three days and Luciferase assay was performed using the Luciferase Dual Reporter Assay System (Promega, catalog No. E1910). Clones showing the highest tTA-Advanced expression and luciferase inducibility were used to produce second stable lines. In all, -10 clones were isolated per line, all of which showed at least some expression of tTA-Advanced. The clone showing greater than 20-fold inducibility by luciferase assays was used to produce the second stable lines.

[00128] The second stable cell lines carrying vector for expressing miR-30-based shRNA specific to Rb, or the empty control vector TGM, were made by infecting tTA-Advanced expressing clones with TMP-RB.670¹ retroviral particles ("RB670"), or control retroviral particles, and selecting under puromycin dihydrochloride for several days for cells harboring integrated constructs. Individual clones were generated by limiting dilutions on 10 cm plates and validated by performing induction assays for 6 days. In particular, clones were evaluated for inducible GFP expression via fluorescent microscopy as well as western blot analysis for pRB protein level.

[00129] In the absence of Rb, addition of FoxMl failed to repress GATA-3 and in fact led to a considerable increase of GATA3 expression (Figure 15A). Additionally, ChIP experiments as previously described in previous examples were conducted using control siRNA or siRNA specific to FoxMl to show that Rb binding to GATA-3 promoter was FoxMl dependent (Figure 15B). The ChIP data showed that Rb could not bind to the GATA- 3 promoter in the absence of FoxMl (Figure 15B). [00130] The methylation status of the GATA-3 promoter using methylation-specific PCR was studied. Genomic DNA was isolated using Perfect Pure DNA isolation kit (5 Prime). Bisulfite conversion for determining methylation was performed using EZ DNA Methylation kit (Zymo Research). Conversion efficiency was determined to be greater than 95% using primers to converted and unconverted beta actin. Bisulfite-converted DNA was amplified using methylation-specific PCR as described (Herman et ah, 1996, "Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands," Proc Natl Acad Sci U S A 93 : 9821-6; Liu et ah, 2009, "The 14-3-3sigma gene promoter is methylated in both human melanocytes and melanoma," BMC Cancer 9: 162, each of which are incorporated by reference in their entireties herein). Those primers (SEQ ID NOs:59-64) did not amplify non- converted DNA but did amplify Sssl methylase treated, bisulfite-converted DNA. Expression of FoxMl led to a considerable increase in methylation of GATA-3 compared to control transfection. This increase was ablated in the absence of Rb (Figure 15C), demonstrating that the methylation and subsequent repression of GATA-3 was Rb-dependent. Mouse mammary glands expressing scrambled shRNA or RB-specific shRNAs (SEQ ID NOs:80-83), either in the presence or absence of FoxMl, were generated to study whether knockdown of Rb in vivo ablated FoxMl -mediated inhibition of differentiation. The No. 4 inguinal mammary glands were removed from 6-8 week old C57BL/6 mice. Glands were digested for 6 hours in collagenase/hyaluronidase. Cells were collected by centrifugation, red blood cells lysed using a 0.8 % ammonium chloride solution, and glands further digested using 0.25% trypsin (Cellgro) and dispase. DNasel (Sigma) was used to remove DNA from dead cells. Cells were suspended in Hanks' balanced salt solution and 2% FBS and filtered through 0.4uM strainer (BD Biosciences). Cells were counted and incubated in retrovirus as described below. All reagents are from Stem Cell Technologies unless otherwise noted.

[00131] As disclosed above, the pMigR-FoxMl-EGFP plasmid construct was generated by cloning FoxMl cDNA into pMigR-EGFP. pMigR-dsRed was made by replacing EGFP in pMigR with dsRed expression construct (Clontech) and GATA-3 -dsRed was made by cloning the PCR amplified GATA-3 cDNA into pMigR-dsRed. Scrambled and shRNA constructs against Rbl were purchased from Origene. Retrovirus was generated using 293 Ampho packaging cell line. Cells were plated at 40% confluency and transfected with retroviral constructs using lipofectamine2000 (Invitrogen). After 24 hours, media was changed to 3% FBS and DMEM and fresh virus was used to infect mammospheres. Low DMEM was used to minimize the FBS that stem cells are exposed to. 2ml of fresh virus was added to mammosphere cells from above along with lOug/ml polybrene. Cells were incubated with virus at 37°C for 120 minutes and gently mixed every 20 minutes. After 2 hours, cells were centrifuged, supernatant was removed, and cells were resuspended in media containing DMEM/F 12 (Invitrogen/Gibco), serum-free B27 (Gibco), 20ng/mL EGF (Peprotech), 20ng/ml FGF (Peprotech), 4μg/mL Heparin (Sigma), and Penicillin/Streptamycin (Cellgro). Cells were plated at a density of 5 x 10⁵/75cm² flask. Spheres were allowed to form for 7 days.

[00132] At the end of 7 days spheres were collected, digested in 0.05% trypsin for 10 minutes at 37°C, resuspended in Hanks' balanced salt solution and 2% FBS, centrifuged, and suspended in fresh media at a concentration of 1 x 10⁶/ml. GFP, dsRed, or double positive cells were sorted using Beckman Coulter MoFlo sorter and Summit software. One thousand sorted cells were resuspended in matrigel (BD Biosciences) and were implanted into the cleared mammary fat pad of 3-4 week old C57BL/6 mice as previously described (DeOme 1959, supra). All data were normalized to the control gland from the same animal. All analysis was performed after 7-8 weeks of regrowth.

[00133] The cell sorting experiments demonstrated that expression of FoxMl led to an inhibition of differentiation that was alleviated by the knockdown of Rb (Figure 15D). Taken together, the data suggested that FoxMl functions in a complex with DNMT3b and Rb to inhibit GATA-3 expression and mammary luminal differentiation.

[00134] Having described the invention in detail and by reference to specific embodiments thereof, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims. More specifically, although some aspects of the present invention are identified herein as particularly advantageous, it is contemplated that the present invention is not necessarily limited to these particular aspects of the invention.

Claims

What is claimed is:

1. A pharmaceutical composition for inhibiting tumor growth comprising a combination of a FoxMl inhibitor and either trastuzumab or paclitaxel, wherein the combination is in a therapeutically effective amount, and a pharmaceutically acceptable excipient, diluent or carrier.

2. The pharmaceutical composition of claim 1 wherein the combination comprises a FoxMl inhibitor and trastuzumab.

3. The pharmaceutical composition of claim 1 wherein the combination comprises a FoxMl inhibitor and paclitaxel.

4. The pharmaceutical composition of claim 1 wherein the combination comprises a FoxMl inhibitor and trastuzumab and paclitaxel.

5. The pharmaceutical composition of any one of claims 1-4 wherein the FoxMl inhibitor comprises an inhibitory P I 9ARF peptide.

6. The pharmaceutical composition of claim 5 wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7.

7. The pharmaceutical composition of claim 6, wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO:6.

8. The pharmaceutical composition of any one of claims 1-4 wherein the FoxMl inhibitor comprises a FoxMl -specific siRNA.

9. The pharmaceutical composition of claim 8, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: l l.

10. The pharmaceutical composition of claim 9, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:9.

1 1. The pharmaceutical composition of any one of claims 1-4 wherein the FoxMl inhibitor comprises a thiazole antibiotic.

12. The pharmaceutical composition of claim 1 1, wherein the thiazole antibiotic is siomycin A or thiostrepton.

13. The pharmaceutical composition of any one of claims 1-4 wherein the FoxMl inhibitor is an antioxidant.

14. The pharmaceutical composition of claim 13 wherein the antioxidant is N-acetyl-L- cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

15. A method of treating breast cancer in a patient comprising the step of administering to a patient in need thereof the pharmaceutical composition of any one of claims 1-14, wherein the breast cancer cells are HER2/ErbB2 positive.

16. The method of claim 15, wherein the breast cancer is resistant to trastuzumab treatment or paclitaxel treatment.

17. The method of claim 15, wherein the breast cancer is sensitive to trastuzumab treatment or paclitaxel treatment.

18. The method of any one of claims 15-17 wherein the FoxMl inhibitor comprises an inhibitory P 19ARF peptide.

19. The method of claim 18 wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7.

20. The method of claim 19, wherein the inhibitory P 19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6.

21. The method of any one of claims 15-17 wherein the FoxMl inhibitor comprises a FoxMl -specific siRNA.

22. The method of claim 21, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11.

23. The method of claim 22, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:9.

24. The method of any one of claims 15-17 wherein the FoxMl inhibitor comprises a thiazole antibiotic.

25. The method of claim 24, wherein the thiazole antibiotic is siomycin A or thiostrepton

26. The method of any one of claims 15-17 wherein the FoxMl inhibitor comprises an antioxidant.

27. The method of claim 26, wherein the antioxidant is N-acetyl-L-cysteine (NAC),

catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or

manganese(III)-5, 10, 15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

28. A method of treating HER2/ErbB2 positive breast cancer in a patient comprising the steps of

(a) obtaining a breast cancer tissue sample from a patient in need of the treatment, wherein the breast cancer tissue sample is HER2/ErbB2 positive;

(b) detecting FoxMl expression in the breast cancer tissue sample using a reagent that specifically detects FoxMl ; and

(c) administering to the patient a FoxMl inhibitor and trastuzumab or paclitaxel or both trastuzumab and paclitaxel if FoxMl expression is detected in the breast cancer tissue sample.

29. The method of claim 28, wherein FoxMl expression is detected in the nucleus of the cells of the breast cancer tissue sample.

30. The method of claim 28 or 29 further comprising, the steps of obtaining a control breast tissue sample and assaying the control breast tissue sample to detect FoxMl expression therein, wherein in step (c) a FoxMl inhibitor is administered to the patient with trastuzumab or paclitaxel or both trastuzumab and paclitaxel if FoxMl expression is greater in the breast cancer tissue sample than in the control breast tissue sample.

31. The method of any one of claims 28-30 wherein the FoxMl inhibitor comprises an inhibitory P 19ARF peptide.

32. The method of claim 31 wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7.

33. The method of claim 32, wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6.

34. The method of claim any one of claims 28-30 wherein the FoxMl inhibitor comprises a FoxMl -specific siRNA.

35. The method of claim 34, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11.

36. The method of claim 35, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:9.

37. The method of any one of claims 28-30 wherein the FoxMl inhibitor comprises a thiazole antibiotic.

38. The method of claim 37, wherein the thiazole antibiotic is siomycin A or thiostrepton

39. The method of any one of claims 28-30 wherein the FoxMl inhibitor comprises an antioxidant.

40. The method of claim 39 wherein the antioxidant is N-acetyl-L-cysteine (NAC),

catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or manganese(III)-5, 10, 15,20-tetrakis(N-methylpyridinium-2-yl)porphyrin pentachloride (MnTM-2-PyP).

41. A method of identifying trastuzumab-resistant or paclitaxel-resistant breast cancer in a patient, wherein the breast cancer is HER2/ErbB2 positive, comprising the steps of

(a) obtaining a breast cancer tissue sample from a patient having breast cancer that is HER2/ErbB2 positive; and

(b) detecting FoxMl expression in the breast cancer tissue sample using a reagent that specifically detects FoxMl,

wherein detection of FoxMl expression in the breast cancer tissue sample indicates that the breast cancer is trastuzumab-resistant or paclitaxel-resistant.

42. The method of claim 41, wherein FoxMl expression is detected in the nucleus of the cancer cell.

43. The method of claim 41 or 42 further comprising the steps of obtaining a control breast tissue sample and assaying the control breast tissue sample to detect FoxMl expression therein, wherein the breast cancer is trastuzumab-resistant or paclitaxel- resistant if FoxMl expression is greater in the breast cancer tissue sample than FoxMl expression in the control breast tissue sample.

44. The method of any one of claims 41-43, wherein the reagent comprises one or more FoxMl -specific primers, and the level of FoxMl expression is determined by reverse- transcriptase polymerase chain reaction (RT-PCR).

45. The method of any one of claims 41-43, wherein the reagent is a FoxMl -specific antibody and the level of FoxMl expression is determined by an immunoassay.

46. A method of reducing the risk of developing trastuzumab resistance or paclitaxel resistance in a patient with breast cancer comprising the step of administering to a patient in need thereof a FoxMl inhibitor, wherein the breast cancer is HER2/ErbB2 positive.

47. A method of treating a paclitaxel-resistant breast tumor in a patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor and paclitaxel, wherein a combination of the FoxMl inhibitor and paclitaxel effectively inihibits a paclitaxel-resistant breast tumor.

48. A method of treating a trastuzumab-resistant breast tumor in a patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor and trastuzumab, wherein a combination of the FoxMl inhibitor and trastuzumab effectively inhibits trastuzumab-resistant breast tumor, and wherein the breast tumor is HER2/ErbB2 positive.

49. The method of any one of claims 46-48 wherein the FoxMl inhibitor comprises an inhibitory P 19ARF peptide.

50. The method of claim 49 wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7.

51. The method of claim 50, wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6.

52. The method of any one of claims 46-48 wherein the FoxMl inhibitor comprises a FoxMl -specific siRNA.

53. The method of claim 52, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11.

54. The method of claim 53, wherein the FoxMl -specific siRNA comprises a polynucleotide having the sequence of SEQ ID NO:9.

55. The method of any one of claims 44-46 wherein the FoxMl inhibitor comprises a thiazoel antibiotic.

56. The method of claim 55, wherein the thiazole antibiotic is siomycin A or thiostrepton

57. The method of any one of claims 46-48 wherein the FoxMl inhibitor comprises an antioxidant.

58. The method of claim 57, wherein the antioxidant is N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or

59. A method of treating cancer in a patient comprising administering to a patient in need thereof a FoxMl inhibitor and paclitaxel, wherein a combination of the FoxMl inhibitor and paclitaxel effectively inhibits cancer.

60. A method of reducing the risk of developing paclitaxel-resistance in a cancer patient comprising the step of administering to a patient in need thereof a FoxMl inhibitor.

61. A method of treating paclitaxel-resistant cancer in a patient comprising the steps of

(a) obtaining a cancer tissue sample from a patient in need of the treatment;

(b) detecting FoxMl expression in the cancer tissue sample using a reagent that specifically detects FoxMl;

(c) obtaining a control tissue sample; and

(d) assaying the control tissue sample to detect FoxMl expression therein, wherein a FoxMl inhibitor is administered to the patient with paclitaxel if

FoxMl expression in the cancer tissue sample is greater than FoxMl expression in the control tissue sample.

62. The method of claim 61, wherein the FoxMl expression is detected in the nucleus of the cells of the cancer tissue sample.

63. The method of claim 61 or 62, wherein the reagent comprises one or more FoxMl - specific primers, and the level of FoxMl expression is determined by reverse- transcriptase polymerase chain reaction (RT-PCR).

64. The method of claim 61 or 62, wherein the reagent is a FoxMl specific antibody and the level of FoxMl expression is determined by an immunoassay.

65. The method of any one of claims 59-64, wherein the cancer is ovarian cancer, breast cancer, small cell lung cancer, non-small cell lung cancer, colorectal cancer, malignant peripheral nerve sheath tumors, cervical cancer, leukemia, prostate, Kaposi's sarcoma, metastatic melanoma, pancreatic cancer, head and neck tumors, meningiomas, basal cell carcinoma, and gliomas.

66. The method of claim 65 wherein the cancer is ovarian cancer, breast cancer, small cell lung cancer, non-small cell lung cancer, or Kaposi's sarcoma.

67. The method of any one of claims 59-61 wherein the FoxMl inhibitor comprises an inhibitory P 19ARF peptide.

68. The method of claim 67 wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7.

69. The method of claim 68, wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6.

70. The method of any one of claims 59-61 wherein the FoxMl inhibitor comprises a FoxMl -specific siRNA.

71. The method of claim 70, wherein the FoxMl -specific siRNA comprises a

polynucleotide having the sequence of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, or SEQ ID NO: 11.

72. The method of claim 71, wherein the FoxMl -specific siRNA comprises a

polynucleotide having the sequence of SEQ ID NO:9.

73. The method of any one of claims 59-61 wherein the FoxMl inhibitor comprises a thiazole antibiotic.

74. The method of claim 73, wherein the thiazole antibiotic is siomycin A or thiostrepton

75. The method of any one of claims 59-61 wherein the FoxMl inhibitor comprises an antioxidant.

76. The method of claim 75, wherein the antioxidant is N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or

77. A method of identifying paclitaxel-resistant cancer in a patient comprising the steps of:

(a) obtaining a cancer tissue sample from a patient; and

(b) detecting FoxMl expression in the cancer tissue sample using a reagent that specifically detects FoxMl,

wherein detecting FoxMl expression in the cancer tissue sample indicates that the cancer is resistant to paclitaxel treatment.

78. The method of claim 77, wherein the FoxMl expression is detected in the nucleus of the cells in the cancer tissue sample.

79. The method of claim 77 or 78 further comprising the steps of obtaining a control tissue sample assaying the control tissue sample to detect FoxMl expression therein, wherein the cancer is paclitaxel-resistant cancer if FoxMl expression in the cancer tissue sample is greater than FoxMl expression in the control tissue sample.

80. The method of any one of claims 77-79, wherein the reagent comprises one or more FoxMl -specific primers, and the level of FoxMl expression is determined by reverse- transcriptase polymerase chain reaction (RT-PCR).

81. The method of any one of claims 77-79, wherein the reagent is a FoxMl specific antibody and the level of FoxMl expression is determined by an immunoassay.

82. A method of promoting breast tumor cell differentiation by reducing the level of FoxMl expression comprising the step of contacting the breast tumor with a FoxMl inhibitor.

83. A method of promoting breast tumor cell differentiation that reduces GATA3

promoter methylation comprising the step of contacting the breast tumor with a FoxMl inhibitor.

84. A method of promoting breast tumor cell differentiation that reduces interactions between FoxMl and Rb interaction comprising the step of contacting the breast tumor cell with a FoxMl inhibitor.

85. The method of any one of claims 82-84, wherein breast tumor cell proliferation is inhibited by increased differentiation.

86. The method of any one of claims 82-84, wherein the breast tumor cell is contacted with the FoxMl inhibitor when a patient with a breast tumor is administered the FoxMl inhibitor.

87. The method of any one of claims 82-84 wherein the FoxMl inhibitor comprises an inhibitory P 19ARF peptide.

88. The method of claim 87 wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6 or SEQ ID NO:7.

89. The method of claim 88, wherein the inhibitory P19ARF peptide comprises a peptide having the sequence of SEQ ID NO: 6.

90. The method of any one of claims 82-84 wherein the FoxMl inhibitor comprises a FoxMl -specific siRNA.

91. The method of claim 90, wherein the FoxMl -specific siRNA comprises a

92. The method of claim 91, wherein the FoxMl -specific siRNA comprises a

polynucleotide having the sequence of SEQ ID NO:9.

93. The method of any one of claims 78-80 wherein the FoxMl inhibitor comprises a thiazole antibiotic.

94. The method of claim 93, wherein the thiazole antibiotic is siomycin A or thiostrepton

95. The method of any one of claims 82-84 wherein the FoxMl inhibitor comprises an antioxidant.

96. The method of claim 95, wherein the antioxidant is N-acetyl-L-cysteine (NAC), catalase, 4-Hydroxy-2,2,6,6-tetramethylpiperidine-l-oxyl (Tempol), or