WO2011117452A1 - Truncated phytases of bifidobacteria and uses thereof - Google Patents

Abstract

The invention relates to an isolated polynucleotide consisting of a nucleotide sequence coding for an amino acid sequence of Bifidobacterium having at least 55% identity with amino acid sequence SEQ ID NO: 1, in which said amino acid sequence lacks a sequence coding for the transmembrane helix, located at the carboxy-terminal end of the original sequence, and in which said amino acid sequence is a protein of which the main activity is phytase. Preferably, the polynucleotide originates from strains of Bifidobacterium pseudocatenulatum (B. pseudocatenulatum) ATCC27919 or Bifidobacterium longum subsp. infantis (B. longum subsp. infantis) ATCC15697. The invention also relates to the use of the polynucleotide, or to any of the products described in the invention, in order to reduce the phytate content of a food or to produce myo-inositol triphosphate (ΙnsΡ₃).

Description

 Truncated phytases of Bifidobacteria and their uses

The present invention falls within the field of biotechnology and food, in particular, the present invention relates to truncated phytases of soluble and easily purifiable Bifidobacteria, which can be applied to all foods comprising plant products that have high content of phytates, such as cereals and legumes, both for human consumption and for animal consumption. STATE OF THE PREVIOUS TECHNIQUE

Products based on cereals, oilseeds and legumes may contain antinutritive substances such as phytic acid (myo-inositol hexakisphosphate, lnsP6 or lns (1, 2,3,4,5,6) P6) and their salts (phytates) , the largest form of phosphorus storage in seeds and pollen (Fretzdorff and Brümmer, 1992. Cereal Chem, 69: 266-270).

Phytate is found as a poly-anion in a wide pH range and therefore has a high affinity for positively charged food components, such as minerals, trace elements and proteins (Cheryan, 1980. Crit. Rev Food Sci Nutr , 13: 297-335). The biggest concern about the presence of phytates in the human and animal diet is the negative effect on mineral absorption. These substances are capable of forming insoluble complexes with metals at the pH of the gastrointestinal tract, which results in a decrease in the bioavailability of minerals (Erdman, 1979. J Am OH Chem Soc, 56: 736-741; Zemel and Shelef, 1982. J Food Sci, 47: 535-537). Many studies have shown that a diet rich in phytates causes deficiency in zinc, calcium, iron, magnesium, manganese and copper, particularly in unbalanced diets, at risk populations and in animal feed {Sandberg et al., 1982. J Nut, 48 : 185-189; Weaver et al., 1991. J Nut, 121: 1769-1775; Sandberg et al., 1999. Am J Clin Nut, 70: 240-246). In vitro and in vivo studies indicated that a partial dephosphorylation of the ? Phytic acid or phytates decreases the negative effect on mineral absorption (Sandberg et al., 1989. J Food Sci, 54: 159-161; Larsson and Sandberg, 1991. J Cereal Sci, 14: 141-149). Foods contain mixtures of different m / o-inositol phosphates with different isomeric forms, which can interact with other food components and under certain conditions tetraphosphate (lnsP ₄ ) or m / o-inositol triphosphate (InsPa) could decrease or increase mineral absorption (Shen et al., 1998. J Nutr Biochem, 9: 298-301; Sandberg et al., 1999. Am J Clin Nutr, 70: 240-246). Complete or advanced hydrolysis of lnsP ₆ in food products based on cereals and legumes decreases the negative effect on mineral absorption and intermediate hydrolysis products that have specific biological activity in the human body are generated, which could positively affect health . It has been shown that some isomers of lnsP3 and lnsP ₄ have important pharmacological effects such as anti-inflammatory, in the prevention of diabetic complications, involved in cell growth and differentiation, or the regulation of intracellular calcium (Shears, 1998, Biochim Biophys Acta, 1436 : 49-67; Shí et al., 2006. Subcell Biochem, 39: 265-292).

Generally, phytate phosphorus is not available for monogastric animals, that is, non-ruminant animals, since they do not have the digestive enzyme phytase, which is necessary to separate the phosphorus from the phytate molecule. However, ruminant animals can assimilate phytate phosphorus since they have microorganisms in the rumen that produce phytase. The phytase enzyme has the ability to break bonds in which the phosphorus is bound to the phytate molecule and thus produces its release.

Currently there are no phytases for human consumption. Commercial phytases are available to be administered in the production of monogastric animal feed. The products currently marketed are: Natuphos (BASF), Ronozyme P (Novozymes a / S), Phzyme (Danisco A / S, Diversa), Finase (AB Enzymes), Allzyme (Alltech).

Aspergillus niger is the microorganism that produces the most active extracellular phytase. There are currently commercial phytases available obtained by fermentation of genetically modified Aspergillus (Natuphos, Novo and Finase) and by extraction of the non-genetically modified Aspergillus culture medium (Allzyme). The use of commercial phytases could improve the bioaccessibility of minerals in cereal or leguminous products by eliminating phytate, which is a common practice in animal feed. Aspergillus and Trichoderma fungal cultures are normally used for their production. However, so far, commercial phytases are not used for human consumption, since they are not considered food grade. In addition, many commercial phytases are not specific for phytate.

Therefore, a problem in the state of the art is identified, which consists in the need to provide phytases from GRAS / QPS microorganisms (Generally Regarded as Safe / Qualified Presumption or Safety). This problem is partially resolved as indicated by some publications that refer to the use of bifidobacteria for phytate degradation (Palacios et al., 2008. Eur. Food Res. Technol., 226: 825-831; Palacios et al. 2008. Food Microbiol, 25: 169-176, Sanz Penella et al., 2009. J Agrie Food Chem, 57: 0239-10244). As a consequence, the complete solution to the problem is pending, in an effective way, that is, by isolating sequences that code for phytases and where these phytases have an acceptable solubility that facilitates their purification.

This task would entail contributing to the state of the art a very useful tool in the availability of phosphorus from the phytate molecule as well as the increase in the bioavailability of minerals. For this it is necessary to take into account that changes in a single amino acid in a protein can cause alterations in the folding of the same that cause the loss of phytase activity, therefore, the achievement of said technological tool may not be obvious. To date, no gene coding for a phytase enzyme has been described in Bifidobacterium strains and the sequenced genomes of Bifidobacterium do not carry genes that encode any protein with homology to known phytases. The search for proteins that have different phosphatase domains in Bifidobacterium pseudocatenulatum ATCC27919 and Bifidobacterium longum subsp. infantis ATCC15697 results in a multitude of hypothetical proteins. Two of these genes (BLONJ3263 and BIFPSEUDO _„ 03792) encoded proteins with an acid histidine phosphatase domain. These two proteins would have been excluded in principle from the analysis, since the characteristics of the impure phytase extracts described for Bifidobacterium in the literature indicated that the optimal reaction pH was close to the neutral pH, the reaction tended to the accumulation of lnsP3 and the extract was more specific for fats than p-nitrophenyl phosphate {Haros et al., 2005. FEMS Microbiol Lett, 247: 231-239; Haros et al., 2007. Int J Food Microbiol, 1 17: 76-84; Haros et al, 2009. Int J Food Microbiol, 135: 7-14).

EXPLANATION OF THE INVENTION

The present invention relates to an isolated polynucleotide consisting of a nucleotide sequence encoding an amino acid sequence of Bifidobacterium that has at least 55% identity with respect to the amino acid sequence SEQ ID NO: 1, where said amino acid sequence lacks the sequence coding for the transmembrane helix, located at the carboxy-terminal end of the original sequence, and said amino acid sequence is a protein whose majority activity is phytase. Said polynucleotide is preferably derived from the Bifidobacterium pseudocatenulatum (hereinafter B. pseudocatenulatum) ATCC27919 or Bifidobacterium longum subsp. infantis (B. longum subsp. infantis) ATCC15697. The amino acid sequence for which the polynucleotide encodes can have a sequence encoding a peptide attached to its amino-terminal end. signal. Likewise, the present invention also relates to the polynucleotide expression product, the isolated aminoacidic sequence encoded by said polynucleotide, the vector or the cell comprising the polynucleotide or the cell population comprising said cell. Furthermore, the present invention relates to the use of the polynucleotide or to any of the products described to reduce the phytate content of a food or to produce m / o-innositol triphosphate (InsPs), or to various methods for the production of the polynucleotide. The present invention provides an isolated polynucleotide encoding a protein with phytase activity from bacteria of the genus Bifidobacterium. Said protein is truncated and as a consequence it can be purified more efficiently than the original protein from which it originates since it lacks a sequence encoding a transmembrane helix, located at the carboxy-terminal end of the original sequence. The truncated protein has a series of relevant technical advantages over the state of the art, among them we can highlight:

- It has greater solubility than the original unmodified protein.

- Said truncated protein continues to have high specificity for phytate despite having removed a fragment of it. The rest of commercial phytases do not present as much specificity.

 - The polynucleotide encoding the truncated protein is more easily translated into a homologous or heterologous system as a soluble protein. That is, for a given time, when using a particular expression system, more protein with phytase activity will be obtained if a polynucleotide that codes for the truncated protein is expressed that does express a polynucleotide that codes for the original protein (complete ).

- Although the nucleotide sequence is a sequence rich in nucleotides G and C, it is adequately expressed in E. coli, which allows it to be obtained in a directed and controlled manner with vectors optimized for this heterologous expression system. As described in the previous section, to date no gene coding for a phytase enzyme has been described in Bifidobacterium strains. The inventors of the present invention carried out the search for proteins that had different phosphatase domains in Bifidobacterium pseudocatenulatum ATCC27919 and Bifidobacterium iongum subsp. infantis ATCC15697, obtaining a multitude of hypothetical proteins. Two of the genes coding for said proteins were selected {BLON_0263 and BIFPSEUDO_03792) and their proteins were characterized by having a histidine acid phosphatase domain. Because in the prior art it had been suggested that the optimum pH of the impure phytase extracts described for Bifidobacterium was close to the neutral pH, the proteins selected by the inventors could have been excluded by the person skilled in the art to solve The technical problem of the invention. However, the results obtained by the inventors, shown in the corresponding section, show that through the selection of said enzymes (due to the presence in the amino-acidic sequence of putative domains anchoring to the cell surface and their cellular location) and thanks to truncation of these, the proteins were obtained in soluble form with phytase activity from Bifidobacterium pseudocatenulatum ATCC27919 and Bifidobacterium Iongum subsp. infantis ATCC15697.

On the other hand, the protein comes from microorganisms considered GRAS / QPS (Generally Regarded as Safe / Qualified Presumption of Safety) and commonly used as probiotics in food preparations. This can facilitate its inclusion in foods in which the hydrolysis of phytates and the formation of new phosphate isomers of m / o-inositol can be an advantage at a nutritional and health level.

Therefore, in the present invention an enzyme is provided with phytase activity highly specific for phytate including the tools necessary for purification, eliminating part of the amino acid sequence of said phytate. protein. Said truncation does not imply changes in the tertiary structure of the protein so that its activity is preserved.

Thus, one aspect of the present invention relates to an isolated polynucleotide consisting of a nucleotide sequence encoding an amino acid sequence of Bifidobacterium that has at least 55% identity with respect to the amino acid sequence SEQ ID NO: 1, throughout its length, where said amino acid sequence is a protein whose majority activity is phytase. The amino acid sequence lacks a sequence encoding the transmembrane helix, located at the carboxy-terminal end of the original sequence. Preferably the isolated polynucleotide consists of a nucleotide sequence encoding a Bifidobacterium amino acid sequence having at least 56%, 57%, 58%, 59%, 60%, 61%, 63%, 65%, 67%, 69 %, 71%, 73%, 75%, 77%, 79%, 81%, 83%, 85%, 87%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with respect to the amino acid sequence SEQ ID NO: 1, in its entire length.

Another aspect of the present invention relates to an isolated polynucleotide consisting of a nucleotide sequence encoding an amino acid sequence of Bifidobacterium that has at least 55% identity with respect to the amino acid sequence SEQ ID NO: 3, in its entirety. length, where said amino acid sequence is a protein whose majority activity is phytase. The amino acid sequence lacks a sequence encoding the transmembrane helix, located at the carboxy-terminal end of the original sequence. Preferably the isolated polynucleotide consists of a nucleotide sequence that encodes an amino acid sequence of Bifidobacterium having at least 56%, 57%, 58%, 59%, 60%, 61%, 63%, 65%, 67%, 69 %, 71%, 73%, 75%, 77%, 79%, 81%, 82%, 83%, 85%, 87%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with respect to the amino acid sequence SEQ ID NO: 3, in its entire length. The amino acid sequence may be encoded by any nucleotide sequence that results in any of the amino acid sequences of the invention by means of transcription of the nucleotide sequence to a messenger RNA and its subsequent translation into the amino acid sequence. Because the genetic code is degenerated, the same amino acid can be encoded by different codons (triplets), therefore, the same amino acid sequence can be encoded by different nucleotide sequences.

The term "original sequence" refers to the amino acid sequence of the protein, without truncating, that is, the sequence comprising the peptide encoding the transmembrane helix, as well as the corresponding signal peptide.

The amino acid sequence encoded by the polynucleotide of the invention may have variants. These variants refer to limited variations in the amino acid sequence, which allow the maintenance of protein functionality. This means that the reference sequence and the variant sequence are similar as a whole, and identical in many regions. These variations are generated by substitutions, deletions or additions. Such substitutions include, but are not limited to, substitutions between glutamic acid (Glu) and aspartic acid (Asp), between Lysine (Lys) and Arginine (Arg), between asparagine (Asn) and glutamine (Gln), between serine (Ser) and threonine (Thr), and among the amino acids that make up the group alanine (Ala), leucine (Leu), valine (Val) and isoleucine (He). The variations can be variations existing in nature such as allelic variations, or artificially generated as for example by mutagenesis or direct synthesis. These variations do not cause essential changes in the essential characteristics or properties of the protein. The protein may additionally include secretory sequences, sequences that allow its purification as histidine tails, prosequences or sequences that increase its stability during protein production. The genus Bifidobacterium is composed of Gram-positive, anaerobic, saprophytic bacteria of the intestinal flora that reside in the colon, aiding in digestion. Some bifidobacteria are used as probiotics. In the present invention, the nucleotide sequence encoding phytase is isolated from at least one strain selected from the list of species comprising, but not limited to, B. adolescentis, B. angulatum, B. animalis, B. asteroids, B bifidum, B. boum, B. breve, B. catenulatum, B. choerinum, B. coryneforme, B. cuniculi, B. denticolens, B. dentium, B. gallicum, B. gallinarum, B. balloonsum, B, indicum , B. infantis, B. inopinatum, B. lactis, B. magnum, B. merycicum, B. minimum, B. pseudolongum, B. pullorum, B. ruminantium, B. saeculare, B. subtile, B. suis, B Thermacidophilum, B. thermophilum. B. pseudocatenulatum or B. longum. Preferably the nucleotide sequence encoding phytase is isolated from at least one strain of the species B. pseudocatenulatum (preferably from strain ATCC27919) or B. longum subsp. infantis (preferably of strain ATCC15697).

SEQ ID NO: 1 corresponds to the truncated amino acid sequence of the B. pseudocatenulatum ATCC27919 phytase protein. Said sequence lacks both the amino acid sequence encoding the signal peptide of the amino-terminal end and the sequence encoding the transmembrane helix of the carboxy-terminal end.

Table 1 shows the percentages of identity between different amino acid sequences of Bifidobacteria phytases, in addition to the genus Clavibacter and Rhodococcus. The expression "percentage (%) of identity" between two amino acid sequences, as understood in the present invention, refers to the number of amino acid positions over the total length of the sequence being compared, where all amino acids in that position They are identical. As can be seen, the percentage of bifidobacteria protein identity acquires values from 59% to 83%. The sequence more different from the rest of Bifidobacteria seems to be that of B. pseudocatenulatum ATCC27919 since it shows the lowest percentages of identity with regarding the amino acid sequences of the other strains of the genus Bifidobacterium. The lowest percentage of identity is shown by the sequences of B. pseudocatenulatum ATCC27919 and B. longum subsp. infantis ATCC15697 with each other, however, as demonstrated in the present invention, the two sequences show major phytase activity and the two proteins are more soluble than the respective un-truncated protein (see examples section).

The strains of B. pseudocatenulatum ATCC27919 and B. longum subsp. infantis ATCC15697 have been deposited in other crop collections in addition to the American Type Culture Collection (ATCC). Thus, the strain of B. pseudocatenulatum ATCC27919 has also been deposited in microorganism deposit authorities with the numbers CECT5776; strain B1279; AS 1,22277; BCRC (formerly CCRC) 15476; CCUG 34989; CIP 104168; DSM 20438; HAMBI 562; JCM 1200; LMG 10505; CUETM 89-16; CCTM 3069; Scardovi B1279. On the other hand, the strain of B. longum subsp. infantis ATCC15697 has also been deposited with microorganism deposit authorities under CECT numbers 4551; CCRC 14602; CCTM La 3067; CCUG 18368; CCUG 30512; CIP 64.67; CUETM 89-19; DSM 20088; JCM 1222; LMG 881 1; LMG 10499; NCFB 2205; NCTC 1 1817; Reuter S12.

In this way, the percentage of at least 55% identity with respect to the amioacid sequence SEQ ID NO: 1 is justified, since microorganisms of other genera have a sequence with identities ranging from 36% to 41% identity with with respect to the amioacid sequence SEQ ID NO: 1, a percentage far away from those obtained between strains of bifidobacteria. Identity percentages have been obtained through the ClustalW program (http://www.ebi.ac.uk/Tools/clustalw2) of the European Bioinformatics Institute of the European Molecular Biology Laboratory. (EMBL-EBI) that allows an alignment of these sequences and assigns these percentages automatically. Table 1 . Percentage of identity between several amino acid sequences of Bifidobacteria phytases and of the genera Clavibacter and Rhodococcus. The access numbers of the sequences cited in this table are:

B. longum subsp. infantis ATCC15697 (YP__002321769), B. pseudocatenulatum ATCC27919 (ZP__03743199), B. dentium ATCC 27678 (EDT45330), B. longum DJO10A (YP_001955145.1), Clavibacter michiganensis subsp. michiganensis NCPPB 382 (YP_001221200.1), Rhodococcus erythropolis PR4 (YP_002763531 .1)

The percent identity of the amino acid sequence refers to the number of identical amino acids at the equivalent amino acid positions of the total length of the sequence of the present invention that is compared, that is, throughout its length. The "transmembrane helix" or membrane helix refers to the amino acid sequence that constitutes one or more apolar segments that are embedded in the lipid bilayer of the cell membrane. These apolar segments are constituted by one or several a helices, which is the main reason for secondary structure of the protein.

Said sequence is characterized in that it lacks a sequence coding for the transmembrane helix, located at the carboxy-terminal end of the original truncated sequence. The peptide encoding the transmembrane helix has the function of fixing the original phytase protein to the cell membrane, causing its insolubility and therefore the difficulty of being purified. In addition, said protein, despite being truncated, retains its phytase enzyme activity and its high specificity for phytate. The enzyme also has phosphatase activity, however, this activity is minority. The phytase and phosphatase activity of enzymes can be determined by measuring their specificity for certain substrates (see table 6). To determine the "major phytase activity" of the enzyme of the present invention any technique known in the state of the art can be used and said activity would be major provided that the phytase activity is greater than the phosphatase activity. Preferably the phytase activity can be determined by measuring the specificity of the enzyme by phytate with respect to the specificity of the same enzyme by the p-nitrophenyl phosphate (pNPP) substrate. Therefore, according to the results shown in Table 6, the "major phytase activity" of said enzyme refers to the relationship between phytase activity / phosphatase activity being greater than 50, 60, 70, 80, 90 or 100. Preferably the ratio between phytase activity / phosphatase activity is equal to or greater than 90 and more preferably the ratio between phytase activity / phosphatase activity is equal to or greater than 100.

In this case the phytase activity is defined Uf¡ _t / mg protein and phosphatase activity defined Uf ₀ t / mg protein. 1/2: inorganic phosphorus pine trees released per hour at 50 ^Q C and pH: 6.0;

using potassium phytate as substrate.

Ufe *: p-nitrophenol prnoles released per hour at 50 ⁹ C and pH: 6.0; using p-nitrophenyl phosphate as substrate.

The activity of the phytase protein is identified with three numbers; EC 3.1 .3.8, EC.3.1 .3.26 and EC.3.1 .3.72. These numbers have been assigned by the Enzyme Commission number according to the chemical reactions they catalyze (IUBMB Enzyme Nomenclature, CAS Registry Number 9001-42-7). The enzyme with EC activity 3.1.3.8 is called, but not limited to, phytase, phytate 3- phosphatase, m / o-inositol-hexaphosphate 3-phosphohydrolase or 3-phytase. The enzyme with activity EC.3.1 .3.26 is called, but not limited to, phytase, phytate 6-phosphatase, m / o-inositol-hexaphosphate 6-phosphohydrolase or 6-phytase. The enzyme with activity EC.3.1 .3.72 is called, but not limited to, phytase or 5-phytase.

In the present invention, the term "protein" or "enzyme" can be used as equivalent to the term "amino acid sequence" considering that the protein is the folded amino acid sequence, that is, with tertiary structure. In turn, the term "amino acid sequence" is synonymous with the term "polypeptide sequence."

At this point it can be argued that there are currently no reliable methods capable of predicting the tertiary structure of a protein from its amino acid sequence. Methods capable of predicting simpler aspects of its structure are available, from which certain information about its possible function can be derived. The tertiary structure of a protein seems to be determined primarily by the specificity of its amino acid sequence. However, the lack of precision in determining the basic parameters from which the tertiary structure would be derived makes the most reliable prediction methods based on knowledge, a combination of statistical and empirical methods. In spite of this, it is not possible to reliably predict the tertiary structure of the phytase protein of the present invention and thereby its enzymatic activity, from amino acid sequence. Therefore, the removal of a fragment of the protein could result in a protein whose enzymatic activity would be diminished with respect to the original (native) protein. However, the isolated amino acid sequence, truncated with respect to the original amino acid sequence, does not show the loss of phytase activity, resulting in the non-obviousness of said truncated sequence. A preferred embodiment of the invention relates to the isolated polynucleotide consisting of a nucleotide sequence encoding an amino acid sequence of Bifidobacterium having at least 55% identity with respect to the amino acid sequence SEQ ID NO: 1 throughout its length, wherein said amino acid sequence also has a sequence encoding a signal peptide attached to its amino-terminal end. Preferably the signal peptide is derived from a sequence that has its origin in the original sequence from which the isolated polynucleotide of the invention originates.

The signal peptide has an amino acid sequence that leads to the protein that contains it at a certain location in the cell. According to the Sec transport system, the proteins, when they are still in the cytoplasm (pre-protein) are endowed with a sequence, called a signal peptide, at the N-terminal end. The signal peptide of the pre-protein enters through the Sec channel of the cytoplasmic cell membrane), whereby the signal peptide appears on the outer side of the membrane. In this way, the peptide is cleaved from the pre-protein sequence through the action of a peptidase, which results in the release of mature protein abroad. The mature protein may in turn be anchored to the cytoplasmic membrane, as is the case with the original or native protein of the present invention. Therefore, the amino acid sequence of the present invention can have a sequence encoding a signal peptide attached to its amino-terminal end and thus the protein is released outside the cell, thereby facilitating the purification of the protein already that lysis of host cells would not be necessary for their release.

Another preferred embodiment relates to the isolated polynucleotide, where the amino acid sequence is SEQ ID NO: 1, of B. pseudocatenulatum ATCC27919. Said amino acid sequence lacks the sequence coding for the transmembrane helix, delimited by amino acid 613 and 639, including both, of the original sequence SEQ ID NO: 2, and furthermore, said amino acid sequence is a protein whose majority activity is phytase. The sequence SEQ ID NO: 2 is the complete {non-truncated) amino acid sequence of the B. pseudocatenulatum ATCC27919 phytase enzyme (access N ⁹ ZP_03743199). A more preferred embodiment of the invention relates to the isolated polynucleotide, wherein said amino acid sequence has the signal peptide sequence SEQ ID NO: 5 attached to its amino-terminal end. This sequence SEQ ID NO: 5 is delimited by amino acid 1 and 52, including both, of the original sequence SEQ ID NO: 2.

Another preferred embodiment relates to the isolated polynucleotide, where the amino acid sequence is SEQ ID NO: 3, of B. longum subsp. infantis ATCC15697. Said amino acid sequence lacks the sequence coding for the transmembrane helix, delimited by amino acid 600 and 623, including both, of the original sequence SEQ ID NO: 4, and furthermore, said amino acid sequence is a protein whose majority activity is phytase. A more preferred embodiment of the invention relates to the isolated polynucleotide, wherein said amino acid sequence has the signal peptide sequence SEQ ID NO: 6 attached to its amino terminus. This sequence SEQ ID NO: 6 is delimited by amino acid 1 and 32, including both, of the original sequence SEQ ID NO: 4. SEQ ID NO: 3 corresponds to the truncated amino acid sequence of the phytase protein of B. longum subsp. infantis ATCC15697. Said sequence lacks both the amino acid sequence encoding the signal peptide of the amino-terminal end and the sequence encoding the transmembrane helix of the carboxy-terminal end. SEQ ID NO: 4 is the (not truncated or original) complete amino acid sequence of the phytase enzyme B. pseudocatenulatum ATCC27919 (N ^s access YPJD02321769.1).

Hereinafter, to refer to any polynucleotide described in the above aspect or in its preferred embodiments, the term "polynucleotide of the invention" or "polynucleotide of the present invention" may be used.

Other aspects of the present invention are: The expression product of the polynucleotide of the invention; the isolated amino acid sequence encoded by the polynucleotide of the invention; the encapsulated anterior expression product or the encapsulated anterior amino acid sequence; or the vector comprising the polynucleotide of the invention.

The term "polynucleotide expression product" as understood in the present invention refers to any product resulting from the expression of the nucleotide sequence. Thus, as a product resulting from the expression of the sequence is understood, for example, the RNA that is obtained from the transcription of the sequence, the processed RNA, the protein resulting from the translation of the RNA in any of its processing states or subsequent modifications of the nucleotide sequence inside the cell provided that the resulting sequence has its origin in the original sequence transferred or does not lose the functional characteristic that characterizes it, that is, the majority phytase activity. The term "vector" refers to a DNA fragment that has the ability to replicate in a given host and, as the term implies, can serve as a vehicle to multiply another DNA fragment that has been fused to it (insert). Insert refers to a DNA fragment that is fused to the vector; In the case of the present invention, the vector may comprise the polynucleotide of the invention. The vectors can be plasmids, cosmids, bacteriophages or viral vectors, without excluding other types of vectors that correspond to the definition made of vector. Preferably the vector is a plasmid. An example of a plasmid is that of the pQE series, as shown in the examples of the present invention.

The term "encapsulated" refers to the fact that the expression product of the polynucleotide or amino acid sequence encoded by the polynucleotide of the invention (enzyme), is coated with materials of different nature to obtain micrometric sized particles. The product resulting from encapsulation is called microparticle, microcapsule or microsphere, without excluding other terms used in the state of the art. The industrial application of the encapsulated product is, for example, but not limited, to achieve a sustained or controlled release of the expression product or enzyme, to protect the expression product or the enzyme to protect them from pH, temperature, temperature. enzymatic degradation or other physical factors that could subtract activity in said enzyme.

The coating materials for carrying out said microencapsulation are selected from the list comprising: fat (for example but not limited to, wax or stearyl alcohol), at least one protein (for example but not limited to, gelatin or albumin), at least a polymer (natural; for example but not limited to, alginate, dextran or chitosan / semi-synthetic; for example but not limited to cellulose / synthetic derivative; for example but not limited to, acrylic or aliphatic polyester derivative), or any combination thereof.

The methods for mycroencapsular are known to a person skilled in the art. For example, but not limited to, it can be microcapsulated by: solvent extraction / evaporation, coacervation / phase separation, atomization (Spay driying), ionic gelation or interfacial polymerization. Others Methods can be found in Gabrie MH Meesters (2010) (Chapter 9, Encapsulation of Enzymes and Peptides, In: Encapsulation Technologies for Active Food Ingredients and Food Processing. Pages 253-268). Another aspect of the present invention is an isolated cell comprising:

 - The polynucleotide of the invention,

 - the expression product of the polynucleotide of the invention,

 - the isolated amino acid sequence encoded by the polynucleotide of the invention,

 - the encapsulated anterior expression product or the encapsulated anterior amino acid sequence, or

- the vector comprising the polynucleotide of the invention. The term "cell" as understood in the present invention refers to a prokaryotic or eukaryotic cell. A more preferred embodiment of the present invention relates to the cell described in the preceding paragraph, wherein said cell is prokaryotic. According to a more preferred embodiment, the prokaryotic cell is of a different species of B. pseudocatenulatum and B. longum subsp. infantis The different species of prokaryotic cell can be E. coli. The inventors demonstrate that, although the nucleotide sequence is rich in nucleotides G and C, it is effectively expressed in E. coli, which is an unexpected result. The cell transformed with a vector comprising the polynucleotide of the invention can incorporate the sequence into any of the cell's DNA; nuclear, mitochondrial and / or chloroplast, or remain as part of a vector that has its own machinery for self-replication. The selection of the cell that has incorporated any of the sequences of the invention is carried out by any method known in the state of the art, for example, but not limited, by auxotrophies or through the expression of any selection marker . Hereinafter, to refer to any cell described in the preceding paragraphs, the term "cell of the invention" or "cell of the present invention" can be used. Another aspect of the present invention relates to the cell population comprising the cell of the invention. Said cell population may be formed by any cell of the present invention, by cells of a single strain or cell line, by combination of cells of the strain of B. pseudocatenulatum ATCC27919 and B. longum subsp. infantis ATCC 1 5697 or by combination of any of them with other cells of different strains of the same species or cell line of the genus Bifidobacterium or of another genus. That is, the isolated cell population can be a co-culture of cells of at least one strain ATCC27919 or ATCC15697 with cells of any other strain.

A further aspect of the present invention relates to the use of the polynucleotide of the invention, of the expression product of the polynucleotide of the invention (or said encapsulated expression product), of the isolated amino acid sequence encoded by the polynucleotide of the invention (or said encapsulated amino acid sequence), of the vector comprising the polynucleotide of the invention, of the cell of the invention or of the cell population of the invention, to reduce the content of m / o-innositol hexaphosphate (InsPe) of a food. According to a preferred embodiment, the food is essentially vegetable. According to another more preferred embodiment, the plant food comprises any part of the seed of said plant, in any processing state. The seed can come from any vegetable such as, but not limited to, a legume plant, a grass plant or pseudocereals (for example, but not limited to amaranth, quinoa). According to an even more preferred embodiment, the seeds come from at least one legume plant. According to another even more preferred embodiment, the seeds come from at least one grass plant. According to another preferred embodiment, the food It is intended for feeding monogastric animals. According to a more preferred embodiment the food is a feed.

M / o-inositol hexaphosphate (lnsP ₆ ) is phytic acid. The m / o-inositol hexaphosphate, m / o-inositol hexaphosphate, m / o-inositol hexakisphosphate or hexaphosphoinositol can be abbreviated as \ nsPe or \ PQ. The salt of phytic acid is phytate. In the present invention, the term "phytate" can be used to refer to \ nsPe or any of its salts. Phytate phosphorus is generally not available for monogastric animals, that is, non-ruminants, since they do not have the digestive enzyme phytase, which is necessary to separate the phosphorus from the phytate molecule. However, ruminant animals can assimilate phytate phosphorus because they have intestinal microorganisms that produce phytase. The term "essentially vegetable" as understood in the present invention refers to the fact that the plant food has food compounds whose origin is not vegetable but more than 50% of the food compounds that make up said food have plant origin. The grass plant from which the seeds are used is a plant of the Pooideae subfamily, said plant is selected from the list that comprises an Aveneae Tribe plant, preferably, but not limited to, of the Avena genus, more preferably the Avena sativa species ( oats); of the Triticeae Tribe, preferably, but not limited to, of the genus Hordeum (more preferably the species Hordeum vulgare [barley]), Dry (more preferably the species Sécale cereale [rye]) or Triticum (more preferably the species Triticum aestivum); of the Oryzeae Tribe, preferably, but not limited to, of the genus Oryza, more preferably the species Oryza sativa (rice); or of the Andropogoneae Tribe, preferably, but not limited to, of the genus Shorgum or of the genus Zea, more preferably the species Zea mays (corn). The grass plant from which the seeds are used is a plant of the Faboideae, Caesalpinioideae or Mimosoideae subfamily. Preferably the Faboideae subfamily plant is selected from the genus from the list comprising Pisum, Phaseolus, Vicia, Cicer, Medicago or Glycine.

A further aspect of the present invention relates to the use of the polynucleotide of the invention, of the expression product of the polynucleotide of the invention (or said encapsulated expression product), of the isolated amino acid sequence encoded by the polynucleotide of the invention (or said encapsulated amino acid sequence), of the vector comprising the polynucleotide of the invention, of the cell of the invention or of the cell population of the invention, to produce m / o-Inositol triphosphate (lnsP ₃ ). The m / oinositol triphosphate, myo-Inositol triphosphate or triphosphoinositol can be abbreviated as InsPe or IP ₃ . LnsP ₃ has an important application in health since m / ^' o-inositol triphosphates are involved in numerous biological functions in the body, such as in the detoxification of heavy metals (ES 2054628).

Another aspect of the present invention relates to the method for the production of the polynucleotide of the invention, which comprises:

to. amplify by means of a PCR technique the fragment of the nucleotide sequence that has at least 55% identity with respect to the amino acid sequence SEQ ID NO: 1, in its entire length, using as a template a chromosomal DNA of Bifidobacterium,

b. cloning said fragment into an expression vector, and

C. transforming said vector into a host cell for replication.

The PCR technique of step (a) of the method is selected from the state of the art PCR techniques known to the person skilled in the art. The amplification of the nucleotide sequence fragment is carried out by using at least two primers where one of them will bind to the template strand (direct primer) and the other to the complementary strand (reverse primer), in a position that allow to obtain, through successive amplifications with a thermo-resistant RNA / DNA polymerase enzyme, the fragment encoding the phytase of the present invention, as indicated in step (a). The expression vector contains the sequences necessary for the replication and expression of the nucleotide sequence encoding the phytase of the present invention in the host cell of step (b) of the method. Said host cell can be a prokaryotic cell, for example, but not limited to at least one Escheríchia cell. coli

A preferred embodiment of the present invention relates to the method, where the amplification of step (a) is carried out by the direct primer SEO ID NO: 7 and the reverse primer SEQ ID NO: 8, and the template is DNA is chromosomal of B. pseudocatenulatum ATCC27919. Another preferred embodiment of the present invention relates to the method where the amplification of step (a) is carried out by means of the direct primer SEQ ID NO: 9 and the reverse primer SEQ ID NO: 10, and the template is DNA is chromosomal of B longum subsp. infantis ATCC15697. Another aspect of the present invention relates to the method for reducing the phytate content of a food, which comprises:

to. contacting the food with the isolated amino acid sequence encoded by the polynucleotide of the invention (or with said encapsulated amino acid sequence), with the cell of the invention, or with the cell population comprising said cell of the invention, and

b. incubate the mixture obtained in step (a) at a pH between 3.5 and 7.5.

The incubation conditions of the mixture, according to step (b), are selected according to the results shown in Figures 1 A and B.

A further aspect of the present invention relates to the method of producing lnsP3, which comprises: to. contacting a composition comprising phytic acid or at least one phytate salt with the isolated aminoacidic sequence encoded by the polynucleotide of the invention, with the cell of the invention, or with the cell population comprising said cell of the invention,

b. incubate the mixture obtained in step (a) at a pH between 3.5 and 7.5.

It is known that the addition of phytases of fungal origin decreases the phytate content in bakery products during the kneading, fermentation and first baking stage (Haros et al., 2001. Eur Food Res Technol., 213: 3 7- 322; Haros et al., 2001. J Agr Food Chem, 49: 5450-5454; Sanz Penella et al., 2008. J Cereal Sci, 48: 71 5-721). During the kneading (7 minutes) and dough rest stage at 24 ^and C (10 minutes), the inclusion of fungal phytase in the integral bread formulation caused a decrease of between 17.3% and 51.9% of the initial phytate in flour, depending on the dose added (Haros et al., 2001. J Agr Food Chem, 49: 5450-5454). Türk and Sandberg (1992. J Cereal Sci, 15: 281-294) observed that the inclusion of ingredients such as milk in the integral bread formulation could significantly delay the effect of commercial fungal phytase to hydrolyze phytates. Wholemeal bread made with pre-cooked doughs added with commercial fungal phytase preserved in freezing for long periods of time (3 months) significantly decreases the phytate content during the freezing, storage, defrosting and complete cooking process (Rosell et al., 2009. J Cereal Sci, 50: 272-277). Therefore, the reduction of the phytate content of a food or the enzymatic degradation of phytates in food processing processes depends on numerous factors such as pH, process temperature, time, water content, concentration of mineral salts, additives and the process itself (Türk and Sandberg, 1992. J Cereal Sci, 1 5: 281-294). Thus, the incubation mentioned in step (b) of the method to reduce the phytate content of a food or to produce lnsP ₃ is carried out at a pH that is selected from a range between 3.5 and 7.5 preferably the pH is select from a range between 3.75 and 7.25; between 4 and 7; between 4.25 and 7.75; between 4.5 and 7; between 4.75 and 6.75; or between 5.5 and 6.5. The temperature at which the processes are carried out will depend on the type of food that is intended to be treated as well as the type of material with which the enzyme is microencapsulated. Therefore the method can be carried out at very different temperatures such as at about 4 ^S C, about 60 ^e C or at a temperature that is selected between 24 ^Q C and 60 ⁹ C, preferably between 27 ² C and 57 ^S C, between 30 ^S C and 55 ^Q C or between 35 ^e C and 50 ⁹ C. The time will depend on the rest of the parameters or even on the food to be treated.

The phytate salt of step (a) is selected from the list comprising, but not limited to, sodium salt, potassium salt, calcium salt, magnesium salt or calcium-magnesium salt.

A preferred embodiment of the present invention relates to the method for reducing the phytate content of a food or to the method for producing lnsP3, where the incubation of step (b) is carried out at a pH between 5.5 and 6, 5. Another preferred embodiment of the present invention relates to the method for reducing the phytate content of a food or to the method for producing lnsP3, where the composition of step (a) further comprises calcium or at least one calcium salt, in the case of use the amynoacid sequence SEQ ID NO: 3 of B. longum subsp. infantis, the cell of the invention that comprises it, or the cell population comprising said cell.

The calcium salt is selected from the list comprising, but not limited to, calcium carbonate, calcium phosphate, calcium gluconate, calcium chloride, calcium pidolate, calcium lactogluconate or calcium docusate.

According to a more preferred embodiment, the calcium salt is calcium chloride. As seen in Table 7, the use of calcium chloride increases activity of the truncated enzyme from the phytase sequence of B. longum subsp. 24% inf.

Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following figures and examples are provided by way of illustration, and are not intended to be limiting of the present invention.

DESCRIPTION OF THE FIGURES

FIG. 1. Shows the effect of pH and temperature on the phytase activity of truncated phytases of B. pseudocatenulatum and B.longum Subsp. infantis produced and purified from E. coli.

A. Shows the effect of pH.

 B. Shows the effect of temperature.

The activity represented refers to the relative activity taking as ^" ! 00% the maximum activity of each of the enzymes

FIG. 2. It shows the kinetics of phytate hydrolysis and the generation of m / o-inositol phosphates of lower phosphorylation by truncated phytases of B. pseudocatenulatum and B. longum Subsp. infantis produced and purified from E. coli.

A. It shows the kinetics of phytate hydrolysis and the generation of m / o-inositol phosphates of lower phosphorylation by the purified phytase of B. pseudocatenulatum. B. It shows the kinetics of phytate hydrolysis and the generation of m / o-inositol phosphates of lower phosphorylation by the purified phytase of B. tongum Subsp. inf. FIG. 3. It shows the protein profile obtained by ion exchange chromatography (axis of the abscissa time in minutes; axis of the ordinates in mAU, mini-units of absorbance at 280 nm).

20 mM Tris-HCI buffer mobile phase at pH 7.2.

Gradient elution 200-300 mM NaCI at 1 ml_ / min.

UV / Visible Detector

FIG. 4. It shows the protein profile of the crude extract obtained by ion exchange chromatography under the conditions shown below (axis of the abcisses time in minutes; axis of the ordinates in mAU, mini-units of absorbance at 280 nm):

20 mM Tris-HCI buffer mobile phase at pH 7.2.

Gradient elution 0-250 mM NaCI at 1 ml_ / min.

UV / Visible Detector

FIG. 5. It shows the protein profile obtained by ion exchange chromatography under the conditions shown below (axis of the abcissa time in minutes; axis of the ordinates in mAU, mini-units of absorbance at 280 nm):

20 mM Tris-HCI buffer mobile phase at pH 7.5

Gradient elution 0.1 M NaCl at 1 mL / min.

UV / Visible Detector

FIG. 6. Shows the protein profile obtained by ion exchange chromatography-FPLC under the conditions shown below. (axis of the abscissa time in minutes; axis of the ordinates in mAU, minimum absorbance at 280 nm):

Mobile phase buffer Tris-HCI 25 mM at pH 7.5.

Gradient elution 0-500 mM NaCl at 6 mL / min.

UV / Visible Detector

FIG. 7. It shows the protein profile obtained by ion-exchange chromatography-FPLC under the conditions shown below (axis of the abyss time in minutes; axis of the ordinates in mAU, minimum absorbance at 280 nm):

Mobile phase buffer Tris-HCI 25 mM at pH 7.5.

Gradient elution 0-250 mM NaCI at 1 ml_ / min.

UV / Visible Detector

FIG. 8. Shows SDS-PAGE geies with the expression of the phytases of B. pseudocatenulatum and B. longum Subsp. inf antis in E. coli. Full: Full length phytase

 Truncated: phytase that lacks the C-terminal fragment

soluble: soluble fraction,

insoluble: Insoluble fraction.

 The arrows indicate the presence of phytase in the soluble fraction

FIG. 9. Shows SDS-PAGE gels with the expression of the phytase of B. longum subsp. infantis in E. coli using different concentrations of inducer (IPTG) Complete: Full length phytase

 Truncated: Phytase that lacks the C-terminal fragment

Soluble: Soluble fraction. Insoluble: Insoluble fraction.

 The arrow indicates the presence of phytase in the soluble fraction EXAMPLES

The invention will now be illustrated by tests carried out by the inventors. The following specific examples provided in this patent document serve to illustrate the nature of the present invention. These examples are included for illustrative purposes only and should not be construed as limitations on the invention claimed herein. Therefore, the examples described are not intended to limit its scope.

EXAMPLE 1. Purification and characterization of the biochemical properties of the phytase of the selected strains B. longum Subsp. ínfantis and B. pseudocatenulatum as enzyme producers.

The strains of bifidobacteria used in this study were provided by the ATCC: R pseudocatenulatum ATCC27919 (Scardovi et al., 1979. International Journal Systematic Bacteriology, 29: 291-31 1) and B. longum subsp. infantis ATCC15697 (Reuter, 1971. International Journal Systematic Bacteriology, 21: 273-275), which were originally isolated from the human intestine.

In a first trial on the analysis of phytase activity in B. longum Subsp. infantis and B. pseudocatenulatum it was observed that in both strains such activity was associated with the cell, so that the idea of using the culture medium supernatant for purification was rejected. An efficient method for cell disruption was developed, in order to obtain the enzyme in solution in order to begin with the purification steps. 1.1. Location of the phytase activity.

Using said method of cell disruption, the location of the enzymatic activity in B. longum Subsp was determined. infantis and B. pseudocatenulatum. In addition to determining phytase activity, phosphatase activity was also determined, in the supernatant (cytoplasmic extract) and in the pellet (cell wall). The activity values are presented in Table 2. In this table it is observed that the phytase activity is found both in the supernatant (composed of cytoplasmic extract and membranes) and in the pellet (corresponding to the cell wall). However, the phytase activity of the supernatant was more specific in both species.

Table 2. Location of phytase and phosphatase activity in strains of bif idobacteria ³

Location Activity Fitasa Activity Fosfatasa

Cytoplasm +

 B. longum Subsp. infantis membranes 0.224 ± 0.007 0.089 ± 0.025

Wall 0.115 ± 0.054 0.241 ± 0.129

Cytoplasm +

 B. pseudocatenulatum membranes 0.167 ± 0.076 0.020 ± 0.012

Wall 0.302 ± 0.237 0.388 ± 0.068 ^a Average ± Standard Deviation (n = 2)

bUf _¡t : pine trees Pi / h at 50 ^Q C at pH: 6.0

cUfot: p-nitrophenol pineapples / h at 50 ^Q C at pH: 6.0

1.2. Purification of the phytases of B. longum Subsp. infantis and B. pseudocatenulatum, It was decided to begin with the purification of the phytase from B. longum Subsp. infantis For this purpose, a liter of culture of the strain of this species was prepared and the disruption method developed for the preparation of the cytoplasmic extract was used. To start with the purification method, it was decided to use ion exchange chromatography {column TSK gel DEAE-5PW), using as a mobile phase 20 mM Tris-HCI buffer at pH 7.2, an elution gradient from 200 to 300 mM of NaCI at a flow of 1 mL / min, collecting 25 fractions of 1 mL each, with UV / Visible detector, conditions previously used in purification of acid phosphatase from LactobaciHus pentosus (Palacios et al., 2005. J Appl Microbio !, 98: 229-237). The resulting chromatogram is shown in FIG. 3. The gradient used did not show a satisfactory peak resolution, since no separation of the proteins from the crude extract was obtained. A second test was performed by modifying the NaCI gradient from a concentration of 0 to 250 mM. Protein separation improved substantially, as shown in FIG. 4. The vertical line divides the chromatogram into two zones, the area on the left (until minute 19) indicates the proteins that do not adhere to the column, while the area on the right corresponds to the elution zone with NaCI, therefore those that adhere to the column. Phytase activity was measured in all fractions collected, this being found in the fraction corresponding to the first peak of the chromatogram (FIG. 4). Phosphatase activity was found in the first 17 fractions. In previous trials, it was confirmed that phosphatase activity is not found in subsequent fractions. Table 3 shows the phytase and phosphatase activity data in the different chromatogram fractions of FIG. Four.

Table 3. Phytase and phosphatase activity in the eluted fractions.

Fraction 1 2 3 4 5 6 7 8 9 10

Um / ml 0.007 0.307 0.579 0.161 0.024 0.010 0.000 0.006 0.010 0.000 U _f / ml 0.00 0.609 1, 175 0.444 0.220 0.075 0.020 0.000 0.000 0.000 Section 11 12 13 14 15 16 17 18 19 20

U _fi t / ml 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 IWml 0.00 0.00 0.00 0.00 0, 00 0.00 0.00 ndndnd

Section 21 22 23 24 25 26 27 28 29 30

U _m / mi 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 Ufos ml ndndndndndndndndndnd

Fraction 31 32 33 34 35 36 37 38

 Ufit mi 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Ufos / ml n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d.

l½: Mimols Pi / h at 50 ^Q C at pH: 6.0

Ufot: p-nitrophenol pineapples / h at 50 ^Q C at pH: 6.0

n.d. not determined The fractions in which activity was found were pooled and re-analyzed by HPLC coupled to the gel filtration column (TSKgel G3000 PWXL). As a mobile phase, 20 mM Tris-HCI solution was used at pH 7.5 containing 0.1 M NaCl. The chromatogram shows that the resolution of the peaks improved (FIG. 5).

To progress in chromatographic separation, it was decided to use another anion exchange column (Resource Q column), coupled to FPLC (Fast protein liquid chromatography) (AKTA Purifier, GE Healthcare, Uppsala, Sweden). To work with this new column, a new separation method was designed following the manufacturer's instructions. 25 mM Tris-HCI at pH 7.5 was used as mobile phase, with NaCI gradient from 0 to 500 mM in 60 mL, at a flow of 6 mL / min (FIG. 6). Again, a peak was obtained that corresponds to the fraction of protein that did not adhere to the column (Fraction N ⁹ 2) and subsequently another peak that corresponded to the fraction that adhered to the column. It was observed that there was no good resolution of peaks, so it was decided to change the operating conditions. The same mobile phase was used, reducing the gradient of NaCI at an interval between 0 and 250 mM, at a flow rate of 1 mL minute (FIG. 7). Phytase activity and phosphatase activity were measured in the different eluted fractions, observing a peak of activity again in the fraction that did not adhere to the column (Table 4).

Table 4. Phytase and phosphatase activity of the different eluted fractions of the chromatograph.

 Fraction Activity Phytase Activity Phosphatase

 6 0.269 0.137

7 0.589 0.307

8 0.615 0.321

9 0.420 0.190

10 0.072 0.037

1 1 0.009 0.005

52 0.004 0.006

53 0.090 0.070

54 0.147 0.093

55 0.004 0.010

56 0.002 0.008

57 0.004 0.008

58 0.002 0.000

59 0.004 0.000

60 0.000 0.000

Ufi _t : Mmoles Pi / h at 50 ^e C at pH: 6.0

Ufot: p-nitrophenol pine trees / ha 50 ⁹ C at pH: 6.0

This result together with the fact that the fraction that did not adhere to the column presented a cloudy appearance, led to the conclusion of the possibility of the existence of membrane debris in the supernatant and that the phytase activity was found in the membranes and not in the cytoplasmic extract. So it was decided to ultracentrifuge (100,000 g for 1 hour, 70TI rotor - Beckman) the supernatant obtained after cell disruption, to efficiently separate said turbidity and finally check the hypothesis raised. Once the pelletóe \ supernatant was efficiently separated, phytase and phosphatase activity was measured in the three cell fractions obtained: wall, membranes and cytoplasmic extract (Table 5).

Table 5. Activities in the different fractions.

Fractions Activity Phytase Activity Phosphatase

 U / mL U / mL

 Wall 6.58 8.76

Membrane 2.54 0.39

 Cytoplasm 0.02 0.23

U _f¡t : μη-ioles Pí / h at 50 ⁹ C at pH: 6.0

U _fot : p-nitrophenol pineapples / h at 50 ^S C at pH: 6.0

The result obtained indicated that the phytase activity was found in the cell fractions of the cell wall and membrane, since no activity was found in the supernatant free of cell debris. The membrane fraction was resuspended in 20 mM Tris-HCI buffer at pH 6.15 in the presence of 1% Triton X100, in order to release and solubilize the enzyme. However, phytase activity did not recover in the supernatant after treatment. The experiment was repeated again from the beginning, the new membrane fraction being resuspended in 20 mM Tris-HCI buffer at pH 6.15 in the presence of 15% glycerol, but again the phytase activity did not recover in the supernatant with the new treatment. .

EXAMPLE 2. Cloning of the sequences SEQ ID NO: 1 and SEQ ID NO: 3 and purification of said phytases, from B. longum subsp. infantis ATCC15697 and B. pseudocatenulatum ATCC 27919. 2.1. Purification of phytases encoded by SEQ ID NO: 1 and SEQ IDNO: 3.

As shown in example 1, the majority phytase activity was located in the membrane. After analysis of the sequences of the genomes of B. longum subsp. infantis and B. pseudocatenulatum in search of proteins with phytase or phosphatase domains the genes BLONJD263 and BIFPSEUDO_03792 that encoded hypothetical proteins (YP_002321769 and ZP__03743199) with an acidic histidine-phosphatase domain were identified. The presence of a secretion signal peptide (amino acids 1 to 32 in YPJ302321769 and amino acids 1 to 52 in ZP__03743199) was predicted. Although the phytase activity determined in cells of B. longum subsp. infantis and B. pseudocatenulatum showed an activity profile similar to alkaline phytases (pH, accumulation of lnsP3 and high specificity) it was decided to study these putative acid histidine phosphatases since at the carboxy-terminal end of the proteins a sequence was identified that looked like meet the hydrophobicity requirements of a membrane anchor peptide. The purification of these phytases was a difficulty at first because, as demonstrated by the authors of the present invention, that the proteins appeared to be associated with the cell membrane. In preliminary attempts it was not possible to properly purify the protein. The possibility of identifying fragments that could interfere with the recovery of these proteins was evaluated. After several analyzes, it was determined that these sequences could be favoring the anchoring of the protein to the cell membrane (as it had been determined empirically for the phytase activity present in Bifidobacterium cells) thus preventing its release and as a consequence its correct purification (example 2.3). Therefore, the primers mentioned in Example 2.2 were designed to achieve proteins lacking said peptide that was probably the cause of their adhesion to the cell membrane. In Example 2.3 it is shown that the elimination of this peptide favors the solubility and therefore the purification of the proteins from E. coli. The expression of these proteins and their subsequent characterization led to the conclusion of that genes BLON_0263 and BIFPSEUDO_03792 encode the phytases of B. longum subsp. ínfantis and B. pseudocatenulatum, respectively (example 3).

2.2. Cloning of the sequences SEQ ID NO: 1 and SEQ ID NO: 3.

The genes of both phytases were amplified by PCR with the oligonucleotides: PHY1 5 'GCTAGATCTATGGAGGCTGACGGCCGG (SEQ ID NO: 9) and PHY2 5'- GACAAGCTTTCAGACCGAACTTCCGGTACGTGCC (SEQ ID NO: 10) {B. longum subsp. ATCC 5697) and PHY4 5'- GCTAGATCTGGGGAAGGAACCGCCCGG (SEQ ID NO: 7) and PHY5 5'- CACAAGCTTTCACGTCACGTTTGAACCGGTTTTG (SEQ ID NO: 8) {B, pseudocatenulatum using both the DNA DNA, both DNA and Expand DNA, respectively DNA chromosome, both DNA and DNA, respectively High Fidelity PCR System "(Roche) under the following conditions: 94 ^S C 5 minutes, followed by 35 cycles of denaturation at 94 ^e C 1 minute, hybridization 55 ^Q C 1 minute and extension at 72 ^Q C 2 minutes, followed by a final extension at 72 ^e C 12 minutes.

The PCR products were analyzed by agarose electrophoresis and isolated by the GFX PCR and Gel Band Purification Kit (GE healthcare). The fragments were digested with the enzymes Bglll and Hindlll (restriction sites added in the underlined oligonucleotides) and cloned into the vector pQE80 (Qiagen) digested with BamHI and Hindlll, giving rise to plasmids pQEPHYI (B. longum subsp. ATCC15697 ) and pQEPHY2 (B. pseudocatenulatum ATCC27919). In these plasmids the phytase enzymes are expressed in the form of an amino-terminal fusion with a tail of six histidines (6XHis) to facilitate their purification. The construction excluded the secretion signal peptides (amino-terminal) and a sequence that was estimated to belong to the carboxy-terminal transmembrane helix present in the two proteins. Both plasmids were transformed into the Escherichia strain co // M15. The transformed E. coli M15 cells were grown in 500 mL of LB with 100 Mg / ml ampicillin at 37 ⁹ C under agitation to an optical density at 600 nm of 0.6. Phytase enzyme expression was induced by adding IPTG up to 0.1 mM and continuing incubation for 3-4 hours. The cells were collected by centrifugation, washed with 100 mM Tris-HCI buffer pH 7.4 and resuspended in 5 ml of the same buffer with 1 mg / ml lysozyme, 0.5 mM PMSF and 0.5 mM DTT incubating 30 minutes at 37 ^S C.

These cells were broken by sonication (5 pulses of 20 seconds). After centrifuging at 15,000 rpm (SS34 rotor, Beckman centrifuge) 30 minutes, the supernatants were filtered on 0.45 pm filters and applied to 1 ml Ni-NTA (Qiagen) columns. After several washes, the fusion proteins carrying the 6X tag (Hís) were eluted in a buffer containing 300 mM imidazole. After analysis by SDS-PAGE, the fractions containing the phytases were dialyzed against 100 mM Tris-HC1 buffer pH 7.4, 1 mM EDTA, 10% glycerol and 50mM NaCL and purified by FPLC (Aktapurifier, GE Healthcare) in an ion exchange column (ResourceQ), eluting by a linear gradient of NaCI from 0 to 1 M in 20 mM Tris-HCI buffer pH 6.0. Phytase fractions were collected and various aliquots were stored at -80 ^S C.

2.3. Solubility of truncated proteins with respect to the original (native) proteins.

FIG. 8 shows SDS-PAGE gels with the expression of the phytases of B. pseudocatenulatum and B. tongum Subsp. inf antis in E. coli. The fraction of insoluble and soluble proteins of clones that overexpress complete phytase or with the deletion of a putative transmembrane helix at the carboxy-terminal end is shown. As noted, phytases are expressed very effectively in E. coli, although almost all of the protein is insoluble (inclusion bodies or associated with membrane fragments). However, deletion of the carboxy-terminal fragment results in phytases that show a percentage of soluble protein (indicated by black arrows). It was these soluble proteins that were purified, characterizing their phytase activity. The gels of FIG. 8 show an induction experiment in E. coli using 1 mM IPTG (plasmid pQE80) at 37 ^e C. Subsequent tests with lower concentration of IPTG resulted in an increase in the soluble protein portion. As an example, FIG. 9 shows the induction of the expression and solubility of the phytase of B. longum subsp. infantis with different concentrations of IPTG in E. coli. It is noted that while the original (complete) phytase is totally insoluble, the truncated phytase can be obtained in soluble form (indicated by the black arrow). The fact that phytases are expressed in large quantities in E. coli would facilitate various strategies aimed at either obtaining a higher percentage of soluble protein or developing denaturation (solubilization) and protein purification protocols followed by a renaturation.

EXAMPLE 3. Determination of phytase activity and optimal reaction conditions. 3.1. Determination of phytase activity.

Phytase activity was determined by the method described by Haros et al. (2005. FEMS Microbiology Letters, 247: 231-239). The reaction consisted of 250 μί of 0.1 M sodium acetate at pH 5.5, containing 1, 2 mM potassium phytate, and 50 ¡Á. of each of the eluted extracts of the chromatographic column. After incubation for 15 minutes at 50 ^S C, the reaction was stopped by adding 50 - trichloroacetic acid 20% (Sigma-Aldrich Chemie GmbH, Steinhein, Germany), allowed to stand 10 minutes at 0 ^and C and centrifuged at 13,000 rpm for 5 minutes at 4 ^Q C (Centrifuge 54 5R, Eppendorf AG, Hamburg, Germany). In the supernatant the phosphorus released was determined by spectrophotometric determination of the yellow complex formed when the ortho phosphate reacts with the ammonium molybonatenadate in an acid medium, according to the method described by Tanner and Barnett (1986. J Assoc Off Anal Chem , 69: 777-785) adapted to micro scale in microplate reader (Spectromax 190, Molecular Devices, Sunnyvale, CA, USA) according to Haros et al (2001. Eur Food Res Technol, 213: 317-322). At 100 μΐ of the supernatant 100 - molybdanadate reagent (Fluka Chemie) was added GmbH, Burchs, Switzerland) diluted (1/5). After standing 10 minutes at 30 -O the absorbance was measured at 400 nm. The samples were analyzed in duplicate.

3.2. Determination of the optimal reaction conditions.

• Optimum reaction temperature and pH, stability of enzymatic preparations.

The effect of temperature was determined in a range from 27 ⁹ C to 80 ^S C using the standard method of phytase activity determination at pH 5.5 in acetic buffer / acetate.

The effect of pH on phytase activity was studied in a pH range between 3.0 to 8.0 incubating at an optimal reaction temperature (50 ^e C) according to the standard method. The buffers were used at a 100 mM concentration and were the following: citrate / NaOH, pH 3.0; acetic / acetate pH 3.6-5.5; bis / tris pH 6.0-7.3; tris / HCI, pH 8.0.

The activity of purified phytase from B. pseudocatenulatum had an optimum pH between 5.5 and 6.5 {FIG. 1 A), the optimum reaction temperature being 50-55 ^s C (FIG. 1 B). The phytase of B, longum subsp. infantis showed maximum activity at the same pH (5.5) and temperature 50 ° C (FIG. 1A and B, respectively). The enzymes were also active in a wide pH range between 4.5 and 7.5 for the B. pseudocatenulatum phytase and between 4.5 and 6.5 for the B. longum subsp phytase. infantis, keeping 50% or more of its optimal activity (FIG. 1 A).

Both enzymes were active in a wide range of temperatures, exceeding 40% of the maximum activity between 30 and 55 ^S C (B. longum subsp. Infantis) and between 30 and 60 ^Q C (B. pseudocatenulatum). This range includes the physiological temperature which could be important in both human and animal feeding (FIG. 1 B). - Determination of the substrate specificity.

The relative activity of the purified enzymes against different phosphate esters at 1.2 mM was analyzed. It was determined by measuring the phosphorus released after incubation under optimal reaction conditions according to the methodology described above. Enzymatic activities were expressed relative to that obtained using dipotassium phytate as a substrate. The different substrates studied were: phosphoenolpyruvate, fructose-6-phosphate, glucose-6-phosphate, deoxyAMP, glucose-1-phosphate, glyceraldehyde-3P, ATP, ADP, AP, fructose 1, 6- bisphosphate, paranitrophenylphosphate (pNPP).

Enzymes isolated from bifidobacteria were shown to have a high specificity for phytate, while activity against a wide variety of monophosphorylated substrates is less than 7% (relative to phytate) and in most cases the activity is nil (Table 6 ). High specificity is one of the desired characteristics of a commercial phytase.

Table 6. Substrate specificity of the bifidobacteria phytases of the present invention.

Substrate (1 mM)% activity

 B. pseudocatenulatum B. longum subsp.

 infantis

 Phytate 100 100 pNPP 0.9 1

 Phosphoenolpyruvate 0 0

acetyl phosphate 6.7 2.3

 AMP 0 0.4

 ADP 0 0

 ATP 0 0

glyceraldehyde-3P 0 0

glucose-1 P 0 0 glucose-6P 0 0

fructose-1 P 0 0

fructose- 1, 6bisP 4.9 1.45

- Determination of the effect of possible activators and inhibitors.

The possible activating or inhibiting effect on phytase activity was determined by the addition of different chemicals in the reaction mixture. The possible activating or inhibiting substances of the enzymatic activity studied were: calcium chloride (CaC½), cobalt chloride (CoCfe), manganese chloride {MnCI ₂ ), iodoacetic acid (IAA), potassium fluoride (KF), beta- mercaptoethanol, ethylenediaminetetraacetic acid (EDTA) and sulfonyl phenyl methyl fluoride (PMSF).

The phytase activity was determined according to a standard reaction test in the presence of 5 mM of the chemical substances mentioned above and expressed relative to the activity obtained in the absence of the possible inhibitor or activator compounds.

The effect of several chemical compounds on phytase activity is shown in Table 7. Most of the compounds studied, with the exception of iodoacetic acid (IAA), had inhibitory effects on enzyme activity. The mechanism of enzymatic inhibition of iodoacetic acid is by blocking sulfhydryl groups, showing in this study no inhibitory effect of phytases of bif idobacteria at the concentration tested.

PMSF is usually an enzyme inhibitor, in this study it inhibited to a greater extent the enzyme of B. longum Subsp. infantis, while the phytase of B, pseudocatenulatum presented a slight inhibition.

Divalent metals acted by inhibiting phytase with the exception of calcium that acted as an activator of the activity in the B. infantis enzyme. Chelating agents such as EDTA can also exert their inhibitory action on activity by sequestering metals from the active site of the enzyme, which could be the case with bifidobacteria phytases.

Table 7. Inhibitory and activating effect of the phytase activity of bifidobacteria.

Activator or Inhibitor% Activity

 (5 mM)

 B. pseudocatenulatum B. longum subsp, infantis

- 100 100

 CaCfe 72 124

CoCl ₂ 79.8 84

MnCI ₂ 71 76

 EDTA 85.3 69.2

 PMSF 92.1 65.1

β-mercaptoethanol 61 64.1

 IAA 100 99.9

 KF 70.3 79.3

EXAMPLE 4. Determination of m / o-inositol phosphates by HPLC.

The purification and determination of m / o-inositol phosphates was performed according to the methodology described by Türk and Sandberg (1992. J Cereal Sci, 15: 281-294) and later modified by Sanz Penella was /. (2008. J Cereal Sci, 48: 715-721).

The enzyme was incubated in 0.1 M sodium acetate solution at pH 5.5, at 50 ⁹ C for 3 hours in the presence of potassium phytate as a substrate (lnsP ₆ ) - different time intervals were extracted aliquots of 250 μί to study the kinetics of degradation of \ nsPe and the generation of m / o-inositol phosphates with a lower degree of phosphorylation. The enzymatic reaction was stopped by term shock for 5 minutes at 100 ^e C. The separation and quantification of m / o-inositol phosphates was carried out by reverse phase high performance liquid chromatography. The mobile phase consisted of methanol: 0.05M formic acid (51: 49), containing 1.5% (v / v) tetrabutylammonium hydroxide (Sigma-Aldrich, St Louis, MO, USA), adjusted to pH 4, 3 with 9M sulfuric acid (Sigma, St Louis, MO). The chromatographic analysis was carried out with an HP1050 liquid chromatograph (Hewlett Packard, Waldbronn, Germany), equipped with an HP 1047A refractive index detector (Hewlett Packard, Waldbronn, Germany). The samples (50 / iL) were injected into the chromatograph for the separation and quantification of m / o-inositol phosphates using a Tracer Excel 120 ODS-B column (5μτη x 15cm x 0.4cm; Teknokroma, Barcelona, Spain). The chromatographic conditions were: flow 1 mL mobile phase / min and column temperature 35 ^Q C. For the identification of m / o-inositol phosphates, a phytic acid hydrolyzate in 50% aqueous solution was used (w / v ) (Sigma, St Louis, MO). As a standard solution, 5mM potassium phytate (Sigma, St Louis, MO) was used. The samples were analyzed in duplicate.

In FIG. 2A and B show the kinetics of disappearance of phytates or m / o-inositol hexakisphosphate (lnsP ₆ ) and the generation of m / o-inositol phosphates with a lower degree of phosphorylation with reaction time. It is observed that the disappearance of \ nsP _& occurred immediately in the first half hour of reaction with the generation and immediate disappearance of m / o-inositol pentakisphosphate (IP ₅ or \ nsP5). At the same time, m / o-inositol tetrakisphosphate (IP ₄ or lnsP ₄ ) was generated, which is also a substrate for the enzyme and disappeared with the reaction time, its disappearance being slower with the phytase of B. longum subsp. infantis Hydrolysis of LNSP _6-4 resulted in the generation triphosphate m / o- inositol (IP ₃ or InsPs), the concentration increased with reaction time remaining in high concentrations after 3 hours incubation. Bifidobacteria enzymes seem not to act on lns ₃ and accumulate after acting on phytates. This could have an important health implication since m / o-inositol triphosphates are involved in numerous biological functions in our body, in fact some of them find their destiny as drugs.

Claims

Isolated polynucleotide consisting of a nucleotide sequence encoding an amino acid sequence of Bifidobacterium that has at least 55% identity with respect to the amino acid sequence SEQ ID NO: 1, in its entire length, where said amino acid sequence is a protein whose Majority activity is phytase.

Polynucleotide according to claim 1, wherein said amino acid sequence also has a sequence encoding a signal peptide at its amino-terminal end.

Polynucleotide according to claim 1, wherein the amino acid sequence is SEQ ID NO: 1, of Bifidobacterium pseudocatenulatum ATCC27919 and said amino acid sequence:

 to. it lacks the sequence coding for the transmembrane helix, delimited by amino acid 613 and 639, including both, of the original sequence SEQ ID NO: 2, and

 b. said amino acid sequence is a protein with phytase activity.

Polynucleotide according to claim 3, wherein said amino acid sequence has the signal peptide sequence SEQ ID NO: 5 attached to its amino-terminal end.

Polynucleotide according to claim 1, wherein the amino acid sequence is SEQ ID NO: 3, from Bifidobacterium longum subsp. infantis ATCC15697 and said amino acid sequence:

to. it lacks the sequence coding for the transmembrane helix, delimited by amino acid 600 and 623, including both, of the original sequence SEQ ID NO: 4, and b. said amino acid sequence is a protein with phytase activity.

6. A polynucleotide according to claim 5, wherein said amino acid sequence has the signal peptide sequence SEQ ID NO: 6 attached to its amino-terminal end.

7. Expression product of the polynucleotide according to any one of claims 1 to 6.

8. Isolated amino acid sequence encoded by the polynucleotide according to any one of claims 1 to 6.

9. Expression product according to claim 7 or amino acid sequence according to claim 8, wherein said expression product or said amino acid sequence is encapsulated.

10. Vector comprising the polynucleotide according to any one of claims 1 to 6.

eleven . Cell comprising the polynucleotide according to any one of claims 1 to 6, the expression product according to claim 7 or 9, the amino acid sequence according to claim 8 or 9, or the vector according to claim 10.

12. Cell according to claim 1, wherein said cell is prokaryotic.

13. Cell according to claim 12, wherein the prokaryotic species is a different species of Bifidobacterium pseudocatenulatum and Bifidobacterium longum subsp. infantis

14. Cell population comprising the cell according to any of claims 1 1 to 13.

15. Use of the polynucleotide according to any one of claims 1 to 6, of the expression product according to claim 7 or 9, of the amino acid sequence according to claim 8 or 9, of the vector according to claim 10, of the cell according to any of the claims 1 to 13, or of the cell population according to claim 14, to reduce the content of m / o-inositol hexaphosphate (lnsP ₆ ) of a food.

16. Use according to claim 15, wherein the food is essentially vegetable.

17. Use according to claim 16, wherein the plant food comprises any part of the seed of said plant, in any processing state.

18. Use according to claim 17, wherein the seeds come from at least one legume plant.

19. Use according to claim 17, wherein the seeds come from at least one grass plant.

20. Use according to any of claims 14 to 18, wherein the feed is intended for feeding monogastric animals.

twenty-one . Use according to claim 20, wherein the food is a feed.

22. Use of the polynucleotide according to any one of claims 1 to 6, of the expression product according to claim 7 or 9, of the amino acid sequence according to claim 8 or 9, of the vector according to claim 10, of the cell according to any of the claims 1 to 13, or of the cell population according to claim 14, to produce m / o-inositol triphosphate (InsPs).

23. Method for the production of the polynucleotide according to any of claims 1 to 6, comprising:

 to. amplify by means of a PCR technique the fragment of the nucleotide sequence that has at least 55% identity with respect to the amino acid sequence SEQ ID NO: 1, in its entire length, using as a template a chromosomal DNA of Bifidobacterium,

 b. cloning said fragment into an expression vector, and

 C. transforming said vector into a host cell for replication.

24. Method according to claim 23, wherein the amplification of step (a) is carried out by the direct primer SEQ ID NO: 7 and the reverse primer SEQ ID NO: 8, and the template is DNA is chromosomal from Bifidobacteríum pseudocatenulatum.

25. Method according to claim 24, wherein the amplification of step (a) is carried out by the direct primer SEQ ID NO: 9 and the reverse primer SEQ ID NO: 10, and the template is DNA is chromosomal from Bifidobacterium longum subsp. infantis

26. Method for reducing the lnsP ₆ content of a food comprising:

 to. contacting the food with the amino acid sequence according to claim 8 or 9, with the cell according to any one of claims 1 to 13, or with the cell population according to claim 14, and

b. incubate the mixture obtained in step (a) at a pH between 3.5 and 7.5.

27. Method for producing InsPe comprising:

 to. contacting a composition comprising phytic acid or at least one phytate salt with the amino acid sequence according to claim 8 or 9, with the cell according to any one of claims 1 to 13, or with the cell population according to claim 14,

 b. incubate the mixture obtained in step (a) at a pH between 3.5 and 7.5.

28. A method according to any of claims 26 or 27, wherein the incubation of step (b) is carried out at a pH between 5.5 and 6.5.

29. A method according to any of claims 27 or 28, wherein the composition of step (a) further comprises calcium or at least one calcium salt, in the case of using the amino acid sequence SEQ ID NO: 3 of Bifidobacterium longum subsp. infantis, the cell according to any one of claims 1 to 13 comprising it, or the cell population according to claim 14 comprising said cell.

30. Method according to claim 29, wherein the calcium salt is calcium chloride.