WO2011112429A1 - Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases - Google Patents

Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases Download PDF

Info

Publication number
WO2011112429A1
WO2011112429A1 PCT/US2011/027117 US2011027117W WO2011112429A1 WO 2011112429 A1 WO2011112429 A1 WO 2011112429A1 US 2011027117 W US2011027117 W US 2011027117W WO 2011112429 A1 WO2011112429 A1 WO 2011112429A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
membered
alkyl
independently
occurrence
Prior art date
Application number
PCT/US2011/027117
Other languages
French (fr)
Inventor
Anilkumar Gopinadhan Nair
Kerry M. Keertikar
Seong Heon Kim
Joseph A. Kozlowski
Stuart Rosenblum
Oleg B. Selyutin
Michael Wong
Wensheng Yu
Qingbei Zeng
Original Assignee
Schering Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=43939669&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2011112429(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to EP11707763.6A priority Critical patent/EP2545060B1/en
Priority to KR1020127026331A priority patent/KR20130008040A/en
Priority to MX2012010392A priority patent/MX2012010392A/en
Priority to CN2011800233538A priority patent/CN102918049A/en
Priority to CA2792121A priority patent/CA2792121A1/en
Priority to SG2012063780A priority patent/SG183526A1/en
Priority to MA35291A priority patent/MA34147B1/en
Application filed by Schering Corporation filed Critical Schering Corporation
Priority to EA201290882A priority patent/EA201290882A1/en
Priority to BR112012022125A priority patent/BR112012022125A2/en
Priority to AU2011224698A priority patent/AU2011224698A1/en
Priority to ES11707763.6T priority patent/ES2558554T3/en
Priority to JP2012557114A priority patent/JP2013522202A/en
Publication of WO2011112429A1 publication Critical patent/WO2011112429A1/en
Priority to TNP2012000416A priority patent/TN2012000416A1/en
Priority to ZA2012/06716A priority patent/ZA201206716B/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F7/00—Compounds containing elements of Groups 4 or 14 of the Periodic System
    • C07F7/02—Silicon compounds
    • C07F7/08—Compounds having one or more C—Si linkages
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F7/00—Compounds containing elements of Groups 4 or 14 of the Periodic System
    • C07F7/02—Silicon compounds
    • C07F7/08—Compounds having one or more C—Si linkages
    • C07F7/0803—Compounds with Si-C or Si-Si linkages
    • C07F7/081—Compounds with Si-C or Si-Si linkages comprising at least one atom selected from the elements N, O, halogen, S, Se or Te
    • C07F7/0812—Compounds with Si-C or Si-Si linkages comprising at least one atom selected from the elements N, O, halogen, S, Se or Te comprising a heterocyclic ring
    • C07F7/0816—Compounds with Si-C or Si-Si linkages comprising at least one atom selected from the elements N, O, halogen, S, Se or Te comprising a heterocyclic ring said ring comprising Si as a ring atom
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/695—Silicon compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Definitions

  • the present invention relates to novel Fused Tricyclic Silyl Compounds
  • compositions comprising at least one Fused Tricyclic Silyl Compound, and methods of using the Fused Tricyclic Silyl Compounds for treating or preventing HCV infection in a patient.
  • HCV Hepatitis C virus
  • BB -NANBH blood-associated NANBH
  • NANBH is to be distinguished from other types of viral-induced liver disease, such as hepatitis A virus (HAV), hepatitis B virus (HBV), delta hepatitis vims (HDV),
  • HAV hepatitis A virus
  • HBV hepatitis B virus
  • HDV delta hepatitis vims
  • CMV cytomegalovirus
  • EBV Epstein-Barr virus
  • HCV replication inhibition is a viable strategy for the prevention of hepatocellular carcinoma.
  • Current therapies for HCV infection include a-interferon monotherapy and combination therapy comprising a-interferon and ribavirin. These therapies have been shown to be effective in some patients with chronic HCV infection, but suffer from poor efficacy and unfavorable side- effects and there are currently efforts directed to the discovery of HCV replication inhibitors that are useful for the treatment and prevention of HCV related disorders.
  • chenodeoxycholic acid and conjugated bile acids (such as tauroursodeoxycholic acid).
  • Phosphonoformic acid esters have also been proposed as potentially useful for the treatment of various viral infections, including HCV. Vaccine development, however, has been T/US2011/027117
  • HCV NS5A is a 447 amino acid phosphoprotein which lacks a defined enzymatic function. It runs as 56kd and 58kd bands on gels depending on phosphorylation state (Tanji, et al J. Virol. 69:3980-3986 (1995)). HCV NS5A resides in replication complex and may be responsible for the switch from replication of RNA to production of infectious virus (Huang, Y, et al, Virology 364:1-9 (2007)).
  • Multicyclic HCV NS5A inhibitors have been reported. See U.S. Patent Publication Nos. US20080311075, US20080044379, US20080050336, US20080044380, US20090202483 and US2009020478.
  • HCV NS5A inhibitors having fused tricyclic moieties are disclosed in International Patent Publication Nos. WO 10/065681, WO 10/065668, and WO 10/065674.
  • HCV NS5 A inhibitors and their use for reducing viral load in HCV infected humans have been described in U.S. Patent Publication No. US20060276511.
  • the present invention provides Compounds of Formula (I)
  • A is -alkylene-N(R 7 )(R n ), ⁇ alkylene-N(R 16 )(R 1 ! ), 4 to 7- membered monocyclic heterocycloalkyl, 4 to 7-membered monocyclic heterocycloalkenyl, 7 to 1 1- membered bicyclic heterocycloalkyl or R 15 , wherein said 4 to 7- membered monocyclic T U 2011/027117
  • heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 11 - membered bicyclic heterocycloalkyl group or said R ! 5 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or R 15 group can be optionally and independently substituted on one or more ring nitrogen atoms with R 4 , and on one or more ring carbon atoms with R i2 , such that two R J2 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered
  • B is 5-membered monocyclic heteroarylene group or a 9-membered bicyclic heteroarylene group containing at least one nitrogen atom, wherein said 5-membered monocyclic heteroarylene group and said 9-membered bicyclic heteroarylene group can be optionally fused to a benzene, pyridine or pyrimidine ring, and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart and said 9-membered bicyclic heteroarylene group or it's fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with R 6 and on one or more ring carbon atoms with R ;
  • D is -alkylene-N(R 7 )(R u ), -alkylene-N(R i6 )(R u ), 4 to 7- membered monocyclic heterocycloalkyl, 4 to 7-membered monocyclic heterocycloalkenyl, 7 to 11- membered bicyclic heterocycloalkyl or R 15 , wherein said 4 to 7- membered monocyclic
  • heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 1 1 - membered bicyclic heterocycloalkyl group or said R 15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or R 15 group can be optionally and independently substituted on one or more ring nitrogen atoms with R 4 , and on one or more ring carbon atoms with R 12 , such that two R 12 groups on the same ring carbon atom, together with the carbon atom to which P T/US2011/027117
  • -N C(R 2 )-, -C(R ) 2 -0- ? -0-C(R 7 ) 2 -, -C(R 7 ) 2 -N(R 6 )- or -N(R 6 )-C(R 7 ) 2 - 3 such that two vicinal R groups of M , together with the carbon atoms to which they are attached, can optionally join to form a 3- to 7-membered cycloalkyl group, a 3- to 7-membered heterocycloalkyl group or a 5- to 6-membered heteroaryl group;
  • X 1 is -C(R S )- or -N-;
  • X 2 is -C(R 5 )- or -N-;
  • each occurrence of R 1 is independently Ci-C 6 alkyl, ⁇ alkylene-0-(Ci-C6 alkyl), Cj-Ce haloalkyl, 3- to 7-membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally substituted with up to three groups, which can be the same or different, and are selected from Ci-C ⁇ j alkyl, 3- to 7-membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl, heteroaryl, halo, C,-C 6 haloalkyl, -Si(R t3 ) 3 , -CN, -OR 3 , -N(R 3 ) 2 , -C(0)R 10 ,
  • each occurrence of R 3 is independently H, C C 6 alkyl, Ci-C 6 haloalkyl, -CrC 6 alkylene-OC(0)(Ci-C 6 alkyl), Q-Cehydroxyalkyl, 3 to 7-membered cycloalkyl, 4 to 7- membered heterocycloalkyl, aryl or heteroaryl wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to three groups
  • each occurrence of R 4 is independently H, -Ci-C 6 alkyl, d-Ce haloalkyl, - [C(R 7 ) 2 ] q N(R 6 ) 2i -C(0)R 1 , -C ⁇ 0)-[C(R 7 ) 2 ] q N(R 6 ) 2 , -C(0)-[C(R 7 ) 2 ] q -R i ,-C(0)- -C(0)-[C(R 7 ) 2 ] q N(R 6 )C(0)0-R', - C(0)-[C(R 7 ) 2 ] q C(0)0-R 5 or -alkylene-N(R 6 )-[C(R 7 ) 2 ] q -N(R 6 )-C(0)0-R 1 ; U 2011/027117
  • R 5 each occurrence of R 5 is independently H, Ci ⁇ C 6 alkyl, -Si(R !3 ) 3 , 3- to 7-mernbered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl or heteroaryl;
  • each occurrence of R 6 is independently H, Cs-C 6 alkyl, 3- to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to two R 8 groups, and wherein two R 6 groups that are attached to a common nitrogen atom, together with the nitrogen atom to which they are attached, can optionally join to form a 4- to 7-membered heterocycloalkyl group;
  • each occurrence of R 7 is independently H, C]-Cg alkyl, Cj-C 6 haloalkyl,
  • each occurrence of R 8 is independently H, Ci-C 6 alkyl, halo, -C] -C 6 haloalkyl, Ci-C 6 hydroxyalkyl, -OH, -C(0)NH-(C C 6 alkyl), -C(0)N(Ci -C 6 alkyl) 2 , -0-(C C 6 alkyl), -NH 2 , -NH(C,-C 6 alkyl), -N(C r C 6 alkyl) 2 and -NHC(0)-(C C 6 alkyl) or ⁇ Si(R B ) 3 ;
  • each occurrence of R 10 is independently CrC 6 alkyl, Ci-C 6 haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl, or heteroaryl;
  • each occurrence of R ! 1 is independently H, -C-e alkyl, C]-C 6 haloalkyl, - [C(R ) 2 ] q N(R 6 ) 2 , -C(0)R l , -C(0)-[C(R 7 ) 2 ] q N(R 6 ) 2 ,
  • each occurrence of R 12 is H, Cj-Ce alkyl, C C 6 haloalkyl, 3 to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl, heteroaryl, halo, -CN, -OR 3 ,
  • each occurrence of R 13 is independently selected from Ci-C 6 alkyl, 3- to 7- membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl, heteroaryl, Cj-C 6 haloalkyl, -CN and -OR 3 , wherein two R B groups, together with the silicon atom to which they are attached, can optionally join to form a 4- to 7-membered silicon-containing
  • each occurrence of R is independently a monocyclic 5- to 7-membered
  • one optional and additional heteroatom ring member elected from the group consisting of nitrogen, oxygen and sulfur, and wherein an R 15 group can be optionally and independently substituted on one or two ring carbon atoms with R ;
  • R !6 is independently:
  • heteroaryl has one or two ring nitrogen atoms and no other ring heteroatoms
  • R 16 when R 16 is said 3 to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said phenyl group or said heteroaryl group, then R 16 can be optionally substituted with up to three groups, which can be the same or different, and are selected from C 3 -C 6 alkyl, halo, -C r C 6 haloalkyl, Ci-C 6 hydroxyalkyl, -OH, -C(0)NH-(C r C 6 alkyl), -C(0)N(Ci-C 6 alkyl) 2 , -0-(C C 6 alkyl), -NH 2> -NH(Ci-C 6 alkyl), -N(d-C 6 alkyl)2 and -NHC(0)-(C C 6 alkyl);
  • each occurrence of R 17 is independently: (i) a 5- to 7-membered silylcycloalkyl ring having one -Si(R ] 3 ) 2 - ring member; or
  • a 5- to 7-membered silylheterocycloalkyl ring having one -Si(R I3 ) 2 - ring member, and one to two heteroatom ring members, which can be the same or different, and are selected from the group consisting of nitrogen, oxygen, and sulfur, such that the -Si(R I3 ) 2 - group must be bonded only to ring carbon atoms; or
  • R 17 group can be optionally and independently substituted on one or two ring carbon atoms with up to two R 12 groups;
  • each occurrence of q is independently an integer ranging from 1 to 4; and each occurrence of r is independently an integer ranging from 0 to 6,
  • a and D is R !S or ⁇ alkylene-N ⁇ R 16 )(R ! 1 ).
  • the Compounds of Formula (I) (also referred to herein as the "Fused Tricyclic Silyl Compounds") and pharmaceutically acceptable salts thereof can be useful, for example, for inhibiting HCV viral replication or replicon activity, and for treating or preventing HCV infection in a patient. Without being bound by any specific theory, it is believed that the Fused Tricyclic Silyl Compounds inhibit HCV viral replication by inhibiting HCV NS5A.
  • the present invention provides methods for treating or preventing HCV infection in a patient, comprising administering to the patient an effective amount of at least one Fused Tricyclic Silyl Compound.
  • the present invention relates to novel Fused Tricyclic Silyl Compounds
  • compositions comprising at least one Fused Tricyclic Silyl Compound, and methods of using the Fused Tricyclic Silyl Compounds for treating or preventing HCV infection in a patient.
  • a "patient” is a human or non-human mammal. In one embodiment, a patient is a human. In another embodiment, a patient is a chimpanzee.
  • an effective amount refers to an amount of Fused Tricyclic Silyl Compound and/or an additional therapeutic agent, or a composition thereof that is effective in producing the desired therapeutic, ameliorative, inhibitory or preventative effect when administered to a patient suffering from a viral infection or virus-related disorder.
  • an effective amount can refer to each individual agent or to the combination as a whole, wherein the amounts of all agents administered are together effective, but wherein the component agent of the combination may not be present individually in an effective amount.
  • alkyl refers to an aliphatic hydrocarbon group having one of its hydrogen atoms replaced with a bond.
  • An alkyl group may be straight or branched and contain from about 1 to about 20 carbon atoms. In one embodiment, an alkyl group contains from about 1 to about 12 carbon atoms. In different embodiments, an alkyl group contains from 1 to 6 carbon atoms (C Gs alkyl) or from about 1 to about 4 carbon atoms (Cj-C 4 alkyl).
  • alkyl groups include methyl, ethyl, n- propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, neopentyl, isopentyl, n- hexyl, isohexyl and neohexyl.
  • An alkyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O- alkyl,
  • an alkyl group is linear. In another embodiment, an alkyl group is branched. Unless otherwise indicated, an alkyl group is unsubstituted,
  • alkenyl refers to an aliphatic hydrocarbon group containing at least one carbon-carbon double bond and having one of its hydrogen atoms replaced with a bond.
  • An alkenyl group may be straight or branched and contain from about 2 to about 15 carbon atoms. In one embodiment, an alkenyl group contains from about 2 to about 12 carbon atoms. In another embodiment, an alkenyl group contains from about 2 to about 6 carbon atoms.
  • alkenyl groups include ethenyl, propenyl, n-butenyl, 3-methylbut-2-enyl, n-pentenyl, octenyl and decenyt
  • An alkenyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O-alkyl, -O-aryl, -alkylene-O- alkyl, alkylthio, -N3 ⁇ 4, -NH(alkyl), -N(alkyl) 2 , -NH(cycloalkyl), -0-C(0)-alkyl, -O-C(O)- aryl, -0-C(0)-cycloalkyl, -C(0)OH and -C(0)0-alkyl.
  • alkynyl refers to an aliphatic hydrocarbon group containing at least one carbon-carbon triple bond and having one of its hydrogen atoms replaced with a bond.
  • An alkynyl group may be straight or branched and contain from about 2 to about 15 carbon atoms. In one embodiment, an alkynyl group contains from 2011/027117
  • an alkynyl group contains from about 2 to about 6 carbon atoms.
  • alkynyl groups include ethynyl, propynyl, 2-butynyl and 3-methylbutynyl.
  • An alkynyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O-alkyl, -O-aryl, -alkylene-O-alkyl, alkylthio, -N3 ⁇ 4, - NH(alkyl), -N(alkyl) 2 , -NH(cycloalkyl), -0-C(0)-alkyl, -0-C(0)-aryl, -0-C(0)-cycloalkyl, -C(0)OH and -C(0)0alkyl,
  • C 2 -Q alkynyl refers to an alkynyl group having from 2 to 6 carbon atoms. Unless otherwise indicated, an alkynyl group is unsubstituted.
  • alkylene refers to an alkyl group, as defined above, wherein one of the alkyl group's hydrogen atoms has been replaced with a bond.
  • alkylene groups include -CH 2 -, -03 ⁇ 403 ⁇ 4-, -CH 2 CH 2 CH 2 -, - CH2CH 2 CH 2 CH 2 -, -CH(CH 3 )CH 2 CH 2 ⁇ , -CH(CH 3 )- and -CH 2 CH(CH 3 )CH 2 -.
  • an alkylene group has from 1 to about 6 carbon atoms.
  • an alkylene group is branched. In another embodiment, an alkylene group is linear. In one embodiment, an alkylene group is -CH 2 -.
  • the term "Ci-C 6 alkylene” refers to an alkylene group having from 1 to 6 carbon atoms.
  • aryl refers to an aromatic monocyclic or multicyclic ring system comprising from about 6 to about 14 carbon atoms. In one embodiment, an aryl group contains from about 6 to about 10 carbon atoms. An aryl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. In one embodiment, an aryl group can be optionally fused to a cycloalkyl or cycloalkanoyl group. Non-limiting examples of aryl groups include phenyl and naphthyl. In one embodiment, an aryl group is phenyl. Unless otherwise indicated, an aryl group is unsubstituted.
  • arylene refers to a bivalent group derived from an aryl group, as defined above, by removal of a hydrogen atom from a ring carbon of an aryl group.
  • An arylene group can be derived from a monocyclic or multicyclic ring system comprising from about 6 to about 14 carbon atoms. In one embodiment, an arylene group contains from about 6 to about 10 carbon atoms. In another embodiment, an arylene group is a naphthylene group. In another embodiment, an arylene group is a phenylene group.
  • An arylene group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below.
  • An arylene group is T/US2011/027117
  • an arylene group can be optionally fused to a cycloalkyl or cycloalkanoyl group.
  • arylene groups include phenylene and naphthalene.
  • an arylene group is unsubstituted.
  • an ar ene group is:
  • cycloalkyl refers to a non-aromatic mono- or multicyclic ring system comprising from about 3 to about 10 ring carbon atoms. In one embodiment, a cycloalkyl contains from about 5 to about 10 ring carbon atoms. In another embodiment, a cycloalkyl contains from about 3 to about 7 ring atoms. In another embodiment, a cycloalkyl contains from about 5 to about 6 ring atoms.
  • cycloalkyl also encompasses a cycloalkyl group, as defined above, which is fused to an aryl (e.g., benzene) or heteroaryl ring.
  • Non-limiting examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.
  • Non-limiting examples of multicyclic cycloalkyls include 1-decalinyl, norbornyl and adamantyl.
  • a cycloalkyl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. In one embodiment, a cycloalkyl group is unsubstituted.
  • 3 to 7-membered cycloalkyl refers to a cycloalkyl group having from 3 to 7 ring carbon atoms. Unless otherwise indicated, a cycloalkyl group is unsubstituted. A ring carbon atom of a cycloalkyl group may be functionalized as a carbonyl group, An illustrative example of such a cycloalkyl group (also referred to herein as a "cycloalkanoyl” group) includes, but is not limited to, cyclobutanoyl:
  • cycloaikenyl refers to a non-aromatic mono- or multicyclic ring system comprising from about 4 to about 10 ring carbon atoms and containing at least one endocyclic double bond. In one embodiment, a cycloaikenyl contains from about 4 to about 7 ring carbon atoms. In another embodiment, a cycloaikenyl contains 5 or 6 ring atoms.
  • monocyclic cycloalkenyls include cyclopentenyl, cyclohexenyl, cyclohepta-l,3-dienyl, and the like.
  • a cycloaikenyl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below.
  • a ring carbon atom of a cycloalkyl group may be functionalized as a carbonyl group.
  • a cycloaikenyl group is cyclopentenyl.
  • a cycloaikenyl group is cyclohexenyl.
  • the term "4 to 7-membered cycloaikenyl” refers to a cycloaikenyl group having from 4 to 7 ring carbon atoms. Unless otherwise indicated, a cycloaikenyl group is unsubstituted.
  • halo means -F, -CI, -Br or -I.
  • haloalkyl refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with a halogen. In one embodiment, a haloalkyl group has from 1 to 6 carbon atoms. In another
  • a haloalkyl group is substituted with from 1 to 3 F atoms.
  • haloalkyl groups include -CH 2 F, -CHF 2) -CF 3 , -CH 2 C1 and -CC1 3 .
  • the term "Ci-C 6 haloalkyl” refers to a haloalkyl group having from 1 to 6 carbon atoms.
  • hydroxyalkyl refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with an ⁇ OH group.
  • a hydroxyalkyl group has from 1 to 6 carbon atoms.
  • Non- limiting examples of hydroxyalkyl groups include -CH 2 OH, -CH2CH 2 OH, - CH 2 CH 2 CH 2 OH and -CH 2 CH(OH)CH 3 .
  • C C 6 hydroxyalkyl refers to a hydroxyalkyl group having from 1 to 6 carbon atoms.
  • heteroaryl refers to an aromatic monocyclic or multicyclic ring system comprising about 5 to about 14 ring atoms, wherein from 1 to 4 of 1 027117
  • ring atoms is independently O, N or S and the remaining ring atoms are carbon atoms.
  • a heteroaryl group has 5 to 10 ring atoms.
  • a heteroaryl group is monocyclic and has 5 or 6 ring atoms.
  • a heteroaryl group is bicyclic.
  • a heteroaryl group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below.
  • a heteroaryl group is joined via a ring carbon atom, and any nitrogen atom of a heteroaryl can be optionally oxidized to the corresponding N-oxide.
  • heteroaryl also encompasses a heteroaryl group, as defined above, which is fused to a benzene ring.
  • heteroaryls include pyridyl, pyrazinyl, furanyl, thienyl, pyrimidinyl, pyridone (including N-substituted pyridones), isoxazolyl, isothiazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyrazolyl, furazanyl, pyrrolyl, triazolyl, 1,2,4-thiadiazolyl, pyrazinyl, pyridazinyl, quinoxalinyl, phthalazinyl, oxindolyl, imidazo[l,2-a]pyridinyl, imidazo[2,l-b]thiazolyl, benzofurazanyl, indolyl, azaindolyl,
  • heteroaryl also refers to partially saturated heteroaryl moieties such as, for example, tetrahydroisoquinolyl, tetrahydroquinolyl and the like.
  • a heteroaryl group is a 5-membered heteroaryl
  • a heteroaryl group is a 6-membered heteroaryl.
  • a heteroaryl group comprises a 5- to 6-membered heteroaryl group fused to a benzene ring. Unless otherwise indicated, a heteroaryl group is unsubstituted.
  • heteroarylene refers to a bivalent group derived from an heteroaryl group, as defined above, by removal of a hydrogen atom from a ring carbon or ring heteroatom of a heteroaryl group.
  • a heteroarylene group can be derived from a monocyclic or multicyclic ring system comprising about 5 to about 14 ring atoms, wherein from 1 to 4 of the ring atoms are each independently O, N or S and the remaining ring atoms are carbon atoms.
  • a heteroarylene group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below.
  • heteroarylene group is joined via a ring carbon atom or by a nitrogen atom with an open valence, and any nitrogen atom of a heteroarylene can be optionally oxidized to the corresponding N-oxide.
  • heteroarylene also encompasses a heteroarylene group, as defined above, which is fused to a benzene ring.
  • Non-limiting examples of heteroaryl enes include pyridylene, pyrazinylene, furanylene, thienylene, pyrimidinyl ene, 2011/027117
  • pyridonylene (including those derived from N-substituted pyridonyls), isoxazolylene, isothiazolylene, oxazolylene, oxadiazolylene, thiazolylene, pyrazolylene, thiophenylene, furazanylene, pyrrolylene, triazolylene, 1,2,4-thiadiazolylene, pyrazinylene, pyridazinylene, quinoxalinylene, phthalazinylene, oxindolylene, imidazotl ⁇ -ajpyridinylene, imidazo[2,l- b] thiazolylene, benzofurazanylene, indolylene, azaindolylene, benzimidazolylene, benzothienylene, quinolinylene, imidazolylene, benzimidazolylene, thienopyridylene, quinazolinylene, thienopyrimidylene
  • heteroarylene also refers to partially saturated heteroarylene moieties such as, for example, tetrahydroisoquinolylene,
  • a heteroarylene group is divalent and either available bond on a heteroarylene ring can connect to either group flanking the heteroarylene group.
  • a heteroarylene group is divalent and either available bond on a heteroarylene ring can connect to either group flanking the heteroarylene group.
  • a heteroarylene group is a monocyclic heteroarylene group or a bicyclic heteroarylene group. In another embodiment, a heteroarylene group is a monocyclic heteroarylene group. In another embodiment, a heteroarylene group is a bicyclic heteroarylene group. In still another embodiment, a heteroarylene group has from about 5 to about 10 ring atoms. In another embodiment, a heteroarylene group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heteroarylene group is bicyclic and has 9 or 10 ring atoms. In another embodiment, a heteroarylene group is a 5-membered monocyclic heteroarylene.
  • a heteroarylene group is a 6-membered monocyclic heteroarylene.
  • a bicyclic heteroarylene group comprises a 5 or 6-membered monocyclic heteroarylene group fused to a benzene ring. Unless otherwise indicated, a heteroarylene group is unsubstituted.
  • heterocycloalkyl refers to a non-aromatic saturated monocyclic or multicyclic ring system comprising 3 to about 11 ring atoms, wherein from 1 to 4 of the ring atoms are independently O, S, N or Si, and the remainder of the ring atoms 2011/027117
  • a heterocycloalkyl group can be joined via a ring carbon, ring silicon atom or ring nitrogen atom.
  • a heterocycloalkyl group is monocyclic and has from about 3 to about 7 ring atoms.
  • a heterocycloalkyl group is monocyclic has from about 4 to about 7 ring atoms.
  • a heterocycloalkyl group is bicyclic and has from about 7 to about 11 ring atoms.
  • a heterocycloalkyl group is monocyclic and has 5 or 6 ring atoms.
  • a heterocycloalkyl group is monocyclic.
  • a heterocycloalkyl group is bicyclic. There are no adjacent oxygen and/or sulfur atoms present in the ring system. Any -NH group in a heterocycloalkyl ring may exist protected such as, for example, as an -N(BOC), -N(Cbz), -N(Tos) group and the like; such protected heterocycloalkyl groups are considered part of this invention.
  • the term "heterocycloalkyl” also encompasses a heterocycloalkyl group, as defined above, which is fused to an aryl (e.g., benzene) or heteroaryl ring.
  • a heterocycloalkyl group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below.
  • the nitrogen or sulfur atom of the heterocycloalkyl can be optionally oxidized to the corresponding N-oxide, S-oxide or S,S-dioxide.
  • monocyclic heterocycloalkyl rings include oxetanyl, piperidyl, pyrrolidinyl, piperazinyl, morpholinyl, thiomorpholinyl, thiazolidinyl, 1,4-dioxanyl, tetrahydrofuranyl,
  • a ring carbon atom of a heterocycloalkyl group may be functional ized as a carbonyl group.
  • An illustrative example of such a heterocycloalkyl group is; H
  • a heterocycloalkyl group is a 5-membered monocyclic heterocycloalkyl. In another embodiment, a heterocycloalkyl group is a 6-membered monocyclic heterocycloalkyl.
  • the term "3 to 7-membered monocyclic cycloalkyl” refers to a monocyclic heterocycloalkyl group having from 3 to 7 ring atoms.
  • the term "4 to 7- membered monocyclic cycloalkyl” refers to a monocyclic heterocycloalkyl group having from 4 to 7 ring atoms.
  • 7 to 11-membered bicyclic heterocycloalkyl refers to a bicyclic heterocycloalkyl group having from 7 to 11 ring atoms. Unless otherwise indicated, an heterocycloalkyl group is unsubstituted.
  • heterocycloalkenyl refers to a heterocycloalkyl group, as defined above, wherein the heterocycloalkyl group contains from 4 to 10 ring atoms, and at least one endocyclic carbon-carbon or carbon-nitrogen double bond.
  • a heterocycloalkenyl group can be joined via a ring carbon or ring nitrogen atom.
  • a heterocycloalkenyl group has from 4 to 7 ring atoms.
  • heterocycloalkenyl group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heterocycloalkenyl group is bicyclic. A heterocycloalkenyl group can optionally substituted by one or more ring system substituents, wherein "ring system substituent" is as defined above. The nitrogen or sulfur atom of the heterocycloalkenyl can be optionally oxidized to the corresponding N-oxide, S-oxide or S,S-dioxide.
  • heterocycloalkenyl groups include 1,2,3,4- tetrahydropyridinyl, 1,2-dihydropyridinyl, 1 ,4- dihydropyridinyl, 1,2,3,6-tetrahydropyridinyl, 1 ,4,5,6-tetrahydropyrimidinyl, 2-pyrrolinyl, 3-pyrrolinyl, 2-imidazolinyl, 2-pyrazolinyl, dihydroimidazolyl, dihydrooxazolyl, dihydrooxadiazolyl, dihydrothiazolyl, 3,4-dihydro-2H-pyranyI, dihydrofuranyl, fluoro- substituted dihydrofuranyl, 7-oxabicyclo[2.2.1]heptenyl, dihydrothiophenyl,
  • a ring carbon atom of a heterocycloalkenyl group may be functionalized as a carbonyl group.
  • a heterocycloalkenyl group is a 5-membered heterocycloalkenyl.
  • a heterocycloalkenyl group is a 6-membered heterocycloalkenyl. The term "4 to 7-membered
  • heterocycloalkenyl refers to a heterocycloalkenyl group having from 4 to 7 ring atoms. Unless otherwise indicated, a heterocycloalkenyl group is unsubstituted.
  • ring system substituent refers to a substituent group attached to an aromatic or non- aromatic ring system which, for example, replaces an available hydrogen on the ring system.
  • Ring system substituents may be the same or different, each being independently selected from the group consisting of alkyl, alkenyl, alkynyl, aryl, heteroaryl, -alkylene-aryl, -arylene-alkyl, -alkylene-heteroaryl, -alkenylene- heteroaryl, -alkynylene-heteroaryl, -OH, hydroxyalkyl, haloalkyl, -O-alkyl, -O-haloalkyl, - alkylene-O-alkyl, -O-aryl, -O-alkylene-aryl, acyl, -C(0)-aryl, halo, -N0 2 , -CN, -SF 5 , - C(0)OH, -C(0)0-alkyl, -C(0)0-aryl, -C(0)0-alkylene-aryl, -S(0) 2 -alkyl, -alkyl, -alky
  • Y s and Y 2 can be the same or different and are independently selected from the group consisting of hydrogen, alkyl, aryl, cycloalkyl, and -alkylene-aryl.
  • Ring system substituent may also mean a single moiety which simultaneously replaces two available hydrogens on two adjacent carbon atoms (one H on each carbon) on a ring system. Examples of such moiety are methylenedioxy, ethylenedioxy, -C(CH 3 ) 2 - ample:
  • silylalkyl refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with a -Si(R*) 3 group, wherein each occurrence of R x is independently CrC 6 alkyl, phenyl or a 3- to 6- membered cycloalkyl group.
  • a silylalkyl group has from 1 to 6 carbon atoms.
  • a silyl alkyl group contains a -Si(CH 3 ) 3 moiety.
  • Non- limiting examples of silylalkyl groups include
  • substituted means that one or more hydrogens on the designated atom is replaced with a selection from the indicated group., provided that the designated atom's normal valency under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds.
  • stable compound' or “stable structure” is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
  • substantially purified form refers to the physical state of a compound after the compound is isolated from a synthetic process (e.g., from a reaction mixture), a natural source, or a combination thereof.
  • substantially purified form also refers to the physical state of a compound after the compound is obtained from a purification process or processes described herein or well-known to the skilled artisan ⁇ e.g., chromatography, recrystallization and the like), in sufficient purity to be characterizable by standard analytical techniques described herein or well-known to the skilled artisan.
  • protecting groups When a functional group in a compound is termed "protected”, this means that the group is in modified form to preclude undesired side reactions at the protected site when the compound is subjected to a reaction. Suitable protecting groups will be recognized by those with ordinary skill in the art as well as by reference to standard textbooks such as, for example, T. W. Greene et al, Protective Groups in Organic Synthesis (1991), Wiley, New York.
  • any substituent or variable e.g., alkyl, R 6 , R a , etc.
  • its definition on each occurrence is independent of its definition at every other occurrence, unless otherwise indicated.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
  • Prodrugs and solvates of the compounds of the invention are also contemplated herein.
  • a discussion of prodrugs is provided in T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems (1987) 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, (1987) Edward B. Roche, ed., American Pharmaceutical T/US2011/027117
  • prodrug means a compound ⁇ e.g., a drug precursor) that is transformed in vivo to provide a Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt or solvate of the compound.
  • the transformation may occur by various mechanisms ⁇ e.g., by metabolic or chemical processes), such as, for example, through hydrolysis in blood.
  • a prodrug can comprise an ester formed by the replacement of the hydrogen atom of the acid group with a group such as, for example, (Cj-Cg)alkyl, ⁇ -C ⁇ alkanoyloxymethyl, 1- (alkanoyloxy)ethyl having from 4 to 9 carbon atoms, 1 -methyl- 1 -(alkanoyloxy)-ethyl having from 5 to 10 carbon atoms, alkoxycarbonyloxymethyl having from 3 to 6 carbon atoms, l-(alkoxycarbonyloxy)ethyl having from 4 to 7 carbon atoms, 1 -methyl- 1- (alkoxycarbonyloxy)ethyl having from 5 to 8 carbon atoms, N- (alkoxycarbonyl)aminomethyl having from 3 to 9 carbon atoms, 1-(N)alkyl, ⁇ -C ⁇ alkanoyloxymethyl, 1- (alkanoyloxy)ethyl having from 4 to 9 carbon atoms, 1
  • a prodrug can be formed by the replacement of the hydrogen atom of the alcohol group with a group such as, for example, (Ct-Cejalkanoyloxymethyl, l-((Ci-C 6 )alkanoyloxy)ethyl, 1- methyl-1 -((Ci-Cg)alkanoyloxy)ethyl, (C 1 -C 6 )alkoxycarbonyloxymethyl, N-(Cj- C6)alkoxycarbonylaminomethyl, succinoyl, (CrC 6 )alkanoyl, a-amino(Ci-C )alkyl, a- amino(Ci-C4)alkylene-aryl, arylacyl and a-aminoacyl, or ⁇ -aminoacyl-a-aminoacyl, where each ⁇ -aminoacyl group is independently selected from the
  • a prodrug can be formed by the replacement of a hydrogen atom in the amine group with a group such as, for example, R-carbonyl-, ROcarbonyl-, NRR'-carbonyl- wherein R and R' are each independently (Ci-Cio)alkyl, (C3-C7) cycloalkyl, benzyl, a natural a-aminoacyl,— C(OH)C(0)OY !
  • Y 1 is H, (Ci-C 6 )alkyl or benzyl, — C(OY 2 )Y 3 wherein Y 2 is (C;-C 4 ) alkyl and Y 3 is (C C 6 )alkyl; carboxy (C C 6 )alkyl; amiiio(C C 4 )alkyl or mono-N- or di-N,N-(Ci-C 6 )alkylaminoalkyl; -C(Y )Y 5 wherein Y 4 is H or methyl and Y 5 is mono-N- or di-N ⁇ -id-Ceialkylami o morpholino; piperidin-l-yl or pyrrolidin-l-yl, and the like.
  • esters of the present compounds include the following groups: (1) carboxylic acid esters obtained by esterification of the hydroxy group of a hydroxyl compound, in which the non-carbonyl moiety of the carboxylic acid portion of the ester grouping is selected from straight or branched chain alkyl (e.g., methyl, ethyl, n- propyl, isopropyl, t-butyl, sec-butyl or n-butyl), alkoxyalkyl (e.g., methoxymethyl), aralkyl (e.g., benzyl), aryloxyalkyl (for example, phenoxymethyl), aryl (e.g., phenyl optionally substituted with, for example, halogen, Ci -4 alkyl, -0-(Ci- alkyl) or amino); (2) sulfonate esters, such as alkyl- or aralkylsulfonyl (for example, methanesulfon
  • the phosphate esters may be further esterified by, for example, a Ci. 2 o alcohol or reactive derivative thereof, or by a 2,3-di (C 6 . 2 )acyl glycerol.
  • One or more compounds of the invention may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms.
  • “Solvate” means a physical association of a compound of this invention with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. "Solvate” encompasses both solution-phase and isolatable solvates. Non-limiting examples of solvates include ethanolates, methanolates, and the like. A “hydrate” is a solvate wherein the solvent molecule is water.
  • One or more compounds of the invention may optionally be converted to a solvate.
  • Preparation of solvates is generally known.
  • the Fused Tricyclic Silyl Compounds can form salts which are also within the scope of this invention.
  • Reference to a Fused Tricyclic Silyl Compound herein is understood to include reference to salts thereof, unless otherwise indicated.
  • the term "salt(s)", as employed herein, denotes acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases.
  • zwitterions may be formed and are included within the term "salt(s)" as used herein.
  • the salt is a pharmaceutically acceptable (i.e., non-toxic, physiologically acceptable) salt.
  • the salt is other than a pharmaceutically acceptable salt.
  • Salts of the Compounds of Formula (I) may be formed, for example, by reacting a Fused Tricyclic Silyl Compound with an amount of acid or base, such as an equivalent amount, in a medium such as one in which the salt precipitates or in an aqueous medium followed by lyophilization.
  • Exemplary acid addition salts include acetates, ascorbates, benzoates,
  • benzenesulfonates bisulfates, borates, butyrates, citrates, camphorates, camphorsulfonates, fumarates, hydrochlorides, hydrobromides, hydroiodides, lactates, maleates,
  • methanesulfonates (“mesylates"), naphthalenesulfonates, nitrates, oxalates, phosphates, propionates, salicylates, succinates, sulfates, tartarates, thiocyanates, toluenesulfonates (also known as tosylates) and the like.
  • a compound of formula (I) is present as its dihydrochloride salt.
  • a compound of formula (I) is present as its dimesylate salt.
  • acids which are generally considered suitable for the formation of pharmaceutically useful salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl et al, Camille G.
  • Exemplary basic salts include ammonium salts, alkali metal salts such as sodium, lithium, and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, salts with organic bases (for example, organic amines) such as dicyclohexylamine, t-butyl amine, choline, and salts with amino acids such as arginine, lysine and the like.
  • alkali metal salts such as sodium, lithium, and potassium salts
  • alkaline earth metal salts such as calcium and magnesium salts
  • salts with organic bases for example, organic amines
  • organic bases for example, organic amines
  • amino acids such as arginine, lysine and the like.
  • Basic nitrogen-containing groups may be quarternized with agents such as lower alkyl halides ⁇ e.g., methyl, ethyl, and butyl chlorides, bromides and iodides), dialkyl sulfates (e.g., dimethyl, diethyl, and dibutyl sulfates), long chain halides (e.g., decyl, lauryl, and stearyl chlorides, bromides and iodides), aralkyl halides (e.g., benzyl and phenethyl bromides), and others.
  • agents such as lower alkyl halides ⁇ e.g., methyl, ethyl, and butyl chlorides, bromides and iodides), dialkyl sulfates (e.g., dimethyl, diethyl, and dibutyl sulfates), long chain halides (e.g., decyl, lauryl
  • Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well-known to those skilled in the art, such as, for example, by chromatography and/or fractional crystallization.
  • Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers.
  • an appropriate optically active compound e.g., chiral auxiliary such as a chiral alcohol or Mosher's acid chloride
  • Sterochemically pure compounds may also be prepared by using chiral starting materials or by employing salt resolution techniques. Also, some of the Fused Tricyclic Silyl
  • Atropisomers e.g., substituted biaryls
  • Enantiomers can also be directly separated using chiral chromatographic techniques.
  • Fused Tricyclic Silyl Compounds may exist in different tautomeric forms, and all such forms are embraced within the scope of the invention.
  • all keto-enol and imine-enamine forms of the compounds are included in the invention.
  • All stereoisomers for example, geometric isomers, optical isomers and the like
  • of the present compounds including those of the salts, solvates, hydrates, esters and prodrugs of the compounds as well as the salts, solvates and esters of the prodrugs, such as those which may exist due to asymmetric carbons on various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, 27117
  • Individual stereoisomers of the compounds of the invention may, for example, be substantially free of other isomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers.
  • the chiral centers of the present invention can have the S or R configuration as defined by the IUPAC 1974 Recommendations.
  • the use of the terms "salt”, “solvate 11 , “ester”, “prodrug” and the like, is intended to apply equally to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates or prodrugs of the inventive compounds.
  • the atoms may exhibit their natural isotopic abundances, or one or more of the atoms may be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number predominantly found in nature.
  • the present invention is meant to include all suitable isotopic variations of the compounds of generic Formula I.
  • different isotopic forms of hydrogen (H) include protium and deuterium ( 2 H).
  • Protium is the predominant hydrogen isotope found in nature. Enriching for deuterium may afford certain therapeutic advantages, such as increasing in vivo half-life or reducing dosage requirements, or may provide a compound useful as a standard for characterization of biological samples.
  • Isotopically-enriched Compounds of Formula (I) can be prepared without undue experimentation by conventional techniques well known to those skilled in the ait or by processes analogous to those described in the Schemes and Examples herein using appropriate isotopically-enriched reagents and/or intermediates.
  • a Compound of Formula (I) has one or more of its hydrogen atoms replaced with deuterium.
  • DMF is NN-dimethylformamide
  • dppf is diphenylphosphinoferrocene
  • DMSO is dimethylsulfoxide
  • EtOAc is ethyl acetate
  • Et 2 0 is diethyl ether
  • Et 3 N is triethylamine
  • HATU is 0-(7-azabenzotriazol-l-yl)-N,N,N',N'-tetramethyluronium hexafiuorophosphate
  • Hg(OAc) 2 is mercuric acetate
  • HPLC high performance liquid chromatography
  • HRMS is high resolution mass spectrometry
  • KOAc is potassium acetate
  • Lawesson's Reagent is 2,4- Bis(4-methoxyphenyl)-l,3-dithiadiphosphetane-2 J 4-disulfide
  • LCMS is liquid
  • LCMS low resolution mass spectrometry
  • mCPBA m-chloroperbenzoic acid
  • MeOH is methanol
  • MTBE is feri-butylmethyl ether
  • NBS is N-bromosuccinimide
  • NH 4 OAc is ammonium acetate
  • Pd(PPh 3 ) 4 is
  • PdCi 2 (dppf)2 is [1.1 '-
  • PdC ⁇ Cdppf CHbCb is [l,V- Bis(diphenylphosphino)ferrocene] dichloro palladium(II) complex with dichioromethane; pinacol 2 B 2 is bis(pinacolato)diboron; PPTS is pyridinium p-toluene sulfonate; RPLC is reverse-phase liquid chromatography; SEM-C1 is 2-(trimethylsilyl)ethoxymethyl chloride; TBAF is tetrabutylammonium fluoride; TBAI is tetrabutylammonium iodide; TBDMSCl is fert-butyldimethylsilyl chloride; TFA is trifluoroacetic acid; THF is tetrahydrofuran; TLC is thin-layer chromatography; XPhos is 2-
  • the pres nt invention provides Fused Tricyclic Silyl Compounds of Formula (I):
  • A is selected from:
  • A is selected from:
  • B is a 5-membered monocyclic heteroarylene.
  • B is:
  • C is a monocyclic heteroarylene.
  • C is a 6-membered monocyclic heteroarylene.
  • C is a 5-membered monocyclic heteroarylene.
  • C is a bicyclic heteroarylene.
  • C is:
  • R is an optional ring substituent selected from F, -OCH 3 , pyridyl, -OCH 2 CH 2 OH, ⁇ OCH 2 CH 2 OC(0)CH 3 , cyclopropyl and thiophenyl.
  • D is selected from:
  • a and D are each independently
  • a and D are each selected from:
  • R 4 is T/US2011/027117
  • B is a 5-membered monocyclic heteroarylene
  • R is an optional ring substituent selected from F, -OCH3, pyridyl,
  • the Compounds of Formula (I) have the formula (la):
  • A is -alkylene-N(R 7 )(R n ), -allcylene-N(R 16 )(R n ), 4 to 7- membered monocyclic heterocycloalkyl, 7 to 11- membered bicyclic heterocycloalkyl or R 15 , wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or said R 15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or R 15 group can be optionally and independently substituted on one or more ring nitrogen atoms with R 4 , and on one or more ring carbon atoms with R 12 , such that two
  • D is -alkylene-N(R 7 )(R n ), ⁇ alkylene-N(R !6 )(R u ), 4 to 7- membered monocyclic heterocycloalkyl, 7 to 11- membered bicyclic heterocycloalkyl or R 15 , wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or said R 15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 1 1 - membered bicyclic heterocycloalkyl group or R 15 group can be optionally and independently substituted on one or more ring nitrogen atoms with R 4 , and on one or more ring carbon atoms with R 12 ,
  • A is selected from:
  • A is selected from: T/US2011/027117
  • B is a 5 -membered monocyclic heteroarylene group containing at least one nitrogen atom, wherein said 5- membered monocyclic heteroarylene group can be optionally fused to a benzene, pyridine or pyrimidine ring, and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with K 6 and on one or more ring carbon atoms with R 1 .
  • B is a 5-membered monocyclic heteroarylene.
  • B is:
  • C is a monocyclic heteroarylene.
  • C is a 6-membered monocyclic heteroarylene.
  • C is a 5-membered monocyclic heteroarylene.
  • C is a bicyclic heteroarylene.
  • C is 11 027117
  • R is an optional ring substituent selected from halo, 3- to 7-membered cycioalkyl, 5- or 6-membered heteroaryl, 0-(Ci-C 6 alkyl), -0-(C]-C 6 hydroxyalkyl) and -0-(C r C 6 alkylene)-OC(0)-(C C 6 alkyl).
  • C is:
  • K i2 is an optional ring substituent selected from F, -OCH 3 , pyridyl,
  • D is selected from:
  • D is selected from:
  • a and D are each independently selected from:
  • a and D are each independently selected from:
  • a and D are each independently a 4 to 7- membered monocyclic heterocycloalkyl, 7 to 1 1- membered bicyclic heterocycloalkyl or R 15 , wherein said 4 to 7- membered monocyclic heterocycloalkyl group or said R 15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7- membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more ring nitrogen atoms with R 4 , and on one or more ring carbon atoms with R 12 , such that two R 12 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group, or a spirocyclic 4
  • a and D are each independently selected from:
  • B is a 5-membered monocyclic heteroarylene
  • R 12 is an optional ring substituent selected from F, -OCH 3; pyridyl,
  • a and D are each independently selected from:
  • R is an optional ring substituent selected from F, -OCH 3 , pyridyl,
  • A, C, D, M 1 , X ! and X 2 are defined above for the Compounds of Formula (la) and B is 5-membered monocyclic heteroaryiene group containing at least one nitrogen atom, wherein said 5-membered monocyclic heteroaryiene group can be optionally fused to 11 027117
  • a benzene, pyridine or pyrimidine ring and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with R 6 and on one or more ring carbon atoms with R 12 .
  • A is ⁇ -alkylene-N(R 7 )(R n ). In another embodiment, for the Compounds of Formula (lb), A is -alkylene- N(R ,6 )(R n ).
  • A is a 4 to 7-membered heterocycloalkyl.
  • A is R ! 5 .
  • A is selected from:
  • A is selected from:
  • A is selected from:
  • A is selected from:
  • A is , wherein each occurrence of R is independently H
  • A is selected from:
  • R is H, alkyl, haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7- membered heterocycloalkyl, aryl or heteroaryl and R a is alkyl, haloalkyl, silylalkyl, 3 to 7- membered cycloalkyl or 4 to 7- membered heterocycloalkyl, aryl or heteroaryl.
  • A is selected from:
  • R 4 is: , wherein R a is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH 2 CH 2 Si(CH3)3, -C3 ⁇ 4CH 2 CF 3 , pyranyl, benzyl or phenyl, and R ! is methyl, ethyl or isopropyl.
  • A is selected from:
  • A is:
  • A is -alkylene- N(alkyl)-C(0)-CH(alkyl)-NHC(0)0-alkyl, -alkylene-N(cycloa!kyl)-C(0)-CH(alkyl)- NHC(0)0-alkyl, -alkylene-N(cycloalkyl)-C(0)-CH(cycloalkyl)-NHC(0)0-alkyl J - alkyiene-N(cycloalkyl)-C(0)-CH(aryl)-NHC(0)0-alkyl or -alkylene-N(cycloalkyl)-C(0)- CH(heteroary!)-NHC(0)0-alkyl.
  • B is a 5-membered monocyclic heteroarylene.
  • B is:
  • C is a monocyclic heteroarylene.
  • C is a 6-membered monocyclic heteroarylene.
  • C is a 5-membered monocyclic heteroarylene.
  • C is abicyclic heteroarylene.
  • R is an optional ring substituent selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, - 0-(C r C 6 alkyl), -0-(Ci-C 6 hydroxyalkyi) and -0-(C r C 6 alkylene)-OC(0)-(Ci-C 6 alkyl).
  • R is an optional ring substituent selected from F, -OCH 3 , pyridyl,
  • D isTMalkylene-N(R 7 )(R H ). In another embodiment, for the Compounds of Formula (lb), D is -alkylene- N(R 16 )(R n ).
  • D is a 4 to 7-membered heterocycloalkyl.
  • D is R 15 .
  • D is selected from:
  • D is selected from:
  • D is selected from:
  • D is selected from ;
  • D is , wherein each occurrence of R 12 is independently H or F.
  • D is selected from:
  • R 4 is , wherein R 1 is H, alkyl, haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7- membered heterocycloalkyi, aryl or heteroaryl and R a is alkyl, haloalkyl, silyialkyl, 3 to 7- membered cycloalkyl or 4 to 7- membered heterocycloalkyi, aryl or heteroaryl.
  • D is selected from:
  • R a is H, methyl, ethyl, propyl, isopropyl, -butyl, cyclopropyl, -CH 2 CH 2 Si(CH 3 )3, -CH 2 CH 2 CF 3 , pyranyl, benzyl or phenyl, and R 1 is methyl, ethyl or isopropyl.
  • D is selected from:
  • D is:
  • R is independently H or F; and R 4 is
  • D is:
  • D is -alkylene- N(alkyl)-C(0)-CH(alkyl)-NHC(0)0-alkyl ; -alkylene-N(cycloalkyl)-C(0)-CH(alkyl)- NHC(0)Oalkyl, -alkylene-N(cycloalkyl)-C(0)-CH(cycloalkyl)-NHC(0)0-alkyl, - alkylene-N(cycloalkyl)-C(0)-CH(aryl)-NHC(0)0-alkyl or-alkylene-N(cycloa!kyl)-C(0)- CH(heteroaryl)-NHC(0)0-alkyl.
  • M 1 is a bond.
  • M 1 is -S(0) 2-
  • M ! is -0-.
  • M 1 is -C(R 7 ) 2 -.
  • M 1 is -CH 2 -.
  • M 1 is -N(R 6 )-.
  • M 5 is a bond.
  • M 1 is -CH-CH-.
  • M s is -CH-N-.
  • M 1 is -C(R 7 ) 2 -0-.
  • M is -0-C(R ) 2 -.
  • M 1 is -C(R 7 ) 2 -
  • M 1 is -N(R 6 )-C(R 7 ) 2 -
  • X C(R )-.
  • X 1 N-.
  • X 1 is -CH-.
  • X 2 is -CH-.
  • X 1 and X 2 are each -CH-.
  • each of A and D is R i 5 .
  • a and D are each independently
  • a and D are each independently selected from:
  • one of A and D is 1 5 and the other is selected from:
  • one of A and D is and the other is selected from:
  • one of A and D is selected from:
  • one of A and D is R and the other is selected from: and each occurrence of R 4 is
  • one of A and D is:
  • each occurrence of R is independently H or F; the other of A and D is selected from:
  • M is a bond
  • M 1 is -S(0) 2- In another embodiment, for the Compounds of Formula (lb), M 1 is -0-.
  • M is -C(R ) -.
  • M 1 is -C3 ⁇ 4-.
  • M 1 is ⁇ N(R 6 )-
  • M 1 is a bond.
  • M 1 is -C(R 7 ) 2 -0-, In another embodiment, for the Compounds of Formula (lb), M 1 is -0-C(R 7 ) 2 -, In yet another embodiment, for the Compounds of Formula (lb), M 1 is -C(R 7 ) 2 -
  • M is -N(R )-C(R ) 2
  • X ! (R 5 )-.
  • X 1 is -N-.
  • X 1 is -CH-.
  • X is ⁇ (R )-.
  • X 2 N-.
  • X 2 is -CH-.
  • X and X are each -CH
  • C is phenylene, 5- or 6- membered monocyclic heteroarylene or 9-membered bicyclic heteroarylene, wherein said phenylene group, said 5- or 6-membered monocyclic heteroarylene group or said 9-membered bicyclic heteroarylene group can be optionally and independently substituted with up to two groups, which can be the same or different, and are selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, -0(CrC 6 alkyl), -0-(Ci-C 6 hydroxyalkyl), or -0-(C,-C 6 alkyl ene)-OC(0)-(Ci-Q alkyl);
  • each occurrence of Z is independently -Si(R x ) 2 -, -C(R y ) 2 - or - ⁇ S(0) 2 -, such that at least one occurrence of Z is -Si(R ) 2 -; each occurrence of R x is independently Ci-C 6 alkyl or two R groups that are attached to the same Si atom, combine to form a ⁇ 3 ⁇ 4) 4 - or ⁇ (CH 2 )s- group; and
  • each occurrence of R y is independently H or F;
  • each occurrence of R 1 is independently Cj-C 6 alkyl
  • each occurrence of R 4 is independently -C(0)CH(R 7 )NHC(0)OR 1 ;
  • each occurrence of R 7 is independently Cj-C 6 alkyl, Cj-Ce silylalkyl or 4 to 7- membered heterocycloalkyl;
  • C is:
  • R is a single ring substituent selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, -0-(C ⁇ ⁇ Ce alkyl), -0-(CrC 6 hydroxyalkyl) and - 0-(C r C 6 alkylene)-OC(0)-(Ci-C 6 alkyl).
  • R is an optional ring substituent selected from F, -OCH 3 , pyridyl,
  • each occurrence of t is independently 1 or 2.
  • each occurrence of t is 1.
  • one occurrence of Z is -Si(R x ) 2 - and the other is ⁇ C(R y ) 2 -.
  • each occun-ence of Z is -Si(R x ) 2 -
  • each occurrence of Z is -C(R y ) 2 -.
  • one occurrence of Z is -Si(C3 ⁇ 4) 2 - and the other is -C(R y ) 2 ⁇ .
  • each occurrence of Z is independently -Si(R ) 2 - or -C(R y ) 2 -;
  • each occurrence of R x is independently Ci-C 6 alkyl or two R x groups that are attached to the same Si atom, combine to form a ⁇ CH 2 )4- or -(CH 2 )s- group;
  • each occurrence of R y is independently H or F
  • one occurrence of Z is ⁇ Si(R x ) 2 - and the other is -C(R y ) 2 -.
  • each occurrence of Z is -Si(R x ) 2 -.
  • one occurrence of is -CF 2 -.
  • one occurrence of Z -Si(CH 3 ) 2 - and the other is -CF 2 -.
  • Z a is -Si(R x ) 2 -;
  • Z b is ⁇ C(RV;
  • each occurrence of R x is independently Ci-C 6 aikyl or two R x groups that are attached to the same Si atom, combine to form a -(CH 2 )4- or ⁇ (CH 2 ) 5 - group;
  • each occurrence of R y is independently H or F.
  • each occurrence of R x is methyl, of Z is -CF 2 -.
  • each occurrence of R y is F.
  • variables A, B, C, D, M 1 , X 1 and X 2 in the Compounds of Formula (I) are selected independently from each other.
  • a Compound of Formula (I) is in substantially purified form.
  • Other embodiments of the present invention include the following:
  • composition comprising an effective amount of a Compound of Formula (I) or a pharmaceutically acceptable salt thereof, and a
  • HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors.
  • a pharmaceutical combination that is (i) a Compound of Formula ( ⁇ ) and (ii) a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti -infective agents; wherein the Compound of Formula (I) and the second therapeutic agent are each employed in an amount that renders the combination effective for inhibiting HCV replication, or for treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection.
  • HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors.
  • HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors. 1 027117
  • (j) A method of inhibiting HCV replication in a subject in need thereof which comprises administering to the subject the pharmaceutical composition of (a), (b) or (c) or the combination of (d) or (e).
  • (k) A method of treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection in a subject in need thereof which comprises administering to the subject the pharmaceutical composition of (a), (b) or (c) or the combination of (d) or (e).
  • the present invention also includes a compound of the present invention for use (i) in, (ii) as a medicament for, or (iii) in the preparation of a medicament for: (a) inhibiting HCV replication or (b) treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection.
  • the compounds of the present invention can optionally be employed in combination with one or more second therapeutic agents selected from HCV antiviral agents, anti-infective agents, and immunomodulators.
  • Additional embodiments of the invention include the pharmaceutical compositions, combinations and methods set forth in (a)-(k) above and the uses set forth in the preceding paragraph, wherein the compound of the present invention employed therein is a compound of one of the embodiments, aspects, classes, sub-classes, or features of the compounds described above. In all of these embodiments, the compound may optionally be used in the form of a pharmaceutically acceptable salt or hydrate as appropriate.
  • compositions and methods provided as (a) through (k) above are understood to include all embodiments of the compounds, including such embodiments as result from combinations of embodiments.
  • Non-limiting examples of the Compounds of Formula (I) include compounds 1-106, as set forth below.
  • Compounds 1, 2, 15, 16, 20, 42, 44-51, 53-58, 60, 61, 65-67, 70-74, 76- 81, 83-97 and 99-106 were made using the methods described in the Schemes and Examples herein.
  • Compounds 3-14, 17-19, 21-41, 43, 52, 59, 62-64, 68, 75, 82 and 98 can be made using the methods described in the Schemes and Examples herein.
  • the Compounds of Formula (I) may be prepared from known or readily prepared starting materials, following methods known to one skilled in the ait of organic synthesis. Methods useful for making the Compounds of Formula (I) are set forth in the Examples below and generalized in Schemes 1-8 below. Alternative synthetic pathways and analogous structures will be apparent to those skilled in the art of organic synthesis. All stereoisomers and tautomeric forms of the compounds are contemplated.
  • Scheme 1 shows a method useful for making the naphthyl imidazole compounds of formula A7 and A8, which are useful intermediates for making the Compounds of Formula
  • Nitration of bromonaphthyl acetamide Al provides nitro analog A2 (J. Am. Chem. Soc, 73:4297 (1997)).
  • the removal of acetyl group under acidic conditions followed by reduction of the nitro group should afford diaminonaphthalene A4.
  • Coupling of the aniline to a cyclic or acyclic TV-protected a-amino acid A5 gives an amide of formula A6, which upon heating in acetic acid will cyclize to provide tricyclic bormonaphthylimidazole A7.
  • the bromide could be converted to a boronate A8 with a palladium catalyst.
  • Scheme 2 shows a method useful for making the quinolineimidazole compounds of formula B6, which are useful intermediates for making the Compounds of Formula (I).
  • aminonitroquinoline Bl can be reduced to diaminoquinoline B2, which is then coupled to a cyclic or acyclic N-protected a-amino acid AS to providean amide B3. It can then be cyclized to quinolineimidazole B4 under acidic conditions. N- oxide B5 can then be obtained with w-chloroperbenzoic acid. Upon treatment with phosphorous oxychloride, B5 should give the desired chloroquinoline B6, which can used in Suzuki coupling reactions.
  • Scheme 3 shows a method useful for making the boronic acid compounds of formula C4, which are useful intermediates for making the Compounds of Formula (I), where in “C” is a monocyclic 5 to 6-membered heteroaryl (examples: thiophene or pyridine).
  • the Suzuki coupling partner C3 or C4 can be prepared from commercially available heteroaryl bromoacetyl compound of formula CI (Scheme 3).
  • an N-protected amino acid PG-AA-OH
  • DIPEA an amine base
  • a ketoester C2 is formed. If heated together with ammonium acetate, the ketoester is converted to the desired imidazole derivative C3.
  • the bromide can then be converted to a boronate C4 with a palladium catalyzed reaction.
  • Scheme 4 shows methods useful for making the compounds of formula CI and C3, which are useful intermediates for making the Compounds of Formula (I), wherein variable C is other than a bond and B is an imidazole ring.
  • heteroaryl bromoacetyl CI When heteroaryl bromoacetyl CI is not commercially available, it can be prepared by performing Friedel-Crafts acylation on a heteroaryl bromide of formula Dl using well- known methods, (e.g., those described in ricka et al, J. Chem. Soc. Per n Trans I 859- 863 (1973), and Kricka et al, Chem. Rew., 74, 101-123, (1974)) to provide the acylated products of formula D2.
  • a compound of formula D2 can then be brominated using bromine, for example, to provide the compounds of formula CI.
  • bromo-iodo substituted heteroaromatic rings D3 can undergo a
  • Stilie coupling with (a-ethoxyvinyl) tributylstannane in the presence of a palladium catalyst using the methods including, but not limited to those described in Choshi et al., J. Org. Chem., 62:2535-2543 (1997), and Scott et al , J. Am. Chem. Soc, 106:4630 (1984)), to provide the ethyl-vinyl ether intermediate D4.
  • Treating D4 with N-bromosuccimide gives the desired bromoacetyl intermediate CI, which can then be elaborated to advanced intermediates C3 or C4 for Suzuki coupling.
  • a heteroaromatic dibromide of formula D5 can be lithiated using n- butyl lithium and then quenched with N-Boc- glycine Weinreb amide to provide a Boc- protected ⁇ -keto amino compound of formula D6.
  • Removal of the Boc group using TFA for example, provides an amine compound of formula D7, which can then be coupled with an N -protected amino acid using typical amide bond forming reagents such as HATU to provide a ketoamide compound of formula D8.
  • compound D8 Upon heated in the presence of ammonium acetate, compound D8 can be cyclized to the imidazole analog of formula C3.
  • Scheme 5 shows a method useful for making the boronic acid compounds of formula E4, which are useful intermediates for making the Compounds of Formula (I).
  • a heteroaromatic diamine El could be converted to a bicyclic imidazole E3 using the two step coupling-cyclization procedure described, for example, in Scheme 3.
  • the corresponding boronate E4 can then easily be obtained from bromide E3 via well-known 1 027117
  • Scheme 6 shows methods useful for making the Compounds of Formula (I) via a Suzuki Coupling process.
  • a Suzuki coupling between protected imidazole boronate C4 (or boronic acid, not shown) and the fused bi-aryl tricyclic bromide A6 using, for example, the methods described in Angew Chem. Int. Ed. Engl. , 40 ? 4544 (2001) provide the compounds of formula Gl.
  • Compounds of formula Gl can then be used to provide compounds of formula G2 by removal of the nitrogen protecting groups of Gl.
  • An appropriate cap of group R can be added to the deprotected amino groups of G2 using reactions including, but not limited to acylation (with an acyl chloride or amino acid coupling reagent such as HATU or HOBt/EDCI), sulfonylation (with a sulfonyl chloride) or alkylation (with alkyl halide or reductive amination) to provide the desired Compounds of Formula (I).
  • acylation with an acyl chloride or amino acid coupling reagent such as HATU or HOBt/EDCI
  • sulfonylation with a sulfonyl chloride
  • alkylation with alkyl halide or reductive amination
  • Scheme 7 shows alternative methods useful for making the Compounds of Formula (I) via a Suzuki Coupling process.
  • a bicyclic bromide of formula E3 and fused tricyclic boronate of formula A7 can be joined using the methods described in Scheme 6 above, to provide coupled intermediates of formula HI.
  • the compounds of formula HI can then be further elaborated using, for example, the methods described in Scheme 6 above, to provide the Compounds of Formula (I), wherein C is a bond and B is a bicyclic heteroarylene group.
  • ⁇ N ⁇ y N / ⁇ - ⁇ - ⁇ ⁇ . t N--7 ⁇ - ⁇ ⁇ .
  • a boronate of formula C4 and chloroquinolineimidazole of formula B6 can be coupled under Suzuki coupling conditions similar to the methods described above to provideproducts of formula II, which can be transformed to the final targets of formula 13, using methods well-known to those skilled in the art of organic synthesis, including those described in Scheme 6 above.
  • the amino acids such as, but not limited to proline, 4,4-difluoroproline, (S)-2-piperidine carboxylic acid, valine, alanine, norvaline, etc.
  • the amino acids are incorporated as part of structures.
  • amide bonds include but are not limited to, the use of a reactive carboxy derivative (e.g., an acid halide, or ester at elevated temperatures) or the use of an acid with a coupling reagent (e.g. , HOBt, EDCI, DCC, HATU, PyBrop) with an amine.
  • a reactive carboxy derivative e.g., an acid halide, or ester at elevated temperatures
  • a coupling reagent e.g. , HOBt, EDCI, DCC, HATU, PyBrop
  • Such materials can be characterized using conventional means, including physical constants and spectral data.
  • the Fused Tricyclic Silyl Compounds are useful in human and veterinary medicine for treating or preventing a viral infection in a patient.
  • the Fused Tricyclic Silyl Compounds can be inhibitors of viral replication.
  • the Fused Tricyclic Silyl Compounds can be inhibitors of HCV replication. Accordingly, the Fused Tricyclic Silyl Compounds are useful for treating viral infections, such as HCV.
  • the Fused Tricyclic Silyl Compounds can be administered to a patient in need of treatment or prevention of a viral infection.
  • the invention provides methods for treating a viral infection in a patient comprising administering to the patient an effective amount of at least one Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt thereof.
  • the Fused Tricyclic Silyl Compounds can be useful for treating or preventing a viral infection caused by the Flaviviridae family of viruses.
  • Flaviviridae infections that can be treated or prevented using the present methods include but are not limited to, dengue fever, Japanese encephalitis, yasanur Forest disease, Murray Valley encephalitis, St. Louis encephalitis, Tick-borne encephalitis, West Nile encephalitis, yellow fever and Hepatitis C Virus (HCV) infection.
  • dengue fever Japanese encephalitis
  • yasanur Forest disease Murray Valley encephalitis
  • St. Louis encephalitis St. Louis encephalitis
  • Tick-borne encephalitis West Nile encephalitis
  • West Nile encephalitis yellow fever
  • HCV Hepatitis C Virus
  • the Flaviviridae infection being treated is hepatitis C virus infection.
  • the Fused Tricyclic Silyl Compounds are useful in the inhibition of HCV (e.g., HCV NS5 A), the treatment of HCV infection and/or reduction of the likelihood or severity of symptoms of HCV infection and the inhibition of HCV viral replication and/or HCV viral production in a cell-based system.
  • HCV e.g., HCV NS5 A
  • the Fused Tricyclic Silyl Compounds are useful in treating infection by HCV after suspected past exposure to HCV by such means as blood transfusion, exchange of body fluids, bites, accidental needle stick, or exposure to patient blood during surgery or other medical procedures.
  • the hepatitis C infection is acute hepatitis C. In another embodiment, the hepatitis C infection is chronic hepatitis C.
  • the invention provides methods for treating HCV infection in a patient, the methods comprising administering to the patient an effective amount of at least one Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt thereof.
  • the amount administered is effective to treat or prevent infection by HCV in the patient.
  • the amount administered is effective to inhibit HCV viral replication and/or viral production in the patient.
  • the Fused Tricyclic Silyl Compounds are also useful in the preparation and execution of screening assays for antiviral compounds.
  • the Fused Tricyclic Silyl Compounds are useful for identifying resistant HCV replicon cell lines harboring mutations within NS5A, which are excellent screening tools for more powerful antiviral compounds.
  • the Fused Tricyclic Silyl Compounds are useful in establishing or determining the binding site of other antivirals to the HCV replicase.
  • compositions and combinations of the present invention can be useful for treating a patient suffering from infection related to any HCV genotype.
  • HCV types and subtypes may differ in their antigenicity, level of viremia, severity of disease produced, and response to interferon therapy as described in Holland et al. , Pathology, 30(2): 192- 195 (1998).
  • the nomenclature set forth in Simmonds et al., JGen Virol, 74(Ptl l :2391-2399 (1993) is widely used and classifies isolates into six major genotypes, 1 through 6, with two or more related subtypes, e.g., la and lb.
  • genotypes 7-10 and 1 1 have been proposed, however the phylogenetic basis on which this classification is based has been questioned, and thus types 7, 8, 9 and 11 isolates have been reassigned as type 6, and type 10 isolates as type 3 (see Lamballerie et al., J Gen Virol, 78(Ptl):45-51 (1997)).
  • the major genotypes have been defined as having sequence similarities of between 55 and 72% (mean 64.5%), and subtypes within types as having 75%-86% similarity (mean 80%) when sequenced in the NS-5 region (see Simmonds et al. , J Gen Virol, 75(Pt 5): 1053-1061 (1994)).
  • the present methods for treating or preventing HCV infection can further comprise the administration of one or more additional therapeutic agents which are not Fused Tricyclic Silyl Compounds.
  • the additional therapeutic agent is an antiviral agent.
  • the additional therapeutic agent is an immunomodulatory agent, such as an immunosuppressive agent.
  • the present invention provides methods for treating a viral infection in a patient, the method comprising administering to the patient: (i) at least one Fused Tricyclic Silyl Compound, or a pharmaceutically acceptable salt thereof, and (ii) at least one additional therapeutic agent that is other than a Fused Tricyclic Silyl Compound, wherein the amounts administered are together effective to treat or prevent a viral infection.
  • therapeutic agents in the combination may be administered in any order such as, for example, sequentially, concurrently, together, simultaneously and the like.
  • the amounts of the various actives in such combination therapy may be different amounts (different dosage amounts) or same amounts (same dosage amounts).
  • a Fused Tricyclic Silyl Compound and an additional therapeutic agent may be present in fixed amounts (dosage amounts) in a single dosage unit (e.g. , a capsule, a tablet and the like).
  • the at least one Fused Tricyclic Silyl Compound is administered during a time when the additional therapeutic agent(s) exert their prophylactic or therapeutic effect, or vice versa.
  • the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) are administered in doses commonly employed when such agents are used as monotherapy for treating a viral infection.
  • the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating a viral infection.
  • the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) act synergistically and are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating a viral infection.
  • the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) are present in the same composition.
  • this composition is suitable for oral administration.
  • this composition is suitable for intravenous administration.
  • this composition is suitable for subcutaneous administration.
  • this composition is suitable for parenteral administration.
  • Viral infections and virus-related disorders that can be treated or prevented using the combination therapy methods of the present invention include, but are not limited to, those listed above.
  • the viral infection is HCV infection.
  • the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) can act additively or synergistically, A synergistic combination may allow the use of lower dosages of one or more agents and/or less frequent administration of one or more agents of a combination therapy. A lower dosage or less frequent administration of one or more agents may lower toxicity of therapy without reducing the efficacy of therapy.
  • Compound and the additional therapeutic agent(s) may inhibit the resistance of a viral infection to these agents.
  • Non-limiting examples of additional therapeutic agents useful in the present compositions and methods include an interferon, an immunomodulator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a virion production inhibitor, a viral entry inhibitor, a viral assembly inhibitor, an antibody therapy (monoclonal or polyclonal), and any agent useful for treating an RNA-dependent polymerase-related disorder.
  • the additional therapeutic agent is a viral protease inhibitor. In another embodiment, the additional therapeutic agent is a viral replication inhibitor,
  • the additional therapeutic agent is an HCV NS3 protease inhibitor.
  • the additional therapeutic agent is an HCV NS5B polymerase inhibitor.
  • the additional therapeutic agent is a nucleoside inhibitor.
  • the additional therapeutic agent is an interferon.
  • the additional therapeutic agent is an HCV replicase inhibitor.
  • the additional therapeutic agent is an antisense agent.
  • the additional therapeutic agent is a therapeutic vaccine. In a further embodiment, the additional therapeutic agent is a virion production inhibitor.
  • the additional therapeutic agent is an antibody therapy. In another embodiment, the additional therapeutic agent is an HCV NS2 inhibitor. In still another embodiment, the additional therapeutic agent is an HCV NS4A inhibitor.
  • the additional therapeutic agent is an HCV NS4B inhibitor. In another embodiment, the additional therapeutic agent is an HCV NS5A inhibitor In yet another embodiment, the additional therapeutic agent is an HCV NS3 helicase inhibitor.
  • the additional therapeutic agent is an HCV IRES inhibitor. In another embodiment, the additional therapeutic agent is an HCV p7 inhibitor. In a further embodiment, the additional therapeutic agent is an HCV entry inhibitor. In another embodiment, the additional therapeutic agent is an HCV assembly inhibitor.
  • the additional therapeutic agents comprise a viral protease inhibitor and a viral polymerase inhibitor.
  • the additional therapeutic agents comprise a viral protease inhibitor and an immunomodulatory agent.
  • the additional therapeutic agents comprise a polymerase inhibitor and an immunomodulatory agent.
  • the additional therapeutic agents comprise a viral protease inhibitor and a nucleoside.
  • the additional therapeutic agents comprise an
  • the additional therapeutic agents comprise an HCV protease inhibitor and an HCV polymerase inhibitor.
  • the additional therapeutic agents comprise a nucleoside and an HCV NS5A inhibitor.
  • the additional therapeutic agents comprise a viral protease inhibitor, an immunomodulatory agent and a nucleoside.
  • the additional therapeutic agents comprise a viral protease inhibitor, a viral polymerase inhibitor and an immunomodulatory agent.
  • the additional therapeutic agent is ribavirin.
  • HCV polymerase inhibitors useful in the present compositions and methods include, but are not limited to, VP-19744 (Wyeth/ViroPharma), PSI-7851 (Pharmasset), RG7128 (Roche/Pharmasset), PSI-7977 (Pharmasset), PSI-938 (Pharmasset), PSI-879 (Pharmasset), PSI-661 (Pharmasset), PF-868554/filib vir (Pfizer), VCH-759/VX-759 (ViroChem
  • HCV-371 (Wyeth/VirroPharma), HCV-796 (Wyeth/ViroPharma), IDX- 184 (Idenix), IDX-375 (Idenix), NM-283 (Idenix/Novartis), GL-60667 (Genelabs), JTK- 109 (Japan Tobacco), PSI-6130 (Pharmasset), R1479 (Roche), R-1626 (Roche), R-7128 (Roche), MK-0608 (Isis/Merck), INX-8014 (Inhibitex), IMX-8018 (Inhibitex), INX-189 (Inhibitex), GS 9190 (Gilead), A-848837 (Abbott), ABT-333 (Abbott), ABT-072 (Abbott), A-837093 (Abbott), BI-207127 (Boehringer-Ingelheim), BILB-1941 (Boehringer- Ingelheim), M -3281 (Merc
  • HC V polymerase inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in International Publication Nos. WO 08/082484, WO 08/082488, WO 08/083351, WO 08/136815, WO 09/032116, WO
  • Interferons useful in the present compositions and methods include, but are not limited to, interferon alfa-2a, interferon alfa-2b, interferon alfacon-1 and PEG-interferon alpha conjugates.
  • PEG-interferon alpha conjugates are interferon alpha molecules covalently attached to a PEG molecule.
  • Illustrative PEG-interferon alpha conjugates include interferon alpha-2a (RoferonTM, Hoffman La-Roche, Nutley, New Jersey) in the form of pegylated interferon alpha-2a ⁇ e.g., as sold under the trade name PegasysTM), interferon alpha-2b (IntronTM, from Schering-Plough Corporation) in the form of pegylated interferon alpha-2b ⁇ e.g.
  • interferon alpha-2b-XL ⁇ e.g., as sold under the trade name PEG-IntronTM
  • interferon alpha-2c Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingelheim, Germany
  • PEG- interferon lambda Boehringer Ingelheim, Ingel
  • Antibody therapy agents useful in the present compositions and methods include, but are not limited to, antibodies specific to IL-10 (such as those disclosed in US Patent Publication No. US2005/0101770, humanized 12G8, a humanized monoclonal antibody against human IL-10, plasmids containing the nucleic acids encoding the humanized 12G8 light and heavy chains were deposited with the American Type Culture Collection (ATCC) as deposit numbers PTA-5923 and PTA-5922, respectively), and the like).
  • ATCC American Type Culture Collection
  • viral protease inhbitors useful in the present compositions and methods include, but are not limited to, an HCV protease inhibitor.
  • HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Nos. 7,494,988, 7,485,625, 7,449,447, 7,442,695, 7,425,576, 7,342,041, 7,253,160, 7,244,721, 7,205,330, 7,192,957, 7,186,747, 7,173,057, 7,169,760, 7,012,066, 6,914,122, 6,91 1,428, 6,894,072, 6,846,802, 6,838,475, 6,800,434, 6,767,991, 5,017,380, 4,933,443, 4,812,561 and 4,634,697; U.S. Patent Nos. 7,494,988, 7,485,625, 7,449,447, 7,442,695, 7,425,576, 7,342,041, 7,253,160, 7,244,721, 7,205,330, 7,192,957, 7,186,747, 7,173,057, 7,169,760, 7,012,066, 6,91
  • HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, VX-950 (Telaprevir, Vertex), VX-500 (Vertex), VX-813 (Vertex), VBY-376 (Virobay), BI-201335 (Boehringer Ingelheim), TMC-435
  • HCV protease inhbitors useful in the present compositions and methods include, but are not limited to, those disclosed in Landro et al, Biochemistry,
  • HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, the following compounds:
  • Viral replication inhibitors useful in the present compositions and methods include, but are not limited to, HCV replicase inhibitors, IRES inhibitors, NS4A inhibitors, NS3 helicase inhibitors, NS5A inhibitors, NS5B inhibitors, ribavirin, AZD-2836 (Astra Zeneca), viramidine, A-831 (Arrow Therapeutics), EDP-239 (Enanta), ACH-2928 (Achillion), GS- 5885 (Gilead); an antisense agent or a therapeutic vaccine.
  • Viral entry inhibitors useful as second additional therapeutic agents in the present compositions and methods include, but are not limited to, PRO-206 (Progenies), REP-9C (REPICor), SP-30 (Samaritan Pharmaceuticals) and ITX-5061 (iTherx).
  • HCV NS4A inhibitors useful in the useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Nos. 7,476,686 and 7,273,885; U.S. Patent Publication No. US20090022688; and International Publication Nos. WO 2006/019831 and WO 2006/019832.
  • Additional HCV NS4A inhibitors useful as second additional therapeutic agents in the present compositions and methods include, but are not limited to, AZD2836 (Astra Zeneca), ACH-1095 (Achillion) and ACH-806 (Achillion).
  • HCV NS5A inhibitors useful in the present compositions and methods include, but are not limited to, A-832 (Arrow Therpeutics), PPI-461 (Presidio), PPI-1301 (Presidio) and BMS-790052 (Bristol-Myers Squibb).
  • HCV replicase inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Publication No. US20090081636.
  • Therapeutic vaccines useful in the present compositions and methods include, but are not limited to, IC41 (Intercell Novartis), CSL123 (Chiron/CSL), GI 5005
  • compositions and methods examples include, but are not limited to, Ritonavir (Abbott), TT033 (Benitec/Tacere Bio/Pfizer), Sirna-034 (Sirna Therapeutics), GNI 04 (GENimmune), GI-5005
  • HepaCide-I (NanoVirocides), MX3235 (Migenix), SCY-635 (Scynexis); PE02003002 ( emin Pharma), Lenocta (VioQuest Pharmaceuticals), IET - Interferon Enhancing Therapy (Transition Therapeutics), Zadaxin (SciClone Pharma), VP 50406TM (Viropharma, Incorporated, Exton, Pennsylvania); Taribavirin (Valeant Pharmaceuticals); Nitazoxanide (Romark); Debio 025 (Debiopharm); GS-9450 (Gilead); PF-4878691 (Pfizer); ANA773 (Anadys); SCV-07 (SciClone Pharmaceuticals); NIM-881 (Novartis); ISIS 14803TM (ISIS Pharmaceuticals, Carlsbad, California); HeptazymeTM (Ribozyme Pharmaceuticals, Boulder, Colorado); ThymosinTM (SciClone Pharmaceuticals, San
  • the doses and dosage regimen of the other agents used in the combination therapies of the present invention for the treatment or prevention of HCV infection can be determined by the attending clinician, taking into consideration the approved doses and dosage regimen in the package insert; the age, sex and general health of the patient; and the type and severity of the viral infection or related disease or disorder.
  • the Fused Tricyclic Silyl Compound(s) and the other agent(s) can be administered simultaneously (i.e., in the same composition or in separate compositions one right after the other) or sequentially.
  • kits comprising the separate dosage forms is therefore advantageous.
  • a total daily dosage of the at least one Fused Tricyclic Silyl Compound(s) alone, or when administered as combination therapy can range from about 1 to about 2500 mg per day, although variations will necessarily occur depending on the target of therapy, the patient and the route of administration.
  • the dosage is from about 10 to about 1000 mg/day, administered in a single dose or in 2-4 divided doses, in another embodiment, the dosage is from about 1 to about 500 mg day, administered in a single dose or in 2-4 divided doses. In still another embodiment, the dosage is from about 1 to about 100 mg day, administered in a single dose or in 2-4 divided doses, in yet another embodiment, the dosage is from about 1 to about 50 mg/day, administered in a single dose or in 2-4 divided doses.
  • the dosage is from about 500 to about 1500 mg day, administered in a single dose or in 2-4 divided doses. In still another embodiment, the dosage is from about 500 to about 1000 mg day, administered in a single dose or in 2-4 divided doses. In yet another embodiment, the dosage is from about 100 to about 500 mg day, administered in a single dose or in 2-4 divided doses.
  • the additional therapeutic agent is INT ON-A interferon alpha 2b (commercially available from Schering-Plough Corp.)
  • this agent is administered by subcutaneous injection at 3MIU(12 mcg)/0.5mL/TIW for 24 weeks or 48 weeks for first time treatment.
  • the additional therapeutic agent is PEG-INTRON interferon alpha 2b pegylated (commercially available from Schering-Plough Corp.)
  • this agent is administered by subcutaneous injection at 1.5 mcg kg/week, within a range of 40 to 150 meg/week, for at least 24 weeks.
  • the additional therapeutic agent is ROFERON A interferon alpha 2a (commercially available from Hoffmann-La Roche)
  • this agent is administered by subcutaneous or intramuscular injection at 3MIU(11.1 mcg/mL)/TIW for at least 48 to 52 weeks, or alternatively 6MIU/TIW for 12 weeks followed by 3MIU/TIW for 36 weeks.
  • the additional therapeutic agent when the additional therapeutic agent is PEGASUS interferon alpha 2a pegylated (commercially available from Hoffmann-La Roche), this agent is administered by subcutaneous injection at 180 mcg/lmL or 180 mcg/0.5mL, once a week for at least 24 weeks.
  • the additional therapeutic agent when the additional therapeutic agent is INFERGEN interferon alphacon-1 (commercially available from Amgen), this agent is administered by subcutaneous injection at 9 mcg/TiW is 24 weeks for first time treatment and up to 15 mcg TIW for 24 weeks for non-responsive or relapse treatment.
  • this agent is administered at a daily dosage of from about 600 to about 1400 mg/day for at least 24 weeks.
  • one or more compounds of the present invention are
  • an interferon an immunomod lator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a viral polymerase inhibitor a virion production inhibitor, a viral entry inhibitor, a viral assembly inhibitor, an antibody therapy (monoclonal or polyclonal), and any agent useful for treating an RNA-dependent polymerase-related disorder.
  • additional therapeutic agents selected from: an interferon, an immunomod lator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a viral polymerase inhibitor a virion production inhibitor, a viral entry inhibitor, a viral assembly inhibitor, an antibody therapy (monoclonal or polyclonal), and any agent useful for treating an RNA-dependent polymerase-related disorder.
  • one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV protease inhibitor, an HCV polymerase inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin.
  • the combination therapies can include any combination of these additional therapeutic agents.
  • one or more compounds of the present invention are administered with one additional therapeutic agent selected from an HCV protease inhibitor, an interferon, a pegylated interferon and ribavirin.
  • one or more compounds of the present invention are administered with two additional therapeutic agents selected from an HCV protease inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin.
  • one or more compounds of the present invention are administered with an HCV protease inhibitor and ribavirin.
  • an HCV protease inhibitor and ribavirin.
  • one or more compounds of the present invention are administered with a pegylated interferon and ribavirin.
  • one or more compounds of the present invention are administered with three additional therapeutic agents selected from an HCV protease inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin.
  • one or more compounds of the present invention are
  • one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor.
  • one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor.
  • one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and ribavirin.
  • one or more compounds of the present invention are
  • one or more compounds of the present invention are administered with ribavirin.
  • one or more compounds of the present invention are
  • HCV polymerase inhibitor a viral protease inhibitor, an interferon, and a viral replication inhibitor.
  • one or more compounds of the present invention are administered with ribavirin, interferon and another therapeutic agent.
  • one or more compounds of the present invention are administered with ribavirin, interferon and another therapeutic agent, wherein the additional therapeutic agent is selected from an HCV polymerase inhibitor, a viral protease inhibitor, and a viral replication inhibitor.
  • one or more compounds of the present invention are administered with ribavirin, interferon and a viral protease inhibitor.
  • one or more compounds of the present invention are administered with ribavirin, interferon and an HCV protease inhibitor.
  • one or more compounds of the present invention are administered with ribavirin, interferon and boceprevir or telaprevir.
  • one or more compounds of the present invention are administered with ribavirin, interferon and an HCV polymerase inhibitor.
  • one or more compounds of the present invention are administered with pegylated-interferon alpha and ribavirin.
  • the Fused Tricyclic Silyl Compounds are useful in veterinary and human medicine. As described above, the Fused Tricyclic Silyl Compounds are useful for treating or preventing HCV infection in a patient in need thereof.
  • the Fused Tricyclic Silyl Compounds can be administered as a component of a composition that comprises a pharmaceutically acceptable carrier or vehicle.
  • the present invention provides pharmaceutical compositions comprising an effective amount of at least one Fused Tricyclic Silyl Compound and a pharmaceutically acceptable carrier.
  • the active ingredients will typically be administered in admixture with suitable carrier materials suitably selected with respect to the intended form of administration, i.e., oral tablets, capsules (either solid-filled, semi-solid filled or liquid filled), powders for constitution, oral gels, elixirs, dispersible granules, syrups, suspensions, and the like, and consistent with conventional pharmaceutical practices.
  • the active drug component may be combined with any oral non-toxic pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc, mannitol, ethyl alcohol (liquid forms) and the like.
  • Solid form preparations include powders, tablets, dispersible granules, capsules, cachets and suppositories. Powders and tablets may be comprised of from about 0.5 to about 95 percent inventive composition. Tablets, powders, cachets and capsules can be used as solid dosage forms suitable for oral administration.
  • suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethyl cellulose, polyethylene glycol and waxes.
  • lubricants there may be mentioned for use in these dosage forms, boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like.
  • Disintegrants include starch, methylcellulose, guar gum, and the like. Sweetening and flavoring agents and preservatives may also be included where appropriate.
  • Liquid form preparations include solutions, suspensions and emulsions and may include water or water-propylene glycol solutions for parenteral injection.
  • Liquid form preparations may also include solutions for intranasal administration.
  • solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for either oral or parenteral administration.
  • liquid forms include solutions, suspensions and emulsions.
  • a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted, and the active ingredient is dispersed
  • compositions of the present invention may be formulated in sustained release form to provide the rate controlled release of any one or more of the components or active ingredients to optimize therapeutic effects, i.e., antiviral activity and the like.
  • Suitable dosage forms for sustained release include layered tablets containing layers of varying disintegration rates or controlled release polymeric matrices impregnated with the active components and shaped in tablet form or capsules containing such impregnated or encapsulated porous polymeric matrices.
  • the one or more Fused Tricyclic Silyl Compounds are administered orally.
  • the one or more Fused Tricyclic Silyl Compounds are administered intravenously.
  • a pharmaceutical preparation comprising at least one Fused Tricyclic Silyl Compound is in unit dosage form.
  • the preparation is subdivided into unit doses containing effective amounts of the active components.
  • compositions can be prepared according to conventional mixing, granulating or coating methods, respectively, and the present compositions can contain, in one embodiment, from about 0.1% to about 99% of the Fused Tricyclic Silyl Compound(s) by weight or volume. In various embodiments, the present compositions can contain, in one embodiment, from about 1% to about 70% or from about 5% to about 60% of the Fused Tricyclic Silyl Compound(s) by weight or volume.
  • the quantity of Fused Tricyclic Silyl Compound in a unit dose of preparation may be varied or adjusted from about 1 mg to about 2500 mg. In various embodiment, the quantity is from about 10 mg to about 1000 mg, 1 mg to about 500 mg, 1 mg to about 100 mg, and 1 mg to about 100 mg.
  • the total daily dosage may be divided and administered in portions during the day if desired. In one embodiment, the daily dosage is administered in one portion. In another embodiment, the total daily dosage is administered in two divided doses over a 24 hour period. In another embodiment, the total daily dosage is administered in three divided doses over a 24 hour period. In still another embodiment, the total daily dosage is administered in four divided doses over a 24 hour period.
  • a total daily dosage of the Fused Tricyclic Silyl Compounds range from about 0.1 to about 2000 mg per day, although variations will necessarily occur depending on the target of therapy, the patient and the route of administration.
  • the dosage is from about 1 to about 200 mg/day, administered in a single dose or in 2-4 divided doses.
  • the dosage is from about 10 to about 2000 mg day, administered in a single dose or in 2-4 divided doses.
  • the dosage is from about 100 to about 2000 mg day, administered in a single dose or in 2-4 divided doses.
  • the dosage is from about 500 to about 2000 mg/day, administered in a single dose or in 2-4 divided doses.
  • compositions of the invention can further comprise one or more additional therapeutic agents, selected from those listed above herein. Accordingly, in one
  • the present invention provides compositions comprising: (i) at least one Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt thereof; (ii) one or more additional therapeutic agents that are not a Fused Tricyclic Silyl Compound; and (iii) a pharmaceutically acceptable carrier, wherein the amounts in the composition are together effective to treat HCV infection.
  • the present invention provides compositions comprising a Compound of Formula (I) and a pharmaceutically acceptable carrier.
  • compositions comprising a
  • compositions comprising a Compound of Formula (I), a pharmaceutically acceptable carrier, and wto additional therapeutic agents, each of which are independently selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents.
  • the present invention provides a kit comprising a therapeutically effective amount of at least one Fused Tricyclic Silyl Compound, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and a pharmaceutically acceptable carrier, vehicle or diluent.
  • the present invention provides a kit comprising an amount of at least one Fused Tricyclic Silyl Compound, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and an amount of at least one additional therapeutic agent listed above, wherein the amounts of the two or more active ingredients result in a desired therapeutic effect.
  • the one or more Fused Tricyclic Silyl Compounds and the one or more additional therapeutic agents are provided in the same container.
  • the one or more Fused Tricyclic Silyl Compounds and the one or more additional therapeutic agents are provided in separate containers.
  • N-Bromo succinimide (838.4 mg, 4.71 mmol) was added in portions over 15 minutes to a cooled (ice/water) CH 2 C1 2 (20 mL) solution of Int-7c (1.06 g, 4.50 mmol). The reaction mixture was allowed to stir for 75 minutes and concentrated in vacuo to an oil. The crude product was purified using silica-gel RPLC (Acetonitrile/ water/ 0.1% TFA) to separate the mono bromide from its dibromo analog (over bromination) and the starting material. The RPLC elute was neutralized with excess H3/MeOH, and the volatile IN2010.7118
  • Int-9f was prepared from N-BOC-trans-fluoro-L-proline, (available from Alfa) using the method described above.
  • Int-9g was prepared from N-Boc-4,4-difluoro-L-proline, (Aldrich) using the method described above.
  • IN2010.7118 was prepared from N-Boc-4,4-difluoro-L-proline, (Aldrich) using the method described above.
  • Int-9h was prepared from BOC-HYP-OH, (available from Aldrich) using the method described above.
  • Int-9i was prepared from commercially available BOC-4-amino-pyrrolidine-2- carboxylic acid using the method described above.
  • Int-9j was prepared from commercially available BOC-4-amino-pyrrolidine-2- carboxylic acid using the method described above, with appropriate fiinctionahzation with methyl chloroformate as in example 1.
  • Int-9k was prepared from 2S-carboxy piperidine (prepared according to method described in Gudasheva et al., J. Med. Chem Ther. 1996, 31, 151). IN2010.7118
  • lnt-91 was prepared from 2S-carboxy-4,4-F piperidine (prepared according to the method described in Chinese Patent No. CN 101462999).
  • Int-9m was prepared from 2S-carboxy morpholine, using the method described above.
  • Int-9q was prepared from commercially available Int-9o using the method described above
  • the resulting crude Int-9r was purified using silica gel chromatography (80 g RediSep® SiC3 ⁇ 4 cartridge; 1-9% MeOH / EtOAc gradient) to provide Compound Int-9r (458 mg, 60% yield) as a yellow solid.
  • Int-9s was prepared from (lR,3S,4S)-N-BOC-2-azabicyclo[2.2.1]-heptane-3- carboxylic acid using the method described above for the synthesis of compound Int-9r.
  • Int-9t was prepared from 15 g of 2(S)-azabicyclo[2.2.2]-octane-2,3-dicarboxylic acid 2-tert-butyl ester (commercially available from Wuxi Apptech Co) using the method described above for the synthesis of compound Int-9r, to provide 10.1 g of Int-9t.
  • reaction mixture was then diluted with water (150 mL) and diethyl ether (150 mL) and separated. The organic phase was washed with brine (200 mL), dried over MgSC>4, filtered and concentrated in vacuo. The resulting residue was purified using flash chromatography on an ISCO 330 g Redi-Sep column (0-20% EtOAc hexanes as eluent) to provide Compound Int-llb (7.47 g, 65 %).
  • Int-9g Int-16c
  • Compound Int-9g (5.7 g, 13.31 mmol), bis(pinacolaton)diboron (6.8 g, 26.78 mmol), Pd(PPh 3 ) 4 (0.76 g, 0,66 mmol), potassium acetate (2.0 g, 20.37 mmol) and 1,4- dioxane were added to a 500 mL flask .
  • the resulting suspension was degassed and allowed to stir at 80 °C for about 15 hours.
  • the reaction mixture was then cooled to room temperature and filtered.
  • Int-16d, Int-16e, Int-16f and Int-16g were prepared from Int-9h, Int-9f, Int-9s and Int-9t, respectively, using the method described above.
  • Compound Int-17g was prepared from N-BOC-trans-fluoro-L-proline, using the method described above.
  • Compound Int-17h was prepared from N-Boc-4,4-difluoro-L-proline, using the method described above.
  • Compound Int-17i was prepared from BOC-HYP-OH, using the method described above. IN2010.7118
  • Int-17i Compound Int-17j was prepared from L-pipecolic acid, using the method described above.
  • Compound Int-17k was prepared from 2S-carboxy mo ⁇ holine, using the method described above.
  • Compound Int-171 was prepared from (1R, 3S, 4S)-N-BOC-2-azabicyclo[2.2.1]- heptane-3-carboxylic acid, using the method described above.
  • Compound Int-17m was prepared from 2(S)-azabicyclo[2.2.2]-octane-2,3- dicarboxylic acid 2-tert-butyl ester, using the method described above. IN2010.71 18
  • reaction mixture was filtered through Celite, and the Celite was rinsed with CH2CI2 (100 mL) and the combined filtrate and washing was concentrated in vacuo.
  • the resulting residue was purified using flash chromatography on an ISCO 330 g Redi-Sep column using a gradient of 0-70% EtOAc/hexanes as eluent to provide Compound Int-18 as a yellow solid (19 g, 82%).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)

Abstract

The present invention relates to novel Fused Tricyclic SiIyI Compounds of Formula (I): and pharmaceutically acceptable salts thereof, wherein A, B, C, D, M1, X1 and X2 are as defined herein. The present invention also relates to compositions comprising at least one Fused Tricyclic Silyl Compound, and methods of using the Fused Tricyclic Silyl Compounds for treating or preventing HCV infection in a patient.

Description

1 027117
FUSED TRICYCLIC SILYL COMPOUNDS AND METHODS OF USE
THEREOF FOR THE TREATMENT OF VIRAL DISEASES
FIELD OF THE INVENTION
The present invention relates to novel Fused Tricyclic Silyl Compounds,
compositions comprising at least one Fused Tricyclic Silyl Compound, and methods of using the Fused Tricyclic Silyl Compounds for treating or preventing HCV infection in a patient. BACKGROUND OF THE INVENTION
Hepatitis C virus (HCV) is a major human pathogen. A substantial traction of these HCV-infected individuals develop serious progressive liver disease, including cirrhosis and hepatocellular carcinoma, which are often fatal. HCV is a (+)-sense single-stranded enveloped RNA virus that has been implicated as the major causative agent in non-A, non-B hepatitis (NANBH), particularly in blood-associated NANBH (BB -NANBH) (see,
International Publication No. WO 89/04669 and European Patent Publication No. EP 381 216). NANBH is to be distinguished from other types of viral-induced liver disease, such as hepatitis A virus (HAV), hepatitis B virus (HBV), delta hepatitis vims (HDV),
cytomegalovirus (CMV) and Epstein-Barr virus (EBV), as well as from other forms of liver disease such as alcoholism and primary biliar cirrhosis.
it is well-established that persistent infection of HCV is related to chronic hepatitis, and as such, inhibition of HCV replication is a viable strategy for the prevention of hepatocellular carcinoma. Current therapies for HCV infection include a-interferon monotherapy and combination therapy comprising a-interferon and ribavirin. These therapies have been shown to be effective in some patients with chronic HCV infection, but suffer from poor efficacy and unfavorable side- effects and there are currently efforts directed to the discovery of HCV replication inhibitors that are useful for the treatment and prevention of HCV related disorders.
Current research efforts directed toward the treatment of HCV includes the use of antisense oligonucleotides, free bile acids (such as ursodeoxycholic acid and
chenodeoxycholic acid) and conjugated bile acids (such as tauroursodeoxycholic acid). Phosphonoformic acid esters have also been proposed as potentially useful for the treatment of various viral infections, including HCV. Vaccine development, however, has been T/US2011/027117
hampered by the high degree of viral strain heterogeneity and immune evasion and the lack of protection against reinfection, even with the same inoculum.
In light of these treatment hurdles, the development of small-molecule inhibitors directed against specific viral targets has become a major focus of anti-HCV research. The determination of crystal structures for NS3 protease, NS3 RNA helicase, NS5A, and NS5B polymerase, with and without bound ligands, has provided important structural insights useful for the rational design of specific inhibitors.
Recent attention has been focused toward the identification of inhibitors of HCV NS5A. HCV NS5A is a 447 amino acid phosphoprotein which lacks a defined enzymatic function. It runs as 56kd and 58kd bands on gels depending on phosphorylation state (Tanji, et al J. Virol. 69:3980-3986 (1995)). HCV NS5A resides in replication complex and may be responsible for the switch from replication of RNA to production of infectious virus (Huang, Y, et al, Virology 364:1-9 (2007)).
Multicyclic HCV NS5A inhibitors have been reported. See U.S. Patent Publication Nos. US20080311075, US20080044379, US20080050336, US20080044380, US20090202483 and US2009020478. HCV NS5A inhibitors having fused tricyclic moieties are disclosed in International Patent Publication Nos. WO 10/065681, WO 10/065668, and WO 10/065674.
Other HCV NS5 A inhibitors and their use for reducing viral load in HCV infected humans have been described in U.S. Patent Publication No. US20060276511.
SUMMARY OF THE INVENTION
aspect, the present invention provides Compounds of Formula (I)
Figure imgf000003_0001
(0
and pharmaceutically acceptable salts thereof,
wherein:
A is -alkylene-N(R7)(Rn), ~alkylene-N(R16)(R1 !), 4 to 7- membered monocyclic heterocycloalkyl, 4 to 7-membered monocyclic heterocycloalkenyl, 7 to 1 1- membered bicyclic heterocycloalkyl or R15, wherein said 4 to 7- membered monocyclic T U 2011/027117
3 heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 11 - membered bicyclic heterocycloalkyl group or said R! 5 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or R15group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with Ri2, such that two RJ2 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group or a spirocyclic 4 to 7-membered heterocycloalkyl group;
B is 5-membered monocyclic heteroarylene group or a 9-membered bicyclic heteroarylene group containing at least one nitrogen atom, wherein said 5-membered monocyclic heteroarylene group and said 9-membered bicyclic heteroarylene group can be optionally fused to a benzene, pyridine or pyrimidine ring, and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart and said 9-membered bicyclic heteroarylene group or it's fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with R6 and on one or more ring carbon atoms with R ;
C is a bond, -C(R5 =C(R5)-, -C≡C-, phenylene, monocyclic heteroarylene or bicyclic heteroarylene, wherein said phenylene group, said monocyclic heteroarylene group or said bicyclic heteroarylene group can be optionally and independently substituted on one or more ring nitrogen atoms with R and on one or more ring carbon atoms with R ;
D is -alkylene-N(R7)(Ru), -alkylene-N(Ri6)(Ru), 4 to 7- membered monocyclic heterocycloalkyl, 4 to 7-membered monocyclic heterocycloalkenyl, 7 to 11- membered bicyclic heterocycloalkyl or R15, wherein said 4 to 7- membered monocyclic
heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 1 1 - membered bicyclic heterocycloalkyl group or said R15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 4 to 7-membered monocyclic heterocycloalkenyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or R15group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with R12, such that two R12 groups on the same ring carbon atom, together with the carbon atom to which P T/US2011/027117
4 they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group or a spirocyclic 4 to 7-membered heterocycloalkyl group;
M1 is a bond, -C(R7)2-, -0-, -N(R6)-, -S(0)2- -C(R2)=C(R2)-, -C(R )-N-,
-N=C(R2)-, -C(R )2-0-? -0-C(R7)2-, -C(R7)2-N(R6)- or -N(R6)-C(R7)2-3 such that two vicinal R groups of M , together with the carbon atoms to which they are attached, can optionally join to form a 3- to 7-membered cycloalkyl group, a 3- to 7-membered heterocycloalkyl group or a 5- to 6-membered heteroaryl group;
X1 is -C(RS)- or -N-;
X2 is -C(R5)- or -N-;
each occurrence of R1 is independently Ci-C6 alkyl, ~alkylene-0-(Ci-C6 alkyl), Cj-Ce haloalkyl, 3- to 7-membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally substituted with up to three groups, which can be the same or different, and are selected from Ci-C<j alkyl, 3- to 7-membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl, heteroaryl, halo, C,-C6 haloalkyl, -Si(Rt3)3, -CN, -OR3, -N(R3)2, -C(0)R10, -C(0)OR3, - C(0)N(R3)2, -NHC(O)Ri0, -NHC(0)NHR3, -NHC(0)OR3, -OC(0)R10, -SR3 and -S(0)2R10; each occurrence of R2 is independently H, Ci-Cg alkyl, -Ci-C6 haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7-membered heterocycloalkyl, Q-Cghydroxyalkyl, -OH, -O- (C C6 alkyl), halo, -CN, -NH2) -NH(d-C6 alkyl), -N(CrC6 alkyl)2, -NHC(0)-(Ci-C6 alkyl), -C(0)NH-(Ci-C6 alkyl), -C(0)N(d-C6 alkyl)2i or -Si(R13)3;
each occurrence of R3 is independently H, C C6 alkyl, Ci-C6 haloalkyl, -CrC6 alkylene-OC(0)(Ci-C6 alkyl), Q-Cehydroxyalkyl, 3 to 7-membered cycloalkyl, 4 to 7- membered heterocycloalkyl, aryl or heteroaryl wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to three groups
independently selected from -OH, halo, Ci-C6 alkyl, Q-Ce haloalkyl, -NH(Ci-C6 alkyl) and - N(Ci-C6 alkyl)2;
each occurrence of R4 is independently H, -Ci-C6 alkyl, d-Ce haloalkyl, - [C(R7)2]qN(R6)2i -C(0)R1, -C{0)-[C(R7)2]qN(R6)2, -C(0)-[C(R7)2]q-Ri,-C(0)-
Figure imgf000005_0001
-C(0)-[C(R7)2]qN(R6)C(0)0-R', - C(0)-[C(R7)2]qC(0)0-R5 or -alkylene-N(R6)-[C(R7)2]q-N(R6)-C(0)0-R1; U 2011/027117
5 each occurrence of R5 is independently H, Ci~C6 alkyl, -Si(R!3)3, 3- to 7-mernbered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl or heteroaryl;
each occurrence of R6 is independently H, Cs-C6 alkyl, 3- to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to two R8 groups, and wherein two R6 groups that are attached to a common nitrogen atom, together with the nitrogen atom to which they are attached, can optionally join to form a 4- to 7-membered heterocycloalkyl group;
each occurrence of R7 is independently H, C]-Cg alkyl, Cj-C6 haloalkyl,
-alkyl ene-0-(C|-C6 alkyl), silylalkyl, 3- to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to three R groups, and wherein two geminal R7 groups, together with the common carbon atom to which they are attached, can optionally join to form -C(=0>, -C(=S)-, -C(=NH)-, -C(=N-OH)-, -C(=N-Ci-C6 alkyl)-, - C(-N-0-C,-C6 alkyl)-, -C(=N-(3 to 7-membered cycloalkyl))-, -C(=N-0-(3- to 7-membered cycloalkyl))-, -C(=N-(4 to 7-membered heterocycloalkyl))-, -C(=N-0-(4- to 7-membered heterocycloalkyl))-, a 3 to 7-membered cycloalkyl group or a 4- to 7-membered
heterocycloalkyl group, such that no two adjacent -C(R7)2- groups can join to form a - C(=0)-C(=0)-, -C(=S)-C(-S)-, -C(=0)-C(=S)- or -C(=S)-C(=0)- group;
each occurrence of R8 is independently H, Ci-C6 alkyl, halo, -C] -C6 haloalkyl, Ci-C6 hydroxyalkyl, -OH, -C(0)NH-(C C6 alkyl), -C(0)N(Ci -C6 alkyl)2, -0-(C C6 alkyl), -NH2, -NH(C,-C6 alkyl), -N(CrC6 alkyl)2 and -NHC(0)-(C C6 alkyl) or ~Si(RB)3;
each occurrence of R10 is independently CrC6 alkyl, Ci-C6 haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl, or heteroaryl;
each occurrence of R! 1 is independently H, -C-e alkyl, C]-C6 haloalkyl, - [C(R )2]qN(R6)2, -C(0)Rl, -C(0)-[C(R7)2]qN(R6)2,
-C(0)-[C(R7)2]qN(R6)C(0)-Rl, -C(0)-[C(R7)2]qN(R6)C(0)0-R1, -C(0)-[C(R7)2]qC(0)0-Rl, -C(0)[C(R7)2]qN(R6)S02-R1 or -alkylene-N(R6)-[C(R7)2]q-N(R6)-C(0)0-R1 ;
each occurrence of R12 is H, Cj-Ce alkyl, C C6 haloalkyl, 3 to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl, heteroaryl, halo, -CN, -OR3,
N(R3)2, -C(O)R!0, -C(0)OR3, -C(0)N(R3)2, -NHC(0)R10, -NHC(0)NHR3, -NHC(0)OR3, - OC(0)R10, -SR3, -S(0)2R10 or Si(RI3)3 and wherein two R12 groups together with the carbon atom(s) to which they are attached, can optionally join to form a 5 to 7-membered cycloalkyl or 4- to 7-membered heterocyclo alkyl ring;
each occurrence of R13 is independently selected from Ci-C6 alkyl, 3- to 7- membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl, heteroaryl, Cj-C6 haloalkyl, -CN and -OR3, wherein two RB groups, together with the silicon atom to which they are attached, can optionally join to form a 4- to 7-membered silicon-containing
heterocycloalkyl ring;
each occurrence of R is independently a monocyclic 5- to 7-membered
silylheterocycloalkyl ring or a bicyclic 7- to 1 -membered bicyclic silylheterocycloalkyl ring wherein said silylheterocycloalkyl rings contains as heteroatom ring members:
(i) one -Si(R13)2-;
(ii) one -N(R4)-; and
(iii) one optional and additional heteroatom ring member elected from the group consisting of nitrogen, oxygen and sulfur, and wherein an R15 group can be optionally and independently substituted on one or two ring carbon atoms with R ;
each occurrence of R!6 is independently:
(i) C,-C6 alkyl substituted with ~Si(R13)3;
(ii) 3 to 7-membered cycloalkyl substituted with -Si(R13)3;
(iii) 4 to 7-membered heterocycloalkyl substituted with -Si(R13)3;
(iv) phenyl substituted with -Si(Ri3)3;
(v) 6-membered heteroaryl substituted with -Si(RJ3) , wherein said
heteroaryl has one or two ring nitrogen atoms and no other ring heteroatoms; or
(vi) -(CH2)r-R17,
and wherein when R16 is said 3 to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said phenyl group or said heteroaryl group, then R16 can be optionally substituted with up to three groups, which can be the same or different, and are selected from C3-C6 alkyl, halo, -CrC6 haloalkyl, Ci-C6 hydroxyalkyl, -OH, -C(0)NH-(Cr C6 alkyl), -C(0)N(Ci-C6 alkyl)2, -0-(C C6 alkyl), -NH2> -NH(Ci-C6 alkyl), -N(d-C6 alkyl)2 and -NHC(0)-(C C6 alkyl);
each occurrence of R17 is independently: (i) a 5- to 7-membered silylcycloalkyl ring having one -Si(R] 3)2- ring member; or
(ii) a 5- to 7-membered silylheterocycloalkyl ring having one -Si(RI3)2- ring member, and one to two heteroatom ring members, which can be the same or different, and are selected from the group consisting of nitrogen, oxygen, and sulfur, such that the -Si(RI3)2- group must be bonded only to ring carbon atoms; or
(iii) a 7- to 1 1 -membered bicyclic silylheterocycloalkyl ring having one - Si(R13)2- ring member, and one to three heteroatom ring members, which can be the same or different, and are selected from the group consisting of nitrogen, oxygen, and sulfur.
and wherein an R17 group can be optionally and independently substituted on one or two ring carbon atoms with up to two R12 groups;
each occurrence of q is independently an integer ranging from 1 to 4; and each occurrence of r is independently an integer ranging from 0 to 6,
wherein at least one of A and D is R!S or ~~alkylene-N<R16)(R! 1).
The Compounds of Formula (I) (also referred to herein as the "Fused Tricyclic Silyl Compounds") and pharmaceutically acceptable salts thereof can be useful, for example, for inhibiting HCV viral replication or replicon activity, and for treating or preventing HCV infection in a patient. Without being bound by any specific theory, it is believed that the Fused Tricyclic Silyl Compounds inhibit HCV viral replication by inhibiting HCV NS5A.
Accordingly, the present invention provides methods for treating or preventing HCV infection in a patient, comprising administering to the patient an effective amount of at least one Fused Tricyclic Silyl Compound.
The details of the invention are set forth in the accompanying detailed description below.
Although any methods and materials similar to those described herein can be used in the practice or testing of the present invention, illustrative methods and materials are now described. Other embodiments, aspects and features of the present invention are either further described in or will be apparent from the ensuing description, examples and appended claims. T/US2011/027117
8
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to novel Fused Tricyclic Silyl Compounds,
compositions comprising at least one Fused Tricyclic Silyl Compound, and methods of using the Fused Tricyclic Silyl Compounds for treating or preventing HCV infection in a patient.
Definitions and Abbreviations
The terms used herein have their ordinary meaning and the meaning of such terms is independent at each occurrence thereof. That notwithstanding and except where stated otherwise, the following definitions apply throughout the specification and claims.
Chemical names, common names, and chemical structures may be used interchangeabl to describe the same structure. If a chemical compound is referred to using both a chemical structure and a chemical name and an ambiguity exists between the structure and the name, the structure predominates. These definitions apply regardless of whether a term is used by itself or in combination with other terms, unless otherwise indicated. Hence, the definition of "alkyl" applies to "alkyl" as well as the "alkyl" portions of "hydroxyalkyl," "haloalkyl," "-O-alkyl," etc...
As used herein, and throughout this disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings:
A "patient" is a human or non-human mammal. In one embodiment, a patient is a human. In another embodiment, a patient is a chimpanzee.
The term "effective amount" as used herein, refers to an amount of Fused Tricyclic Silyl Compound and/or an additional therapeutic agent, or a composition thereof that is effective in producing the desired therapeutic, ameliorative, inhibitory or preventative effect when administered to a patient suffering from a viral infection or virus-related disorder. In the combination therapies of the present invention, an effective amount can refer to each individual agent or to the combination as a whole, wherein the amounts of all agents administered are together effective, but wherein the component agent of the combination may not be present individually in an effective amount.
The term "preventing," as used herein with respect to an HCV viral infection or HCV-virus related disorder, refers to reducing the likelihood of HCV infection. The term "alkyl," as used herein, refers to an aliphatic hydrocarbon group having one of its hydrogen atoms replaced with a bond. An alkyl group may be straight or branched and contain from about 1 to about 20 carbon atoms. In one embodiment, an alkyl group contains from about 1 to about 12 carbon atoms. In different embodiments, an alkyl group contains from 1 to 6 carbon atoms (C Gs alkyl) or from about 1 to about 4 carbon atoms (Cj-C4 alkyl). Non-limiting examples of alkyl groups include methyl, ethyl, n- propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, neopentyl, isopentyl, n- hexyl, isohexyl and neohexyl. An alkyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O- alkyl,
-O-aryl, -alkyl ene-O-alkyl, alkylthio, -N¾, -NH(alkyl), -N(alkyl)2, -NH(cycloalkyl), -OC(0)-alkyl, -0-C(0)-aryl, -0-C(0)-cycloalkylf -C(0)OH and -C(0)0-alkyl. In one embodiment, an alkyl group is linear. In another embodiment, an alkyl group is branched. Unless otherwise indicated, an alkyl group is unsubstituted,
The term "alkenyl," as used herein, refers to an aliphatic hydrocarbon group containing at least one carbon-carbon double bond and having one of its hydrogen atoms replaced with a bond. An alkenyl group may be straight or branched and contain from about 2 to about 15 carbon atoms. In one embodiment, an alkenyl group contains from about 2 to about 12 carbon atoms. In another embodiment, an alkenyl group contains from about 2 to about 6 carbon atoms. Non-limiting examples of alkenyl groups include ethenyl, propenyl, n-butenyl, 3-methylbut-2-enyl, n-pentenyl, octenyl and decenyt An alkenyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O-alkyl, -O-aryl, -alkylene-O- alkyl, alkylthio, -N¾, -NH(alkyl), -N(alkyl)2, -NH(cycloalkyl), -0-C(0)-alkyl, -O-C(O)- aryl, -0-C(0)-cycloalkyl, -C(0)OH and -C(0)0-alkyl. The term "C2-C6 alkenyl" refers to an alkenyl group having from 2 to 6 carbon atoms. Unless otherwise indicated, an alkenyl group is unsubstituted.
The term "alkynyl," as used herein, refers to an aliphatic hydrocarbon group containing at least one carbon-carbon triple bond and having one of its hydrogen atoms replaced with a bond. An alkynyl group may be straight or branched and contain from about 2 to about 15 carbon atoms. In one embodiment, an alkynyl group contains from 2011/027117
10 about 2 to about 12 carbon atoms. In another embodiment, an alkynyl group contains from about 2 to about 6 carbon atoms. Non-limiting examples of alkynyl groups include ethynyl, propynyl, 2-butynyl and 3-methylbutynyl. An alkynyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O-alkyl, -O-aryl, -alkylene-O-alkyl, alkylthio, -N¾, - NH(alkyl), -N(alkyl)2, -NH(cycloalkyl), -0-C(0)-alkyl, -0-C(0)-aryl, -0-C(0)-cycloalkyl, -C(0)OH and -C(0)0alkyl, The term "C2-Q alkynyl" refers to an alkynyl group having from 2 to 6 carbon atoms. Unless otherwise indicated, an alkynyl group is unsubstituted.
The term "alkylene," as used herein, refers to an alkyl group, as defined above, wherein one of the alkyl group's hydrogen atoms has been replaced with a bond. Non- limiting examples of alkylene groups include -CH2-, -0¾0¾-, -CH2CH2CH2-, - CH2CH2CH2CH2-, -CH(CH3)CH2CH2~, -CH(CH3)- and -CH2CH(CH3)CH2-. In one embodiment, an alkylene group has from 1 to about 6 carbon atoms. In another
embodiment, an alkylene group is branched. In another embodiment, an alkylene group is linear. In one embodiment, an alkylene group is -CH2-. The term "Ci-C6 alkylene" refers to an alkylene group having from 1 to 6 carbon atoms.
The term "aryl," as used herein, refers to an aromatic monocyclic or multicyclic ring system comprising from about 6 to about 14 carbon atoms. In one embodiment, an aryl group contains from about 6 to about 10 carbon atoms, An aryl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. In one embodiment, an aryl group can be optionally fused to a cycloalkyl or cycloalkanoyl group. Non-limiting examples of aryl groups include phenyl and naphthyl. In one embodiment, an aryl group is phenyl. Unless otherwise indicated, an aryl group is unsubstituted.
The term "arylene," as used herein, refers to a bivalent group derived from an aryl group, as defined above, by removal of a hydrogen atom from a ring carbon of an aryl group. An arylene group can be derived from a monocyclic or multicyclic ring system comprising from about 6 to about 14 carbon atoms. In one embodiment, an arylene group contains from about 6 to about 10 carbon atoms. In another embodiment, an arylene group is a naphthylene group. In another embodiment, an arylene group is a phenylene group. An arylene group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. An arylene group is T/US2011/027117
1 1 divalent and either available bond on an arylene group can connect to either group flanking the arylene group. For example, the group "A-arylene-B," wherein the arylene group is:
Figure imgf000012_0001
is understood to represent both:
Figure imgf000012_0002
In one embodiment, an arylene group can be optionally fused to a cycloalkyl or cycloalkanoyl group. Non-limiting examples of arylene groups include phenylene and naphthalene. In one embodiment, an arylene group is unsubstituted. In another
embodiment, an ar ene group is:
Figure imgf000012_0003
Unless otherwise indicated, an arylene group is unsubstituted.
The term "cycloalkyl," as used herein, refers to a non-aromatic mono- or multicyclic ring system comprising from about 3 to about 10 ring carbon atoms. In one embodiment, a cycloalkyl contains from about 5 to about 10 ring carbon atoms. In another embodiment, a cycloalkyl contains from about 3 to about 7 ring atoms. In another embodiment, a cycloalkyl contains from about 5 to about 6 ring atoms. The term "cycloalkyl" also encompasses a cycloalkyl group, as defined above, which is fused to an aryl (e.g., benzene) or heteroaryl ring. Non-limiting examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl. Non-limiting examples of multicyclic cycloalkyls include 1-decalinyl, norbornyl and adamantyl. A cycloalkyl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. In one embodiment, a cycloalkyl group is unsubstituted. The term "3 to 7-membered cycloalkyl" refers to a cycloalkyl group having from 3 to 7 ring carbon atoms. Unless otherwise indicated, a cycloalkyl group is unsubstituted. A ring carbon atom of a cycloalkyl group may be functionalized as a carbonyl group, An illustrative example of such a cycloalkyl group (also referred to herein as a "cycloalkanoyl" group) includes, but is not limited to, cyclobutanoyl:
Figure imgf000013_0001
The term "cycloaikenyl," as used herein, refers to a non-aromatic mono- or multicyclic ring system comprising from about 4 to about 10 ring carbon atoms and containing at least one endocyclic double bond. In one embodiment, a cycloaikenyl contains from about 4 to about 7 ring carbon atoms. In another embodiment, a cycloaikenyl contains 5 or 6 ring atoms. Non-limiting examples of monocyclic cycloalkenyls include cyclopentenyl, cyclohexenyl, cyclohepta-l,3-dienyl, and the like. A cycloaikenyl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. A ring carbon atom of a cycloalkyl group may be functionalized as a carbonyl group. In one embodiment, a cycloaikenyl group is cyclopentenyl. In another embodiment, a cycloaikenyl group is cyclohexenyl. The term "4 to 7-membered cycloaikenyl" refers to a cycloaikenyl group having from 4 to 7 ring carbon atoms. Unless otherwise indicated, a cycloaikenyl group is unsubstituted.
The term "halo," as used herein, means -F, -CI, -Br or -I.
The term "haloalkyl," as used herein, refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with a halogen. In one embodiment, a haloalkyl group has from 1 to 6 carbon atoms. In another
embodiment, a haloalkyl group is substituted with from 1 to 3 F atoms. Non-limiting examples of haloalkyl groups include -CH2F, -CHF2) -CF3, -CH2C1 and -CC13. The term "Ci-C6 haloalkyl" refers to a haloalkyl group having from 1 to 6 carbon atoms.
The term "hydroxyalkyl," as used herein, refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with an ~OH group. In one embodiment, a hydroxyalkyl group has from 1 to 6 carbon atoms. Non- limiting examples of hydroxyalkyl groups include -CH2OH, -CH2CH2OH, - CH2CH2CH2OH and -CH2CH(OH)CH3. The term "C C6 hydroxyalkyl" refers to a hydroxyalkyl group having from 1 to 6 carbon atoms.
The term "heteroaryl," as used herein, refers to an aromatic monocyclic or multicyclic ring system comprising about 5 to about 14 ring atoms, wherein from 1 to 4 of 1 027117
13 the ring atoms is independently O, N or S and the remaining ring atoms are carbon atoms. In one embodiment, a heteroaryl group has 5 to 10 ring atoms. In another embodiment, a heteroaryl group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heteroaryl group is bicyclic. A heteroaryl group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below. A heteroaryl group is joined via a ring carbon atom, and any nitrogen atom of a heteroaryl can be optionally oxidized to the corresponding N-oxide. The term
"heteroaryl" also encompasses a heteroaryl group, as defined above, which is fused to a benzene ring. Non-limiting examples of heteroaryls include pyridyl, pyrazinyl, furanyl, thienyl, pyrimidinyl, pyridone (including N-substituted pyridones), isoxazolyl, isothiazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyrazolyl, furazanyl, pyrrolyl, triazolyl, 1,2,4-thiadiazolyl, pyrazinyl, pyridazinyl, quinoxalinyl, phthalazinyl, oxindolyl, imidazo[l,2-a]pyridinyl, imidazo[2,l-b]thiazolyl, benzofurazanyl, indolyl, azaindolyl, benzimidazolyl, benzothienyl, quinolinyl, imidazolyl, benzimidazolyl, thienopyridyl, quinazolinyl, thienopyrimidyl, pyrrolopyridyl, imidazopyridyl, isoquinolinyl, benzoazaindolyl, 1,2,4-triazinyl,
benzothiazolyl and the like, and all isomeric forms thereof. The term "heteroaryl" also refers to partially saturated heteroaryl moieties such as, for example, tetrahydroisoquinolyl, tetrahydroquinolyl and the like. In one embodiment, a heteroaryl group is a 5-membered heteroaryl, In another embodiment, a heteroaryl group is a 6-membered heteroaryl. In another embodiment, a heteroaryl group comprises a 5- to 6-membered heteroaryl group fused to a benzene ring. Unless otherwise indicated, a heteroaryl group is unsubstituted.
The term "heteroarylene," as used herein, refers to a bivalent group derived from an heteroaryl group, as defined above, by removal of a hydrogen atom from a ring carbon or ring heteroatom of a heteroaryl group. A heteroarylene group can be derived from a monocyclic or multicyclic ring system comprising about 5 to about 14 ring atoms, wherein from 1 to 4 of the ring atoms are each independently O, N or S and the remaining ring atoms are carbon atoms. A heteroarylene group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below. A heteroarylene group is joined via a ring carbon atom or by a nitrogen atom with an open valence, and any nitrogen atom of a heteroarylene can be optionally oxidized to the corresponding N-oxide. The term "heteroarylene" also encompasses a heteroarylene group, as defined above, which is fused to a benzene ring. Non-limiting examples of heteroaryl enes include pyridylene, pyrazinylene, furanylene, thienylene, pyrimidinyl ene, 2011/027117
14
pyridonylene (including those derived from N-substituted pyridonyls), isoxazolylene, isothiazolylene, oxazolylene, oxadiazolylene, thiazolylene, pyrazolylene, thiophenylene, furazanylene, pyrrolylene, triazolylene, 1,2,4-thiadiazolylene, pyrazinylene, pyridazinylene, quinoxalinylene, phthalazinylene, oxindolylene, imidazotl^-ajpyridinylene, imidazo[2,l- b] thiazolylene, benzofurazanylene, indolylene, azaindolylene, benzimidazolylene, benzothienylene, quinolinylene, imidazolylene, benzimidazolylene, thienopyridylene, quinazolinylene, thienopyrimidylene, pyrrolopyridylene, imidazopyridylene,
isoquinolinylene, benzoazaindolylene, 1,2,4-triazinylene, benzothiazolylene and the like, and all isomeric forms thereof. The term "heteroarylene" also refers to partially saturated heteroarylene moieties such as, for example, tetrahydroisoquinolylene,
tetrahydroquinolylene, and the like. A heteroarylene group is divalent and either available bond on a heteroarylene ring can connect to either group flanking the heteroarylene group. For example, the group "A-heteroaryle -B," wherein the heteroarylene group is:
Figure imgf000015_0001
is understood to represent both:
Figure imgf000015_0002
In one embodiment, a heteroarylene group is a monocyclic heteroarylene group or a bicyclic heteroarylene group. In another embodiment, a heteroarylene group is a monocyclic heteroarylene group. In another embodiment, a heteroarylene group is a bicyclic heteroarylene group. In still another embodiment, a heteroarylene group has from about 5 to about 10 ring atoms. In another embodiment, a heteroarylene group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heteroarylene group is bicyclic and has 9 or 10 ring atoms. In another embodiment, a heteroarylene group is a 5-membered monocyclic heteroarylene. In another embodiment, a heteroarylene group is a 6-membered monocyclic heteroarylene. In another embodiment, a bicyclic heteroarylene group comprises a 5 or 6-membered monocyclic heteroarylene group fused to a benzene ring. Unless otherwise indicated, a heteroarylene group is unsubstituted.
The term "heterocycloalkyl," as used herein, refers to a non-aromatic saturated monocyclic or multicyclic ring system comprising 3 to about 11 ring atoms, wherein from 1 to 4 of the ring atoms are independently O, S, N or Si, and the remainder of the ring atoms 2011/027117
15 are carbon atoms. A heterocycloalkyl group can be joined via a ring carbon, ring silicon atom or ring nitrogen atom. In one embodiment, a heterocycloalkyl group is monocyclic and has from about 3 to about 7 ring atoms. In another embodiment, a heterocycloalkyl group is monocyclic has from about 4 to about 7 ring atoms. In another embodiment, a heterocycloalkyl group is bicyclic and has from about 7 to about 11 ring atoms. In still another embodiment, a heterocycloalkyl group is monocyclic and has 5 or 6 ring atoms. In one embodiment, a heterocycloalkyl group is monocyclic. In another embodiment, a heterocycloalkyl group is bicyclic. There are no adjacent oxygen and/or sulfur atoms present in the ring system. Any -NH group in a heterocycloalkyl ring may exist protected such as, for example, as an -N(BOC), -N(Cbz), -N(Tos) group and the like; such protected heterocycloalkyl groups are considered part of this invention. The term "heterocycloalkyl" also encompasses a heterocycloalkyl group, as defined above, which is fused to an aryl (e.g., benzene) or heteroaryl ring. A heterocycloalkyl group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below. The nitrogen or sulfur atom of the heterocycloalkyl can be optionally oxidized to the corresponding N-oxide, S-oxide or S,S-dioxide. Non-limiting examples of monocyclic heterocycloalkyl rings include oxetanyl, piperidyl, pyrrolidinyl, piperazinyl, morpholinyl, thiomorpholinyl, thiazolidinyl, 1,4-dioxanyl, tetrahydrofuranyl,
tetrahydrothiophenyl, delta-lactam, delta-lactone, silacyclopentane, silapyrrolidine and the like, and all isomers thereof. Non-limiting illustrative examples of a silyl-containing heterocycl
Figure imgf000016_0001
A ring carbon atom of a heterocycloalkyl group may be functional ized as a carbonyl group. An illustrative example of such a heterocycloalkyl group is; H
.
In one embodiment, a heterocycloalkyl group is a 5-membered monocyclic heterocycloalkyl. In another embodiment, a heterocycloalkyl group is a 6-membered monocyclic heterocycloalkyl. The term "3 to 7-membered monocyclic cycloalkyl" refers to a monocyclic heterocycloalkyl group having from 3 to 7 ring atoms. The term "4 to 7- membered monocyclic cycloalkyl" refers to a monocyclic heterocycloalkyl group having from 4 to 7 ring atoms. The term "7 to 11-membered bicyclic heterocycloalkyl" refers to a bicyclic heterocycloalkyl group having from 7 to 11 ring atoms. Unless otherwise indicated, an heterocycloalkyl group is unsubstituted.
The term "heterocycloalkenyl," as used herein, refers to a heterocycloalkyl group, as defined above, wherein the heterocycloalkyl group contains from 4 to 10 ring atoms, and at least one endocyclic carbon-carbon or carbon-nitrogen double bond. A heterocycloalkenyl group can be joined via a ring carbon or ring nitrogen atom. In one embodiment, a heterocycloalkenyl group has from 4 to 7 ring atoms. In another embodiment, a
heterocycloalkenyl group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heterocycloalkenyl group is bicyclic. A heterocycloalkenyl group can optionally substituted by one or more ring system substituents, wherein "ring system substituent" is as defined above. The nitrogen or sulfur atom of the heterocycloalkenyl can be optionally oxidized to the corresponding N-oxide, S-oxide or S,S-dioxide. Non-limiting examples of heterocycloalkenyl groups include 1,2,3,4- tetrahydropyridinyl, 1,2-dihydropyridinyl, 1 ,4- dihydropyridinyl, 1,2,3,6-tetrahydropyridinyl, 1 ,4,5,6-tetrahydropyrimidinyl, 2-pyrrolinyl, 3-pyrrolinyl, 2-imidazolinyl, 2-pyrazolinyl, dihydroimidazolyl, dihydrooxazolyl, dihydrooxadiazolyl, dihydrothiazolyl, 3,4-dihydro-2H-pyranyI, dihydrofuranyl, fluoro- substituted dihydrofuranyl, 7-oxabicyclo[2.2.1]heptenyl, dihydrothiophenyl,
dihydrothiopyranyl, and the like and the like. A ring carbon atom of a heterocycloalkenyl group may be functionalized as a carbonyl group. In one embodiment, a heterocycloalkenyl group is a 5-membered heterocycloalkenyl. In another embodiment, a heterocycloalkenyl group is a 6-membered heterocycloalkenyl. The term "4 to 7-membered
heterocycloalkenyl" refers to a heterocycloalkenyl group having from 4 to 7 ring atoms. Unless otherwise indicated, a heterocycloalkenyl group is unsubstituted. The term "ring system substituent," as used herein, refers to a substituent group attached to an aromatic or non- aromatic ring system which, for example, replaces an available hydrogen on the ring system. Ring system substituents may be the same or different, each being independently selected from the group consisting of alkyl, alkenyl, alkynyl, aryl, heteroaryl, -alkylene-aryl, -arylene-alkyl, -alkylene-heteroaryl, -alkenylene- heteroaryl, -alkynylene-heteroaryl, -OH, hydroxyalkyl, haloalkyl, -O-alkyl, -O-haloalkyl, - alkylene-O-alkyl, -O-aryl, -O-alkylene-aryl, acyl, -C(0)-aryl, halo, -N02, -CN, -SF5, - C(0)OH, -C(0)0-alkyl, -C(0)0-aryl, -C(0)0-alkylene-aryl, -S(0)-alkyl, -S(0)2-alkyl, - S(0)-aryl, -S(0)2-aryl, -S(0)-heteroaryl, -S(0)2-heteroaryl, -S-alkyl, -S-aryl, -S -heteroaryl, -S-aikylene-aryl, -S-alkylene-heteroaryl, -S(0)2-alkylene-aryi, -S(0)2-alkylene-heteroaryl, - Si(alkyl)2, -Si(aryl)2, -Si(heteroaryl)2? -Si(alkyl)(aryl), -Si(alkyl)(cycloalkyl), - Si(alkyl)(heteroaryl), cycloalkyl, heterocycloalkyl, -0-C(0)-alkyl, -O-C(0)-aryl, -O-C(O)- cycloalkyl, -C(=N-CN)-NH2, -C(=NH)-NH2, -C(=NH NH(alkyl), -N(Y (Y2), -alkylene- N(Yi)(Y2), -C(0)N(Yi)(Y2) and -S(0)2N(YI)(Y2), wherein Ys and Y2 can be the same or different and are independently selected from the group consisting of hydrogen, alkyl, aryl, cycloalkyl, and -alkylene-aryl. "Ring system substituent" may also mean a single moiety which simultaneously replaces two available hydrogens on two adjacent carbon atoms (one H on each carbon) on a ring system. Examples of such moiety are methylenedioxy, ethylenedioxy, -C(CH3)2- ample:
Figure imgf000018_0001
The term "silylalkyl," as used herein, refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with a -Si(R*)3 group, wherein each occurrence of Rx is independently CrC6 alkyl, phenyl or a 3- to 6- membered cycloalkyl group. In one embodiment, a silylalkyl group has from 1 to 6 carbon atoms. In another embodiment, a silyl alkyl group contains a -Si(CH3)3 moiety. Non- limiting examples of silylalkyl groups include
~CH2-Si(CH3)3 and ~C¾CH2-Si(CH3)3.
The term "substituted" means that one or more hydrogens on the designated atom is replaced with a selection from the indicated group., provided that the designated atom's normal valency under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds. By "stable compound' or "stable structure" is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
The term "in substantially purified form," as used herein, refers to the physical state of a compound after the compound is isolated from a synthetic process (e.g., from a reaction mixture), a natural source, or a combination thereof. The term "in substantially purified form," also refers to the physical state of a compound after the compound is obtained from a purification process or processes described herein or well-known to the skilled artisan {e.g., chromatography, recrystallization and the like), in sufficient purity to be characterizable by standard analytical techniques described herein or well-known to the skilled artisan.
It should also be noted that any carbon as well as heteroatom with unsatisfied valences in the text, schemes, examples and tables herein is assumed to have the sufficient number of hydrogen atom(s) to satisfy the valences.
When a functional group in a compound is termed "protected", this means that the group is in modified form to preclude undesired side reactions at the protected site when the compound is subjected to a reaction. Suitable protecting groups will be recognized by those with ordinary skill in the art as well as by reference to standard textbooks such as, for example, T. W. Greene et al, Protective Groups in Organic Synthesis (1991), Wiley, New York.
When any substituent or variable (e.g., alkyl, R6, Ra, etc.) occurs more than one time in any constituent or in Formula (I), its definition on each occurrence is independent of its definition at every other occurrence, unless otherwise indicated.
As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
Prodrugs and solvates of the compounds of the invention are also contemplated herein. A discussion of prodrugs is provided in T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems (1987) 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, (1987) Edward B. Roche, ed., American Pharmaceutical T/US2011/027117
19
Association and Pergamon Press. The term "prodrug" means a compound {e.g., a drug precursor) that is transformed in vivo to provide a Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt or solvate of the compound. The transformation may occur by various mechanisms {e.g., by metabolic or chemical processes), such as, for example, through hydrolysis in blood.
For example, if a Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt, hydrate or solvate of the compound contains a carboxylic acid functional group, a prodrug can comprise an ester formed by the replacement of the hydrogen atom of the acid group with a group such as, for example, (Cj-Cg)alkyl, {^-C^alkanoyloxymethyl, 1- (alkanoyloxy)ethyl having from 4 to 9 carbon atoms, 1 -methyl- 1 -(alkanoyloxy)-ethyl having from 5 to 10 carbon atoms, alkoxycarbonyloxymethyl having from 3 to 6 carbon atoms, l-(alkoxycarbonyloxy)ethyl having from 4 to 7 carbon atoms, 1 -methyl- 1- (alkoxycarbonyloxy)ethyl having from 5 to 8 carbon atoms, N- (alkoxycarbonyl)aminomethyl having from 3 to 9 carbon atoms, 1-(N- (alkoxycarbonyl)amino)ethyl having from 4 to 10 carbon atoms, 3-phthalidyl, 4- crotonolactonyl, gamma-butyrolacton-4-yl, di-N,N-(Ci-C2)alkylamino(C2-C3)alkyl {such as β-dimethylaminoethyl), carbamoyl-(Ci~C2)alkyl, N,N~di (Cj-C2)alkylcarbamoyl-(C
C2)alkyl and piperidino-, pyrrolidino- or morpholino(C2~C3)alkyl, and the like.
Similarly, if a Fused Tricyclic Silyl Compound contains an alcohol functional group, a prodrug can be formed by the replacement of the hydrogen atom of the alcohol group with a group such as, for example, (Ct-Cejalkanoyloxymethyl, l-((Ci-C6)alkanoyloxy)ethyl, 1- methyl-1 -((Ci-Cg)alkanoyloxy)ethyl, (C1-C6)alkoxycarbonyloxymethyl, N-(Cj- C6)alkoxycarbonylaminomethyl, succinoyl, (CrC6)alkanoyl, a-amino(Ci-C )alkyl, a- amino(Ci-C4)alkylene-aryl, arylacyl and a-aminoacyl, or α-aminoacyl-a-aminoacyl, where each α-aminoacyl group is independently selected from the naturally occurring L-amino acids, -P(0)(OH)2,
-P(0)(0(Ci-C6)alkyi)2 or glycosyl (the radical resulting from the removal of a hydroxyl group of the hemiacetal form of a carbohydrate), and the like.
If a Fused Tricyclic Silyl Compound incorporates an amine functional group, a prodrug can be formed by the replacement of a hydrogen atom in the amine group with a group such as, for example, R-carbonyl-, ROcarbonyl-, NRR'-carbonyl- wherein R and R' are each independently (Ci-Cio)alkyl, (C3-C7) cycloalkyl, benzyl, a natural a-aminoacyl,— C(OH)C(0)OY! wherein Y1 is H, (Ci-C6)alkyl or benzyl, — C(OY2)Y3 wherein Y2 is (C;-C4) alkyl and Y3 is (C C6)alkyl; carboxy (C C6)alkyl; amiiio(C C4)alkyl or mono-N- or di-N,N-(Ci-C6)alkylaminoalkyl; -C(Y )Y5 wherein Y4 is H or methyl and Y5 is mono-N- or di-N^-id-Ceialkylami o morpholino; piperidin-l-yl or pyrrolidin-l-yl, and the like.
Pharmaceutically acceptable esters of the present compounds include the following groups: (1) carboxylic acid esters obtained by esterification of the hydroxy group of a hydroxyl compound, in which the non-carbonyl moiety of the carboxylic acid portion of the ester grouping is selected from straight or branched chain alkyl (e.g., methyl, ethyl, n- propyl, isopropyl, t-butyl, sec-butyl or n-butyl), alkoxyalkyl (e.g., methoxymethyl), aralkyl (e.g., benzyl), aryloxyalkyl (for example, phenoxymethyl), aryl (e.g., phenyl optionally substituted with, for example, halogen, Ci-4alkyl, -0-(Ci- alkyl) or amino); (2) sulfonate esters, such as alkyl- or aralkylsulfonyl (for example, methanesulfonyl); (3) amino acid esters (e.g., L-valyl or L-isoleucyl); (4) phosphonate esters and (5) mono-, di- or
triphosphate esters. The phosphate esters may be further esterified by, for example, a Ci.2o alcohol or reactive derivative thereof, or by a 2,3-di (C6.2 )acyl glycerol.
One or more compounds of the invention may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms. "Solvate" means a physical association of a compound of this invention with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. "Solvate" encompasses both solution-phase and isolatable solvates. Non-limiting examples of solvates include ethanolates, methanolates, and the like. A "hydrate" is a solvate wherein the solvent molecule is water.
One or more compounds of the invention may optionally be converted to a solvate. Preparation of solvates is generally known. Thus, for example, M. Caira et al, J.
Pharmaceutical Sci., 93(3), 601-61 1 (2004) describe the preparation of the solvates of the antifungal fluconazole in ethyl acetate as well as from water. Similar preparations of solvates, hemisolvate, hydrates and the like are described by E. C. van Tonder et al, AAPS PharmSciTechours. , 5(1 ), article 12 (2004); and A. L. Bingham et al, Chem. Comm n., 603-604 (2001). A typical, non-limiting, process involves dissolving the inventive compound in desired amounts of the desired solvent (organic or water or mixtures thereof) 2011/027117
21 at a higher than room temperature, and cooling the solution at a rate sufficient to form crystals which are then isolated by standard methods. Analytical techniques such as, for example IR spectroscopy, show the presence of the solvent (or water) in the crystals as a solvate (or hydrate).
The Fused Tricyclic Silyl Compounds can form salts which are also within the scope of this invention. Reference to a Fused Tricyclic Silyl Compound herein is understood to include reference to salts thereof, unless otherwise indicated. The term "salt(s)", as employed herein, denotes acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases. In addition, when a Fused Tricyclic Silyl Compound contains both a basic moiety, such as, but not limited to a pyridine or imidazole, and an acidic moiety, such as, but not limited to a carboxylic acid, zwitterions ("inner salts") may be formed and are included within the term "salt(s)" as used herein. In one embodiment, the salt is a pharmaceutically acceptable (i.e., non-toxic, physiologically acceptable) salt. In another embodiment, the salt is other than a pharmaceutically acceptable salt. Salts of the Compounds of Formula (I) may be formed, for example, by reacting a Fused Tricyclic Silyl Compound with an amount of acid or base, such as an equivalent amount, in a medium such as one in which the salt precipitates or in an aqueous medium followed by lyophilization.
Exemplary acid addition salts include acetates, ascorbates, benzoates,
benzenesulfonates, bisulfates, borates, butyrates, citrates, camphorates, camphorsulfonates, fumarates, hydrochlorides, hydrobromides, hydroiodides, lactates, maleates,
methanesulfonates ("mesylates"), naphthalenesulfonates, nitrates, oxalates, phosphates, propionates, salicylates, succinates, sulfates, tartarates, thiocyanates, toluenesulfonates (also known as tosylates) and the like. In one embodiment, a compound of formula (I) is present as its dihydrochloride salt. In another embodiment, a compound of formula (I) is present as its dimesylate salt. Additionally, acids which are generally considered suitable for the formation of pharmaceutically useful salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl et al, Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection and Use. (2002) Zurich: Wiley-VCH; S. Berge et al, Journal of Pharmaceutical Sciences ( 1977) 66(1) 1 - 1 ; P . Gould, International J. of Pharmaceutics (1986) 33 201-217; Anderson et al, The Practice of Medicinal Chemistry (1996), Academic Press, New York; and in The Orange Book (Food & Drug Administration, Washington, D.C. on their website). These disclosures are incorporated herein by reference thereto. 7117
Exemplary basic salts include ammonium salts, alkali metal salts such as sodium, lithium, and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, salts with organic bases (for example, organic amines) such as dicyclohexylamine, t-butyl amine, choline, and salts with amino acids such as arginine, lysine and the like. Basic nitrogen-containing groups may be quarternized with agents such as lower alkyl halides {e.g., methyl, ethyl, and butyl chlorides, bromides and iodides), dialkyl sulfates (e.g., dimethyl, diethyl, and dibutyl sulfates), long chain halides (e.g., decyl, lauryl, and stearyl chlorides, bromides and iodides), aralkyl halides (e.g., benzyl and phenethyl bromides), and others.
All such acid salts and base salts are intended to be pharmaceutically acceptable salts within the scope of the invention and all acid and base salts are considered equivalent to the free forms of the corresponding compounds for purposes of the invention.
Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well-known to those skilled in the art, such as, for example, by chromatography and/or fractional crystallization. Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers.
Sterochemically pure compounds may also be prepared by using chiral starting materials or by employing salt resolution techniques. Also, some of the Fused Tricyclic Silyl
Compounds may be atropisomers (e.g., substituted biaryls) and are considered as part of this invention. Enantiomers can also be directly separated using chiral chromatographic techniques.
It is also possible that the Fused Tricyclic Silyl Compounds may exist in different tautomeric forms, and all such forms are embraced within the scope of the invention. For example, all keto-enol and imine-enamine forms of the compounds are included in the invention.
All stereoisomers (for example, geometric isomers, optical isomers and the like) of the present compounds (including those of the salts, solvates, hydrates, esters and prodrugs of the compounds as well as the salts, solvates and esters of the prodrugs), such as those which may exist due to asymmetric carbons on various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, 27117
atropisomers, and diastereomeric forms, are contemplated within the scope of this invention. If a Fused Tricyclic Silyl Compound incorporates a double bond or a fused ring, both the cis- and trans- forms, as well as mixtures, are embraced within the scope of the invention.
Individual stereoisomers of the compounds of the invention may, for example, be substantially free of other isomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers. The chiral centers of the present invention can have the S or R configuration as defined by the IUPAC 1974 Recommendations. The use of the terms "salt", "solvate11, "ester", "prodrug" and the like, is intended to apply equally to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates or prodrugs of the inventive compounds.
In the Compounds of Formula (I), the atoms may exhibit their natural isotopic abundances, or one or more of the atoms may be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number predominantly found in nature. The present invention is meant to include all suitable isotopic variations of the compounds of generic Formula I. For example, different isotopic forms of hydrogen (H) include protium and deuterium (2H). Protium is the predominant hydrogen isotope found in nature. Enriching for deuterium may afford certain therapeutic advantages, such as increasing in vivo half-life or reducing dosage requirements, or may provide a compound useful as a standard for characterization of biological samples. Isotopically-enriched Compounds of Formula (I) can be prepared without undue experimentation by conventional techniques well known to those skilled in the ait or by processes analogous to those described in the Schemes and Examples herein using appropriate isotopically-enriched reagents and/or intermediates. In one embodiment, a Compound of Formula (I) has one or more of its hydrogen atoms replaced with deuterium.
Polymorphic forms of the Fused Tricyclic Silyl Compounds, and of the salts, solvates, hydrates, esters and prodrugs of the Fused Tricyclic Silyl Compounds, are intended to be included in the present invention.
The following abbreviations are used below and have the following meanings: Ac is acyl; AcOH is acetic acid; BF3*OEt2 is boron trifluoride etherate; BOC or Boc is tert- butyloxycarbonyl; Boc20 is Boc anhydride; Boc-Pro-OH is Boc protected proline; L-Boc- Val-OH is Boc protected L-valine; n-BuLi is n-butyllithium; dba is dibenzylideneacetone; DCM is dichloromethane; DIPEA is diisopropylethylamine; DME is dimethoxyethane; 2011/027117
24
DMF is NN-dimethylformamide; dppf is diphenylphosphinoferrocene; DMSO is dimethylsulfoxide; EtOAc is ethyl acetate; Et20 is diethyl ether; Et3N is triethylamine; HATU is 0-(7-azabenzotriazol-l-yl)-N,N,N',N'-tetramethyluronium hexafiuorophosphate; Hg(OAc)2 is mercuric acetate; HPLC is high performance liquid chromatography; HRMS is high resolution mass spectrometry; KOAc is potassium acetate; Lawesson's Reagent is 2,4- Bis(4-methoxyphenyl)-l,3-dithiadiphosphetane-2J4-disulfide; LCMS is liquid
chromatography/mass spectrometry; LRMS is low resolution mass spectrometry; mCPBA is m-chloroperbenzoic acid; MeOH is methanol; MTBE is feri-butylmethyl ether; NBS is N-bromosuccinimide; NH4OAc is ammonium acetate; Pd(PPh3)4 is
tetrakis(triphenylphosphine) palladium(O); PdCi2(dppf)2 is [1.1 '-
Bis(diphenylphosphino)ferrocene]dichloro palladium(II); PdC^Cdppf CHbCb is [l,V- Bis(diphenylphosphino)ferrocene] dichloro palladium(II) complex with dichioromethane; pinacol2B2 is bis(pinacolato)diboron; PPTS is pyridinium p-toluene sulfonate; RPLC is reverse-phase liquid chromatography; SEM-C1 is 2-(trimethylsilyl)ethoxymethyl chloride; TBAF is tetrabutylammonium fluoride; TBAI is tetrabutylammonium iodide; TBDMSCl is fert-butyldimethylsilyl chloride; TFA is trifluoroacetic acid; THF is tetrahydrofuran; TLC is thin-layer chromatography; XPhos is 2-dicyclohexylphosphino-2>,4',6'~
triisopropylbiphenyl; and Z-Pro-OH is N-Benzyloxycarbonyl-L-proline.
The Compounds of Formula (I)
The pres nt invention provides Fused Tricyclic Silyl Compounds of Formula (I):
Figure imgf000025_0001
(I) and pharmaceutically acceptable salts thereof, wherein A, B, C, D, M , X and X are defined above for the Compounds of Formula (I).
In one embodiment, for the Compounds of Formula (I), A is selected from:
Figure imgf000026_0001
In another embodiment, for the Compounds of Formula (I), A is selected from:
Figure imgf000027_0001
In one embodiment, for the Compounds of Formula (I), B is a 5-membered monocyclic heteroarylene.
In another embodiment, for th Formula (I), B is:
Figure imgf000027_0002
In another embodiment, for the Compounds of Formula (I), C is a monocyclic heteroarylene.
In still another embodiment, for the Compounds of Formula (I), C is a 6-membered monocyclic heteroarylene.
In another embodiment, for the Compounds of Formula (I), C is a 5-membered monocyclic heteroarylene.
In another embodiment, for the Compounds of Formula (I), C is a bicyclic heteroarylene.
Figure imgf000027_0003
substituent selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, - 0-(Ci-C6 alkyl), -0-(Ci-C6 hydroxyalkyl) and ~0-(CrC6 alkylene)~OC(0)-(CrC6 alkyl). In a further embodiment, for the Compounds of Formula (I), C is:
Figure imgf000028_0001
wherein R is an optional ring substituent selected from F, -OCH3, pyridyl, -OCH2CH2OH, ~OCH2CH2OC(0)CH3, cyclopropyl and thiophenyl.
In another embodiment, for the Compounds of Formula (I), C is:
Figure imgf000028_0002
In one embodiment, for the Compounds of Formula (I), D is selected from:
Figure imgf000028_0003
Figure imgf000029_0001
In one embodiment, for the Compounds of Formula (I), the group:
Figure imgf000029_0002
has the structure:
Figure imgf000030_0001
another embodiment, for the Compounds of Formula (I), the group:
Figure imgf000030_0002
In another embodiment, for the Compounds of Formula (I), the group:
Figure imgf000031_0001
has the structure:
Figure imgf000031_0002
In one embodiment, for the Compounds of Foraiula (I), A and D are each independently
Figure imgf000031_0003
In a further embodiment, for the Compounds of Formula (I), A and D are each selected from:
Figure imgf000031_0004
and each occurrence of R4 is T/US2011/027117
Figure imgf000032_0001
In one embodiment, for the Compounds of Formula (I), A and D are
independently selected from:
Figure imgf000032_0002
B is a 5-membered monocyclic heteroarylene;
Figure imgf000032_0003
wherein R is an optional ring substituent selected from F, -OCH3, pyridyl,
-OCH2CH2OH, -OCH2CH2OC(0)CH3, cyclopropyl and thiophenyl; and
each occurrence of R4 is
Figure imgf000032_0004
In one embodiment, the Compounds of Formula (I) have the formula (la):
Figure imgf000033_0001
(la)
and pharmaceutically acceptable salts thereof, wherein
A is -alkylene-N(R7)(Rn), -allcylene-N(R16)(Rn), 4 to 7- membered monocyclic heterocycloalkyl, 7 to 11- membered bicyclic heterocycloalkyl or R15, wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or said R15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or R15group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with R12, such that two R12 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group or a spirocyclic 4 to 7-membered heterocycloalkyl group;
D is -alkylene-N(R7)(Rn), ~~alkylene-N(R!6)(Ru), 4 to 7- membered monocyclic heterocycloalkyl, 7 to 11- membered bicyclic heterocycloalkyl or R15, wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or said R15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 1 1 - membered bicyclic heterocycloalkyl group or R15group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with R12, such that two R12 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group or a spirocyclic 4 to 7-membered heterocycloalkyl group; and
C, M!, X! and 2 are defined above for the Compounds of Formula (I).
In one embodiment, for the Compounds of Formula (la), A is selected from:
Figure imgf000034_0001
embodiment, for the Compounds of Formula (la), A is selected from: T/US2011/027117
34
Figure imgf000035_0001
In one embodiment, for the Compounds of Formula (la), B is a 5 -membered monocyclic heteroarylene group containing at least one nitrogen atom, wherein said 5- membered monocyclic heteroarylene group can be optionally fused to a benzene, pyridine or pyrimidine ring, and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with K6 and on one or more ring carbon atoms with R1 .
in one embodiment, for the Compounds of Formula (la), B is a 5-membered monocyclic heteroarylene.
In another embodiment, for th Formula (la), B is:
Figure imgf000035_0002
In another embodiment, for the Compounds of Formula (la), C is a monocyclic heteroarylene.
In still another embodiment, for the Compounds of Formula (la), C is a 6-membered monocyclic heteroarylene.
In another embodiment, for the Compounds of Formula (la), C is a 5-membered monocyclic heteroarylene.
In another embodiment, for the Compounds of Formula (la), C is a bicyclic heteroarylene.
In yet another embodiment, for the Compounds of Formula (la), C is 11 027117
35
Figure imgf000036_0001
, wherein R is an optional ring substituent selected from halo, 3- to 7-membered cycioalkyl, 5- or 6-membered heteroaryl, 0-(Ci-C6 alkyl), -0-(C]-C6 hydroxyalkyl) and -0-(CrC6 alkylene)-OC(0)-(C C6 alkyl).
In a further embodiment, for ormula (la), C is:
Figure imgf000036_0002
wherein Ki2 is an optional ring substituent selected from F, -OCH3, pyridyl,
-OCH2CH2OH? -OCH2CH2OC(0)CH3, cyclopropyl and thiophenyl.
In another embodiment, for the Compounds of Formula (la), C is:
Figure imgf000036_0003
In one embodiment, for the Compounds of Formula (la), D is selected from:
Figure imgf000037_0001
In another embodiment, for the Compounds of Formula (la), D is selected from:
Figure imgf000038_0001
In one embodiment, for the Compounds of Formula (la), the group:
5
Figure imgf000038_0002
another embodiment, for the Compounds of Formula (la), the group:
Figure imgf000039_0001
In another embodime for the Compounds of Formula (la), the group:
has the structure:
Figure imgf000039_0002
In one embodiment, for the Compounds of Formula (la), A and D are each independently selected from:
Figure imgf000040_0001
In a further embodiment, for the Compounds of Formula (la), A and D are each independently selected from:
Figure imgf000040_0002
In another embodiment, for the Compounds of Formula (la), A and D
selected from:
Figure imgf000040_0003
and each occurrence of R is
Figure imgf000040_0004
In one embodiment, for the Compound of Formula (la), A and D are each independently a 4 to 7- membered monocyclic heterocycloalkyl, 7 to 1 1- membered bicyclic heterocycloalkyl or R15, wherein said 4 to 7- membered monocyclic heterocycloalkyl group or said R15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7- membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with R12, such that two R12 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group, or a spirocyclic 4 to 7-membered heterocycloalkyl group; wherein at least one of A and D is Rl s.
In another embodiment, for the Compounds of Formula (la), A and D are each independently selected from:
Figure imgf000041_0001
B is a 5-membered monocyclic heteroarylene;
C is:
Figure imgf000041_0002
wherein R12 is an optional ring substituent selected from F, -OCH3; pyridyl,
-OCH2CH2OH, -OCH2CH2OC(0)CH3, cyclopropyl and thiophenyl.
In one embodiment, for the Compounds of Formula (la), A and D are each independently selected from:
Figure imgf000042_0001
5-membered monocyclic heteroaryiene;
Figure imgf000042_0002
wherein R is an optional ring substituent selected from F, -OCH3, pyridyl,
-OCH2CH2OH, -OCH2CH2OC(0)CH3, cyclopropyl and thiophenyl; and
each occurrence of R4 is
Figure imgf000042_0003
In another embodiment the Compounds of Formula (I) have the formula (lb):
Figure imgf000042_0004
(lb)
and pharmaceutically acceptable salts thereof,
wherein A, C, D, M1, X! and X2 are defined above for the Compounds of Formula (la) and B is 5-membered monocyclic heteroaryiene group containing at least one nitrogen atom, wherein said 5-membered monocyclic heteroaryiene group can be optionally fused to 11 027117
42
a benzene, pyridine or pyrimidine ring, and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with R6 and on one or more ring carbon atoms with R12.
In one embodiment, for the Compounds of Formula (lb), A is ~-alkylene-N(R7)(Rn). In another embodiment, for the Compounds of Formula (lb), A is -alkylene- N(R,6)(Rn).
In another embodiment, for the Compounds of Formula (lb), A is a 4 to 7-membered heterocycloalkyl.
In still another embodiment, for the Compounds of Formula (lb), A is R! 5.
In another embodiment, for the Compounds of Formula (lb), A is selected from:
Figure imgf000043_0001
Figure imgf000044_0001
In another embodiment, for the Compounds of Formula (lb), A is selected from:
Figure imgf000044_0002
In still another embodiment, for the Compounds of Formula (lb), A is selected from:
Figure imgf000045_0001
In another embodiment, for the Compounds of Formula (lb), A is selected from:
Figure imgf000045_0002
In yet another embodiment A is selected from:
Figure imgf000045_0003
In another embodiment, for the Compounds of Formula (lb), A is
Figure imgf000045_0004
, wherein each occurrence of R is independently H
In another embodiment, for the Com ounds of Formula (lb), A is
Figure imgf000045_0005
In another embodiment, for the Compounds of Formula (lb), A is
H3C CH3
In a further embodiment, for the Compounds of Formula (lb), A is selected from:
Figure imgf000046_0001
, wherein R is H, alkyl, haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7- membered heterocycloalkyl, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, 3 to 7- membered cycloalkyl or 4 to 7- membered heterocycloalkyl, aryl or heteroaryl.
In another embodiment, for the Compounds of Formula (lb), A is selected from:
Figure imgf000046_0002
and R4 is:
Figure imgf000046_0003
, wherein Ra is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH2CH2Si(CH3)3, -C¾CH2CF3, pyranyl, benzyl or phenyl, and R! is methyl, ethyl or isopropyl.
In another embodiment, for the Compounds of Formula (lb), A is selected from:
Figure imgf000047_0001
and is:
Figure imgf000047_0002
In yet another embodiment, for the Compounds of Formula (lb), A is:
is independently H or F;
and R4 is
Figure imgf000047_0003
In yet another embodiment, for the Com ounds of Formula (lb), A is:
Figure imgf000047_0004
and R4 is
Figure imgf000047_0005
In another embodiment, for the Compounds of Formula (lb), A is -alkylene- N(alkyl)-C(0)-CH(alkyl)-NHC(0)0-alkyl, -alkylene-N(cycloa!kyl)-C(0)-CH(alkyl)- NHC(0)0-alkyl, -alkylene-N(cycloalkyl)-C(0)-CH(cycloalkyl)-NHC(0)0-alkylJ - alkyiene-N(cycloalkyl)-C(0)-CH(aryl)-NHC(0)0-alkyl or -alkylene-N(cycloalkyl)-C(0)- CH(heteroary!)-NHC(0)0-alkyl. In one embodiment, for the Compounds of Formula (lb), B is a 5-membered monocyclic heteroarylene.
In another embodiment, for the Compounds of Formula (lb), B is:
Figure imgf000048_0001
In another embodiment, for the Compounds of Formula (lb), C is a monocyclic heteroarylene.
In still another embodiment, for the Compounds of Formula (lb), C is a 6-membered monocyclic heteroarylene.
In another embodiment, for the Compounds of Formula (lb), C is a 5-membered monocyclic heteroarylene.
In another embodiment, for the Compounds of Formula (lb), C is abicyclic heteroarylene.
Formula (lb), C is
Figure imgf000048_0002
, wherein R is an optional ring substituent selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, - 0-(CrC6 alkyl), -0-(Ci-C6 hydroxyalkyi) and -0-(CrC6 alkylene)-OC(0)-(Ci-C6 alkyl).
In a further embodiment, for the Compounds of Formula (lb), C is:
Figure imgf000048_0003
wherein R is an optional ring substituent selected from F, -OCH3, pyridyl,
-OCH2CH2OH, -OCH2CH2OC(0)CH3, cyclopropyl and thiophenyl.
In another embodiment, for the Compounds of Formula (lb), C is:
Figure imgf000049_0001
In one embodiment, for the Compounds of Formula (lb), D is™alkylene-N(R7)(RH). In another embodiment, for the Compounds of Formula (lb), D is -alkylene- N(R16)(Rn).
In another embodiment, for the Compounds of Formula (lb), D is a 4 to 7-membered heterocycloalkyl.
In still another embodiment, for the Compounds of Formula (lb), D is R15.
In another embodiment, for the Compounds of Formula (lb), D is selected from:
Figure imgf000049_0002
Figure imgf000050_0001
another embodiment, for the Compounds of Formula (lb), D is selected from:
Figure imgf000050_0002
In another embodiment, for the Compounds of Formula (lb), D is selected from:
Figure imgf000050_0003
In still another embodiment, for the Compounds of Formula (lb), D is selected
Figure imgf000050_0004
In another embodiment, for the Compounds of Formula (lb), D is selected from;
Figure imgf000051_0001
In yet another embodiment D is selected from:
Figure imgf000051_0002
In another embodiment, for the Compounds of Formula (lb), D is
Figure imgf000051_0003
, wherein each occurrence of R12 is independently H or F.
In another embodiment, for the Com ounds of Formula (lb), D is
Figure imgf000051_0004
In another embodiment, for the Compounds of Formula (lb), D is
Figure imgf000051_0005
In a further embodiment, for the Compounds of Formula (lb), D is selected from:
Figure imgf000052_0001
and R4 is
Figure imgf000052_0002
, wherein R1 is H, alkyl, haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7- membered heterocycloalkyi, aryl or heteroaryl and Ra is alkyl, haloalkyl, silyialkyl, 3 to 7- membered cycloalkyl or 4 to 7- membered heterocycloalkyi, aryl or heteroaryl.
In anothe embodiment, for the Compounds of Formula (lb), D is selected from:
Figure imgf000052_0003
, wherein Ra is H, methyl, ethyl, propyl, isopropyl, -butyl, cyclopropyl, -CH2CH2Si(CH3)3, -CH2CH2CF3, pyranyl, benzyl or phenyl, and R1 is methyl, ethyl or isopropyl.
In another embodiment, for the Compounds of Formula (lb), D is selected from:
Figure imgf000053_0001
and R is:
Figure imgf000053_0002
In et another embodiment, for the Compounds of Formula (lb), D is:
Figure imgf000053_0003
, wherein each occurrence of R is independently H or F; and R4 is
Figure imgf000053_0004
In yet another embodiment, for the Com ounds of Formula (lb), D is:
Figure imgf000053_0005
and R is
Figure imgf000053_0006
In another embodiment, for the Compounds of Formula (lb), D is -alkylene- N(alkyl)-C(0)-CH(alkyl)-NHC(0)0-alkyl; -alkylene-N(cycloalkyl)-C(0)-CH(alkyl)- NHC(0)Oalkyl, -alkylene-N(cycloalkyl)-C(0)-CH(cycloalkyl)-NHC(0)0-alkyl, - alkylene-N(cycloalkyl)-C(0)-CH(aryl)-NHC(0)0-alkyl or-alkylene-N(cycloa!kyl)-C(0)- CH(heteroaryl)-NHC(0)0-alkyl.
In one embodiment, for the Compounds of Formula (lb), M1 is a bond.
In another embodiment, for the Compounds of Formula (lb), M1 is -S(0)2-
In another embodiment, for the Compounds of Formula (lb), M! is -0-.
In still another embodiment, for the Compounds of Formula (lb), M1 is -C(R7)2-.
In another embodiment, for the Compounds of Formula (lb), M1 is -CH2-.
In another embodiment, for the Compounds of Formula (lb), M1 is -N(R6)-.
In yet another embodiment, for the Compounds of Formula (lb), M5 is a bond.
In a further embodiment, for the Compounds of Formula (lb), M1 is -C(R2)=C(R2)-.
In another embodiment, for the Compounds of Formula (lb), M1 is -CH-CH-.
In another embodiment, for the Compounds of Formula (lb), Ms is -CH-N-.
In still another embodiment, for the Compounds of Formula (lb), M1 is -N=CH-.
In another embodiment, for the Compounds of Formula (lb), M1 is -C(R7)2-0-.
In another embodiment, for the Compounds of Formula (lb), M is -0-C(R )2-.
In yet another embodiment, for the Compounds of Formula (lb), M1 is -C(R7)2-
N(R6)-.
In another embodiment, for the Compounds of Formula (lb), M1 is -N(R6)-C(R7)2-,
In one embodiment, for the Compounds of Formula (lb), X is =C(R )-.
In another embodiment, for the Compounds of Formula (lb), X1 is =N-.
In another embodiment, for the Compounds of Formula (lb), X1 is -CH-.
In one embodiment, for the Compounds of Formula (lb), X" is =C(R )-.
In another embodiment, for the Compounds of Formula (lb), X is =N-.
In another embodiment, for the Compounds of Formula (lb), X2 is -CH-.
In one embodiment, for the Compounds of Formula (lb), X1 and X2 are each -CH-.
In one embodiment for the Compounds of Formula (lb), the group:
Figure imgf000054_0001
has the structure:
Figure imgf000055_0001
in another embodiment, for the Compounds of Formula (lb), the group:
Figure imgf000055_0002
2011/027117
55
In another embodiment for the Compounds of Formula (lb), the group:
has the structure:
Figure imgf000056_0001
In one embodiment, for the Compounds of Formula (lb), one, but not both, of A and
D is R15.
In another embodiment, for the Compounds of Formula (lb), each of A and D is Ri 5.
In another embodiment, for the Compounds of Formula (lb), A and D are each independently
Figure imgf000056_0002
In another embodiment, for the Compounds of Formula (lb), A and D are each independently selected from:
Figure imgf000057_0001
In still another embodiment, for the Compounds of Formula (lb), one of A and D is 15 and the other is selected from:
Figure imgf000057_0002
In another embodiment, for the Compounds of Formula (lb), one of A and D is and the other is selected from:
Figure imgf000057_0003
In yet another embodiment, for the Compounds of Formula (lb), one of A and I selected from:
Figure imgf000057_0004
and the other of A and D is selected from:
Figure imgf000057_0005
In another embodiment, for the Compounds of Formula (lb), at least one of A and Ds:
Figure imgf000058_0001
In a further embodiment, for the Compounds of Formula (lb), A and D
selected from:
Figure imgf000058_0002
and each occurrence of R is
Figure imgf000058_0003
In another embodiment, for the Compounds of Formula (lb), one of A and D is selected from:
the other o
Figure imgf000058_0004
and each occurrence of R4 is
Figure imgf000058_0005
11 027117
58
In another embodiment, for the Compounds of Formula (lb), one of A and D is R and the other is selected from:
Figure imgf000059_0001
and each occurrence of R4 is
Figure imgf000059_0002
In still another embodiment, for the Compounds of Formula (lb), one of A and D is:
Figure imgf000059_0003
, wherein each occurrence of R is independently H or F; the other of A and D is selected from:
and each occurrence of R4 is
Figure imgf000059_0004
In one embodiment, for the Compounds of Formula (lb), M is a bond.
In another embodiment, for the Compounds of Formula (lb), M1 is -S(0)2- In another embodiment, for the Compounds of Formula (lb), M1 is -0-.
In still another embodiment, for the Compounds of Formula (lb), M is -C(R ) -.
In another embodiment, for the Compounds of Formula (lb), M1 is -C¾-.
In another embodiment, for the Compounds of Formula (lb), M1 is ~N(R6)-
In yet another embodiment, for the Compounds of Formula (lb), M1 is a bond.
In a further embodiment, for the Compounds of Formula (lb), M is -C(R )=C(R )-.
In another embodiment, for the Compounds of Formula (lb), M1 is -CH=CH-. In another embodiment, for the Compounds of Formula (lb), M1 is -CH=N-.
In still another embodiment, for the Compounds of Formula (lb), M! is -N=CH-. In another embodiment, for the Compounds of Formula (lb), M1 is -C(R7)2-0-, In another embodiment, for the Compounds of Formula (lb), M1 is -0-C(R7)2-, In yet another embodiment, for the Compounds of Formula (lb), M1 is -C(R7)2-
In another embodiment, for the Compounds of Formula (lb), M is -N(R )-C(R )2
In one embodiment, for the Compounds of Formula (lb), X! is = (R5)-.
In another embodiment, for the Compounds of Formula (lb), X1 is -N-.
In another embodiment, for the Compounds of Formula (lb), X1 is -CH-.
In one embodiment, for the Compounds of Formula (lb), X is ^(R )-.
In another embodiment, for the Compounds of Formula (lb), X2 is =N-.
In another embodiment, for the Compounds of Formula (lb), X2 is -CH-.
In one embodiment, for the Compounds of Formula (lb), X and X are each -CH
Figure imgf000060_0001
(Ic)
and pharmaceutically acceptable salts thereof,
wherein:
C is phenylene, 5- or 6- membered monocyclic heteroarylene or 9-membered bicyclic heteroarylene, wherein said phenylene group, said 5- or 6-membered monocyclic heteroarylene group or said 9-membered bicyclic heteroarylene group can be optionally and independently substituted with up to two groups, which can be the same or different, and are selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, -0(CrC6 alkyl), -0-(Ci-C6 hydroxyalkyl), or -0-(C,-C6 alkyl ene)-OC(0)-(Ci-Q alkyl);
each occurrence of Z is independently -Si(Rx)2-, -C(Ry)2- or -~S(0)2-, such that at least one occurrence of Z is -Si(R )2-; each occurrence of Rx is independently Ci-C6 alkyl or two R groups that are attached to the same Si atom, combine to form a Η ¾)4- or ~(CH2)s- group; and
each occurrence of Ry is independently H or F;
each occurrence of R1 is independently Cj-C6 alkyl;
each occurrence of R4 is independently -C(0)CH(R7)NHC(0)OR1 ;
each occurrence of R7 is independently Cj-C6 alkyl, Cj-Ce silylalkyl or 4 to 7- membered heterocycloalkyl; and
In one embodiment, for the a (Ic), C is:
Figure imgf000061_0001
and wherein R is a single ring substituent selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, -0-(C\~Ce alkyl), -0-(CrC6 hydroxyalkyl) and - 0-(CrC6 alkylene)-OC(0)-(Ci-C6 alkyl).
In another embodiment, for the Compounds of Formula (Ic), C is;
Figure imgf000061_0002
and wherein R is an optional ring substituent selected from F, -OCH3, pyridyl,
-OCIfeC feOH, -OCH2CH2OC(0)CH3, cyclopropyl and tbiophenyl.
In another embodiment, for the Compounds of Formula (Ic), C is:
Figure imgf000061_0003
In another embodiment, for the Compounds of Formula (Ic), each occurrence of t is independently 1 or 2.
In still another embodiment, for the Compounds of Formula (Ic), each occurrence of t is 1. In another embodiment, for the Compounds of Formula (Ic), one occurrence of Z is -Si(Rx)2- and the other is ~C(Ry)2-.
In yet another embodiment, for the Compounds of Formula (Ic), each occun-ence of Z is -Si(Rx)2-
In a further embodiment, for the Compounds of Formula (Ic), each occurrence of Z is -C(Ry)2-.
In another embodiment, for the Compounds of Formula (Ic), one occurrence of Z is -Si(C¾)2- and the other is -C(Ry)2~.
In
Figure imgf000062_0001
(Id) wherein
each occurrence of R is:
Figure imgf000062_0002
each occurrence of Z is independently -Si(R )2- or -C(Ry)2-;
each occurrence of Rx is independently Ci-C6 alkyl or two Rx groups that are attached to the same Si atom, combine to form a ~ CH2)4- or -(CH2)s- group; and
each occurrence of Ry is independently H or F,
such that at least one occurrence of Z is -Si(Rx)2-.
In another embodiment for the Compounds of Formula (Id), one occurrence of Z is ~Si(Rx)2- and the other is -C(Ry)2-.
In another embodiment, for the Compounds of Formula (Id), each occurrence of Z is -Si(Rx)2-. In still another embodiment, for the Compounds of Formula (Id), one occurrence of is -CF2-.
In yet another embodiment, for the Compounds of Formula (Id), one occurrence of Z -Si(CH3)2- and the other is -CF2-.
In
Figure imgf000063_0001
(le) wherein
each occurrence of R is:
Figure imgf000063_0002
Za is -Si(Rx)2-;
Zb is ~C(RV;
each occurrence of Rx is independently Ci-C6 aikyl or two Rx groups that are attached to the same Si atom, combine to form a -(CH2)4- or ~(CH2)5- group; and
each occurrence of Ry is independently H or F.
In another embodiment, for the Compounds of Formula (Id), each occurrence of Rx is methyl, of Z is -CF2-.
In another embodiment, for the Compounds of Formula (Id), each occurrence of Ry is F.
In one embodiment, variables A, B, C, D, M1, X1 and X2 in the Compounds of Formula (I) are selected independently from each other.
In another embodiment, a Compound of Formula (I) is in substantially purified form. Other embodiments of the present invention include the following:
(a) A pharmaceutical composition comprising an effective amount of a Compound of Formula (I) or a pharmaceutically acceptable salt thereof, and a
pharmaceutically acceptable carrier.
(b) The pharmaceutical composition of (a), further comprising a second therapeutic agent selected from the group consisting of HCV antiviral agents,
immunomodulators, and anti-infective agents.
(c) The pharmaceutical composition of (b), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors.
(d) A pharmaceutical combination that is (i) a Compound of Formula (Ϊ) and (ii) a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti -infective agents; wherein the Compound of Formula (I) and the second therapeutic agent are each employed in an amount that renders the combination effective for inhibiting HCV replication, or for treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection.
(e) The combination of (d), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors.
(f) A method of inhibiting HCV replication in a subject in need thereof which comprises administering to the subject an effective amount of a Compound of Formula (I).
(g) A method of treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection in a subject in need thereof which comprises administering to the subject an effective amount of a Compound of Formula (Ϊ).
(h) The method of (g), wherein the Compound of Formula (I) is administered in combination with an effective amount of at least one second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents.
(i) The method of (h), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors. 1 027117
64
(j) A method of inhibiting HCV replication in a subject in need thereof which comprises administering to the subject the pharmaceutical composition of (a), (b) or (c) or the combination of (d) or (e).
(k) A method of treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection in a subject in need thereof which comprises administering to the subject the pharmaceutical composition of (a), (b) or (c) or the combination of (d) or (e).
The present invention also includes a compound of the present invention for use (i) in, (ii) as a medicament for, or (iii) in the preparation of a medicament for: (a) inhibiting HCV replication or (b) treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection. In these uses, the compounds of the present invention can optionally be employed in combination with one or more second therapeutic agents selected from HCV antiviral agents, anti-infective agents, and immunomodulators.
Additional embodiments of the invention include the pharmaceutical compositions, combinations and methods set forth in (a)-(k) above and the uses set forth in the preceding paragraph, wherein the compound of the present invention employed therein is a compound of one of the embodiments, aspects, classes, sub-classes, or features of the compounds described above. In all of these embodiments, the compound may optionally be used in the form of a pharmaceutically acceptable salt or hydrate as appropriate.
It is further to be understood that the embodiments of compositions and methods provided as (a) through (k) above are understood to include all embodiments of the compounds, including such embodiments as result from combinations of embodiments.
Non-limiting examples of the Compounds of Formula (I) include compounds 1-106, as set forth below. Compounds 1, 2, 15, 16, 20, 42, 44-51, 53-58, 60, 61, 65-67, 70-74, 76- 81, 83-97 and 99-106 were made using the methods described in the Schemes and Examples herein. Compounds 3-14, 17-19, 21-41, 43, 52, 59, 62-64, 68, 75, 82 and 98 can be made using the methods described in the Schemes and Examples herein.
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000069_0002
Figure imgf000070_0001
Figure imgf000071_0001
Figure imgf000072_0001
Methods For Making the Compounds of Formula (I)
The Compounds of Formula (I) may be prepared from known or readily prepared starting materials, following methods known to one skilled in the ait of organic synthesis. Methods useful for making the Compounds of Formula (I) are set forth in the Examples below and generalized in Schemes 1-8 below. Alternative synthetic pathways and analogous structures will be apparent to those skilled in the art of organic synthesis. All stereoisomers and tautomeric forms of the compounds are contemplated.
Some commercially available starting materials and intermediates used for the synthesis of the Compounds of Formula (I) are available which contain intact fused tricyclic tricyclic ring systems. These starting materials and intermediates are available from commercial suppliers such as Sigma-Aldrich (St. Louis, MO) and Acros Orga ics Co. (Fair Lawn, NJ). Such starting materials and intermediates compounds are used as received. When such fused tricyclic moieties are not commercially available, they can be prepared using methods well-known to those skilled in the art of organic synthesis. Such synthetic methods include, but are not limited to, those described in ricka et al., J. Chem. Soc. Perkin Trans I, 859-863 (1973); Kricka et al. , Chem. Rew., 74, 101-123, (1974); Kurfuerst et al., Coll. Czech. Chem. Comm., 54» 1705-1715, (1989); Saroja et al, 1 Org. Chem. 69, 987-990, (2004); Fanta et al, Synth. 9-21, (1 74), U.S. Patent Publication No.
US2005038037; and International Publication No. WO2004039859.
Scheme 1 shows a method useful for making the naphthyl imidazole compounds of formula A7 and A8, which are useful intermediates for making the Compounds of Formula
(I)-
Figure imgf000073_0001
Figure imgf000073_0002
Nitration of bromonaphthyl acetamide Al provides nitro analog A2 (J. Am. Chem. Soc, 73:4297 (1997)). The removal of acetyl group under acidic conditions followed by reduction of the nitro group should afford diaminonaphthalene A4. Coupling of the aniline to a cyclic or acyclic TV-protected a-amino acid A5 gives an amide of formula A6, which upon heating in acetic acid will cyclize to provide tricyclic bormonaphthylimidazole A7. The bromide could be converted to a boronate A8 with a palladium catalyst.
Scheme 2 shows a method useful for making the quinolineimidazole compounds of formula B6, which are useful intermediates for making the Compounds of Formula (I).
Scheme 2
Figure imgf000074_0001
Figure imgf000074_0002
Figure imgf000074_0003
B6
Commercially available aminonitroquinoline Bl can be reduced to diaminoquinoline B2, which is then coupled to a cyclic or acyclic N-protected a-amino acid AS to providean amide B3. It can then be cyclized to quinolineimidazole B4 under acidic conditions. N- oxide B5 can then be obtained with w-chloroperbenzoic acid. Upon treatment with phosphorous oxychloride, B5 should give the desired chloroquinoline B6, which can used in Suzuki coupling reactions.
Scheme 3 shows a method useful for making the boronic acid compounds of formula C4, which are useful intermediates for making the Compounds of Formula (I), where in "C" is a monocyclic 5 to 6-membered heteroaryl (examples: thiophene or pyridine).
Scheme 3
Figure imgf000075_0001
C3 C4
The Suzuki coupling partner C3 or C4 can be prepared from commercially available heteroaryl bromoacetyl compound of formula CI (Scheme 3). When treated with an N-protected amino acid (PG-AA-OH) in the presence of an amine base, e.g., DIPEA, a ketoester C2 is formed. If heated together with ammonium acetate, the ketoester is converted to the desired imidazole derivative C3. The bromide can then be converted to a boronate C4 with a palladium catalyzed reaction.
Scheme 4 shows methods useful for making the compounds of formula CI and C3, which are useful intermediates for making the Compounds of Formula (I), wherein variable C is other than a bond and B is an imidazole ring.
Scheme 4
Br-<S) ^ Br-©^ ^ Br-©~ Br
D1 D2 C1
Figure imgf000075_0002
D3 D4 C1
Br^)-Br ÷ Br sH NHBoc ^ Br"©^NH2
D5 D6 07
Figure imgf000075_0003
When heteroaryl bromoacetyl CI is not commercially available, it can be prepared by performing Friedel-Crafts acylation on a heteroaryl bromide of formula Dl using well- known methods, (e.g., those described in ricka et al, J. Chem. Soc. Per n Trans I 859- 863 (1973), and Kricka et al, Chem. Rew., 74, 101-123, (1974)) to provide the acylated products of formula D2. A compound of formula D2 can then be brominated using bromine, for example, to provide the compounds of formula CI.
On the other hand, bromo-iodo substituted heteroaromatic rings D3 can undergo a
Stilie coupling with (a-ethoxyvinyl) tributylstannane in the presence of a palladium catalyst using the methods including, but not limited to those described in Choshi et al., J. Org. Chem., 62:2535-2543 (1997), and Scott et al , J. Am. Chem. Soc, 106:4630 (1984)), to provide the ethyl-vinyl ether intermediate D4. Treating D4 with N-bromosuccimide gives the desired bromoacetyl intermediate CI, which can then be elaborated to advanced intermediates C3 or C4 for Suzuki coupling.
Alternatively, a heteroaromatic dibromide of formula D5 can be lithiated using n- butyl lithium and then quenched with N-Boc- glycine Weinreb amide to provide a Boc- protected β-keto amino compound of formula D6. Removal of the Boc group using TFA, for example, provides an amine compound of formula D7, which can then be coupled with an N -protected amino acid using typical amide bond forming reagents such as HATU to provide a ketoamide compound of formula D8. Upon heated in the presence of ammonium acetate, compound D8 can be cyclized to the imidazole analog of formula C3.
Scheme 5 shows a method useful for making the boronic acid compounds of formula E4, which are useful intermediates for making the Compounds of Formula (I).
Scheme 5
Figure imgf000076_0001
A heteroaromatic diamine El could be converted to a bicyclic imidazole E3 using the two step coupling-cyclization procedure described, for example, in Scheme 3. The corresponding boronate E4 can then easily be obtained from bromide E3 via well-known 1 027117
76 chemistry. Both E3 and E4 can be used as intermediate coupling partners in a Suzuki coupling process to provide the Compound of Formula (I).
Scheme 6 shows methods useful for making the Compounds of Formula (I) via a Suzuki Coupling process.
Scheme 6
Figure imgf000077_0001
A Suzuki coupling between protected imidazole boronate C4 (or boronic acid, not shown) and the fused bi-aryl tricyclic bromide A6 using, for example, the methods described in Angew Chem. Int. Ed. Engl. , 40? 4544 (2001) provide the compounds of formula Gl. Compounds of formula Gl can then be used to provide compounds of formula G2 by removal of the nitrogen protecting groups of Gl. An appropriate cap of group R can be added to the deprotected amino groups of G2 using reactions including, but not limited to acylation (with an acyl chloride or amino acid coupling reagent such as HATU or HOBt/EDCI), sulfonylation (with a sulfonyl chloride) or alkylation (with alkyl halide or reductive amination) to provide the desired Compounds of Formula (I).
Scheme 7 shows alternative methods useful for making the Compounds of Formula (I) via a Suzuki Coupling process.
Figure imgf000077_0002
7117
77
Similarly, a bicyclic bromide of formula E3 and fused tricyclic boronate of formula A7 can be joined using the methods described in Scheme 6 above, to provide coupled intermediates of formula HI. The compounds of formula HI can then be further elaborated using, for example, the methods described in Scheme 6 above, to provide the Compounds of Formula (I), wherein C is a bond and B is a bicyclic heteroarylene group.
Scheme 8
Figure imgf000078_0001
*~ ½¾H©- ¾ I - ¾SH ¾ R
Λ N~y N=/ Ν-Ν-Ν ·. t N--7 Ν-^νΝ ·.
H j j R H [ ;
12 )3
A boronate of formula C4 and chloroquinolineimidazole of formula B6 can be coupled under Suzuki coupling conditions similar to the methods described above to provideproducts of formula II, which can be transformed to the final targets of formula 13, using methods well-known to those skilled in the art of organic synthesis, including those described in Scheme 6 above. In some of the Fused Tricyclic Silyl Compounds contemplated in Schemes 1 -8, the amino acids (such as, but not limited to proline, 4,4-difluoroproline, (S)-2-piperidine carboxylic acid, valine, alanine, norvaline, etc.) are incorporated as part of structures.
Methods have been described in the general literature as well as in Banchard US
2009/0068140 for the preparation of such amino acid-derived intermediates.
One skilled in the art of organic synthesis will recognize that the synthesis of fused tricyclic cores in Formula (I) may require protection of certain functional groups (i.e., derivatization for the purpose of chemical compatibility with a particular reaction condition). Suitable protecting groups for the various functional groups of these compounds and methods for their installation and removal can be found in Greene et αί, Protective Groups in Organic Synthesis, Wiley-Interscience, New York, (1999).
One skilled in the art of organic synthesis will also recognize that one route for the synthesis of fused bi-aryl tricyclic cores in Formula (I) may be more desirable depending on U 2011/027117
78 the choice of appendage substituents. Additionally, one skilled in the art will recognize that in some cases the order of reactions may differ from that presented herein to avoid functional group incompatibilities and can amend the synthetic route accordingly.
One skilled in the art of organic synthesis will recognize that the synthesis of certain rased tricyclic cores in Formula (I) require the construction of an amide bond. Methods useful for making such amide bonds, include but are not limited to, the use of a reactive carboxy derivative (e.g., an acid halide, or ester at elevated temperatures) or the use of an acid with a coupling reagent (e.g. , HOBt, EDCI, DCC, HATU, PyBrop) with an amine.
The preparation of ring systems contemplated in this invention have been described in the literature and in compendia such as "Comprehensive Heterocyclic Chemistry" editions I, II and III, published by Elsevier and edited by A.R. Katritzky & R JK Taylor. Manipulation of the required substitution patterns have also been described in the available chemical literature as summarized in compendia such as "Comprehensive Organic
Chemistry" published by Elsevier and edited by DH R. Barton and W. D. Ollis;
"Comprehensive Organic Functional Group Transformations" edited by edited by A.R.
Katritzky & R JK Taylor and "Comprehensive Organic Transformation" published by Wily- CVH and edited by R. C. Larock.
The starting materials used and the intermediates prepared using the methods set forth in the Schemes above may be isolated and purified if desired using conventional techniques, including but not limited to filtration, distillation, crystallization,
chromatography and alike. Such materials can be characterized using conventional means, including physical constants and spectral data.
\
Uses of the Fused Tricyclic Silyl Compounds
The Fused Tricyclic Silyl Compounds are useful in human and veterinary medicine for treating or preventing a viral infection in a patient. In one embodiment, the Fused Tricyclic Silyl Compounds can be inhibitors of viral replication. In another embodiment, the Fused Tricyclic Silyl Compounds can be inhibitors of HCV replication. Accordingly, the Fused Tricyclic Silyl Compounds are useful for treating viral infections, such as HCV. In accordance with the invention, the Fused Tricyclic Silyl Compounds can be administered to a patient in need of treatment or prevention of a viral infection. T U 2011/027117
79
Accordingly, in one embodiment, the invention provides methods for treating a viral infection in a patient comprising administering to the patient an effective amount of at least one Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt thereof.
Treatment or Prevention of a Flaviviridae Virus
The Fused Tricyclic Silyl Compounds can be useful for treating or preventing a viral infection caused by the Flaviviridae family of viruses.
Examples of Flaviviridae infections that can be treated or prevented using the present methods include but are not limited to, dengue fever, Japanese encephalitis, yasanur Forest disease, Murray Valley encephalitis, St. Louis encephalitis, Tick-borne encephalitis, West Nile encephalitis, yellow fever and Hepatitis C Virus (HCV) infection.
In one embodiment, the Flaviviridae infection being treated is hepatitis C virus infection.
Treatment or Prevention of HCV Infection
The Fused Tricyclic Silyl Compounds are useful in the inhibition of HCV (e.g., HCV NS5 A), the treatment of HCV infection and/or reduction of the likelihood or severity of symptoms of HCV infection and the inhibition of HCV viral replication and/or HCV viral production in a cell-based system. For example, the Fused Tricyclic Silyl Compounds are useful in treating infection by HCV after suspected past exposure to HCV by such means as blood transfusion, exchange of body fluids, bites, accidental needle stick, or exposure to patient blood during surgery or other medical procedures.
In one embodiment, the hepatitis C infection is acute hepatitis C. In another embodiment, the hepatitis C infection is chronic hepatitis C.
Accordingly, in one embodiment, the invention provides methods for treating HCV infection in a patient, the methods comprising administering to the patient an effective amount of at least one Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt thereof. In a specific embodiment, the amount administered is effective to treat or prevent infection by HCV in the patient. In another specific embodiment, the amount administered is effective to inhibit HCV viral replication and/or viral production in the patient. The Fused Tricyclic Silyl Compounds are also useful in the preparation and execution of screening assays for antiviral compounds. For example the Fused Tricyclic Silyl Compounds are useful for identifying resistant HCV replicon cell lines harboring mutations within NS5A, which are excellent screening tools for more powerful antiviral compounds. Furthermore, the Fused Tricyclic Silyl Compounds are useful in establishing or determining the binding site of other antivirals to the HCV replicase.
The compositions and combinations of the present invention can be useful for treating a patient suffering from infection related to any HCV genotype. HCV types and subtypes may differ in their antigenicity, level of viremia, severity of disease produced, and response to interferon therapy as described in Holland et al. , Pathology, 30(2): 192- 195 (1998). The nomenclature set forth in Simmonds et al., JGen Virol, 74(Ptl l :2391-2399 (1993) is widely used and classifies isolates into six major genotypes, 1 through 6, with two or more related subtypes, e.g., la and lb. Additional genotypes 7-10 and 1 1 have been proposed, however the phylogenetic basis on which this classification is based has been questioned, and thus types 7, 8, 9 and 11 isolates have been reassigned as type 6, and type 10 isolates as type 3 (see Lamballerie et al., J Gen Virol, 78(Ptl):45-51 (1997)). The major genotypes have been defined as having sequence similarities of between 55 and 72% (mean 64.5%), and subtypes within types as having 75%-86% similarity (mean 80%) when sequenced in the NS-5 region (see Simmonds et al. , J Gen Virol, 75(Pt 5): 1053-1061 (1994)).
Combination Therapy
In another embodiment, the present methods for treating or preventing HCV infection can further comprise the administration of one or more additional therapeutic agents which are not Fused Tricyclic Silyl Compounds.
In one embodiment, the additional therapeutic agent is an antiviral agent.
In another embodiment, the additional therapeutic agent is an immunomodulatory agent, such as an immunosuppressive agent.
Accordingly, in one embodiment, the present invention provides methods for treating a viral infection in a patient, the method comprising administering to the patient: (i) at least one Fused Tricyclic Silyl Compound, or a pharmaceutically acceptable salt thereof, and (ii) at least one additional therapeutic agent that is other than a Fused Tricyclic Silyl Compound, wherein the amounts administered are together effective to treat or prevent a viral infection.
When administering a combination therapy of the invention to a patient, therapeutic agents in the combination, or a pharmaceutical composition or compositions comprising therapeutic agents, may be administered in any order such as, for example, sequentially, concurrently, together, simultaneously and the like. The amounts of the various actives in such combination therapy may be different amounts (different dosage amounts) or same amounts (same dosage amounts). Thus, for non-limiting illustration purposes, a Fused Tricyclic Silyl Compound and an additional therapeutic agent may be present in fixed amounts (dosage amounts) in a single dosage unit (e.g. , a capsule, a tablet and the like).
In one embodiment, the at least one Fused Tricyclic Silyl Compound is administered during a time when the additional therapeutic agent(s) exert their prophylactic or therapeutic effect, or vice versa.
In another embodiment, the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) are administered in doses commonly employed when such agents are used as monotherapy for treating a viral infection.
In another embodiment, the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating a viral infection.
In still another embodiment, the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) act synergistically and are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating a viral infection.
In one embodiment, the at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) are present in the same composition. In one embodiment, this composition is suitable for oral administration. In another embodiment, this composition is suitable for intravenous administration. In another embodiment, this composition is suitable for subcutaneous administration. In still another embodiment, this composition is suitable for parenteral administration.
Viral infections and virus-related disorders that can be treated or prevented using the combination therapy methods of the present invention include, but are not limited to, those listed above.
In one embodiment, the viral infection is HCV infection. The at least one Fused Tricyclic Silyl Compound and the additional therapeutic agent(s) can act additively or synergistically, A synergistic combination may allow the use of lower dosages of one or more agents and/or less frequent administration of one or more agents of a combination therapy. A lower dosage or less frequent administration of one or more agents may lower toxicity of therapy without reducing the efficacy of therapy.
In one embodiment, the administration of at least one Fused Tricyclic Silyl
Compound and the additional therapeutic agent(s) may inhibit the resistance of a viral infection to these agents.
Non-limiting examples of additional therapeutic agents useful in the present compositions and methods include an interferon, an immunomodulator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a virion production inhibitor, a viral entry inhibitor, a viral assembly inhibitor, an antibody therapy (monoclonal or polyclonal), and any agent useful for treating an RNA-dependent polymerase-related disorder.
In one embodiment, the additional therapeutic agent is a viral protease inhibitor. In another embodiment, the additional therapeutic agent is a viral replication inhibitor,
In another embodiment, the additional therapeutic agent is an HCV NS3 protease inhibitor.
In still another embodiment, the additional therapeutic agent is an HCV NS5B polymerase inhibitor.
In another embodiment, the additional therapeutic agent is a nucleoside inhibitor.
In another embodiment, the additional therapeutic agent is an interferon.
In yet another embodiment, the additional therapeutic agent is an HCV replicase inhibitor.
In another embodiment, the additional therapeutic agent is an antisense agent.
In another embodiment, the additional therapeutic agent is a therapeutic vaccine. In a further embodiment, the additional therapeutic agent is a virion production inhibitor.
In another embodiment, the additional therapeutic agent is an antibody therapy. In another embodiment, the additional therapeutic agent is an HCV NS2 inhibitor. In still another embodiment, the additional therapeutic agent is an HCV NS4A inhibitor.
In another embodiment, the additional therapeutic agent is an HCV NS4B inhibitor. In another embodiment, the additional therapeutic agent is an HCV NS5A inhibitor In yet another embodiment, the additional therapeutic agent is an HCV NS3 helicase inhibitor.
In another embodiment, the additional therapeutic agent is an HCV IRES inhibitor. In another embodiment, the additional therapeutic agent is an HCV p7 inhibitor. In a further embodiment, the additional therapeutic agent is an HCV entry inhibitor. In another embodiment, the additional therapeutic agent is an HCV assembly inhibitor.
In one embodiment, the additional therapeutic agents comprise a viral protease inhibitor and a viral polymerase inhibitor.
In still another embodiment, the additional therapeutic agents comprise a viral protease inhibitor and an immunomodulatory agent.
In yet another embodiment, the additional therapeutic agents comprise a polymerase inhibitor and an immunomodulatory agent.
In another embodiment, the additional therapeutic agents comprise a viral protease inhibitor and a nucleoside.
In another embodiment, the additional therapeutic agents comprise an
immunomodulatory agent and a nucleoside.
In one embodiment, the additional therapeutic agents comprise an HCV protease inhibitor and an HCV polymerase inhibitor.
In another embodiment, the additional therapeutic agents comprise a nucleoside and an HCV NS5A inhibitor.
In another embodiment, the additional therapeutic agents comprise a viral protease inhibitor, an immunomodulatory agent and a nucleoside.
In a further embodiment, the additional therapeutic agents comprise a viral protease inhibitor, a viral polymerase inhibitor and an immunomodulatory agent.
In another embodiment, the additional therapeutic agent is ribavirin.
HCV polymerase inhibitors useful in the present compositions and methods include, but are not limited to, VP-19744 (Wyeth/ViroPharma), PSI-7851 (Pharmasset), RG7128 (Roche/Pharmasset), PSI-7977 (Pharmasset), PSI-938 (Pharmasset), PSI-879 (Pharmasset), PSI-661 (Pharmasset), PF-868554/filib vir (Pfizer), VCH-759/VX-759 (ViroChem
Pharma/Vertex), HCV-371 (Wyeth/VirroPharma), HCV-796 (Wyeth/ViroPharma), IDX- 184 (Idenix), IDX-375 (Idenix), NM-283 (Idenix/Novartis), GL-60667 (Genelabs), JTK- 109 (Japan Tobacco), PSI-6130 (Pharmasset), R1479 (Roche), R-1626 (Roche), R-7128 (Roche), MK-0608 (Isis/Merck), INX-8014 (Inhibitex), IMX-8018 (Inhibitex), INX-189 (Inhibitex), GS 9190 (Gilead), A-848837 (Abbott), ABT-333 (Abbott), ABT-072 (Abbott), A-837093 (Abbott), BI-207127 (Boehringer-Ingelheim), BILB-1941 (Boehringer- Ingelheim), M -3281 (Merck), VCH-222/VX-222 (ViroChem/Vertex), VCH-916
(ViroChem), VCH-716(ViroChem), GSK-71 185 (Glaxo SmithKline), ANA598 (Anadys), GSK-625433 (Glaxo SmithKline), XTL-2125 (XTL Biopharmaceuticals), and those disclosed in Ni et al, Current Opinion in Drug Discovery and Development, 7(4):446 (2004); Tan et al., Nature Reviews, 1:867 (2002); and Beaulieu et al, Current Opinion in Investigational Drugs, 5:838 (2004).
Other HC V polymerase inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in International Publication Nos. WO 08/082484, WO 08/082488, WO 08/083351, WO 08/136815, WO 09/032116, WO
09/032123, WO 09/032124 and WO 09/032125.
Interferons useful in the present compositions and methods include, but are not limited to, interferon alfa-2a, interferon alfa-2b, interferon alfacon-1 and PEG-interferon alpha conjugates. "PEG-interferon alpha conjugates" are interferon alpha molecules covalently attached to a PEG molecule. Illustrative PEG-interferon alpha conjugates include interferon alpha-2a (Roferon™, Hoffman La-Roche, Nutley, New Jersey) in the form of pegylated interferon alpha-2a {e.g., as sold under the trade name Pegasys™), interferon alpha-2b (Intron™, from Schering-Plough Corporation) in the form of pegylated interferon alpha-2b {e.g. , as sold under the trade name PEG-Intron™ from Schering-Plough Corporation), interferon alpha-2b-XL {e.g., as sold under the trade name PEG-Intron™), interferon alpha-2c (Berofor Alpha™, Boehringer Ingelheim, Ingelheim, Germany), PEG- interferon lambda (Bristol-Myers Squibb and ZymoGenetics), interferon alfa-2b alpha fusion polypeptides, interferon fused with the human blood protein albumin (Albuferon™, Human Genome Sciences), Omega Interferon (Intarcia), Locteron controlled release interferon (Biolex/OctoPlus), Biomed-510 (omega interferon), Peg-IL-29 (ZymoGenetics), Locteron CR (Octoplus), R-7025 (Roche), IFN- -2b-XL (Flamel Technologies), belerofon (Nautilus) and consensus interferon as defined by determination of a consensus sequence of naturally occurring interferon alphas (Infergen™, Amgen, Thousand Oaks, California).
Antibody therapy agents useful in the present compositions and methods include, but are not limited to, antibodies specific to IL-10 (such as those disclosed in US Patent Publication No. US2005/0101770, humanized 12G8, a humanized monoclonal antibody against human IL-10, plasmids containing the nucleic acids encoding the humanized 12G8 light and heavy chains were deposited with the American Type Culture Collection (ATCC) as deposit numbers PTA-5923 and PTA-5922, respectively), and the like).
Examples of viral protease inhbitors useful in the present compositions and methods include, but are not limited to, an HCV protease inhibitor.
HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Nos. 7,494,988, 7,485,625, 7,449,447, 7,442,695, 7,425,576, 7,342,041, 7,253,160, 7,244,721, 7,205,330, 7,192,957, 7,186,747, 7,173,057, 7,169,760, 7,012,066, 6,914,122, 6,91 1,428, 6,894,072, 6,846,802, 6,838,475, 6,800,434, 6,767,991, 5,017,380, 4,933,443, 4,812,561 and 4,634,697; U.S. Patent
Publication Nos. US20020068702, US20020160962, US20050119168, US20050176648, US20050209164, US20050249702 and US20070042968; and International Publication Nos. WO 03/006490, WO 03/087092, WO 04/092161 and WO 08/124148.
Additional HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, VX-950 (Telaprevir, Vertex), VX-500 (Vertex), VX-813 (Vertex), VBY-376 (Virobay), BI-201335 (Boehringer Ingelheim), TMC-435
( edivir/Tibotec), ABT-450 (Abbott/Enanta), TMC-435350 (Medivir), RG7227
(Danoprevir, InterMune/Roche), EA-058 (Abbott/Enanta), EA-063 (Abbott/Enanta), GS- 9256 (Giiead), IDX-320 (Idenix), ACH-1625 (Achillion), ACH-2684 (Achillion), GS-9132 (Gilead/Achillion), ACH- 1095 (Gilead/Achillon), IDX-136 (Idenix), IDX-316 (Idenix), ITMN-8356 (InterMune), ITMN-8347 (InterM ne), ITMN-8096 (InterMune), ITMN-7587 (InterMune), BMS-650032 (Bristol-Myers Squibb), VX-985 (Vertex) and PHX1766 (Phenomix).
Further examples of HCV protease inhbitors useful in the present compositions and methods include, but are not limited to, those disclosed in Landro et al, Biochemistry,
36(31):9340-9348 (1997); Ingallinella et al, Biochemistry, 37(25):8906-8914 (1998);
Llinas-Brunet et al , Bioorg Med Chem Lett, 8(13): 1713-1718 (1998); Martin et al, Biochemistry, 37(33):! 1459-11468 (1998); Dimasi et al., J Virol, 71Π0):74 1-7469 (1997); Martin et al, Protein Eng, 10£5):607-ό14 (1997); Elzouki et al., JHepat, 27(l):42-48 (1997); BioWorld Today, 9(217):4 (November 10, 1998); U.S. Patent Publication Nos. US2005/0249702 and US 2007/0274951; and International Publication Nos. WO 98/14181 , WO 98/17679, WO 98/17679, WO 98/22496 and WO 99/07734 and WO 05/087731.
Further examples of HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, the following compounds:
Figure imgf000087_0001
Figure imgf000088_0001
Figure imgf000089_0001
Figure imgf000090_0001
and pharmaceutically acceptable salts thereof.
Viral replication inhibitors useful in the present compositions and methods include, but are not limited to, HCV replicase inhibitors, IRES inhibitors, NS4A inhibitors, NS3 helicase inhibitors, NS5A inhibitors, NS5B inhibitors, ribavirin, AZD-2836 (Astra Zeneca), viramidine, A-831 (Arrow Therapeutics), EDP-239 (Enanta), ACH-2928 (Achillion), GS- 5885 (Gilead); an antisense agent or a therapeutic vaccine.
Viral entry inhibitors useful as second additional therapeutic agents in the present compositions and methods include, but are not limited to, PRO-206 (Progenies), REP-9C (REPICor), SP-30 (Samaritan Pharmaceuticals) and ITX-5061 (iTherx).
HCV NS4A inhibitors useful in the useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Nos. 7,476,686 and 7,273,885; U.S. Patent Publication No. US20090022688; and International Publication Nos. WO 2006/019831 and WO 2006/019832. Additional HCV NS4A inhibitors useful as second additional therapeutic agents in the present compositions and methods include, but are not limited to, AZD2836 (Astra Zeneca), ACH-1095 (Achillion) and ACH-806 (Achillion).
HCV NS5A inhibitors useful in the present compositions and methods include, but are not limited to, A-832 (Arrow Therpeutics), PPI-461 (Presidio), PPI-1301 (Presidio) and BMS-790052 (Bristol-Myers Squibb).
HCV replicase inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Publication No. US20090081636. Therapeutic vaccines useful in the present compositions and methods include, but are not limited to, IC41 (Intercell Novartis), CSL123 (Chiron/CSL), GI 5005
(Globeimmune), TG-4040 (Transgene), GNI-103 (GENimmune), Hepavaxx C (ViRex Medical), ChronVac-C (Inovio/Tripep), PeviPROTM (Pevion Biotect), HCV/MF59 (Chiron/Novartis), MBL-HCV1 (MassBiologics), GI-5005 (Globeimmune), CT-011 (CureTech/Teva) and Civacir (NAB I).
Examples of further additional therapeutic agents useful in the present compositions and methods include, but are not limited to, Ritonavir (Abbott), TT033 (Benitec/Tacere Bio/Pfizer), Sirna-034 (Sirna Therapeutics), GNI 04 (GENimmune), GI-5005
(Globeimmune), IDX-102 (Idenix), Levovirin™ (ICN Pharmaceuticals, Costa Mesa, California); Humax (Genmab), ITX-2155 (Ithrex Novartis), PRO 206 (Progenies),
HepaCide-I (NanoVirocides), MX3235 (Migenix), SCY-635 (Scynexis); PE02003002 ( emin Pharma), Lenocta (VioQuest Pharmaceuticals), IET - Interferon Enhancing Therapy (Transition Therapeutics), Zadaxin (SciClone Pharma), VP 50406™ (Viropharma, Incorporated, Exton, Pennsylvania); Taribavirin (Valeant Pharmaceuticals); Nitazoxanide (Romark); Debio 025 (Debiopharm); GS-9450 (Gilead); PF-4878691 (Pfizer); ANA773 (Anadys); SCV-07 (SciClone Pharmaceuticals); NIM-881 (Novartis); ISIS 14803™ (ISIS Pharmaceuticals, Carlsbad, California); Heptazyme™ (Ribozyme Pharmaceuticals, Boulder, Colorado); Thymosin™ (SciClone Pharmaceuticals, San Mateo, California); Maxamine™ (Maxim Pharmaceuticals, San Diego, California); NKB-122 (JenKen
Bioscience Inc., North Carolina); Alinia (Romark Laboratories), INFORM- 1 (a combination of R7128 and ITMN-191); and mycophenolate mofetil (Hoffman-LaRoche, Nutley, New- Jersey).
The doses and dosage regimen of the other agents used in the combination therapies of the present invention for the treatment or prevention of HCV infection can be determined by the attending clinician, taking into consideration the approved doses and dosage regimen in the package insert; the age, sex and general health of the patient; and the type and severity of the viral infection or related disease or disorder. When administered in combination, the Fused Tricyclic Silyl Compound(s) and the other agent(s) can be administered simultaneously (i.e., in the same composition or in separate compositions one right after the other) or sequentially. This particularly useful when the components of the combination are given on different dosing schedules, e.g., one component is administered once daily and another component is administered every six hours, or when the preferred pharmaceutical compositions are different; e.g., one is a tablet and one is a capsule. A kit comprising the separate dosage forms is therefore advantageous.
Generally, a total daily dosage of the at least one Fused Tricyclic Silyl Compound(s) alone, or when administered as combination therapy, can range from about 1 to about 2500 mg per day, although variations will necessarily occur depending on the target of therapy, the patient and the route of administration. In one embodiment, the dosage is from about 10 to about 1000 mg/day, administered in a single dose or in 2-4 divided doses, in another embodiment, the dosage is from about 1 to about 500 mg day, administered in a single dose or in 2-4 divided doses. In still another embodiment, the dosage is from about 1 to about 100 mg day, administered in a single dose or in 2-4 divided doses, in yet another embodiment, the dosage is from about 1 to about 50 mg/day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage is from about 500 to about 1500 mg day, administered in a single dose or in 2-4 divided doses. In still another embodiment, the dosage is from about 500 to about 1000 mg day, administered in a single dose or in 2-4 divided doses. In yet another embodiment, the dosage is from about 100 to about 500 mg day, administered in a single dose or in 2-4 divided doses.
In one embodiment, when the additional therapeutic agent is INT ON-A interferon alpha 2b (commercially available from Schering-Plough Corp.), this agent is administered by subcutaneous injection at 3MIU(12 mcg)/0.5mL/TIW for 24 weeks or 48 weeks for first time treatment.
In another embodiment, when the additional therapeutic agent is PEG-INTRON interferon alpha 2b pegylated (commercially available from Schering-Plough Corp.), this agent is administered by subcutaneous injection at 1.5 mcg kg/week, within a range of 40 to 150 meg/week, for at least 24 weeks.
In another embodiment, when the additional therapeutic agent is ROFERON A interferon alpha 2a (commercially available from Hoffmann-La Roche), this agent is administered by subcutaneous or intramuscular injection at 3MIU(11.1 mcg/mL)/TIW for at least 48 to 52 weeks, or alternatively 6MIU/TIW for 12 weeks followed by 3MIU/TIW for 36 weeks.
In still another embodiment, when the additional therapeutic agent is PEGASUS interferon alpha 2a pegylated (commercially available from Hoffmann-La Roche), this agent is administered by subcutaneous injection at 180 mcg/lmL or 180 mcg/0.5mL, once a week for at least 24 weeks. In yet another embodiment, when the additional therapeutic agent is INFERGEN interferon alphacon-1 (commercially available from Amgen), this agent is administered by subcutaneous injection at 9 mcg/TiW is 24 weeks for first time treatment and up to 15 mcg TIW for 24 weeks for non-responsive or relapse treatment.
In a further embodiment, when the additional therapeutic agent is Ribavirin
(commercially available as REBETOL ribavirin from Schering-Plough or COPEGUS ribavirin from Hoffmann-La Roche), this agent is administered at a daily dosage of from about 600 to about 1400 mg/day for at least 24 weeks.
In one embodiment, one or more compounds of the present invention are
administered with one or more additional therapeutic agents selected from: an interferon, an immunomod lator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a viral polymerase inhibitor a virion production inhibitor, a viral entry inhibitor, a viral assembly inhibitor, an antibody therapy (monoclonal or polyclonal), and any agent useful for treating an RNA-dependent polymerase-related disorder.
In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV protease inhibitor, an HCV polymerase inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin. The combination therapies can include any combination of these additional therapeutic agents.
In another embodiment, one or more compounds of the present invention are administered with one additional therapeutic agent selected from an HCV protease inhibitor, an interferon, a pegylated interferon and ribavirin.
In still another embodiment, one or more compounds of the present invention are administered with two additional therapeutic agents selected from an HCV protease inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin.
In another embodiment, one or more compounds of the present invention are administered with an HCV protease inhibitor and ribavirin. In another specific
embodiment, one or more compounds of the present invention are administered with a pegylated interferon and ribavirin.
In another embodiment, one or more compounds of the present invention are administered with three additional therapeutic agents selected from an HCV protease inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin.
In one embodiment, one or more compounds of the present invention are
administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and ribavirin.
In one embodiment, one or more compounds of the present invention are
administered with one additional therapeutic agent selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor, in another embodiment, one or more compounds of the present invention are administered with ribavirin.
In one embodiment, one or more compounds of the present invention are
administered with two additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor.
In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and another therapeutic agent.
In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and another therapeutic agent, wherein the additional therapeutic agent is selected from an HCV polymerase inhibitor, a viral protease inhibitor, and a viral replication inhibitor.
In still another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and a viral protease inhibitor.
In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and an HCV protease inhibitor.
In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and boceprevir or telaprevir.
In a further embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and an HCV polymerase inhibitor. In another embodiment, one or more compounds of the present invention are administered with pegylated-interferon alpha and ribavirin.
Compositions and Administration
Due to their activity, the Fused Tricyclic Silyl Compounds are useful in veterinary and human medicine. As described above, the Fused Tricyclic Silyl Compounds are useful for treating or preventing HCV infection in a patient in need thereof.
When administered to a patient, the Fused Tricyclic Silyl Compounds can be administered as a component of a composition that comprises a pharmaceutically acceptable carrier or vehicle. The present invention provides pharmaceutical compositions comprising an effective amount of at least one Fused Tricyclic Silyl Compound and a pharmaceutically acceptable carrier. In the pharmaceutical compositions and methods of the present invention, the active ingredients will typically be administered in admixture with suitable carrier materials suitably selected with respect to the intended form of administration, i.e., oral tablets, capsules (either solid-filled, semi-solid filled or liquid filled), powders for constitution, oral gels, elixirs, dispersible granules, syrups, suspensions, and the like, and consistent with conventional pharmaceutical practices. For example, for oral administration in the form of tablets or capsules, the active drug component may be combined with any oral non-toxic pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc, mannitol, ethyl alcohol (liquid forms) and the like. Solid form preparations include powders, tablets, dispersible granules, capsules, cachets and suppositories. Powders and tablets may be comprised of from about 0.5 to about 95 percent inventive composition. Tablets, powders, cachets and capsules can be used as solid dosage forms suitable for oral administration.
Moreover, when desired or needed, suitable binders, lubricants, disintegrating agents and coloring agents may also be incorporated in the mixture. Suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethyl cellulose, polyethylene glycol and waxes. Among the lubricants there may be mentioned for use in these dosage forms, boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include starch, methylcellulose, guar gum, and the like. Sweetening and flavoring agents and preservatives may also be included where appropriate. Liquid form preparations include solutions, suspensions and emulsions and may include water or water-propylene glycol solutions for parenteral injection.
Liquid form preparations may also include solutions for intranasal administration.
Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for either oral or parenteral administration. Such liquid forms include solutions, suspensions and emulsions.
For preparing suppositories, a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted, and the active ingredient is dispersed
homogeneously therein as by stirring. The molten homogeneous mixture is then poured into convenient sized molds, allowed to cool and thereby solidify.
Additionally, the compositions of the present invention may be formulated in sustained release form to provide the rate controlled release of any one or more of the components or active ingredients to optimize therapeutic effects, i.e., antiviral activity and the like. Suitable dosage forms for sustained release include layered tablets containing layers of varying disintegration rates or controlled release polymeric matrices impregnated with the active components and shaped in tablet form or capsules containing such impregnated or encapsulated porous polymeric matrices.
In one embodiment, the one or more Fused Tricyclic Silyl Compounds are administered orally.
In another embodiment, the one or more Fused Tricyclic Silyl Compounds are administered intravenously.
In one embodiment, a pharmaceutical preparation comprising at least one Fused Tricyclic Silyl Compound is in unit dosage form. In such form, the preparation is subdivided into unit doses containing effective amounts of the active components.
Compositions can be prepared according to conventional mixing, granulating or coating methods, respectively, and the present compositions can contain, in one embodiment, from about 0.1% to about 99% of the Fused Tricyclic Silyl Compound(s) by weight or volume. In various embodiments, the present compositions can contain, in one embodiment, from about 1% to about 70% or from about 5% to about 60% of the Fused Tricyclic Silyl Compound(s) by weight or volume.
The quantity of Fused Tricyclic Silyl Compound in a unit dose of preparation may be varied or adjusted from about 1 mg to about 2500 mg. In various embodiment, the quantity is from about 10 mg to about 1000 mg, 1 mg to about 500 mg, 1 mg to about 100 mg, and 1 mg to about 100 mg.
For convenience, the total daily dosage may be divided and administered in portions during the day if desired. In one embodiment, the daily dosage is administered in one portion. In another embodiment, the total daily dosage is administered in two divided doses over a 24 hour period. In another embodiment, the total daily dosage is administered in three divided doses over a 24 hour period. In still another embodiment, the total daily dosage is administered in four divided doses over a 24 hour period.
The amount and frequency of administration of the Fused Tricyclic Silyl
Compounds will be regulated according to the judgment of the attending clinician considering such factors as age, condition and size of the patient as well as severity of the symptoms being treated. Generally, a total daily dosage of the Fused Tricyclic Silyl Compounds range from about 0.1 to about 2000 mg per day, although variations will necessarily occur depending on the target of therapy, the patient and the route of administration. In one embodiment, the dosage is from about 1 to about 200 mg/day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage is from about 10 to about 2000 mg day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage is from about 100 to about 2000 mg day, administered in a single dose or in 2-4 divided doses. In still another embodiment, the dosage is from about 500 to about 2000 mg/day, administered in a single dose or in 2-4 divided doses.
The compositions of the invention can further comprise one or more additional therapeutic agents, selected from those listed above herein. Accordingly, in one
embodiment, the present invention provides compositions comprising: (i) at least one Fused Tricyclic Silyl Compound or a pharmaceutically acceptable salt thereof; (ii) one or more additional therapeutic agents that are not a Fused Tricyclic Silyl Compound; and (iii) a pharmaceutically acceptable carrier, wherein the amounts in the composition are together effective to treat HCV infection.
In one embodiment, the present invention provides compositions comprising a Compound of Formula (I) and a pharmaceutically acceptable carrier.
In another embodiment, the present invention provides compositions comprising a
Compound of Formula (I), a pharmaceutically acceptable carrier, and a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents. In another embodiment, the present invention provides compositions comprising a Compound of Formula (I), a pharmaceutically acceptable carrier, and wto additional therapeutic agents, each of which are independently selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents.
In one aspect, the present invention provides a kit comprising a therapeutically effective amount of at least one Fused Tricyclic Silyl Compound, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and a pharmaceutically acceptable carrier, vehicle or diluent.
In another aspect the present invention provides a kit comprising an amount of at least one Fused Tricyclic Silyl Compound, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and an amount of at least one additional therapeutic agent listed above, wherein the amounts of the two or more active ingredients result in a desired therapeutic effect. In one embodiment, the one or more Fused Tricyclic Silyl Compounds and the one or more additional therapeutic agents are provided in the same container. In one embodiment, the one or more Fused Tricyclic Silyl Compounds and the one or more additional therapeutic agents are provided in separate containers.
EXAMPLES
General Methods
Solvents, reagents, and intermediates that are commercially available were used as received. Reagents and intermediates that are not commercially available were prepared in the manner as described below. !H NMR spectra were obtained on a Bruker Avance 500 (500 MHz) and are reported as ppm downfield from Me4Si with number of protons, multiplicities, and coupling constants in Hertz indicated parenthetically. Where LC/MS data are presented, analyses was performed using an Applied Biosystems API- 100 mass spectrometer and Shimadzu SCL-IOA LC column: Altech platinum CI 8, 3 micron, 33 mm x 7mm ID; gradient flow: 0 minutes - 10% CH3CN, 5 minutes - 95% CH3CN, 5-7 minutes - 95% CH3CN, 7 minutes ~ stop. The retention time and observed parent ion are given. Flash column chromatography was performed using pre-packed normal phase silica from Biotage, Inc. or bulk silica from Fisher Scientific. Unless otherwise indicated, column chromatography was performed using a gradient elution of hexanes/ethyl acetate, from 100% hexanes to 100% ethyl acetate.
Figure imgf000099_0001
To a solution of L- valine (10.0 g, 85.3 mmol) in 1M aqueous NaOH solution (86 mL) at room temperature was added solid sodium carbonate (4.60 g, 43.4 mmol). The reaction mixture was cooled to 0 °C (ice bath) and then methyl chloro formate (7.20 mL, 93.6 mmol) was added dropwise over 20 minutes. The reaction mixture was then allowed to warm to room temperature, and allowed to stir at room temperature for an additional 4 hours. The reaction mixture was then diluted with diethyl ether (100 mL), the resulting solution was cooled to at 0 °C, and then concentrated hydrochloric acid (18 mL, 216 mmol) was added slowly. The reaction was extracted with EtOAc (3 x 100 mL) and the combined organics were dried over MgS04, filtered and concentrated in vacuo to provide Compound Int-l (13.5 g, 90%), which was used without further purification.
The following intermediates can be prepared by the reaction of L- valine with isopropyl chloroformate (Aldrich Inc.), 2-methoxyethyl chloro formate (Aldrich) or with 1- methylcyclopropyl hydroxysuccinimide respectively, using the method described above:
Figure imgf000099_0002
Int-lb Int-lc Int-ld
EXAMPLE 2
Preparation of Intermediate Compound Int-2a
Figure imgf000100_0001
Int-2a
To a solution of D-phenylglycine (10,0 g, 66.1 mmol) and NaOH (21.2 g, 265 mmol) in water (60 mL) at 0 °C was added methyl chloroformate (10.2 mL, 133 mmol) drop wise over 20 minutes. The resulting mixture was allowed to stir at 0 °C for 1 hour, then was acidified using concentrated hydrochloric acid (25 mL, 300 mmol). The acidic solution was extracted with EtOAc (3 x 100 mL) and the combined organics were dried over MgS04, filtered and concentrated in vacuo to provide Compound Int-2a (12.6 g, 91%), which was used without further purification.
The following intermediates can be prepared by the reaction of glycine, L- Alanine and 4-F phenyl glycine, respectively with methyl chloroformate (Aldrich Inc.) using the method described above;
Figure imgf000100_0002
Int- 2b Int-2c Int-2d
EXAMPLE 3
Preparation of intermediate Compound Int-3a
Figure imgf000100_0003
Int-3a
A solution of D-phenylglycine (20.0 g, 132 mmol), 37% aqueous formaldehyde (66 mL, 814 mmol) and 5 % Pd on carbon (8.0 g, mmol) in a mixture of methanol (80 mL) and 1 N HC1 (60 mL) was placed on a hydrogenation shaker and shook under an atmosphere of 35-40 psi hydrogen for 4 hours. The reaction was then flushed with nitrogen, filtered through a celite pad and concentrated in vacuo to provide Compound Int-3a (29.7 g, quant,) as a white solid, which was used without further purification.
EXAMPLE 4
Preparation of Intermediate Compound Int-4e
Figure imgf000101_0001
lnt-4a J J int-4b lnt-4c
Figure imgf000101_0002
lnt~4d lnt-4e
Step A - Synthesis of Intermediate Compound Int-4b
To a solution of methyl 2-(benzyloxycarbonylamino)-2-(dimethoxyphosphoryl) acetate (10.0 g, 30.2 mmol, made as described in Hamada et al., Organic Letters; English; 20: 4664 - 4667 (2009)) in THF (100 mL) at -20 °C was added tetramethylguanidine (4.20 mL, 33.2 mmol). The reaction mixture was allowed to stir at -20 °C for 1 hour then dihydro-2H-pyran-4(3H)-one (Int-4a) was added (3.1 mL, 33.2 mmol) in THF (5 mL) and the reaction mixture was wanned to room temperature and stirred for about 15 hours.
EtOAc (200 mL) was added and the organic mixture was washed with water (3 χ 50 mL) and brine (50 mL). The organic layers were combined and dried with Na2S04, filtered and concentrated in vacuo. The crude product was purified using flash chromatography on an I SCO 330 g Redi-Sep column using 0-35% EtOAc/hexanes as the eluent to provide Compound Int~4b as a white solid (615 mg, 45%). 1H NMR (CDC13) δ 7.40-7.30 (m, 5H), 6.00 (br s, 1H), 5.12 (s, 2H), 3.80-3.65 (m, 7H), 2.92 (m, 2H), 2.52-2.48 (m, 2H).
Step B - Synthesis of Intermediate Compound Int-4c
To a solution of Int-4b (2.43 g, 7.96 mmol) in methanol (160 mL) previously purged with N2 was added (-)- 1 ,2-Bis((2S,5S)-2, 5 -dimethylphospholano) ethane
(cyclooctadiene)rhodium(I) tetrafluoroborate (487 mg, 0.880 mmol) under N2. The mixture IN2010.7118
101
was shaken in a Parr shaker apparatus for 18 hours at 50 psi of ¾. After evacuating the hydrogen, the suspension was filtered and the filtrate was concentrated to provide Compound Int-4c as a white solid (1.30 g, 53%). ¾ NM (CDC¾) δ 7.40-7.30 (m, 5H), 5.32 (br s, 1H), 5.12 (s, 2H), 4.40-4.30 (m, 1H), 4.00-3.95 (m, 2H), 3.75 (s, 3H), 3.40-3.25 (m, 2H), 2.10-1.95 (m, 1H), 1.50-1.45 (m, 4H).
Step C - Synthesis of Intermediate Compound Int-4d
To a suspension of 50% palladium on carbon (10% wet, 200 mg) in absolute ethanol (20 mL) under nitrogen was added Int-4c (1.06 g, 3.45 mmol). With stirring, the solution was placed under vacuum for 30 seconds and then was opened to a hydrogen gas balloon for 2 hours. After evacuating the hydrogen, the suspension was filtered through a Celite pad and the pad washed with ethanol (2 x 20 mL). The filtrate was concentrated to provide a colorless oil (585 mg, 98%). Ή NMR (CDC13) δ 4.06-3.96 (m, 2H), 3.73 (s, 3H), 3.48- 3.28 (m, 3H), 1.92-1.78 (m, 1H), 1.61-1.47 (m, 6H).
To a solution of the colorless oil (585 mg, 3.37 mmol) and triethylamine (0.710 mL,
5.09 mmol) in CH2C12 (6 mL) was added methyl chloroformate (0.290 mL, 3.76 mmol). The reaction mixture was allowed to stir at room temperature for about 15 hours. Water (15 mL) was added and the aqueous mixture was extracted with CH2CI2 (3 x 20 mL). The combined organic layers were dried over Na2S04, filtered and concentrated in vacuo. The crude product was purified using flash chromatography on an ISCO 24 g Redi-Sep column using 0-3% Με0Η/Ο¾(¾ as the eluent to provide Compound Int-4d as a colorless oil (600 mg, 77%). Ή NMR (CDClj) δ 5.27-5.18 (m, 1H), 4.38^1.28 (m, 1H), 4.06-3.96 (m, 2H), 3.75 (s, 3H), 3.69 (s, 3H), 3.39-3.30 (m, 2H), 2.09-1.94 (m, 1H), 1.59-1.48 (m, 4H). Step D - Synthesis of Intermediate Compound Int-4e
To a solution of compound lnt-4d (600 mg, 2.59 mmol) in THF (5 mL) was added lithium hydroxide monohydrate (218 mg, 5.19 mmol) in water (5 mL) . The reaction mixture was allowed to stir at room temperature for 2 hours then concentrated to half volume. The aqueous mixture was then acidified with 6N HCl and extracted with EtOAc (7 x 50 mL). The combined organic layers were dried over Na2S0 , filtered and concentrated to provide Compound Int-4e as an off-white solid (485 mg, 86%). Ή NMR (CD3OD) δ 4.09-4.07 (m, 1H), 3.96-3.92 (m, 2H), 3.65 (s, 3H), 3.40-3.34 (m, 2H), 2.10-1.99 (m, 1H), 1.56-1.47 (m, 4H). IN2010.7118
102
EXAMPLE S
Preparation of Intermediate Compound Sf
Figure imgf000103_0001
lnt-5d lnt-5f
Step A - Synthesis of Intermediate Compound Int-2a
To a solution of methyl 2-(benzyloxycarbonylamino)-2-(dimethoxyphosphoryl) acetate (1.50 g, 4.52 mmol) in THF (5 mL) at -20 °C was added tetramethylguanidine (625iL, 4.98 mmol). The reaction mixture was allowed to stir at -20 °C for 1 hour then tert- butyl 4-oxopiperidine-l-carboxylate was added (992 mg, 4.97 mmol) in THF (2 mL) and the reaction mixture was warmed to room temperature and stirred for about 15 hours. EtOAc (90 mL) was added and the organic mixture was washed with water (3 x 20 mL) and brine (25 mL). The combined organic layers were dried over Na2SC>4, filtered and concentrated in vacuo. The crude product was purified using flash chromatography on an 1SCO 40 g Redi-Sep column using 0-35% EtOAc/hexanes as the eluent to provide Compound Int-5a as a white semi-solid (1.1 g, 61%). Ή NMR (CDC13) δ 7.40-7.30 (m, 5H), 6.02 (br s, 1H), 5.12 (s, 2H), 3.80-3.40 (m, 7H), 2.90-2.80 (m, 2H), 2.45-2.35 (m, 2H), 1.45 (s, 9H).
Step B - Synthesis of Intermediate Compound Int-Sb
To a solution of Int-5a (1.30 g, 3.21 mmol) in methanol (90 mL) previously purged with N2 was added (-)-l,2-Bis((2S,5S)-2,5-dimethylphospholano)ethane
(cyclooctadiene)rhodium(I) tetrafluoroborate (197 mg, 0.354 mmol) under N2. The mixture IN2010.7118
103
was shaken in a Parr shaker apparatus for 18 hours at 50 psi of ¾. After evacuating the hydrogen, the suspension was filtered and the filtrate was concentrated to provide Compound Int-5b as a colorless oil (1.00 g, 77%). ¾ NMR (CDC13) δ 7.40-7.30 (m, 5H), 5.35-5.25 (m, 1H), 5.10 (s, 2H), 4.40-4.35 (m, 1H), 4.20-4.10 (m, 2H), 3.70 (s, 3H), 2.70- 2.55 (m, 2H), 2.00-1.90 (m, 1H), 1.65-1.40 (m, 11H), 1.30-1.20 (m, 2H).
Step C - Synthesis of Intermediate Compound IntSc
To a solution of 50% palladium on carbon (10% wet, 250 mg) in absolute ethanol (20 mL) under nitrogen was added Int-5b (1.00 g, 2.46 mmol). With stirring, the solution was placed under vacuum for 30 seconds and then was opened to a hydrogen gas balloon for 2 hours. After evacuating the hydrogen, the suspension was filtered through a Celite pad and the pad washed with ethanol (2 x 20 mL). The filtrate was concentrated to provide Compound Int-5c as a colorless oil (670 mg, quant.). Ή NMR (CDC13) δ 4.21-4.08 (m, 2H), 3.73 (s, 3H), 3.31 (d, 7= 6.0 Hz, 1H), 2.75-2.57 (m, 2H), 1.84-1.70 (m, 1H), 1.68- 1.56 (m, 1H), 1.45 (s, 9H), 1.45-1.20 (m, 5H).
Step D - Synthesis of Intermediate Compound Int-Sd
To a solution of compound Int-5c (670 mg, 2.46 mmol) and triethylamine (0.520 mL, 3.73 mmol) in CH2C12 (10 mL) was added methyl chloroformate (0.210 mL, 2.72 mmol). The reaction mixture was allowed to stir at room temperature for about 15 hours.
Water (20 mL) was added and the aqueous mixture was extracted with CH2CI2 (2 x 15 mL).
The combined organic layers were dried over Na2SC>4, filtered and concentrated in vacuo.
The crude product was purified using flash chromatography on an ISCO 24 g Redi-Sep column using 0-3% MeOH/CftCL. as the eluent to provide Compound Int-5d as an off- white solid (515 mg, 63%). Ή NMR (CDCI3) δ 5.26-5.17 (m, 1H), 4.38-4.30 (m, IH),
4.20-4.07 (m, 2H), 3.75 (s, 3H), 3.68 (s, 3H), 2.71-2.57 (m, 2H), 2.00-1.85 (m, IH), 1.87-
1.48 (m, 2H), 1.44 (s, 9H), 1.35-1.18 (m, 2H).
Step E - Synthesis of Intermediate Compound IntSe
Compound Int-5d (300 mg, 0.908 mmol) was dissolved in a mixture of TFA (2 mL) and CH2CI2 (10 mL) and the solution was allowed to stir at room temperature for 1 hour before it was concentrated in vacuo to provide a solid. To this residue triethylamine (0.760 mL, 5.45 mmol) in CH2CI2 (10 mL) was added followed by acetic anhydride (0.086 mL, IN2010.7118
104
0.915 mmol). The reaction mixture was allowed to stir at room temperature for about 15 hours then concentrated in vacuo. The crude product was purified using flash chromatography on an ISCO 12 g Redi-Sep column using 0-4% MeOH/CH2(¾ as the eluent to provide Compound Int-5e as a colorless oil (247 mg, 99%). Ή N R (CDC13) δ 5.27-5.21 (m, IH), 4.73-4.62 (m, IH), 4.42-4.32 (m, IH), 3.69 (s, 3H), 3.18 (s, 3H), 3.18- 3.09 (m, IH), 3.07-2.95 (m ,1H), 2.55-2.41 (m, IH), 2.07 (s, 3H), 1.78-1.49 (m, 3H), 1.38- 1.21 (m, 2H).
Step F - Synthesis of Intermediate Compound Int-5f
To a solution of compound Int-Se (247 mg, 2.59 mmol) in THF (3 mL) was added lithium hydroxide monohydrate (77 mg, 1.83 mmol) in water (3 mL). The reaction mixture was allowed to stir at room temperature for about 15 hours then concentrated to half volume. The aqueous mixture was then acidified with IN HCl to pH 4 and extracted with EtOAc (7 x 15 mL). The combined organics were dried over NazSCu, filtered and concentrated to provide Compound Int-5f as an off-white solid (106 mg, 45%). JH NMR (CDjOD) δ 5.52-5.43 (m, IH), 4.71-4.62 (m, IH), 4.44-4.31 (m, IH), 3.91-3.81 (M, IH), 3.70 (s, 3H), 3.12-2.99 (m, IH), 2.58-2.46 (m, IH), 2.10 (m, 4H), 1.86-1.54 (m, 2H), 1.50- 1.21 (m, 3H).
EXAMPLE 6
Preparation of Intermediate Compound Int-6f
EN2010.7118
105
Figure imgf000106_0001
Step A— Synthesis of Intermediate Compound Int-όΐ
A stirred mixture of Int-6a (50.0 g, 0.412 mol), ethyl glyoxylate (81.5 mL, 50% in toluene, 0.412 mol) and PPTS (0.50 g, 2.00 mmol) in benzene (600 mL) was heated to reflux in a Dean-Stark apparatus until no further water (~8 mL) azeotroped from the reaction (~ 4 h). The resulting mixture was concentrated in vacuo. The crude residue Int- 6b was used without purification: Ή NMR (300 MHz, CDC13) δ 7.72 (s, 1H), 7.36-7.24 (m, 5H), 4.61 (q, = 6.9 Hz, 1H), 4.35 (q, /= 7.2 Hz, 2H), 1.62 (d, ./= 6.6 Hz, 3H), 1.34 (t, J = 7.2 Hz, 3H).
Step B - Synthesis of Intermediate Compound Int- lie
To a stirred solution of crude Int-6b in methylene chloride (600 mL) at -78 °C were added the following in 10 minute intervals: TFA (31.0 mL, 0.416 mol), boron trifluoride etherate (51.3 mL, 0.416 mol) and freshly distilled cyclopentadiene (32.7 g, 0.494 mol). After less than 2 minutes the reaction forms a thick brown mass. After 6 hours at -78 °C the reaction was allowed to slowly warm to room temperature for about 15 hours, at which time the reaction had formed a dark brown solution. The reaction was quenched with saturated aqueous a2C03 (~ 900 mL) and stirred for 30 minutes. The resultant solids were removed by filtration through Celite®. The aqueous filtrate was extracted with methylene chloride (3 x 100 mL). The combined extracts were washed with saturated aqueous NaCl (2 x 75 mL), dried over Na2SC>4, filtered and concentrated in vacuo. The crude product was purified using flash column chromatography (silica; 8 x 18 cm) using 10% to 25% ethyl IN2010.71 18
106
acetate hexanes as the eluent to provide endo Int-6c (10.9 g, 9%) as a brown oil: Ή NMR (300 MHz, CDCI3) δ 7.34-7.19 (m, 5H), 6.00-5.95 (ra, 1H), 4.18 (q, /= 7.1 Hz, 3H), 3.47 (s, 1H), 3.03 is, 1H), 2.97 (q, J= 6.5 Hz, 1H), 2.41 (s, 1H), 1.86 (d, /= 8.2 Hz, 1H), 1.26 (t, J= 6.6 Hz, 3H), 1.17 (t, / = 6.6 Hz, 3H). Exo Int-6c (84.3 g, 74%) was collected as a brown oil: Ή NMR (300 MHz, CDC13) δ 7.34-7.19 (m, 5H), 6.36-6.33 (m, 1H), 6.22-6.18 (m, 1H), 4.37 (s, 1H), 3.87 (q, J= 6.8 Hz, 2H), 3.10 (q, J= 6.5 Hz, 1H), 2.96 (s, 1H), 2.27 (s, 1H), 2.20 (d, 7= 8.4 Hz, 1H), 1.48 (d, 7= 6.5 Hz, 3H), 1.01 (d, 7= 7.0 Hz, 3H), 1.00 (m, 1H). Step C -Synthesis of Intermediate Compound lnt-6d
A mixture of e∞-Int-6c (15.8 g, 0.582 mol) and 10% Pd/C (4.07 g, 50% wet) in a 1 :2 mixture of EtOH/EtOAc (150 mL) was shaken in a Parr hydrogenation apparatus under an atmosphere of ¾ (50 psi). After 23 hours the mixture was filtered through Celite® and the filtrate concentrated in vacuo. ¾ NMR analysis of the resulting residue (10.8 g) showed some aromatic resonances present. Repetition of the hydrogenation procedure using 10% Pd C (2.0 g) afforded Int-6d (10.0 g, quant.) as a brown oil: Ή NMR (300 MHz, CDCI3) δ 4.18 (q, 7= 7.2 Hz, 3H), 3.54 (s, 1H), 3.32 (s, 1H), 2.62 (s, 1H), 2.23 (s, 1H), 1.64-1.39 (m, 5H), 1.31-1.20 (m, 4H). Step D - Synthesis of Intermediate Compound lnt-6e
To a stirred mixture of Int-6d (36.6 g, 0.236 mol) and saturated aqueous Na2CC>3 (300 mL) in THF (600 mL) at 0 °C was added di-fert-butyl dicarbonate (59.0 g, 0.270 mol). The reaction mixture was allowed to slowly warm to room temperature over 6 hours. After 68 hours the reaction mixture was diluted with EtOAc (250 mL) and water (250 mL). The aqueous layer was extracted with EtOAc (2 x 200 mL) and the combined extracts were washed with saturated aqueous NaCl (2 x 75 mL), dried over a2SO<t, filtered and concentrated in vacuo. The resulting residue was purified using flash column chromatography (silica; 16 x 10 cm) using 10-20% ethyl acetate/hexanes as the eluent to provide Compound Int-6e (49.0 g, 84%) as a pale yellow oil: Ή NMR (300 MHz, CDCI3) δ 4.35 (s, 0.6H), 4.22-4.10 (m, 2.4H), 3.81 (s, 0.45H), 3.71 (s, 0.55H), 2.66 (s, 1H), 1.96- 1.90 (m, 1H), 1.76-1.50 (m, 3H), 1.55-1.45 (m, 5H), 1.39 (s, 5H), 1.30-1.23 (m, 4H).
Step E— Synthesis of Intermediate Compound Int-6f IN2010.7118
107
To a stirred mixture of Int-6e (49.0 g, 0.182 mmol) in 1 :1 THF/water (600 mL) was added LiOH«H20 (15.3 g, 0.364 mol). The reaction mixture was warmed to 60 °C for 47 hours, cooled to room temperature and concentrated in vacuo to remove excess THF. The resulting residue was diluted with <¾(¾ (200 mL) then acidified with 2N HCl until pH ~ 4. The aqueous layer was extracted with CH2CI2 (4 » 100 mL) and the combined extracts were washed with saturated aqueous NaCl (25 mL), dried over Na2SO,t, filtered and concentrated in vacuo to provide Compound Int-6f (41.2 g, 93%) as an off white solid: ]H NMR (400 MHz, DMSO-i¾) δ 12.44 (s, 1H), 4.13 (s, 0.56H), 4.06 (s, 0.47H), 3.61 (d, J= 4.0 Hz, 1H), 2.59 (s, 1H), 1.75-1.45 (m, 5H), 1.39 (s, 4H), 1.32 (s, 5H), 1.23 (t, J= 8.4 Hz, 1H); Optical Rotation: [a]D 25 -169.0° (c = 1.1, CHCI3).
EXAMPLE 7
Preparation of Intermediate Compound lnt-7d Step A - Synthesis of Intermediate Compound Int- 7b
Figure imgf000108_0001
lnt-7a lnt-7b
A 2 L, 3-necked round bottomed flask equipped with an overhead stirrer and a N2 inlet was charged with a solution of oxalyl chloride (130 mL, 0.26 mol) in dichloromethane (250 mL). The solution was cooled to -78 °C, and a solution of DMSO (20 mL, 0.28 mol) in dichloromethane (30 mL) was added dropwise. After 30 minutes, a solution of (S)-N- Boc-prolinol (Int-7a, 40 g, 0.2 mol) in dichloromethane (200 mL) was added dropwise. After 30 minutes, triethylamine (140 mL, 1.0 mol) was added to the solution, and the flask was transferred to an ice/water bath and stirred for another 30 minutes. The reaction mixture was diluted with dichloromethane (200 mL) and washed successively with H20, 1M HCl, saturated NaHCC-3, and brine. The organic layer was dried over Na2S<¾, filtered, and concentrated to provide Compound Int-7b (40 g) as an oil, which was used without further purification. IN2010.7118
108
- Synthesis of Intermediate Compound Int-lc
Figure imgf000109_0001
lnt-7b int-7c
To Int-7b (80 g, 0.4 mol) was added a solution of ammonia in MeOH (prepared from 150 mL of 7 N ammonia/ MeOH and 200 mL MeOH, 1.05 mol, 260 mol %). An exotherm was noted and the internal reaction temperature increased to about 30 °C. The resulting reaction was allowed to stir for 30 minutes at room temperature, then glyoxal (76 g, 0.52 mol, 130 mole %) was added portionwise over a 5 minute period, during which time the internal reaction temperature increased to about 60 °C. The reaction was allowed to stir for about 15 hours at room temperature, then the reaction mixture was concentrated in vacuo and to the resulting residue was added dichloromethane (1L) and water (0.5 L). The organic layer was separated, washed water (0.25 L), dried over MgSO-t, filtered and concentrated in vacuo. The residue obtained was slurried with hot ethyl acetate (100 mL) and hexanes (100 mL) and the slurry was allowed to cool to room temperature. The cooled slurry was then filtered and the collected solid was washed with 30% ethyl acetate/hexanes, then dried under vacuum to provide Compound Int-7c (66.2g, 70% yield). Ή NMR
(DMSO) δ: 11.68/11.59 (br s, 1H), 6.94 (s, 1H), 6.76 (s, 1H), 4.76 (m, 1H), 3.48 (m, 1H), 3.35-3.29 (m, 1H), 2.23-1.73 (m, 4H), 1.39/1.15 (s, 9H).
Step C- Synthesis of Intermediate Compound Int-7d
Figure imgf000109_0002
lnt-7c lnt-7d
N-Bromo succinimide (838.4 mg, 4.71 mmol) was added in portions over 15 minutes to a cooled (ice/water) CH2C12 (20 mL) solution of Int-7c (1.06 g, 4.50 mmol). The reaction mixture was allowed to stir for 75 minutes and concentrated in vacuo to an oil. The crude product was purified using silica-gel RPLC (Acetonitrile/ water/ 0.1% TFA) to separate the mono bromide from its dibromo analog (over bromination) and the starting material. The RPLC elute was neutralized with excess H3/MeOH, and the volatile IN2010.7118
109
component was removed in vacuo. The resulting residue was partitioned between CH2CI2 and water, and the aqueous layer was extracted with water. The combined organic phase was dried (MgS04), filtered, and concentrated to provide Compound Int-7d as a white solid (374 mg). Ή NM (DMSO) δ: 12.12 (br s, 1H), 7.10 (m, 1H), 4.70 (m, 1H), 3.31 (m, 1H; overlapped with water signal), 2.25-1.73 (m, 4H), 1.39/1.17 (s, 3.8H + 5.2H).
Alternative Synthesis of Int-7d
Step D— Synthesis of Intermediate Compound Int-7e
Figure imgf000110_0001
lnt-7b |nt-7e
To a suspension of Int-7b (140 g, 0.59 mol) in THF (2000 mL) was added N- bromosuccinimide (200 g, 1.1 mol). The mixture was allowed to stir at room temperature under N2 gas for about 15 hours. The solvent was then removed in vacuo, and the resulting residue was purified using silica-gel chromatography (ethyl acetate eluent) to provide 230 g of Compound Int-7e. MS (ESI) m/e (M+tf): 396.
Step E - Synthesis of Intermediate Compound Int-7d
Figure imgf000110_0002
lnt-7e lnt-7d
To a suspension of Int-7e (230 g, 0.58 mol) in EtOH/H20 (1 :1 ratio, 3000 mL) was added Na2S<_>3 (733 g, 5.8 mol). The resulting mixture was allowed to stir at mild reflux for about 15 hours. After cooling to room temperature, the mixture was extracted with dichloromethane twice and the combined organic layers were concentrated under vacuum to a semi-solid. The resulting residue was purified using chromatography on silica gel to provide Compound Int-7d. MS (ESI) m/e (M+H+): 317. ΓΝ2010.7118
110
Step F - Synthesis of Intermediate Compound Int-7f
Figure imgf000111_0001
Int-re lnt-7f
Compound Int-7e (2.63 g, 5.0 mmol) was dissolved in THF (30 mL) and the resulting solution was cooled to - 78 °C, then n-BuLi (1M in hexane, 2.2 mL, 5.5 mmol) was added and the reaction was allowed to stir for 20 minutes. N- fluorodibenzenesulfonimide (1.6 mL, 5.0 mmol) was added at - 78 °C and the reaction mixture was allowed to warm slowly to room temperature again. The reaction was quenched with aq. NH4CI then partitioned between water and EA. The organic layer was dried over
Figure imgf000111_0002
and concentrated in vacuo. The resulting residue was purified using flash column chromatography (Gradient of EtOAc:petroleum ether from 0-20% EtOAc) to provide Compound Int-7f. (63 % yield). MS (ESI) m/z (M+H)+: 464,466. 19 F NM = - 151.8 ppm
EXAMPLE 8
Preparation of Intermediate Compound Int-8g
Step A - Synthesis of Intermediate Compound Int-8b
Figure imgf000111_0003
lnt-8a mt-8b
To a solution of compound CBz-proline (50 g, 0.2 mol) in THF (500 mL) and Et3N (20 mL) was added dropwise isopropyl chloroformate (25 g, 0.22 mol) at ice water bath. Then the resulting solution was allowed to warm to room temperature and stirred for lh. Then a solution of CH2N2 (0.22 mol) in ether was added slowly until no 2 gas evolution was noted. Acetic acid (4 mL) was added and the reaction mixture was allowed to stir for 10 minutes. NaHCOj solution was then added and the reaction mixture extracted three times with ethyl acetate. The organic layers were combined, dried over Na2S04, and concentrated to provide crude product. The crude product was then purified using column chromatography on silica gel (Pet Ether: E. Acetate = 3:1) to provide Compound Int-8b (38 g, 70% yield). ΙΝ2010.7Π8
111
Step B - Synthesis of Intermediate Compound Int-8c
Figure imgf000112_0001
lnt-8b |nt-8c
To a solution of Int-8b (38 g, 0.14 mol) in acetic acid (20 mL) was added dropwise an aqueous HBr solution (11.2 g, 0.14 mol). After 1 Omin, the mixture was poured into an aqueous NaHC(¾ solution and extracted three times with ethyl acetate. The combined organic layers were washed with brine, water, dried over Na2SC>4 and concentrated in vacuo to provide Compound Int-8c (30 g, 68% yield).
Step C - Synthesis of Intermediate Compound Int-8e
Figure imgf000112_0002
lnt-8c lnt-8d lnt-8e
To a solution of Int-8c (10 g, 32 mmol) and compound lnt-8d (8.4 g, 64 mmol) in DMF (70 mL) was added 2C03 (18 g, 126 mmol). The mixture was allowed to stir at 100 °C in a sealed tube for about 15 hours. The solvent was removed and the resulting residue was purified using column chromatography on silica gel (DCM: MeOH = 20:1) to provide Compound Int-8e. (6 g, 59% yield).
Step D - Synthesis of Intermediate Compound Int- f
Figure imgf000112_0003
Int-8e lnt-8f
To a solution Int-8e (4 g, 14.7 mmol) in THF (40 mL) was added NaH (6.6 g, 60 % content, 16.17 mmol) at 0 °C. The mixture was allowed to stir at room temperature for 30 minutes and then cooled to 0 °C, and SEM-C1 (2.4 g, 14.7 mmol) added dropwise. The IN2010.71 18
1 12
resulting mixture was allowed to stir at 0 °C for 2 hours. The solvent was removed under vacuum and the resulting residue was purified using column chromatography on silica gel (DC : MeOH =20:1) to provide Compound Int-8f. (2 g, 34 % yield). Step E - Synthesis of Intermediate Compound Int-8g
Figure imgf000113_0001
lnt-8f lnt-8g
To a solution of Int-8f (2 g, 5 mmol) in THF (20 mL) was added dropwise n-BuLi (2.5 mL, 6.3 mmol) at -78 °C (bath) under N2 protection. The resulting solution was allowed to stir at this temperature for 30 minutes, then a solution of NBS (0.89 g, 5 mmol) in THF (10 mL) was added dropwise at -78 °C. The mixture was allowed to stir at -78 °C for 1 hour and then aqueous NH4CI solution was added. The organic layer was separated and concentrated in vacuo off to provide a crude residue, which was purified using column chromatography on silica gel (pet. ether:EtOAc =3:1 as the eluent) to provide Int-Sg (400 mg, 16.5% yield).
EXAMPLE 9
Figure imgf000113_0002
lnt-9a lnt-9b nt- c
Figure imgf000113_0003
lnt-9d lnt-9e
Step A - Synthesis of Intermediate Compound Int-9c
A mixture of compound Int-9a (50.0g, 179.9 mmol), compound Int-9b (43.0 g, 199.8 mmol), and triethylamine (30 mL, 215.5 mmol) in DMF (100 mL) was allowed to stir IN2010.7118
113
at room temperature for about 4 days. Ethyl acetate (600 mL) was then added to the reaction mixture and the resulting solution was washed with brine (3 X 100 mL), dried over sodium sulfate and concentrated in vacuo to provide Compound Int-9c as a brown gel (74.5 g, ~100% yield), which was used without further purification.
Step B - Synthesis of Intermediate Compound Int-9d
Compound Int-9c (20 g, crude, ~48.5 mmol), ammonium acetate (20.0 g, 256.6 mmol), and o-xylene (100 mL) were added to a 500 mL pressure vessel. The resulting mixture was allowed to stir at 140 °C for 2.5 hours, then cooled to room temperature and concentrated in vacuo. The resulting residue was taken up in ethyl acetate (400 mL), washed with saturated sodium carbonate solution, dried over sodium sulfate, and concentrated in vacuo. The resulting residue was purified using a 330 g ISCO silica column Combi-Flash system (20-50% ethyl acetate in hexanes) to provide Compound Int- 9d as an orange solid (15.5 g, 81% yield).
Step C- Synthesis of Intermediate Compound Int-9e
A solution of compound Int-9d (4.0 g, 10.2 mmol), trifiuoroacetic acid (10 mL, 130.6 mmol), and dichloromethane (10 mL) was allowed to stir at room temperature for about 15 hours, then was concentrated in vacuo. The resulting residue was taken up in dichloromethane (60 mL), washed with saturated sodium carbonate, dried over sodium sulfate, and concentrated in vacuo to provide Compound Int-9e as an off-white solid (3 g, -100% yield), which was used without further purification.
Int-9f was prepared from N-BOC-trans-fluoro-L-proline, (available from Alfa) using the method described above.
Figure imgf000114_0001
Int-9f
Int-9g was prepared from N-Boc-4,4-difluoro-L-proline, (Aldrich) using the method described above. IN2010.7118
Figure imgf000115_0001
Int-9h was prepared from BOC-HYP-OH, (available from Aldrich) using the method described above.
Figure imgf000115_0002
Int-9h
Int-9i was prepared from commercially available BOC-4-amino-pyrrolidine-2- carboxylic acid using the method described above.
Figure imgf000115_0003
Int-9i
Int-9j was prepared from commercially available BOC-4-amino-pyrrolidine-2- carboxylic acid using the method described above, with appropriate fiinctionahzation with methyl chloroformate as in example 1.
Figure imgf000115_0004
Int-9j
Int-9k was prepared from 2S-carboxy piperidine (prepared according to method described in Gudasheva et al., J. Med. Chem Ther. 1996, 31, 151). IN2010.7118
Figure imgf000116_0001
Int-9k
lnt-91 was prepared from 2S-carboxy-4,4-F piperidine (prepared according to the method described in Chinese Patent No. CN 101462999).
Figure imgf000116_0002
lnt-91
Int-9m was prepared from 2S-carboxy morpholine, using the method described above.
Figure imgf000116_0003
Int-9m
Int-9q was prepared from commercially available Int-9o using the method described above
Figure imgf000116_0004
lnt-9p
Figure imgf000116_0005
Synthesis of Int-9r IN2010.7118
116
Compound Int-9q (712 mg, 1.68 ramol) was dissolved in DCM (17 mL), solid mCPBA (839 mg, 8.39 mmol) was added and the reaction was stirred for about 15 hours at room temperature. The reaction mixture was then diluted with DCM (150 mL) and quenched by the addition of 1 N aq. sodium bisulfate (40 mL). The organic phase was separated and then washed with saturated aqueous sodium bicarbonate (2 x 60 mL), brine (60 mL), dried over anhydrous MgSC>4, filtered, and concentrated in vacuo. The resulting crude Int-9r was purified using silica gel chromatography (80 g RediSep® SiC¾ cartridge; 1-9% MeOH / EtOAc gradient) to provide Compound Int-9r (458 mg, 60% yield) as a yellow solid.
Int-9s was prepared from (lR,3S,4S)-N-BOC-2-azabicyclo[2.2.1]-heptane-3- carboxylic acid using the method described above for the synthesis of compound Int-9r.
Figure imgf000117_0001
Int-9s
Int-9t was prepared from 15 g of 2(S)-azabicyclo[2.2.2]-octane-2,3-dicarboxylic acid 2-tert-butyl ester (commercially available from Wuxi Apptech Co) using the method described above for the synthesis of compound Int-9r, to provide 10.1 g of Int-9t.
Figure imgf000117_0002
EXAMPLE 10
Preparation of Intermediate Compound Int-lOc
Step A - Synthesis of Intermediate Compound Int- 10a
Figure imgf000117_0003
Int-lOa IN2010.7118
117
To a solution of 2-acetyl-5-bromothiophene (10.0 g, 48.8 nimol) in anhydrous CH2CI2 (120 mL) at room temperature was added bromine (7.79 g, 48.8 mmol). The resulting reaction was allowed to stir at room temperature for 20 hours, then was concentrated in vacuo to provide Int-lOa as a yellow solid (14.0 g, quant.), which was without further purification.
Step B - Synthesis of Intermediate Compound Int-lOb
Figure imgf000118_0001
Int-lOb
To a solution of Int-lOa (13.9 g, 48.8 mmol) and JV-Boc-proline (22.1 g, 103 mmol) in anhydrous acetonitrile (250 mL) at room temperature was added diisopropylethylamine (18.0 mL, 101 mmol). The reaction was allowed to stir at room temperature for 16 hours, then EtOAc (500 mL) and water (500 mL) were added and the layers were separated. The organic solution was washed with saturated aqueous sodium bicarbonate solution (500 mL), dried over MgSO/t, filtered and concentrated in vacuo to provide Int-lOb (21.2 g, quant.), which was used without further purification.
Step C - Synthesis of Intermediate Compound Int-Wc
Figure imgf000118_0002
Int-lOc
A suspension of Int-lOb (11.7 g, 28.0 mmol) and NH4OAc (43 g, 559 mmol) in anhydrous toluene (200 mL) was heated to 100°C and allowed to stir at this temperature for 12 hours. The reaction mixture was then cooled to room temperature, and EtOAc (500 mL) and water (500 mL) were added. The layers were separated and the aqueous layer was extracted with EtOAc (2 x 200 mL). The combined organics were dried over MgSC>4, filtered and concentrated in vacuo and the resulting residue was purified using flash chromatography on an ISCO 330 g Redi-Sep column (10-80% EtOAc hexanes as eluent) to provide Int-lOc (6.18 g, 56 %). LRMS: (M+H)+ = 398.1, 400.1. IN2010.71 18
118
EXAMPLE 11
Preparation of Intermediate Compound Int-llf Step A - Synthesis of Intermediate Compound Int-Ila
Figure imgf000119_0001
Int-lla
To a solution of 2-acetylthiazole (10.0 g, 78.6 mmol) in anhydrous MeOH (150 mL) at room temperature was added trimethyl orthoformate (52.0 g, 488 mmol) and p- tolueiiesulfonic acid (14.2 g, 74.7 mmol). The resulting reaction was heated to 50°C and was allowed to stir at this temperature for 12 hours. EtOAc (600 mL) was then added and the resulting solution was washed with saturated aqueous sodium bicarbonate solution (600 mL) and brine (600 mL). The organic layer was dried over MgS0 , filtered and concentrated in vacuo to provide Compound Int-lla (12.1 g, 90%), which was used without further purification.
Step B - Synthesis of Intermediate
Figure imgf000119_0002
Int-1 lb
To a solution of Int-lla (8.0 g, 46.2 mmol) in anhydrous THF (150 mL) at -78°C under nitrogen was added n-butyl lithium (23.1 mL, 2.0 M, 46.2 mmol) over 10 minutes. The reaction mixture was allowed to stir at -78°C for 45 minutes, then a solution of carbon tetrabromide (15.9 g, 48.0 mmol) in anhydrous THF (50 mL) was added dropwise over 10 minutes. The cooling bath was removed and the reaction mixture was then allowed to warm to 0°C on its own. The reaction mixture was then quenched with saturated ammonium chloride solution (50 mL). The reaction mixture was then diluted with water (150 mL) and diethyl ether (150 mL) and separated. The organic phase was washed with brine (200 mL), dried over MgSC>4, filtered and concentrated in vacuo. The resulting residue was purified using flash chromatography on an ISCO 330 g Redi-Sep column (0-20% EtOAc hexanes as eluent) to provide Compound Int-llb (7.47 g, 65 %).
Step C - Synthesis of Intermediate Compound Int-1 lc IN2010.71 18
119
Figure imgf000120_0001
Int-llc
To a solution of Int-llb (7.47 g, 29.6 mmol) in anhydrous CH2C¾ (100 mL) at room temperature was added TFA (64 mL) and water (2.0 mL). The resulting reaction was allowed to stir at room temperature for 17 hours, and then was concentrated in vacuo. The resulting residue was taken up in diethyl ether (300 mL) and 10% aqueous NaHCC solution (300 mL) and separated. The organic phase was washed with water and brine, dried over gSd, filtered and concentrated in vacuo to provide Compound Int-llc (5.63 g, 92%), which was used without further purification.
Step D - Synthesis of Intermediat Int-1 Id
Figure imgf000120_0002
To a solution of 2-acetyl-5-bromothiazole (5.63 g, 27.3 mmol) in anhydrous CH2CI2 (100 mL) at room temperature was added bromine (4.39 g, 27.3 mmol). The reaction mixture was allowed to stir at room temperature for about 15 hours for 48 hours, then was concentrated in vacuo to provide Compound Int-1 Id as a yellow solid (8.63 g, quant.), which was used without further purification.
Step E - Synthesis of Intermediate Compound Int-1 le
Figure imgf000120_0003
Int-lle
Compound Int-lle was prepared from compound Int-lld using the method described in Example 3, Step B.
Step F - Synthesis of Intermediate Compound Int-1 If IN2010.7118
120
Figure imgf000121_0001
Int-llf
Compound Int-llf was prepared from compound Int-lle using the method described in Example 8, Step C. LRMS: (M+H)+ = 399.0, 401.0.
EXAMPLE 12
Figure imgf000121_0002
lnt-12c Step A - Synthesis of "Intermediate Compound Int-12
To a solution of 5-bromothiophene-2-carboxylic acid (7.6 g, 34.4 mmol) in anhydrous CH2CI2 (270 mL) at room temperature was added oxalyl chloride (3.80 mL, 44.5 mmol) dropwise. The resulting reaction was allowed to stir at room temperature for 1.5 hours, then heated to reflux and allowed to stir at this temperature for 1 hour. The reaction mixture was cooled to room temperature, concentrated in vacuo, and the resulting residue was dissolved in anhydrous acetonitrile (180 mL) and cooled to -15°C.
(Trimethylsilyl)diazomethane solution in hexane (25.8 mL, 2 M, 51.6 mmol) was added dropwise over 20 minutes and the resulting reaction was allowed to stir at -15°C for 1 hour. A hydrobromide solution in acetic acid (7.2 mL, 33 wt%, 41.6 mmol) was then added to the cooled reaction mixture dropwise and the resulting reaction was allowed to stir at -15 °C for additional 20 minutes. The reaction mixture was concentrated in vacuo and the resulting residue was dissolved in ethyl acetate (300 mL) and washed with water, saturated aqueous sodium bicarbonate solution and brine (200 mL each). The organic phase was dried over IN2010.7118
121
MgS04, filtered and concentrated in vacuo to provide Compound Int-12a as a light yellow solid (6.5 g, 63%), which was used without further purification.
Step B - Synthesis of Intermediate Compound Int-12c
Compound Int-12c was synthesized from Int-12a according to the methods described in Example 10, Steps B and C. Int-lc2: LRMS: (M+H)+ = 414.2.
EXAMPLE 13
Preparation of Intermediate Compound Int-13d
Step A - Synthesis of Intermediate Compound Int-13b
Figure imgf000122_0001
fete
Int-13a Int-13b
Ethyl chloroformate (12 mL, 125 mmol) in 180 mL of THF was added drop-wise to a cooled solution (-5°C) of compound Z-Pro-OH (13.8 g, 55.5 mmol), TEA (7.71 mL, 55.5 mmol). The resulting slurry was allowed to stir for 20 minutes at -5°C before saturated NH4OH (15 mL) was added. The solution was allowed to stir at room temperature for 18 hours, volatiles were removed, and the resulting residue was taken up in EtOAc (180 mL). The undissolved white precipitate was filtered off and rinsed with EtOAc (100 mL). The organic layers were dried over Na2S04 and concentrated in vacuo to provide the desired product (13.5 g) as off-white amorphous solid (Int-13b). MS (ESI) vale (M+H+): 249.
Step B - Synthesis of Intermediate Compound Int-13c
Figure imgf000122_0002
Int-13b Int-13c I 2010.7118
122
Lawesson's reagent (16.1 g, 39.9 mmol) was added to a stirred slurry of the amide Int-13b (18 g, 72.6 mmol) in PhMe (200 mL) at room temperature. The reaction mixture was heated to 100°C for 3 hours before the solvent was removed. The resulting residue was purified using flash chromatography on silica gel (DCM MeOH=l :0-20: 1) to provide Compound Int-13c (18 g). MS (ESI) m/e (M+H+): 265.
Step C - Synthesis of Intermediate Compound Int-lld
Figure imgf000123_0001
Int-13c Int-13d
A mixture of Int-13c (10.0 g, 37.8 mmol) and the bromoacetophenone (10.0 g, 35.9 mmol) in EtOH (100 mL) was heated at 90°C for 3 hours. The reaction mixture was cooled and concentrated in vacuo, and the resulting residue was purified using flash chromatography on silica gel to provide Compound Int-13d (1 1 g). MS (ESI) m e (M+H+): 444.
EXAMPLE 14
Figure imgf000123_0002
9e Int-14a Int-14b
A solution of compound Int-9e (1.0 g, 3.42 mmol), compound Int-14a (0.95 g, 4.54 mmol), HATU (1.3g, 3.42 mmol), and DMF (10 mL) was allowed to stir at room temperature for about 15 hours. The solution was then diluted with ethyl acetate (100 mL), washed with brine (3 X 40 mL), dried over sodium sulfate, and concentrated in vacuo. The resulting residue was purified using an 80 g silica gel column/Combi-Flash system (0-5% methanol in dichloromethane) to provide Compound Int-14b as a gel (1.12g, 68%).
EXAMPLE 15
Preparation of Intermediate Compound Int-15c IN2010.7118
Figure imgf000124_0001
Int-7d Int-15b Int-15c
To a solution of compound Int-7d (0.5 g, 1.58 mmol) in DME (15 mL) at room temperature under N2 was added PdCbidppffe (258 mg, 0.30 mmol). The reaction mixture was allowed to stir at 100 °C for 5 minutes, then a solution of compound lnt-15b (592 mg, 3.16 mmol) and K2CO3 (654 mg, 4.74 mmol) in 15 mL ¾0 was added to the reaction mixture in 3 portions over 10 minutes. The resulting reaction was allowed to stir for an additional 30 minutes, after which time thin-layer chromatography analysis indicated consumption of compound Int-7a. The reaction was allowed to stir for an additional 30 minutes, then was concentrated in vacuo, and the resulting residue was taken up in 150 mL ethyl acetate. The organic phase was separated, washed with water (50 mL), brine and dried over sodium sulfate. After filtration, the organic layer was concentrated in vacuo and the resulting residue was purified using flash liquid chromatography (0% to 100% EtOAc Hexane) to provide 600 mg of compound Int-15c (> 85% purity, theory 597 mg). HPLC (CI 8 column Gemini 5u 110A, 150X21.2 mm, 5 micron). FABMS: MH+ = 379
EXAMPLE 16
Pre aration of Intermediate Compound Int-16b
Figure imgf000124_0002
Int-9e Int-16a Int-16b
Compound Int-9e (4.2g, 12.24 mmol), bis(pinacolato)diboron (Compound Int-16a, 6.5g, 25.6 mmol), Pd(PPh3) (0.563g, 0.49 mmol), potassium acetate (3.1 g, 31.58 mmol) and 1,4-dioxane (100 mL) were added to a 350 mL pressure vessel. The resulting mixture was degassed and allowed to stir at 80 °C for 20 hours. The reaction mixture was then cooled to room temperature and filtered. The filtrate was concentrated in vacuo and the IN2010.7118
124
residue obtained was purified using flash column chromatography on silica gel (0-2% methanol in dichloromethane) to provide Compound Int-16b as a white wax (2.5 g, 46.5%).
EXAMPLE 16a
Figure imgf000125_0001
Int-9g Int-16c Compound Int-9g (5.7 g, 13.31 mmol), bis(pinacolaton)diboron (6.8 g, 26.78 mmol), Pd(PPh3)4 (0.76 g, 0,66 mmol), potassium acetate (2.0 g, 20.37 mmol) and 1,4- dioxane were added to a 500 mL flask . The resulting suspension was degassed and allowed to stir at 80 °C for about 15 hours. The reaction mixture was then cooled to room temperature and filtered. The filtrate was concentrated in vacuo and the residue obtained was purified using a 220 g ISCO silica column on Combi-Flash Rf with elution of 0-4% methanol in dichloromethane to provide Compound Int-16c as a wax (5.4 g, 85%).
Int-16d, Int-16e, Int-16f and Int-16g were prepared from Int-9h, Int-9f, Int-9s and Int-9t, respectively, using the method described above.
Figure imgf000125_0002
EXAMPLE 17
Preparation of Intermediate Compound Int-17 IN2010.7118
125
Step A - Synthe
Figure imgf000126_0001
Int-17a
A mixture of 6-bromo-2 -naphthoic acid (80,3 g, 319 mmol), diphenylphosphoryl azide (71 mL, 352 mmol) and triethylamine (50 mL, 358 mmol) in fert-butanol (400 mL) was heated to reflux and allowed to stir at this temperature for 15 hours. The reaction mixture was then cooled to room temperature and poured over saturated aqueous aHC03 solution (600 mL) and stirred vigorously for 30 minutes. The resulting suspension was filtered, washed with water (200 mL) and dried in vacuo at 65 °C. The resulting white solid was suspended in MeOH (500 mL) and cooled to -78 °C, then HC1 gas was bubbled into the mixture until saturated. The reaction mixture was then allowed to stir at room temperature for 15 hours, after which time the resulting solids were collected by filtration, then washed with ice-cold MeOH (100 mL) to provide Compoimd Int-17a as an off-white solid (74.8 g, 91%), which was used without further purification. Ή NMR (DMSO-<¾) δ 10.5-10.0 (br s, 3H), 8.23 (s, IH), 7.99 (d, J= 9.0 Hz, IH), 7.92 (d, = 9.0 Hz, IH), 7.84 (s, IH), 7.68-7.65 (m, IH), 7.56-7.51 (m, IH). LRMS: (M+2H)+ = 223.
Step B - Synt
Figure imgf000126_0002
Int -17a Int-17b
To a solution of Compound Int-17a (74.8 g, 289 mmol) and triethylamine (120 mL, 860 mmol) in CH2C12 (500 mL) at 0 °C was added acetic anhydride (27.5 mL, 292 mmol). The resulting reaction was wanned to room temperature and allowed to stir at this temperature for 1.5 hours. The reaction mixture was filtered and the filtrate concentrated in vacuo. The resulting residue was triturated with hexanes (500 mL) and the resulting solids were filtered, washed with hexanes (100 mL) and dried in vacuo at 55 °C for 1 hour to provide Compound Int-17b as an off-white solid (60.6 g, 79%), which was used without further purification. Ή NMR (DMSO- ) δ 10.1 (s, IH), 8.30 (s, IH), 8.09 (s, IH), 7.85- 7.76 (m, 2H), 7.62-7.53 (m, 2H), 2.10 (s, 3H). LRMS: (M+H)+ = 265. IN2010.7118
126
Step C - Synthes
Figure imgf000127_0001
Int 17b Int-17c
To a solution of Compound Int-17b (60.6 g, 229 mmol) and acetic anhydride (120 mL) in acetic acid (500 mL) at 0 °C was added a solution of fuming nitric acid (36 mL) in Acetic acid (84 mL) dropwise over 2 hours. The resulting reaction was warmed to room temperature and stirred vigorously at this temperature for 4.5 hours. The reaction mixture was filtered and the collected solids were washed with water (100 mL), then recrystallized from EtOH (1.4 L) to provide Compound Int-17c as an off-white solid (58.5 g, 83%), which was used without further purification. ¾ MR (DMSO-i ) δ 8.95 (br s, 1 H), 8.46 (d, J= 9.0 Hz, IH), 8.00 (s, IH), 7.92-7.87 (m, 2H), 7.72-7.67 (m, IH), 2.28 (s, 3H).
Step D - Synth
Figure imgf000127_0002
Int 17c Int-17d
To a solution of Compound Int-17c (58.5 g, 189 mmol) in MeOH (150 mL) was added 6 N HCl (150 mL) and the resulting reaction was heated to 75 °C and allowed to stir at this temperature for 6 hours, then cooled to room temperature. The reaction mixture was filtered and the collected solids were rinsed with water (100 mL) and dried in vacuo at 55 °C for 2 hours to provide Compound Int-17d as a yellow solid (47.9 g, 95%), which was used without further purification. Ή NMR (DMSO-rf6) δ 8.45 (d, J= 9.6 Hz, IH), 8.09- 8.00 (m, 3H), 7.84 (d, J= 9.6 Hz, IH), 7.73-7.67 (m, IH), 7.21 (d, J= 9.6 Hz, IH), 3.33 (br s, IH). Step E - Synthe
Figure imgf000127_0003
Int-17d lnt-17e IN2010.71 18
127
To a solution of Compound Int-17d (47.9 g, 179 mmol) and ammonium chloride (14.4 g, 269 mmol) in water (100 mL) and THF (250 mL) was added iron powder (50 g, 895 mmol). The resulting reaction was heated to 60 °C and allowed to stir vigorously at this temperature for 3 hours, then cooled to room temperature. The reaction mixture was filtered through a Celite® pad and rinsed with MeOH until the Celite was colorless. The combined filtrate and rinsings were concentrated in vacuo and the resulting residue was purified immediately on a silica gel plug (17 cm L x 14 cm W) eluting with 1%
MeOH/CH2CI2 (7 L) to provide Compound Int-17e as a brown solid (40.5 g, 95%). Ή NM (DMSO- ) δ 7.85-7.79 (m, 2H), 7.32-7.29 (m, 1H), 7.03-6.96 (m, 2H), 4.86 (br s, 4H). LRMS: (M+H)+ = 238.
Step F - Synthesis of Intermediate Compound lnt-17f
Figure imgf000128_0001
Int 17e Int-17f To a solution of Compound Int-17e (40.5 g, 1 1 mmol), iV-Boc-proline (45.0 g, 209 mmol) and diisopropylethylamine (90 mL, 517 mmol) in anhydrous DMF (1 L) at 0 °C was added HATU (78 g, 205 mmol). The resulting reaction was warmed to room temperature then allowed to stir at this temperature for 9 hours. Water (1.5 L) was added to the reaction mixture and the resulting solution was extracted with MTBE (3 x 1.5 L). The combined organic extracts were washed with brine (3 x 1 L), dried over Na2SC>4, filtered and concentrated in vacuo. The resulting residue was dissolved in MeOH (75 mL) and water (1.5 L) was added. The resulting heterogeneous mixture was allowed to stir vigorously for 2 hours, then filtered. The filter cake was washed with water (1 L) and dried in vacuo at 55 °C to provide Compound Int-17f as an off-white solid (66.5 g, 90%), which was used without further purification. Ή NMR (DMSO-rf6) δ 9.45-9.42 (m, 1H), 8.12-8.09 (m, 1H), 8.00 (s, 1H), 7.52-7.47 (m, 1H), 7.36-7.33 (m, 1H), 7.19-7.08 (m, 1H), 5.58 (s, 1H), 5.45 (s, 1H), 4.35-4.21 (m, 1H), 3.45-3.31 (m, 2H), 2.33-2.13 (m, 1H), 2.0-1.75 (m, 3H), 1.46- 1.38 (m, 9H).
Step G - Synthesis of Intermediate Compound Int-17 IN2010.7118
128
Figure imgf000129_0001
Int 17f Int-17
A solution of Compound Int-17f (66.5 g, 153 mmol) and Acetic acid (500 mL) was heated to 60 °C and allowed to stir at this temperature for 1 hour. The reaction mixture was cooled to room temperature, water (1 L) was added and the mixture was adjusted to pH 8 using solid sodium carbonate. The aqueous mixture was extracted with CH2CI2 (2 * 1 L) and the combined organic extracts were dried over Na2S<¾, filtered and concentrated in vacuo to provide Compound Int-17 as a crude brown solid (63.7 g, quant), which was used without further purification. ¾ NMR (DMSO- ) 8 13.0-12.5 (m, IH), 8.34 (d, J= 9.0 Hz, IH), 8.25-8.23 (m, IH), 7.78-7.60 (m, 3H), 5.11-4.93 (m, IH), 3.70-3.56 (m, IH), 3.51- 3.39 (m, IH), 2.45-2.24 (m, IH), 2.13-1.85 (m, 3H), 1.49-0.95 (m, 9H). LRMS: (M+H)+ = 416.
Compound Int-17g was prepared from N-BOC-trans-fluoro-L-proline, using the method described above.
Figure imgf000129_0002
Int-17g
Compound Int-17h was prepared from N-Boc-4,4-difluoro-L-proline, using the method described above.
Figure imgf000129_0003
Int-17h
Compound Int-17i was prepared from BOC-HYP-OH, using the method described above. IN2010.7118
129
Figure imgf000130_0001
Int-17i Compound Int-17j was prepared from L-pipecolic acid, using the method described above.
Figure imgf000130_0002
Int-17j
Compound Int-17k was prepared from 2S-carboxy moφholine, using the method described above.
Figure imgf000130_0003
Int-17k
Compound Int-171 was prepared from (1R, 3S, 4S)-N-BOC-2-azabicyclo[2.2.1]- heptane-3-carboxylic acid, using the method described above.
Figure imgf000130_0004
Int-171
Compound Int-17m was prepared from 2(S)-azabicyclo[2.2.2]-octane-2,3- dicarboxylic acid 2-tert-butyl ester, using the method described above. IN2010.71 18
130
Figure imgf000131_0001
Int-17m
Example 18
of Intermediate Compound Int-18
Figure imgf000131_0002
Int-17 Int-18
To a solution of Compound Int-17 (21 g, 50.4 mmol), bis(pinacolato)diboron (14.1 g, 55.5 mmol) and KOAc (7.5 g, 76.4 mmol) in 1,4-dioxane (20 mL) was added a premixed solution of Pd(dba)2 (1.16 g, 2.01 mmol) and tricyclohexylphosphine (1.14 g, 4.06 mmol) in 1,4-dioxane (10 mL). The resulting reaction was heated to 100 °C and allowed to stir at this temperature for 4 hours, then cooled to room temperature. The reaction mixture was filtered through Celite, and the Celite was rinsed with CH2CI2 (100 mL) and the combined filtrate and washing was concentrated in vacuo. The resulting residue was purified using flash chromatography on an ISCO 330 g Redi-Sep column using a gradient of 0-70% EtOAc/hexanes as eluent to provide Compound Int-18 as a yellow solid (19 g, 82%). ¾ NMR (DMSO- ) δ 13.0-12.5 (m, 1H), 8.40-8.36 (m, 2H), 7.84-7.63 (m, 3H), 5.13-4.93 (m, 1H), 3.73-3.57 (m, 1H), 3.51-3.41 (m, 1H), 2.44-2.25 (m, 1H), 2.18-1.95 (m, 3H), 1.40-1.02 (m, 21H). LRMS: (M+H)+ = 464.
EXAMPLE 19
Preparation of Intermediate Compound Int-19e
Step A— Synthesis of Intermediate Compound Int-19a
Figure imgf000131_0003
IN2010.7118
131
Int-19a
To a solution of 50% palladium on carbon (10% wet, 250 mg) in absolute ethanol (100 mL) under nitrogen atmosphere, was added 5-amino-6-nitroquinoline (5.00 g, 26.4 mmol). With stirring, the solution was placed in vacuo for 30 seconds and then was put under ¾ atmosphere using a hydrogen gas-filled balloon. The reaction was allowed to stir for 2 hours, then the reaction flask was evacuated in vacuo and placed under nitrogen atmosphere. The reaction mixture was then sonicated for 10 minutes and methanol (50 mL) was added. The resulting solution was then placed under ¾ atmosphere again and allowed to stir for 2 hours. After evacuating the flask of hydrogen, the reaction mixture was filtered through a Celite pad and the pad was washed with methanol (2 x 200 mL). The combined filtrate and washings were concentrated in vacuo and the resulting residue was dissolved in CH2CI2 (75 mL). The resulting solution was purified using an ISCO 330-g Redi-Sep column (0-10% methanol/CfibCla as eluent) to provide Compound Int-19a as a yellow solid (3.76 g, 89%).
Step B - Synthesis of Intermediate Compound Int-19b
Figure imgf000132_0001
Int-19b
To a solution of Compound Int-19a (1.00 g, 6.28 mmol), HATU (2.63 g, 6.91 mmol) and diisopropylethylamine (3.28 mL, 18.8 mmol) in anhydrous DMF (20 mL) was added Boc-Pro-OH (1.49 g, 6.91 mmol). The resulting reaction was placed under nitrogen atmosphere and was allowed to stir at room temperature for 17 hours. The reaction mixture was then partitioned between EtOAc (100 mL) and saturated aqueous NaCl solution (100 mL). The aqueous layer was extracted with EtOAc (4 χ 100 mL) and the combined organic extracts were washed with brine (4 x 100 mL). The resulting solution was dried over Na2SC> , filtered and concentrated in vacuo. The resulting residue was dissolved in CH2CI2 (10 mL) and was purified via chromatography using an ISCO 80-g Redi-Sep column (0-5% methanol/CH2Cl2 as eluent) to provide Compound Int-19b as an orange oil (0.713 g, 32%). ESI-LRMS: (M+H-C4H902)+ = 257. IN2010.7118
132
Step C - Synthesis of Intermediate Compound Int-19c
Figure imgf000133_0001
Int-19c A solution of compound Int-19b (3.00 g, 8.41 mmol) in CH3COOH (70 mL) was places under nitrogen atmosphere, heated to reflux and allowed to stir at this temperature for 18 hours. The reaction mixture was cooled to room temperature, then was concentrated in vacuo. The oily residue obtained was diluted with CH2CI2 and the solution was neutralized using saturated aqueous NaHCC>3 solution (125 mL). The resulting biphasic mixture was allowed to stir for 1 hour and then separated. The aqueous layer was extracted with CH2CI2 (2 x 200 mL) and the combined organic extracts were concentrated in vacuo to provide Compound Int-19c as an orange foam (2.04 g, 86%), which was used without further purification. Ή NMR (CDC13) δ 11.61 (br s, 0.32H), 11.04 (br s, 0.68H), 8.93-8.85 (m, 1.68 H), 8.38-8.30 (m, 0.32H), 8.08-7.70 (m, 2H), 7.53-7.40 (m, 1H), 5.51-5.43 (m, 1H), 3.64-3.51 (m, 2H), 3.34-3.13 (m, 1H), 2.51-2.11 (m, 6H). LCMS: (M+H)+ = 281.
Step D - Synthesis of Intermediate
Figure imgf000133_0002
Int-19d
To a 0 °C solution of Compound Int-19c (2.03 g, 7.24 mmol) in CH2C12 (75 mL) under nitrogen, was added 3-chloroperoxybenzoic acid (1.50 g, 8.69 mmol). The resulting reaction was allowed to warm to room temperature while stirring for 18 hours, then the reaction mixture was cooled to 0 °C and quenched by adding 10% Na2S(¾ solution (25 mL). The organic solvent was removed in vacuo and the remaining aqueous solution was directly purified using an ISCO 80 g Redi-Sep column (0-10% CH3OH/CH2CI2 as the eluent) to provide a bright yellow foam product. This material underwent a second flash chromatography purification using an ISCO 80 g Redi-Sep column (0-10% CH3OH/CH2CI2 as the eluent) to provide Compound Int-19d as a light yellow foam (1.85 g, 86%). ¾ NMR (CDCI3) δ 11.69 (br s, 0.17H), 11.12 (br s, 0.83H), 8.59-8.38 (m, 2.83H), 8.04-7.96 (d, J= IN2010.7118
133
9.5 Hz, 0.17H), 7.88-7.81 (d, J = 8.2 Hz, 0.17H), 7.75-7.67 (d, J= 9.4 Hz, 0.83H), 7.36- 7.23 (m, 1H), 5.43-5.34 (m, 1H), 3.56-3.48 (m, 2H), 3.24-3.06 (m, 1H), 2.43-2.06 (m, 6H). Step E— Synthesis of Intermediate Compound Int-19e
Figure imgf000134_0001
Int-19e
A solution of Compound Iiit-19d (1.84 g, 6.20 mmol) in CH2C12 (20 mL) was placed under nitrogen atmosphere, cooled to 0 °C, and to the resulting cooled solution was added triethylamine (1.04 mL, 7.45 mmol). The resulting reaction was allowed to stir for 10 minutes, then a solution of phosphoryl chloride (1.14 g, 7.45 mmol) in CH2CI2 (10 mL) was added dropwise over 10 minutes. The reaction was allowed to stir for an additional 1.75 hours at 0 °C then was quenched by the dropwise addition of water (3.0 mL). The resulting reaction mixture was neutralized to pH 7 using 2N NaOH (~ 15 mL), then loaded directly onto a 120 g Redi-Sep column and purified using 0-10% CH3OH/CH2CI2 as the eluent to provide a yellow solid product. The yellow solid product (containing both isomers of Compound Int-19e) was then separated into individual isomers using semi-preparative HPLC (Luna CI 8, CH3CN/water with 0.05% TFA). The isomerically clean fractions were combined with saturated NaHC03 solution (10 mL) and the organic solvent was removed in vacuo. The remaining aqueous portion was extracted with EtOAc (3 x 100 mL) and the combined organic extracts were dried over Na2S0 , filtered and concentrated in vacuo. The resulting residue was dissolved in a mixture of CH3CN and water and the solution was freeze-dried for about 15 hours to provide Compound Int-19e as an off-white solid (463 mg, 23%). Ή NMR (CDC13) δ 11.10 (br s, 1H), 8.87 (br s, 1H), 7.89-7.68 (m, 2H), 7.53- 7.42 (d, J= 8.6 Hz, 1H), 5.52-5.40 (d, J= 8.0 Hz, 1H), 3.69-3.53 (m, 2H), 3.26 (br s, 1H), 2.52-2.11 (m, 6H).
EXAMPLE 20
Preparation of Intermediate Compound Int-20c
Step A - Synthesis of Intermediate Compound Int-20b IN2010.7118
134
Figure imgf000135_0001
Int-20a Int-20b
To a solution of Int-20a (6.1 g, 32.7 mmol), N-acetyl-L-proline (5.4g, 34.35 mmol) and HATU (13.7 g, 34.35 mmol) in anhydrous DMF (100 mL) was added
diisopropylethylamine (16.91 mL, 96.9 mmol) dropwise over 15 minutes at ice temperature The reaction was warmed to room temperature and allowed to stir for 3 hours. The reaction was then diluted with EtOAc (500 mL) and the organic layer washed with water (200 mLx 2). The aqueous layer was back-extracted with EtOAc (100 mLx 2). The combined organic layers were washed with brine, dried over MgS(¼, filtered and concentrated in vacuo. The crude product was purified using flash chromatography using a 1 % -2 % MeOH/CFkCL; as eluent to provide the intermediate amide (4.1 g). The amide was dissolved in glacial acetic acid and was heated at 60 - 70 °C for 1 hour. The reaction mixture was diluted with EtOAc (100 mL) and cooled in ice bath. Saturated Na2C<¾ solution was added slowly until the pH = 8. The organic layer was separated and the aqueous layer was extracted with EtOAc (250 mLx 2). The combined organic layers were washed with water and brine, dried over MgS0 , filtered and concentrated in vacuo to provide Compound Int-20b (3.75g, 38 %). LCMS: M+ = 308
Step B -
Figure imgf000135_0002
Int-20b Int-20c
Int-20b (925 mg, 3 mmol), (Pinacol)2B2 (1.6g, 6.3 mmol), Pd(PPh3)4 (174 mg, 0.15 mmol), potassium acetate (736 mg, 7.5 mmol) and 1,4-dioxane (100 mL) were added to 350 mL pressure vessel. The resulting mixture was degassed, purged with nitrogen and allowed to stir at 80 °C for 17 hours. After the reaction was cooled to room temperature the solution was diluted with CH2CI2 (300 mL) and filtered through a celite plug. The filtrate was washed with NaH(X solution (50 mL) and water (50 mL). The combined organic layers were washed with brine, dried over MgS04, filtered and concentrated in vacuo. The crude IN2010.7118
135
product was purified using flash chromatography using a 0 -5 %MeOH/CH2C¾ as eluent to provide Compound Int-20c (750 mg, 70 %, contains some pinacol). MS: MH+ = 356.2; ¾ NM (500 MHz, CD3OD): δ 8.1-7.4 (m, 3H), 5.3 (m,lH), 3.9 (m, 1H), 3.7(m, 1H), 2.4 (m, 1H), 2.0-2.2 (m, 6H), 1.39(bs, 12H).
Example 21
Figure imgf000136_0001
lnt-21d Step A - Synthesis of Intermediate Compound Int-21c
A solution of Compound Int-21a (7.35g, 39.3 mmol), Compound Int-21b (9.88 g, 39.3 mmol) and diisopropylethylamine (10 mL, 57.5 mmol) in DMF (40 mL) was cooled to 0 °C. HATU (15.0 g, 39.45 mmol) was added slowly to the cooled solution and the resulting reaction was allowed to warm to room temperature on its own, then stirred at room temperature for 1 hours. The reaction mixture was then diluted with ethyl acetate (300 mL) and washed with brine (3 x 100 mL), and the organic phase was dried over sodium sulfate, filtered and concentrated in vacuo. The residure obtained was purified using a 330 g ISCO silica column (0-5% methanol in dichlorotnethane as eluent) to provide Compound Int-21c as abrown gel (15.1 g, 91%).
Step B— Synthesis of Intermediate Compound Int-21d
Compound Int-21c (15.1 g, 35.9 mmol) was dissolved in acetic acid (50 mL) in a 500 mL flask. The resulting solution was heated to 60 °C and allowed to stir at this temperature for 4 hours, then cooled to room temperature and concentrated in vacuo. The resulting residue was dissolved in dichloromethane (200 mL), dried (sodium sulfate and IN2010.7118
136
sodium carbonate), filtered and concentrated in vacuo to provide Compound Int-21d as a brown solid (1 1.Og, 76%), which was used without further purification. LCMS anal, calcd. for: Ci6H,8BrF2N302 401.1; Found: 402.2 (M+H)+.
Example 22
Preparation of Intermediate Compound Int-22c
Figure imgf000137_0001
lnt-21a lnt-22a !nt-22b
Figure imgf000137_0002
lnt-22c Step A - Synthesis of Intermediate Compound Int-22b
Using the method described in Example 21, Step A, Compounds Int-21a and Int- 22a were coupled to provide Compound Int-22b as abrown gel (12.5 g, 81%).
Step B - Synthesis of Intermediate Compound Int-22c
Using the method described in Example 29, Step B, Compound Int-22b was converted to Compound Int-22c as a brown solid (11.20g, 93%), which was used without purification.
EXAMPLE 23
Preparation of Intermediate Compound Int-23e
ΙΝ2010.7Π8
137
Figure imgf000138_0001
lnt-23e
Step A - Synthesis of Intermediate Compound Int-23c
A 5 L- 3 necked round bottomed flask, equipped with a mechanical stirrer, temperature probe, addition funnel and N2 inlet, was charged with the Schollkopf chiral auxiliary-(Int-23a, 200 g, 1.09 mol, 1.0 eq), bis(chloromethyl) dimethylsilane (Int-23b, 256 g, 1.63 mol, 1.5 eq), and THF (2 L, Aldrich anhydrous). The flask was cooled in a dry ice/ 2-propanol bath until the internal temperature reached -75 °C. n-Butyl lithium (Aldrich 2.5 M in hexanes , 478 mL, 1.19 mol, 1.09 eq) was added via a dropping funnel over 1 hour while maintaining the internal reaction temperature between -67 °C and -76 °C. The resulting orange-red solution was allowed to gradually warm to room temperature for about 15 hours. The reaction mixture was then re-cooled to 0 °C and quenched with 500 mL of water. Diethyl ether (2L) was added and the layers were separated. The aqueous layer was extracted with 1 L of diethyl ether. The combined organic layers was washed with water and brine, dried with MgS04, filtered, and concentrated in vacuo to provide 480 g of an orange oil. This material was left under vacuum for about 15 hours to provide 420 g of oil (mixture of Int-23c and Int-23c')- The crude product was split into two batches and purified via silica gel chromatography on a 1.6 Kg flash column. The column was eluted with gradient of 0-4% EtjO in hexanes. The product fractions were concentrated in vacuo at a bath temperature at or below 40 °C to provide 190 grams of Compound Int-25c-(60% yield).
Step B - Synthesis of Intermediate Compound Int-23d IN2010.7118
138
A 5 L, 3 -necked round bottomed flask equipped with a mechanical stirrer, addition funnel, temperature probe, external water bath and N2 inlet was charged with compound Int-23c (196 g, 0.643 mol, 1.0 eq) and methanol (1.5 L). Aqueous HC1 (500 mL of 10% by volume) was added at room temperature over 30 minutes, with a mild exotherm observed. 5 The temperature increased to 37 °C then dropped back down. The reaction mixture was allowed to stir at room temperature for 3 hours and was monitored by TLC and LCMS. The reaction mixture was then concentrated in vacuo to an oil. Additional methanol (3 x 200 mL) was added and the reaction mixture was concentrated in vacuo again. The resulting crude product was dried under house vacuum for about 15 hours. The crude product was
10 then dissolved in CH2C12 (750 mL) and Et20 (1250 mL) and sodium iodide (96.4 g, 0.643 mol, 1.0 eq) was added. Diisopropylethylamine (336 mL, 1.929 mol, 3.0 eq) was added slowly over 25 minutes with efficient stirring, causing the temperature to increase to 35 °C then decrease again. The reaction mixture was allowed to stir at room temperature for 2 hours, at which time the MS of an aliquot indicated consumption of the starting material.
15 The reaction mixture was allowed to stir for an additional 2 hours and then Boc-anhydride (281 g, 1.286 mol, 2.0 eq) was added. The reaction mixture was then allowed to stir at room temperature/. After two days, the reaction mixture was diluted with EtOAc (2 L) and water (1 L), and he layers were separated. The aqueous phase was extracted with 500 mL of EtOAc. The combined organic layers were washed with water (500 mL), and brine (500
20 mL), dried with MgSQ*, filtered, and concentrated in vacuo to a yellow oil (380 g). The crude product was split into two 180 g portions for convenience and each portion was purified via flash silica gel chromatography. Column conditions for a 180 g portion of crude product are as follows. The 180 gram sample of crude product was loaded onto a 191 g Si02 cartridge and purified on a 1.5 Kg Si<¾ column. The column was eluted using a 0%-
25 20% EtOAc hexanes gradient as the mobile phase to provide 52 grams of pure Int-23d and additional fractions of Int-23d that contained a small amount of a Boc- valine impurity. The impure fractions from the two columns were recombined and re-purified. After chromatography, compound Int-23d was obtained as an oil which solidified to a white solid on standing (128 g, 65% yield over the three steps.)
Step C - Synthesis of Intermediate Compound Int-23e
A solution of Int-23d (8.5g, 31.1 mmol) in methanol (100 mL) and 1.0 M aqueous KOH solution (48 mL, 48 mmol) was allowed to stir at room temperature for about 15 IN2010.7118
139
hours, neutralized with 48 ml of 1.0 M aqueous HCl solution to pH ~5, and concentrated in vacuo to an oil. The resulting residue was extracted with dichloromethane (2 x 100 mL) and the combined organic layers were concentrated in vacuo to provide Compound Int-23e as a gel (7.74 g, 96%). Chirai purity was determined using a Chiralcell AD-H column, SFC mode, C02/ MeOH 90/10.
EXAMPLE 24
Preparation of Intermediate Compound Int-24g lnt-24a lnt-24b
Figure imgf000140_0001
lnt-24e lnt-24f lnt-24g
Step A - Synthesis of Intermediate Compound Int-24a
Mercuric acetate (14.3 g, 44.8 mmol) was dissolved in water (45 mL), and THF (45 mL) was added. To this yellow solution at room temperature was added (chloromethyl)- dimethylvinylsilane (5.65 g, 41.9 mmol) which became homogeneous in 30 seconds. The resulting solution was allowed to stir for 5 minutes, then aqueous NaOH (3M, 45 mL) was added, followed by a solution (45 mL) of NaBH4 (0.5M) in 3M NaOH. Diethyl ether (160 mL) was added and the mixture stirred at room temperature for and additional 1 hr. The mixture was then saturated with NaCl and the layers separated. The organic layer was washed with brine (100 mL), dried with N 2S04, and concentrated in vacuo to provide Compound Int-24a as a colorless oil (5.72 g, 89%). Ή NMR (CDC13) δ 3.84-3.75 (m, 2H), 2.81 (s, 2H), 1.34-1.31 (m, 1H), 1.10-1.05 (m, 2H), 0.148 (s, 6H).
Step B - Synthesis of Intermediate Compound Int-24b IN2010.7118
140
To a solution of Int-24a (5.72 g, 37.4 mniol) in CH2C12 (50 mL) was added imidazole (3.82 g, 56.1 mmol). The mixture was allowed to stir at 0 °C and tert- butyldimethylsilyl chloride (8.46 g, 56.1 mmol) was slowly added over 10 minutes and the reaction mixture was warmed to room temperature and stirred for about 15 hours. Water (50 mL) was added and the layers separated. The aqueous layer was extracted with (¾<¾ (3 30 mL) and the combined organic layers were dried over NaiSO.*, filtered and concentrated in vacuo at 80 °C to remove residual iert-butyldimethylsilyl chloride and afford the desired product Int-24b as a colorless oil (9.82 g, 98%). Ή NMR (CDC¾) δ 3.75 (t, J = 7.4 Hz, 2H), 2.78 (s, 2H), 0.99 (t, = 7.4 Hz, 2H), 0.87 (s, 9H), 0.011 (s, 6H), 0.02 (s, 6H).
Step C - Synthesis of Intermediate Compound lnt-24c
To a solution of (ii)-2-isopropyl-3,6-dimethoxy-2,5-dihydropyrazine (6.16 g, 33.4 mmol) in THF (60 mL) was added TB AI (61 mg, 1.67 mmol). The mixture was cooled to -78 °C and a solution of »-BuLi (14.7 mL, 2.5M in hexanes, 36.75 mmol) was slowly added over 10 minutes. The reaction mixture was allowed to stir at -78 °C for 30 minutes, then Int-24b in THF (20 mL) was slowly added over 10 minutes. The reaction was allowed to stir at -78 °C for 2 hours then allowed to warmed to room temperature and stirred for about 15 hours. The reaction was quenched by addition of MeOH (5 mL), concentrated in vacuo, water added (50 mL) followed by diethyl ether (50 mL) and the layers were separated. The organic layer was washed with water (2 x 50 mL) then dried over Na2SC>4, filtered and concentrated in vacuo to provide the crude product. Further purification by column chromatograpy on a 330 g ISCO Redi-Sep silica gel column using a eluent of CH2CI2 with a gradient of 0-10% EtOAc/hexanes afforded the desired product Int-24c as a light amber oil (8.65 g, 63%). Ή NMR (CDCI3) δ 4.07-3.99 (m, 1H), 3.94-3.89 (m, 1H), 3.79-3.71 (m, 2H), 3.68-3.63 (m, 6H), 2.32-2.17 (m, 1H), 1.25-1.21 (m, 1H), 1.06-0.95 (m, 5H), 0.88 (s, 10H), 0.74-0.68 (m, 1H), 0.69-0.66 (m, 2H), 0.12-0.02 (m, 12H).
Step D - Synthesis of Intermediate Compound Int-24d
To a THF solution (60 mL) of Int-24c (8.65 g, 20.8 mmol) cooled to 0 °C was slowly added a solution of tetrabutylammonium fluoride (31.3 mL, 1 ,0M in THF, 31.0 mmol) over 5 minutes. The reaction mixture was allowed to warm to room temperature for about 15 hours with stirring. The reaction was then concentrated in vacuo, and the crude IN2010.7118
141
product chromatographed on a 120 g ISCO Redi-Sep silica gel column using a CH2CI2 with gradient of 0-3% MeOH/CH2C¾ as the eluent to provide Compound lnt-24d as a colorless oil (4.69 g, 99%). Ή NMR (CDC13) δ. 4.15-4.05 (m, 1H), 3.98-3.91 (m, 1H), 3.84-3.73 (m, 2H), 3.69 (s, 6H), 2.39-2.32 (m, 1H), 2.30-2.18 (m, 1H), 1.37-1.29 (m, 1H), 1.10-1.01 (m, 5H), 0.93-0.85 (m, 2H), 0.74-0.68 (m, 2H), 0.14-0.08 (m, 6H).
Step F - Synthesis of Intermediate Compound Int-24e
To a Et20 (30 mL) solution of Int-24d (2.12 g, 267 mmol) was added pyridine (720 μί, 8.82 mmol). The mixture was cooled to 0 °C and thionyl chloride (575 μί, 7.90 mmol) in Et20 (2 mL) was slowly added over 5 minutes. The reaction mixture was allowed to warm to room temperature for about 15 hours with stirring. The reaction mixture was filtered and the filtrate concentrated in vacuo to provide the crude product. Further purification by column chromatography using a 80 g ISCO Redi-Sep silica gel column with CH2CI2 and a gradient of 0-3% MeOH as the eluent afforded the desired product Int-24e as an amber oil (417 mg, 16%). Ή NMR (CDCI3) δ 4.22-3.62 (m, 7H), 2.50-2.13 (m, 4H), 1.58-1.41 (m, 1H), 1.32-0.65 (m, 9H), 0.24-0.04 (m, 6H).
Step G - Synthesis of Intermediate Compound Int-24f
To a solution of Int-24e (417 mg, 1.40 mmol) in MeOH (10 mL) was added a 10% aqueous HC1 solution (10 mL). The resulting mixture was allowed to stir at room temperature for about 15 hours and concentrated in vacuo. The resulting residue was coevaporated with MeOH (3 x 30 mL) and then dissolved in CH2CJ2 (3 mL) and Et20 (6 mL). To this solution was added diisopropylethylamine (750 μί, 4.30 mmol) and the reaction allowed to stir at room temperature After 7 hours di-i-rf-butyl dicarbonate (703 mg, 3.22 mmol) was added and the reaction was stirred for about 15 hours at room temperature and then concentrated in vacuo. The crude product was further purified using column chromatographed using a 12 g ISCO Redi-Sep silica gel column with CH2CI2 and gradient of 0-50% EtOAc hexanes mixture as the eluent to provide Compound Int-24f as an amber oil (94 mg, 23%). Ή NMR (CDC13) δ 4.22-4.01 (m, 1H), 4.10-3.94 (m, 1H), 3.85- 3.70 (m, 3 H), 2.32-2.09 (m, 1H), 1.44 (s, 7H), 1.24-0.88 (m, 6H), 0.16-0.05 (m, 6H).
Step H- Synthesis of Intermediate Compound Int-24g IN2010.7118
142
To a solution of compound Int-24f (218 mg, 0.758 mmol) in THF (3 mL) was added lithium hydroxide monohydrate (64 mg, 1.52 mmol) in water (3 mL). The reaction mixture was allowed to stir at room temperature for about 15 hours then concentrated in vacuo to half volume. The aqueous mixture was then acidified with IN HCl to pH 4 and extracted with EtOAc (5 x 30 mL). The combined organic layers were dried over Na2SC> , filtered and concentrated in vacuo to provide Compound Int-24g as an off-white solid (157 mg, 87%). Ή NMR (CDC13) δΐ.44 (s, 8H), 1.34-0.78 (m, 9H), 0.17-0.03 (m, 6H).
EXAMPLE 25
Figure imgf000143_0001
Int-25c was prepared from Int-23d using the methods described in Examples 7 and 8. Int-25d was prepared from Int-25c using the methods described in Example 7.
EXAMPLE 26
Preparation of Intermediate Compound Int-26b
Figure imgf000143_0002
Step A— Synthesis of Intermediate Compound Int-26a
Int-9a (Aldrich, 9.0 g, 32.4 mmol) and Int-23d (7.74 g, 29.85 mmol) were dissolved in DMF (50 mL). Triethylamine (10 mL, 71.83 mmol) was then added slowly at room temperature and the mixture was stirred for about 15 hours. Ethyl acetate (500 mL) was added, and the organic layer was washed with brine (3 x 100 mL), dried over sodium IN2010.71 18
143
sulfate, and concentrated in vacuo to an oil. The resulting residue was purified using a 220 g ISCO silica column with gradient of 0-20% ethyl acetate in hexanes as the eluent to provide Compound Int-26a as a gel (12.3 g, 83%).
5 Step B - Synthesis of Intermediate Compound Int-26b
A 350 ml pressure vessel was charged with Int-26a (12.3 g, 26.96 mmol), ammonium acetate (18.0 g, 233.7 mmol), xylenes (50 mL), sealed and stirred at 120 °C for two hours. After cooling to room temperature, the suspension was concentrated in vacuo. The resulting residue was dissolved in ethyl acetate (300 mL), washed with water (100 mL) 10 and saturated sodium carbonate solution (100 mL). the combined organic layer was dried over sodium sulfate, and concentrated in vacuo. The resulting residue was further purified using a 330 g ISCO silica column with gradient of 10-50% ethyl acetate in hexanes as an eluent to provide Compound Int-26b as a pale solid (8.5 g, 72%).
15 EXAMPLE 27
Figure imgf000144_0001
Step A - Synthesis of Intermediate Compound Int-27 a
A 100 mL round bottomed flask was charged with In t-17e (2.7g, 11.4 mmol), Int-
20 25d (2.2 g, 7.77 mmol), anhydrous THF, and diisopropylethylamine (2 mL, 15 mmol), and cooled to 0 °C. HATU (3.0 g, 7.89 mmol) was then added and the resulting reaction was allowed to stir at 0 °C for 6.5 hours, during which time the reaction warmed to room temperature, and then the reaction mixture was diluted with water (150 mL). After filtration, the crude solid was purified using a 330 g ISCO silica column on Combi-Flash IN2010.7118
144
system (eluted with 0-5% methanol in dichloromethane) to provide Compound Int-27a as a foam (3.55 g, 96%).
Step B - Synthesis of Intermediate Compound Int-27b
A mixture of Int-27a (2.0 g, 4.18 mmol) and acetic acid (20 mL) was allowed to stir at 60 °C for 5 hours and was then cooled to room temperature. The acetic acid was then removed in vacuo and the resulting residue was purified using a 120 g ISCO silica column on Combi-FIash RF system (0-5% methanol in dichloromethane) to provide Compound Int- 27b as a solid (1.56g, 81%).
EXAMPLE 28
Figure imgf000145_0001
Step A - Synthesis of Intermediate Compound Int-28a
A 200 mL flask was charged with boronic acid Int-18 (0.55 g, 1.19 mmol), bromide Int-26b (0.35 g, 0.80 mmol), PdCk'dppf-dichloromethane complex (65 mg, 0.08 mmol), a solution of sodium carbonate (1.5M, 1.0 mL, 1.5 mmol), and 1,4-dioxane (10 mL). The resulting mixture was degassed and refluxed at approximately 80 °C under nitrogen atmosphere for about 15 hours. The reaction was then cooled and concentrated in vacuo to provide crude product as an oil. Further purification was accomplished using a 80 g ISCO I 2010.7118
145
silica column on Combi-Flash RF system with a gradient of 0-4% methanol in dichloromethane as the eluent to provide Compound Int-28a as a pale foam (320 mg, 58%). LCMS anal, calcd. For:
Figure imgf000146_0001
692.4; Found: 693.4 (M+H)+. Step B - Synthesis of Intermediate Compound Int-28b
Compound Int-28a (320 mg, 0.462 mmol) was dissolved in dichloromethane (3 mL) and trifluoroacetic acid (3 mL) was added. The resulting solution was allowed to stir at room temperature for 5 hours and then concentrated in vacuo to provide Compound Int-28b as a solid (225 mg), which was used for the next reaction without purification.
Step C - Synthesis of Compound 2
A 100 mL flask was charged with diamine Int-28b (225 mg, ~0.46 mmol), acid Int- la (200 mg, 1.14 mmol), diisopropylethylarnine (0.5 mL, 3.75 mmol), DMF (5 mL) and cooled to 0 °C. HATU (435 mg, 1.14 mmol) was then added and the resulting solution was allowed to warm to room temperature After 2.5 hours the reaction was partially concentrated in vacuo and purified using reverse phase chromatography (0-90% acetonitrile in water with 0.1 % TFA as an eluent) provided Compound 2 as a white solid (180 mg, 49%). LCMS anal, calcd. for: C43H54N806Si 806.4 ; Found: 807.4 (M+H)+.
The compounds set forth in the table below were made using the method described above and substituting the appropriate reactants and reagents:
Compoun Compoun
MS MS
d d
(M+H) (M+H)
No. No.
938.2
1 808.3 86
946.2
15 833.4 87
914.2
16 833.4 88
870.1
55 825.2 89
834.1
56 843.3 90 IN2010.7118
146
Figure imgf000147_0001
EXAMPLE 29
Preparation of Compound 54 IN2010.7118
147
Figure imgf000148_0001
Step A - Synthesis of Intermediate Compound Int-29a
A mixture of Int-17h (9.54 g, 21.1 rnrnol), bis(pinacolato)diboron (5.89 g, 23.2 mmol), PdCl2(dppf) (1.54 g, 2.11 mmol) and potassium acetate (6.21 g, 63.3 mmol) in dioxane (120 mL) in a sealed tube was degassed via alternate vacuum and argon flushes. The reaction was then heated to 100 °C and allowed to stir at this temperature for about 4 hours. The reaction mixture was cooled to room temperature and diluted with EtOAc (200 mL), filtered through Celite®, and the collected solide were washed with EtOAc until the filtrate was colorless. The layers were separated and the organic phase was washed sequentially with saturated aqueous NaHC<¾ (2 x 25 mL) and saturated aqueous NaCl (3 x 25 mL), dried over a2S04, filtered and concentrated in vacuo. The resulting residue (16.3 g) was taken up in (¾(¾ and purified using flash chromatography on an ISCO 330-g edi-Sep column using 0-30% EtOAc/hexanes then 30% EtOAc/hexanes as the eluent to provide Compound Int-29a (9.02 g, 85%) as a light brown solid. ESI-LCMS 2.14 min; [M+H]+ = 500. Ή NMR (CDC13): δ 11.33 (br s, 0.32H), 10.79 (br s, 0.48H), 8.58 (d, /= 8.1 Hz, 0.60H), 8.45 (d, J= 6.6 Hz, 1H), 7,99 (dd, J= 8.4, 0.6 Hz, 0.60H), 7.93 (s, 0.80H), 7.82 (d, J= 9.0 Hz, 0.52H), 7.75-7.68 (m, 1H), 7.55 (d, J= 8.7 Hz, 0.60H), 5.45-5.38 (m, 1H), 4.08-3.60 (m, 3H), 3.00-2.80 (m, 1H), 1.51 (s, 9H), 1.40 (s, 12H).
Step B - Synthesis of Intermediate Compound Int-29b 7
IN2010.7118
148
A mechanically stirred mixture ofInt-29a (9.25 g, 18.5 mmol), Int-26b (8.89 g,
20.3 mmol), PdCl2(dppf) (2.03 g, 2.78 mmol) and sodium carbonate (5.89 g, 55.6 mmol) in
1 :2 water/dioxane (600 mL) at room temperature was purged with dry N2 for 10 minutes
then argon gas for 5 minutes. The reaction mixture was then heated to 85 °C and allowed to stir at this temperature for 3 hours. The reaction mixture was cooled to room temperature
then filtered through Celite® and the collected solids were washed with EtOAc until the
filtrate was colorless. The organic layer of the filtrate was separated and washed with
saturated aqueous NaCl (3 x 50 mL), dried over Na2SC>4, filtered and concentrated in vacuo.
The resulting residue (18.8 g) was taken up in C¾ ¾ and purified using flash
chromatography on an ISCO 330-g Redi-Sep column (0-5% MeOH/C¾Cl2 gradient eluent) to provide Compound Int-29b (5.80 g). Compound Int-29b was was further purified via
chromatography using an ISCO 330-g Redi-Sep column (0-100% EtOAc/hexanes) to
provide purified Compound Int-29b (2.81 g, 20%) as an off-white solid. ESI-LCMS 1.70 min; [M+H]"' = 729. Ή NMR (CDC13): δ 11.60-11.40 (m, 0.36H), 11.20-11.00 (m,
0.12H), 10.90-10.40 (m, 0.55H), 10.30-9.90 (m, 0.50H), 8.70-8.58 (m, 1H), 8.20-7.98 (m,
1H), 7.96-7.46 (m, 7H), 7.40-7.28 (m, 0.5H), 7.20-7.08 (m, 0.34 H), 5.65-5.38 (m, 2H),
4.10-3.55 (m, 4H), 3.02-2.80 (m, 2H), 2.55-2.37 (m, 1H), 1.60-1.45 (m, 18H), 1.25-1.15
(m, 1H), 0.56-0.25 (m, 6H). Step C - Synthesis of Compound 54
To a stirred solution of Int-29b (2.80 g, 3.84 mmol) in CH2C12 (24 mL) at room
temperature was added TFA (5 mL) and the resulting solution was allowed to stir at room
temperature for 3 hours. The reaction mixture was then concentrated in vacuo to provide a brown oil intermediate, which was used without further purification. Lyophilization of an
aliquot from 1 :1 MeCN/water (3 mL) at room temperature for 36 hours afforded an off- white solid intermediate. ESI-MS: [M+H]+ = 529. Ή NMR (DMSO-d6): δ 9.35 (br s, 1H),
8.96 (br s, 1H), 8.51 (d, 7= 8.0 Hz, 1H), 8.41 (s, 1H), 8.06 (dd, 7= 8.5, 1.5 Hz, IH), 7.97- 7.87 (m, 5H), 7.82 (d, 9.0 Hz, IH), 7.77 (br s, IH), 5.34 (t, J= 8.5 Hz, IH), 4.69 (d, J=
6.5 Hz, IH), 3.83 (t, = 12.0 Hz, 3H), 3.22-3.09 (m, IH), 3.08-2.93 (m, IH), 1.55 (dd, /=
14.5, 6.5 Hz, IH), 1.21 (dd, /= 14.5, 10.5 Hz, IH), 0.38 (s, 3H), 0.35 (s, 3H).
To a stirred solution of the brown oil intermediate in DMF (60 mL) at 0 °C was
added diisopropylethylamine (6.7 mL, 38.4 mmol). The resulting solution was allowed to
stir at this temperature for 30 minutes, then (5)-2-(methoxycarbonylamino) -3- IN2010.7118
149
methylbutanoic acid (1.48 g, 8.45 mmol) was added and the resulting solution was cooled to -50 °C. HATU (3.28 g, 8.64 mmol) was then added and the resulting reaction was allowed to stir at -50 °C for 15 minutes, then the cooling bath was removed and the reaction was allowed to warmly slowly to room temperature on its own. The reaction was then allowed to stir at room temperature for about 14 hours and diluted with water (500 mL). The reaction mixture was filtered and the collected solid was dried in vacuo to provide a crude product (5.4 g) which was dissolved in CH2CI2 and purified using flash chromatography using an ISCO 330-g Redi-Sep column with a 0-10% methanol/CJHbClz gradient eluent to provide Compound 54 (3.41 g). This compound was further purified using using two ISCO 120-g GOLD Redi-Sep columns with a 0-75% EtOAc/hexanes and then 75%
EtOAc/Hexanes eluent to provide purified Compound 54 (2.25 g) as an off-white solid. ESI-LCMS 1.54 min; [M+H]+ = 843.
Step D - Synthesis of the dihydrochloride salt of Compound 54
To a solution of Compound 54 (2.25 g, 2.67 mmol) in MeOH (24 mL) at room temperature was added 2N HC1 in ether (2.66 mL, 5.33 mmol). The resulting reaction was allowed to stand at room temperature for 5 minutes, then was concentrated in vacuo. The resulting residue was dissolved in a 1 :2 mixture of acetonitrile:water (15 mL) and the resulting solution was lyophilized at room temperature for 72 hours to provide the dihydrochloride salt of Compound 54 as an off-white solid (2.26 g, 64% over 2 steps). ESI- LRMS [M+H]+ 843. Ή NMR (DMSO-<¾: δ 14.76 (br s, IH), 14.35 (br s, IH), 8.70-8.57 (m, IH), 8.52 (s, IH), 8.20-8.07 (m, 2H), 8.07-8.02 (m, 2H), 8.02-7.93 (m, 3H), 7.88-7.80 (m, IH), 7.45 (d, 7= 8.5 Hz, IH), 7.15 (d, J = 8.5 Hz, IH), 5.51 (t, 7= 8.5 Hz, IH), 5.40- 5.29 (m, IH), 4.64-4.45 (m, 2H), 4.42 (t, /= 7.5 Hz, IH), 4.03 (t, J = 8.0 Hz, IH), 3.56 (s, 3H), 3.53 (s, 3H), 3.32-2.97 (m, 5H), 2.20-2.10 (m, IH), 2.00-1.90 (m, IH), 1.65-1.53 (m, IH), 1.25 (dd, J= 15.0, 9.5 Hz, IH), 0.97-0.81 (m, 7H), 0.79 (d, J= 6.5 Hz, 3H), 0.74 (d, J = 6.5 Hz, 3H), 0.39 (s, 3H), 0.28 (s, 3H).
EXAMPLE 30
Preparation of Compound 67 IN2010.7118
150
Figure imgf000151_0001
Int-30a was converted to the Compound 67 using the method described in Example
29.
EXAMPLE 31
Figure imgf000151_0002
69
Step A - Synthesis of Intermediate Compound IntSla
Figure imgf000151_0003
Int-31a
To a solution of dichlorozirconocene (Cp2ZrCl2) (4.2 g, 14.2 mmol) in 40 mL THF at -78 °C was added n-BuLi (1.6 M in hexane, 18 mL, 28.4 mmol). The resulting reaction was allowed to stir for 1 hour at this temperature, then a -78 °C solution of
diphenyldiallylsilane (2 g, 14.2 mmol) in 17 mL of THF was added and the resulting reaction was allowed to stir for 1 hour at -78 °C and for 18 hours at 25 °C. The reaction was cooled to -78 °C and a -78 °C solution of iodine (9 g, 35.5 mmol) in 20 mL THF was added at and the reaction was allowed to stir for 1 hour. The reaction was then quenched with 10% aqueous H2SO4 and the organic phase was extracted with ether. The organic solution was washed sequentially with saturated aqueous NaHCCb solution and brine, dried (Na2SC>4), filtered and concentrated in vacuo. The resulting residue was purified using IN2010.7118
151
ISCO 120 g column (hexane) to provide Compound Int-31a, 2.75 g (49%). ¾ NMR (CDCb) δ 3.44 (dd, J= 2.2, 10.0 Hz, 2H), 3.33 (dd, J= 4.7, 10.0 Hz, 2H), 1.20 (m, 2H), 0.93 (dd, /= 5.9, 14.7 Hz, 2H), 0.63 (dd, J = 11.1, 14.2 Hz, 2H), 0.19 (s, 6H). Step B - Synthesis of Intermediate Compound Int-31b
Figure imgf000152_0001
Int-31b
To a -78 °C solution of (2 )-(-)-2,5-dihydro-3,6-dimethoxy-2-isopropylp)razine (0.61 g, 4.36 mmol) in THF (8 mL) was added n-BuLi (2.5 M in hexane, 1.8 mL, 4.58 mmol). The resulting reaction was allowed to stir for 20 minutes, then Compound Int-31a (2.75 g, 6.98 mmol, in 2 mL of THF) was added and the reaction was allowed to stir at -78 °C for 4 hours. The reaction was quenched with saturated aqueous N¾C1 solution and the organic layers were extiacted with EtOAc. The combined organic solution was washed with brine solution, dried ( ajSCv), filtered and concentrated in vacuo. The resulting residue was purified using an ISCO 40 g column (gradient from 0% to 2.5% ether in hexane) to provide Compound Int-31b, 783 mg (44%). Ή NMR (CDCI3) 6 4.05 (m, 1H), 3.96 (t, = 3.4 Hz, 1H), 3.72 (s, 3H), 3.71 (s, 3H), 3.49 (dd, J= 2,8, 0.4 Hz, 1H), 3.26 (dd, J = 6, 9.4 Hz, 1H), 2.30 (m, 1H), 1.96 (m, 1H), 1.60 (m, 2H), 1.37-1.17 (m, 3H), 1.08 (d, J = 6.9 Hz, 3H), 0.99-0.86 (m, 2H), 0.72 (d, J= 6.6 Hz, 3H), 0.49 (dd, J= 11.0, 14.4 Hz, 1H), 0.35 (dd, J = 1 1.0, 14.2 Hz, 1H), 0.16 (s, 6H).
Step C - Synthesis of Intermediate Com Int-31c
Figure imgf000152_0002
Int-31c
To a 0 °C solution of Compound Int-31b (780 mg, 1.92 mmol) in MeOH (9 mL) was added 10% aqueous HCl (3 mL) and the resulting reaction was allowed to stir at room ΙΝ2010.7Π8
152
temperature for 18 hours. The reaction mixture was concentrated in vacuo and the resulting residue was coevaporated with MeOH twice. The resulting white foam was dissolved in a mixture of ether (6 mL) and CH2CI2 (9 mL), and to the resulting solution was added diisopropylethylamine (1 mL, 5.7 mmol). The resulting reaction was allowed to stir at room temperature for 18 hours, thendi-t-butyl dicarbonate (922 mg, 4.22 mmol) was added and the resulting reaction was allowed to stir at 25 °C for 2 days. The reaction mixture was then poured into cold water and the organic layer was extracted with EtOAc. The combined organic solutions were washed with brine solution, dried (Na2SC>4), filtered and concentrated in vacuo. The the resulting residue was dissolved in MeOH (8 mL), cooled to 0 °C and aqueous 1 M KOH solution (3.3 mL, 3.3 mmol) was added. The resulting reaction was allowed to stir at 25 °C for 1 hour, then the reaction mixture was acidified with 10% aqueous HC1 and the organic layers were extracted with ΟΗ2<¾. The combined organic solution was washed with brine solution, dried (Na2S04), filtered and concentrated in vacuo to provide Compound Int-31c, which was used without further purification.
Step D - Synthesis of Intermediate Compound Int-31d
Figure imgf000153_0001
Int-31d
To a solution of Compound Int-31c (ca 320 mg, ca 1 mmol) in DMF (3 mL) were added triethylamine (0.74 mL, 5.3 mmol) and 2,4'-dibromoacetophenone (673 mg, 2.4 mmol). The resulting reaction was allowed to stir for 2 hours at 25 °C, then the reaction mixture was poured into cold water and the organic layers were extracted with EtOAc. The combined organic solution was washed with brine solution, dried Na2SO<i), filtered and concentrated in vacuo. The resulting residue was purified using an ISCO 80 g column (gradient from 0% to 30% EtOAc in hexane) to provide Compound Int-31d (263 mg, 27% from Compound Int-31b). Ή NMR (CDCI3) δ 7.76 (d, J= 8.5 Hz, 2H), 7.62 (d, J= 8.7 Hz, 2H), 5.50-4.90 (m, 3H), 4.26-4.06 (m, 1H), 3.00-2.45 (m, 2H), 1.75-1.60 (m, 1H), 1.47-1.44 (m, 9H), 1.31-1.13 (m, 3H), 1.00-0.79 (m, 3H), 0.24-0.18 (m, 1H), 0.16-0.12 (m, 6H). LRMS: (M-Boc+H)+= 410. IN2010.7118
153
Step E - Synthesis of Intermediate Compound Int-Sle
Figure imgf000154_0001
To a solution of Compound Int-31d (263 mg, 0.52 mmol) in o-xylene (2 mL) in a pressure vessel was added ammonium acetate (279 mg, 3.6 mmol). The resulting reaction was heated to 140 °C and allowed to stir at this temperature for 1.5 hours, then cooled to 25 °C. The reaction mixture was poured into saturated aqueous NaHC(½ solution and the organic layer was extracted with EtOAc. The combined organic solution was washed with brine solution, dried (Τ½8(¾), filtered and concentrated in vacuo. The resulting residue was purified using an ISCO 40 g column (gradient from 0% to 30% EtOAc in hexane) to provide Compound Int-31e, 170 mg (67%). ¾ NMR (CDC13) δ 7.73-7.20 (m, 4H), 5.50 (br s, 1H), 4.09 (br d, J = 12.5 Hz, lH), 2.94-2.46 (m, 2H), 1.90 (br s, 1H), 1.60-1.47 (m, 9H), 1.31-1.20 (m, 1H), 1.13-1.01 (m, 1H), 0.81 (dd, J = 5.3, 13.8 Hz, 1H), 0.26-0.07 (m, 7H). LRMS: (M+H)+ = 490. Step F - Synthesis of Intermediate Compound IntSlf
Figure imgf000154_0002
To a solution of Compound lnt-31e (170 mg, 0.35 mmol), Compound Int-18 (295 mg, 0.59 mmol) and PdCMdp fh-C Ck complex (29 mg, 0.035 mmol) in 1,4-dioxane (4 mL) was added aqueous 2 M NajCOs solution (0.53 mL, 1.05 mmol). The mixture was degassed, heated to 100 °C and allowed to stir at this temperature for 2.5 hours. The reaction mixture was then cooled to 25 °C, diluted with EtOAc and filtered through a celite pad. The filtrate was concentrated in vacuo and the resulting residue was purified using an ISCO 40 g column (gradient from 0% to 55% EtOAc in hexane) to provide Compound IntSlf (212 mg, 78%). LRMS: (M+H)+ = 783.
Step G - Synthesis of Compound 69 IN2010.7118
154
Figure imgf000155_0001
69
A 0 °C solution of Compound Int-31f (212 mg, 0.27 mmol) in CH2C12(6 mL) was treated with TFA (2 mL) and the resulting reaction was allowed to stir at 25 °C for 4 hours. The reaction mixture was then concentrated in vacuo and the resulting residue was dissolved in MeOH (10 mL) and treated with 4N HC1 in dioxane (1 mL). The mixture was allowed to stir for 5 minutes at 25 °C, then was concentrated in vacuo. The resulting residue was dissolved in DMF (3 mL), cooled to -30 °C and treated with Moc-Val-OH (99.4 mg, 0.57 mmol), diisopropylethylamine (0.33 mL, 1.89 mmol), and HATU (221 mg, 0.58 mmol). The resulting reaction was allowed to stir at -30 °C for lh, then warmed to 0 °C and stirred at this temperature for an additional 2 hours. The reaction mixture was poured into cold water and the resulting precipitate was collected by filtration and purified using Oilson HPLC (CH3CN-H2O, 0.1% TFA) to provide Compound 69. Compound 69 was dissolved in MeOH (10 mL) and treated with 4 N HC1 in dioxane (0.3 mL) followed by concentration in vacuo to provide the dihydrochloride salt of Compound 69 (147 mg, 56%). LRMS: (M+H)+ = 897.
EXAMPLE 32
Figure imgf000155_0002
lnt-32a lnt-32b lnt-32c
Figure imgf000155_0003
lnt-32d lnt-32e ΙΝ2010.7Π8
155
Step A - Synthesis of Intermediate Compound Int-32b
To a 1000 mL flame dried flask was added Int-32a (28.09 g, 181.1 mmol), bromochloromethane (23.5 mL, 362.2 mmol), and anhydrous THF (400 mL). The solution was cooled to -70 °C. n-BuLi (2.5M in hexane, 145 mL, 362 mmol) was added slowly over 5 a period of 1 hour. After the solution was allowed to stir at -70 to -60 °C for 20 minutes, it was allowed to warm up to room temperature in an hour. Saturated N¾C1 solution (200 mL) and Et20 (200 mL) were added. The organic layer was separated and the aqueous layer was extracted with Et20 (100 mL) twice. The organic layers were combined, washed with brine, dried over
Figure imgf000156_0001
filtered and concentrated at 25 °C. The resulting residue was 10 purified using flash chromatography on silica gel (240 g, eluted with hexane) to provide Compound Int-32b (17.2 g, 51.9%).
Step B - Synthesis of Intermediate Compound Int-32c
To a 500 mL flame dried flask was added (/i)-2-isopropyl-3, 6-dimethoxy-2,5-
15 dihydropyrazine (10.0 g, 54.3 mmol) and anhydrous THF (200 mL). The solution was cooled to -78 °C. «-BuLi (2.5M in hexane, 24.0 mL, 59.7 mmol) was added dropwise. After the solution was allowed to stir at -78 °C for 30 minutes, Int-32b (in 5 mL anhydrous THF) was added dropwise. After the solution was allowed to stir at -78 °C for 1 hour, it was allowed to warm up to room temperature in two hours. Water (100 mL) and Et20 (150
20 mL) were added. The organic layer was separated and the aqueous layer was extracted with Et20 (100 mL) twice. The organic layers were combined, washed with brine, dried over Na2SC> , filtered and concentrated in vacuo. The resulting residue was purified using flash chromatography on silica gel (40 g, eluted with Et^O in Hexane: 0% to 3%) to provide Compound Int-32c (10.43 g, 58.0%).
25
Step C- Synthesis of Intermediate Compound Int-32d
To a 500 mL flask was added compound Int-32c (11.5 g, 34.8 mmol) and MeOH (80 mL). 10% HCl (20 mL) was added. The solution was allowed to stir at room temperature for 5 hours and concentrated in vacuo. The resulting residue was dissolved in 30 20 mL MeOH and concentrated again to remove water and HCl. This process was repeated three times. The resulting residue was dissolved in DCM (50 mL) and Et20 (70 mL). DIPEA (15.4 mL, 86.9 mmol) and Nal (5.2 g, 34.75 mmol) were added. The solution was allowed to stir at room temperature for for about 15 hours. Di-¾rt-butyl dicarbonate (18.9 IN2010.7118
156
g, 86.9 mmol) was added. The solution was allowed to stir at room temperature for 4 hours. Water (100 mL) and EtOAc (100 mL) were added. The organic layer was separated and the aqueous layer was extracted with EtOAc (100 mL) twice. The organic layers were combined and washed with brine, dried over anhydrous NazSO^ filtered, and concentrated in vacuo. The product was purified using flash chromatography on silica gel (220g, Hexane/EtOAC: 0% to 20%) to provide Compound Int-32d (7.9 g, 75.9%).
Step D - Synthesis of Intermediate Compound Int-32e
Int-32d (7.9 g, 26.4 mmol) was dissolved in MeOH (100 mL) and the resulting solution was cooled to 0 °C. KOH (1M in water, 39.6 mL, 39.6 mmol) was added and the resulting reaction was allowed to stir at 0 °C for 2 hours, and then warmed to room temperature and allowed to stir for 3 hours. HC1 (2N, 20 mL) was added slowly until the reaction mixture was a pH ~ 4, then the acidified solution was concentrated in vacuo. To the resulting residue was added water (150 mL) and EtOAc (200 mL). The organic layer was separated and the aqueous layer was extracted with EtOAc (2 x 100 mL). The organic layers were combined, washed with brine, dried over anhydrous NajSQi, filtered, and concentrated in vacuo. The resulting residue was dried under vacuum for about 72 hours to provide Compound Int-32e (7.45 g, 99%) which was used without further purification.
EXAMPLE 33
Figure imgf000157_0001
Step A - Synthesis of Intermediate Compound Int-33a
Figure imgf000157_0002
IN2010.7118
157
Compound Int-33a was made using the method described in Example 29, Step A and substituting Compound Int-17g for Compound Int-17h.
Step B - Synthesis of Compound 53
5 Compound 53 was made using the method described in Example 29, Steps B and C and substituting Compound Int-33a for Compound Int-29a.
Step C - Synthesis of the Dihydrochloride Salt of Compound 53
The dihydrochloride salt of Compound 53 was made using the method described in 10 Example 29, Step D and substituting Compound 53 for Compound 54. ESI-LRMS [M+H 825.5. Ή NMR (CD3OD): δ 8.25-8.15 (m, 1H), 7.95-7.25 (m, 9H), 5.95-5.75 (m, 1H), 5.6- 5.4 (m, 2H), 4.6-4.4 ( m, 2H), 4.3-4.1 (m, 2H), 3.7 (s, 6H), 2.9-2.6 (m, 1H), 2.2-2.0 (m, 2H), 1.4-1.2 (m, 3H), 1.1-0.8 (m, 14 H), 0.4 (s, 3H), 0.34 (s, 3H), 0.3-0.2 (m, 2H).
15 EXAMPLE 34
Figure imgf000158_0001
Step A— Synthesis of Compound Int-34a
20
Figure imgf000158_0002
Compound Int-27b (5.0 g, 10.86 mmol), compound Int-16c (5.6 g, 11.78 mmol), PdCl2(dppf) dichloromethane complex (1.7 g, 2.08 mmol), an aqueous solution of sodium carbonate (1.5 M, 12 mL, 18 mmol), and 1,4-dioxane (70 mL) were added to a 500 mL flask. The resulting reaction was degassed, put under nitrogen atmosphere, then heated to 25 90 °C and allowed to stir at this temperature for 5 hours. The reaction mixture was then cooled to room temperature and concentrated in vacuo and the resulting residue was diluted IN2010.71 I8
158
with dichloromethane (300 mL). The resulting solution was filtered and the filtrate was concentrated in vacuo and the residue obtained was purified using a 330 g ISCO silica column / Combi-Flash system (0-90% ethyl acetate in hexanes as eluent) to provide compound Int-34a as a solid (3.7 g; 46% yield). LCMS anal 729 (M+H)+.
Step B - Synthesis of Compound Int-34b
Figure imgf000159_0001
Compound Int-34a (2.9, 3.98 mmol) was taken up in dichloromethane (10 mL) and to the resulting solution was added trifluoroacetic acid (10 mL). The resulting reaction was allowed to stir at room temperature for 5 hours, then the reaction mixture was concentrated in vacuo. The residue obtained was taken up in methanol (100 mL) and to the resulting solution was added HC1 in dioxane (4.0 M, 4.5 mL). The resulting solution was concentrated in vacuo to provide compound Int-34b as a solid, which was used without further purification.
Step C— Synthesis of Compound 56
Figure imgf000159_0002
A solution of compound Int-34b (3.98 mmol), compound Int-la (1.6 g, 9.13 mmol) and diisopropylethylamine (6 mL, 45 mmol) in DMF (3 mL) was cooled to -50 °C. HATU (3.2 g, 8.42 mmol) was then added slowly to the cooled solution and the resulting reaction was allowed to stir at 10 °C for 2 hours. Water (0.5 mL) was then added to quench the reaction and the resulting solution was added dropwise to 500 mL of water with stirring. The resulting suspension was filtered and the collected solid was purified using a 120 g ISCO silica gold column / Combi-Flash system (0-6% methanol in dichloromethane as eluent) to provide compound 56 as a white solid (1.25 g, 37% yield for 2 steps). 1H (600 MHz, CD3OD) 5 8.58 (1H), 8.46 (1H), 8.18-8.15 (2H), 7.95-8.05 (3H), 7.95 (2H), 7.80 (1H), 5.48-5.42 (2H), 4.5 (2H), 4.45-4.35 (1H), 4.08-4.05 (1H), 3.70-3.60 (6H), 3.60-3.15 (1H), 3.10-2.90 (2H), 2.10-2.00 (2H), 1.90-1.18 (1H), 1.40 (1H), 1.05-0.75 (13H), 0.45 IN2010.7118
159
(3H), 0.40 (3H). LCMS anal, calcd. for: C43H52F2N806Si 842.4; Found: 843.4 (M+H)+. H MS anal, calcd. for: CisHszFaNgOeSi 842.3747; Found: 843.3821.
Preparation of the dihydrochloride salt of Compound 56
Compound 56 was taken up in methanol and to the resuling solution was added HC1
(1M in ether, 200 mole %). The reaction was allowed to stir for 10 minutes, then the reaction mixture was concentrated in vacuo to provide the dihydrochloride salt of Compound 56 as a white solid, which was used without further purification. EXAMPLE 35
Cell-Based HCV Replicon Assay
Measurement of inhibition by compounds of the present invention was performed using the HCV replicon system. Several different replicons encoding different HCV genotypes or mutations were used. In addition, potency measurements were made using different formats of the replicon assay, including different ways of measurements and different plating formats. See Jan M. Vrolijk et al, A replicons-based bioassay for the measurement of interferons in patients with chronic hepatitis C, 110 J. VIROLOGICAL METHODS 201 (2003); Steven S. Carroll et al, Inhibition of Hepatitis C Virus UNA Replication by 2'-Modifled Nucleoside Analogs, 278(14) J. BIOLOGICAL CHEMISTRY 11979 (2003). However, the underlying principles are common to all of these determinations, and are outlined below.
TaqMan®-Based Assay Protocol: Compounds of the present invention were assayed for cell-based anti-HCV activity using the following protocol. Replicon cells were seeded at 5000 cells/well in 96-well collagen I-coated Nunc plates in the presence of the test compound. Various concentrations of test compound, typically in 10 serial 2-fold dilutions, were added to the assay mixture, with the starting concentration ranging from 250 μΜ to 1 μΜ. The final concentration of DMSO was 0.5%, fetal bovine serum was 5%, in the assay media. Cells were harvested on day 3 by the addition of lx cell lysis buffer (Ambion cat #8721). The replicon RNA level was measured using real time PCR (TaqMan® assay). The amplicon was located in 5B. The PCR primers were: 5B.2F,
ATGGACAGGCGCCCTGA (SEQ. ID NO. 1); 5B.2R, TTGATGGGCAGCTTGGTTTC (SEQ. ID NO. 2); the probe sequence was FAM-labeled CACGCCATGCGCTGCGG IN2010.7118
160
(SEQ. ID NO. 3). GAPDH RNA was used as endogenous control and was amplified in the same reaction as NS5B (multiplex PCR) using primers and VIC-labeled probe recommended by the manufacturer (PE Applied Biosystem). The real-time RT-PCR reactions were run on ABI PRISM 7900HT Sequence Detection System using the following program: 48°C for 30 minutes, 95°C for 10 minutes, 40 cycles of 95°C for 15 sec, 60°C for 1 minute. The ACT values (CTSB-CTQAPDH) were plotted against the concentration of test compound and fitted to the sigmoid dose-response model using XLfit4 (MDL). EC50 was defined as the concentration of inhibitor necessary to achieve ACT=1 over the projected baseline; EC90 the concentration necessary to achieve ACT=3.2 over the baseline.
Alternatively, to quantitate the absolute amount of replicon RNA, a standard curve was established by including serially diluted T7 transcripts of replicon RNA in the Taqman assay. All TaqMan® reagents were from PE Applied Biosystems. Such an assay procedure was described in detail in e.g. Malcolm et al., Antimicrobial Agents and Chemotherapy 50: 1013-1020 (2006).
HCV replicon EC50 assay data for various replicons and mutants was calculated for selected compounds of the present invention using this method and is provided in the table below. This data indicates that the compounds of the present invention are highly active versus a wide variety of HCV NS5A replicons and mutants.
Figure imgf000161_0001
161
0.012 0.005 >10 NA 11.4 NA 103 NA
>1 0.007 >10 NA 31 NA 1392 NA
>1 0.009 >10 NA 52 NA 2637 NA
0.26 0.004 0.6 NA 2.4 NA 497 NA
0.4 0.007 1.7 NA 5.5 NA 1598 NA
0.05 0.004 0.07 NA 0.25 NA 329 NA
0.04 0.014 0.037 NA 0.2 NA 185 NA
0.505 0.008 1.62 NA 3 NA 1 148 NA
>1 0.05 >10 NA >100 NA 8415 NA
0.016 0.003 0.026 NA 0.09 0.1 10 64
0.009 0.002 0.03 128 0.18 0.02 65 10
0.07 0.006 0.15 NA 0.8 0.35 27 62
0.016 0.003 0.027 48 0.35 0.02 46 16
0.068 <0.05 0.069 NA 0.798 0.652 50 NA
0.03 0.002 0.15 NA 0.8 0.36 118 NA 0.06 0.003 0.09 NA 2.9 0.129 96 NA
0.06 0.005 0.005 NA 0.2 0.076 350 NA
0.06 0.004 0.3 NA 1.7 NA 44 NA
0.002 0.005 0.08 >100 0.15 NA 260 32
0.19 0.011 0.16 NA 5 0.5 380 NA
0.012 0.007 0.04 NA 0.118 0.077 25 NA
0.12 <0.002 0.45 NA 0.9 NA 188 NA
0.1 0.004 0.496 NA 2.411 NA 246 NA
>1 85 >10 NA >100 >100 >1000 NA
0.015 0.001 0.04 NA 0.26 0.137 90 NA
0.127 0.012 0.315 NA 4.4 0.45 351 NA
>1 >1 >10 NA >100 >100 >1000 NA
0.94 0.012 0.712 NA 9.69 >10 >1000 >100
>1 52 >10 NA >100 >100 >1000 NA
>1 2.4 >10 NA >100 >10O >1000 NA 10.7118
163
85 0.102 0.009 0.065 NA 0.69 1.16 728 89
86 >1 141 >10 NA >100 >100 >1000 >1000
87 >1 2.5 >10 NA >100 >100 >1000 >1000
88 >1 4 >10 NA >100 >100 >1000 >1000
89 0.054 0.006 0.5 NA 0.275 0.035 211 NA
92 0.015 0.003 0.02 48 0.35 0.02 46 NA
94 0.008 0.002 0.03 129 0.2 0.02 65 10
95 >0.1 0.015 0.032 NA 0.066 1.217 210 9
96 0.04 0.004 0.013 49.3 0.099 0.936 51 1
97 0.005 0.002 0.005 17.11 0.09 0.029 30 15
99 NA NA NA NA NA NA NA NA
100 0.043 0.002 0.023 NA 7.4 <0.2 204 117
101 >1 0.023 >10 NA 54.6 >100 >1000 >1000
102 0.084 <2 0.097 NA 7.5 0.3 438 113
103 >1 61 NA NA NA NA NA NA IN2010.7118
164
Figure imgf000165_0001
NA = not available
Wherein gtla_H77 was prepared as described in Yi et al., J Virol. 2004, 78(15):7904-15.; gtlb conl was prepared as described in Lohmann et al, Science 1999, 285(5424): 110-3; and gt2a_JFH was prepared as described in Kato et ai, Gastroenterology. 2003, 125(6):1808-17. Chimeric replicons contain NS5A from patient isolates of genotypes la, lb, 2b, 3a and 4a as indicated.
The study of the HCV life cycle has been difficult due to the lack of a cell-culture system to support the HCV virus. To date, compounds in different structural classes acting on different sites within the HCV polyprotein have demonstrated efficacy in various species, including humans, in reducing HCV viral titers. Furthermore, the subgenomic replicon assay is highly correlated with efficacy in non-humans and humans infected with HCV. See K. del Carmen et ai, Annals ofHepatolog , 2004, 3:54.
It is accepted that the HCV replicon system described above is useful for the development and the evaluation of antiviral drugs. See Pietschmann, T. & Bartenschlager, R., Current Opinion in Drug Discovery Research 2001, 4:657-664).
EXAMPLE 36
Pharmacokinetic Analysis of Compound 56
Various pharmacokinetic parameters for compound 56 were measured in rats, dogs and monkeys as described below.
Dosing and Sample Collection IN2010.7118
165
Male Sprague-Dawley rats (Charles River, Co.) were pre-cannulated (femoral artery) in order to facilitate precise blood sampling times, to increase throughput and to reduce the stress on the animals caused by serial bleedings. Following an overnight fast, rats were dosed with the dihydrochloride salt of compound 56 orally at 5 mg kg as a suspenson 5 in 0.4% hydroxylpropyl rnethylcellulose (HPMC) or intravenously at 2.5 mg kg as a solution in 20% hydroxypropyl-P-cyclodextrin (20% HPpCD). Blood was collected into heparin-containmg tubes serially from each animal at 0.25, 0.5, 1, 2, 4, 6, 8, 24 and 48 hr (PO), and 0.167,0.25, 0.5, 1, 2, 4, 6, 8, 24 and 48 hr (IV) post-dosing and centrifuged to generate plasma. The plasma samples were stored at 20°C until analysis.
10
Dogs
Following an overnight fast, male beagle dogs were dosed with the dihydrochloride salt of compound 56 orally at 2 mg kg as a suspenson in 0.4% hydroxylpropyl rnethylcellulose (HPMC) or intravenously at 1 mg kg as a solution in 20% hydroxypropyl-
15 β-cyclodextrin (20% HPpCD). For oral dosing, the animals were typically restrained by hand and dosed by oro-gastric intubation. Dogs were fed approximately 4 hours after dosing. Blood samples were collected from the jugular or cephalic vein at 0.25, 0.5, 1, 2, 4, 6, 8, 12, 24, 48, 72 and 96 hrs (PO) and 0.167, 0.25, 0.5, 1, 2, 4, 6, 8, 12, 24, 48, 72 and 96 hrs (IV) post-dosing and centrifuged to generate plasma. The plasma samples were stored at
20 20°C until analysis.
Monkeys
Following an overnignt fast, male cynomolgus monkeys were dosed with the dihydrochloride salt of compound 56 orally at 2 mg/kg as a suspenson in 0.4%
25 hydroxylpropyl rnethylcellulose (HPMC) or intravenously at 1 mg kg as a solution in 20% hydroxypropyl- β-cyclodextrin (20% HPPCD). For oral dosing, the animals dosed by oro- gastric intubation. Monkeys were fed approximately 1 hour before dosing and 4 hours after dosing. Blood samples were collected from the saphenous and/or cephalic vein at 0.25, 0.5,
I, 2, 4, 6, 8, 12, 24, 48, and 72 (PO), and 0.167, 0.25, 0.5, 1, 2, 4, 6, 8, 12, 24, 48, and 72 hrs 30 (IV) post-dosing and centrifuged to generate plasma. The plasma samples were stored at
20°C until analysis.
II. Plasma Analysis (for all species) IN2010.7118
166
Collected plasma samples were analyzed for the presence of compound 56 using LC-MS/MS as described below.
HPLC/API-MS/MS equipment
The HPLC/API-MS/MS system for the example data consisted of a HPLC pumping system and a auto sampler with the sample tray refrigeration option connected directly to a triple quadrupole mass spectrometer with an API source. Typical HPLC methods for the example data was based on a fast gradient of two solvents: solvent A consisted of 0.1 % formic acid in water, and sol ent B consisted of 0.1 % formic acid in acetonitrile. A fast linear gradient (start at 90% A for 0.2 min, ramp to 95% B from 0.2 to 0.5 min, hold at 95% B until 0.5 min, then ramp back to 90% A from 1.0 to 1.1 min, then hold at 95% A from 1.1 to 1.2 min) was used. The flow rate for the HPLC system was set to 1 mL/min throughout the HPLC gradient; the HPLC column was a Halo CI 8 column (2.7 micron particle size, 50 x 2.1 mm). The example compounds were analyzed by positive ion atmospheric pressure chemical ionization tandem mass spectrometry (APCI-MS/MS). As a general procedure, selected reaction monitoring (SRM) methods were developed for each compound prior to analysis of the plasma samples. Normally, the individual SRM transitions were based on a fragmentation from the protonated molecule ([MH].) to a characteristic product ion.
Using the methods described above, the following pharmacokinetic parameters were calculated in rats, dogs and monkeys and the results are summarized in the table below.
Figure imgf000167_0001
IN2010.7118
167
♦calculated by dose-normalized area under the concentration-time (AUC) between PO and IV
The present invention is not to be limited by the specific embodiments disclosed in the examples that are intended as illustrations of a few aspects of the invention and any embodiments that are functionally equivalent are within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims.
A number of references have been cited herein, the entire disclosures of which are incorporated herein by reference.

Claims

WHAT IS CLAIMED IS:
1 , A compound having the formula:
Figure imgf000169_0001
or a pharmaceutically acceptable salt thereof,
wherein:
A is -~alkylene~N(R7)(Ru), -alkylene-N(R16)(R1 1), 4 to 7- membered monocyclic
1
heterocycloalkyl, 7 to 11 - membered bicyclic heterocycloalkyl or R , wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic
heterocycloalkyl group or said R15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 11- membered bicyclic heterocycloalkyl group or Ri 5group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with R12, such that two R12 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group or a spirocyclic 4 to 7-membered heterocycloalkyl group;
B is 5-membered monocyclic heteroarylene group or a 9-membered bicyclic heteroarylene group containing at least one nitrogen atom, wherein said 5-membered monocyclic heteroarylene group and said 9-membered bicyclic heteroarylene group can be optionally fused to a benzene, pyridine or pyrimidine ring, and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart and said 9-membered bicyclic heteroarylene group or it's fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with R6 and on one or more ring carbon atoms with R12;
C is a bond, -C(R5)=C(R5)-, -C≡C-, phenylene, monocyclic heteroarylene or bicyclic heteroarylene, wherein said phenylene group, said monocyclic heteroarylene group or said bicyclic heteroarylene group can be optionally and independently substituted on one or more ring nitrogen atoms with R6 and on one or more ring carbon atoms with R!2;
D is -alkylene-N(R7)(R1 !), -alkylene~N(Rl6)(RH), 4 to 7- membered monocyclic heterocycloalkyl, 7 to 1 1 - membered bicyclic heterocycloalkyl or R15, wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 1 1 - membered bicyclic
heterocycloalkyl group or said R! S group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7-membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group, said 7 to 1 1- membered bicyclic heterocycloalkyl group or R15group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with R12, such that two R12 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group or a spirocyclic 4 to 7-membered heterocycloalkyl group;
M1 is a bond, ~C(R7)2-> -0-, -N(R6)-, -S(0)2- -C(R2)=C(R2)-, -C(R2)=N-,
-N=C(R2)-, -C(R7)2-0-, -0-C(RV, -C(RVN(R6)- or -N(R6)-C(R7)2-, such that two vicinal R7 groups of M1, together with the carbon atoms to which they are attached, can optionally join to form a 3- to 7-membered cycloalkyl group, a 3- to 7-membered heterocycloalkyl group or a 5- to 6-membered heteroaryl group;
X1 is -C(R5)- or -N-;
X2 is -C(R5)- or -N-;
each occurrence of Rl is independently C C6 alkyl, -alkylene-0-(Ci-C6 alkyl), Ct-C6 haloalkyl, 3- to 7-membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally substituted with up to three groups, which can be the same or different, and are selected from Ci-C6 alkyl, 3- to 7-membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl, heteroaryl, halo, CrC6 haloalkyl, -Si(R13)3, -CN, -OR3, -N(R3)2, -C(O)Ri0, -C(0)OR3, - C(0)N(R3)2, -NHC(O)R10 5 -NHC(0)NHR3, -NHC(0)OR3, -OC(O)Ri0, -SR3 and -~S(0)2R10; each occurrence of R2 is independently H, C\-C(, alkyl, -C5-C6 haloalkyl, 3 to 7- membered cycloalkyl, 4 to 7-membered heterocycloalkyl, d-Cg hydroxyalkyl, -OH, -O- (Ci-C6 alkyl), halo, -CN, -NH2; -NH(C C6 alkyl), -N(CrC6 alkyl)2, -NHC(0)-(CrC6 alkyl), -C(0)NH-(Ci-Q alkyl), -C(0)N(C,-C6 alkyl)2, or ^Si(R13)3; each occurrence of R3 is independently H, Ci-C6 alkyl, Ci-C6 haloalkyl, -Ci-C6 alkylene-OC(0)(Ci-C6 alkyl)5 Ci-C6 ydroxyalkyl, 3 to 7-membered cycloalkyl, 4 to 7- membered heterocycloalkyl, aryl or heteroaryl wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to three groups
independently selected from -OH, halo, C1- 5 alkyl, Ci-C6 haloalkyl, -NH(C|-C6 alkyl) and - N(C,-C6 alkyl)2;
each occurrence of R4 is independently H, -Cj-C6 alkyl, Cj-C6 haloalkyl, - [C(R7)2]qN(R6)2,
Figure imgf000171_0001
~C(0)-[C(R7)2]qN(R6)2, -C(0)-[C(R7)2]q-R1 5 -C(O)- [C(R7)2]qN(R6)C{0)-R1, -C(0)[C{R7)2]qN(R6)S02-R1, -C(0)-[C(R7)2]qN(R6)C(0)0-R', - C(0)-[C(R7)2]qC(0)0-R1 or -alkylene-N(R6)-[C(R7)2]q-N(R6)-C(0)0-R1 ;
each occurrence of R5 is independently H, Ci-C6 alkyl, -Si(Rl 3)3, 3- to 7-membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl or heteroaryl;
each occurrence of R6 is independently H, Q-C6 alkyl, 3- to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to two R groups, and wherein two R6 groups that are attached to a common nitrogen atom, together with the nitrogen atom to which they are attached, can optionally join to form a 4- to 7-membered heterocycloalkyl group;
each occurrence of R7 is independently H, Cj-C6 alkyl, Ci-C6 haloalkyl,
-alkylene-0-(CrC6 alkyl), silylalkyl, 3- to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl or heteroaryl, wherein said 3- to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said aryl group or said heteroaryl group can be optionally and independently substituted with up to three R groups, and wherein two geminal R7 groups, together with the common carbon atom to which they are attached, can optionally join to form -C(=0)-, -C(=S)-, -C(=NH)-, -C(=N-OH)-, -C(=N-Ci-C6 alkyl)-, -
Figure imgf000171_0002
to 7-membered cycloalkyl))-, -C(=N-(4 to 7-membered heterocycloalkyl))-, -C(=N-0-(4- to 7-membered heterocycloalkyl))-, a 3 to 7-membered cycloalkyl group or a 4- to 7-membered
heterocycloalkyl group, such that no two adjacent -C(R7)2- groups can join to form a - C(O)-C(=0)-, -C(=S)-C(HS)-, -C(=0)-C(=S)- or -C(=S)-C(=0)- group; each occurrence of R8 is independently H, Ci-C6 alkyl, halo, -Ci-Cehaloalkyl, Ci-C6 hydroxyalkyl, -OH, -C(0)NH-(C!-C6 alkyl), -C(0)N(Cj-C6 alkyl)2; -0-(Ci-C6 alkyl), -NH2, -NH(Ci-C6 alkyl), -N(Ci-C6 alkyl)2 and -NHC(0)-(Ci-C6 alkyl) or -Si(R13)3;
each occurrence of R10is independently C|-C6 alkyl, Ci-C6haloalkyI, 3 to 7- membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl, or heteroaryl;
each occurrence of Rn is independently H, Cj-C6 alkyl, C]-C6haloalkyl, - [C(R7)2]qN(R6)2,
Figure imgf000172_0001
-C(0)-[C(R7)2]qN(R6)2,
-C{0)-[C(R7)2]qN(R6)C(0)-RI, -C(0)-[C(R7)2]qN(R6)C(O)0-RI, -C(0)-[C(R7)2] C(0)0-R1, -C(0)[C(R7)2]qN(R6)S02-R1 or -alkylene-N(R6)-[C(R7)2]q-N(R6)-C(0)0-R1 ;
each occurrence of R12 is H, C|-Q> alkyl, CrC6haloalkyl, 3 to 7-membered cycloalkyl, 4 to 7-membered heterocycloalkyl, aryl, heteroaryl, halo, -CN, -OR3,
N(R3)2, -C(0)R10, -C(0)OR3, -C(0)N(R3)2, -NHC(0)R10, -NHC(0)NHR3, -NHC(O)0R3, - OC(0)R10, -SR3, -S(0)2R'0 or Si{Ri 3)3 and wherein two R12 groups together with the carbon atom(s) to which they are attached, can optionally join to form a 5 to 7-membered cycloalkyl or 4- to 7-membered heterocycloalkyl ring;
each occurrence of R13 is independently selected from Ci-C6 alkyl, 3- to 7- membered cycloalkyl, 4- to 7-membered heterocycloalkyl, aryl, heteroaryl, Ci-C6haloalkyl, -CN and -OR3, wherein two R13 groups, together with the silicon atom to which they are attached, can optionally join to form a 4- to 7-membered silicon-containing
heterocycloalkyl ring;
each occurrence of R15 is independently a monocyclic 5- to 7-membered
silylheterocycloalkyl ring or a bi cyclic 7- to 11 -membered bicyclic silylheterocycloalkyl ring wherein said silylheterocycloalkyl rings contains as heteroatom ring members:
Figure imgf000172_0002
(ii) one -N(R4)-; and
(iii) one optional and additional heteroatom ring member elected from the group consisting of nitrogen, oxygen and sulfur, and wherein an R1S group can be optionally and independently substituted on one or two ring carbon atoms with R ;
each occurrence of R16 is independently:
(i) Ci-Ce alkyl substituted with -Si(Rl3)3;
(ii) 3 to 7-membered cycloalkyl substituted with -Si(R13)3;
1 "¾
(iii) 4 to 7-membered heterocycloalkyl substituted with -Si(R )3; (iv) phenyl substituted with -Si(R )3;
(v) 6-membered heteroaryl substituted with -Si(RI3)3, wherein said
heteroaryl has one or two ring nitrogen atoms and no other ring heteroatoms; or
(vi) -(CH2) R17 }
and wherein when R16 is said 3 to 7-membered cycloalkyl group, said 4- to 7-membered heterocycloalkyl group, said phenyl group or said heteroaryl group, then R16 can be optionally substituted with up to three groups, which can be the same or different, and are selected from C,-C6 alkyl, halo, -Q-Qs haloalkyl, Ci-C6hydroxyalkyl, -OH, -C(0)NH-(Cr C6 alkyl), -C(0)N(C,-C6 alkyl)2, -O-iC-Q alkyl), -NH2, -NH(C C6 alkyl), -N(Ci-C6 a!kyl)2 and -NHC(0)-(Ci-C6 alkyl);
each occurrence of R17 is independently:
(i) a 5- to 7-membered silylcycloalkyl ring having one -Si(R )2- ring member; or
(ii) a 5- to 7-membered silylheterocycloalkyl ring having one -Si(R!V ring member, and one to two heteroatom ring members, which can be the same or different, and are selected from the group consisting of nitrogen, oxygen, and sulfur, such that the -Si(R, 3)2- group must be bonded only to ring carbon atoms; or
(iii) a 7- to 11 -membered bicyclic silylheterocycloalkyl ring having one - Si(R )2- ring member, and one to three heteroatom ring members, which can be the same or different, and are selected from the group consisting of nitrogen, oxygen, and sulfur.
and wherein an R17 group can be optionally and independently substituted on one or two
1
ring carbon atoms with up to two R groups;
each occurrence of q is independently an integer ranging from 1 to 4; and each occurrence of r is independently an integer ranging from 0 to 6,
wherein at least one of A and D is R15 or -alkyl ene-N(R16)(R! ').
2. The compound of claim 1 , wherein B is 5-membered monocyclic heteroarylene group containing at least one nitrogen atom, wherein said 5-membered monocyclic heteroarylene group can be optionally fused to a benzene, pyridine or pyrimidine ring, and wherein said 5-membered monocyclic heteroarylene group or its fused counterpart, can be optionally and independently substituted on one or more ring nitrogen atoms with R6 and on one or more ring carbon atoms with R .
3. The compound of any of claims 1 and 2, wherein A and D are each independently a 4 to 7- membered monocyclic heterocycloalkyl, 7 to 11- membered bicyclic
heterocycloalkyl or R15, wherein said 4 to 7- membered monocyclic heterocycloalkyl group or said R15 group can be optionally fused to a 3 to 7-membered cycloalkyl group, a 4 to 7- membered heterocycloalkyl group or an aryl group; and wherein said 4 to 7- membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more ring nitrogen atoms with R4, and on one or more ring carbon atoms with R12, such that two R12 groups on the same ring carbon atom, together with the carbon atom to which they are attached, can join to form a spirocyclic 3 to 7-membered cycloalkyl group, or a spirocyclic 4 to 7-membered heterocycloalkyl group; wherein at least one of A and D is R .
4. The compound of any of claims 1 -3, wherein A and D are each independently selected from:
Figure imgf000174_0001
5, The compound of any of claims 1-4, wherein A and D are each independently selected from:
Figure imgf000174_0002
6. The compound any of claims of any of claims 1 -5, wherein each occurrence of R4 is
Figure imgf000175_0001
, wherein R1 is H, Ci-C6 alkyl, Ci-C6 haloalkyl, 3- to 7- membered cycloalkyl, 4- to 7~ membered heterocycloalkyl, aryl or heteroaryl and Ra is Ci-C6 alkyl, Cj- C6 haloalkyl, silylalkyl, 3- to 7- membered cycloalkyl or 4- to 7- membered
heterocycloalkyl, aryl or heteroaryl.
7. The compound of any of claims 1-6, wherein Ra is methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH2CH2Si(CH3)3, -CH2CH2CF3) pyranyl, benzyl or phenyl, and R1 is methyl, ethyl or isopropyl.
8. The compound of any of claims 1 -7, wherein each occurrence of R4 is:
Figure imgf000175_0002
Figure imgf000175_0003
ring substituent selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, -0-(Ci-C6 alkyl), -0-(d-C6 hydroxyalkyl) and -0-(Ci-C6 alkyl ene)-OC(0)-(C C6 alkyl).
11. The compound of any of clai -10, wherein C is :
Figure imgf000176_0001
wherein R is an optional single ring substituent selected from F, -OCH3, pyridyl, -OCH2CH2OH, -OCH2CH2OC(0)CH3> cyclopropyl and thiophenyl.
12. The compound of any of claims 1-11, wherein C is:
Figure imgf000176_0002
13. The compound of any of claims 1-12, wherein the group:
Figure imgf000176_0003
Figure imgf000176_0004
Figure imgf000177_0001
The compound of any of claims 1-13, wherein the group:
Figure imgf000177_0002
has the structure:
Figure imgf000177_0003
15.
Figure imgf000177_0004
and pharmaceutically acceptable salts thereof,
wherein: C is phenylene, 5- or 6- membered monocyclic heteroarylene or 9-membered bicyclic heteroarylene, wherein said phenylene group, said 5- or 6-membered monocyclic heteroarylene group or said 9-membered bicyclic heteroarylene group can be optionally and independently substituted with up to two groups, which can be the same or different, and are selected from halo, 3- to 7-membered cycloalkyl, 5- or 6-membered heteroaryl, -0-(Ci-C6 alkyl), -0-(CrC6 hydroxyalkyl), or -0-(C C6 alkylene)-OC(0)-(Ct-C6 alkyl);
each occurrence of Z is independently -~Si(Rx)2-, -C(Ry)2- or -8(0)2-, such that at least one occurrence of Z is™Si(Rx)2-;
each occurrence of Rx is independently Ci-C6 alkyl or two Rx groups that are attached to the same Si atom, combine to form a -(CH2)4- or -(CH2)s- group; and
each occurrence of Ry is independently H or F;
each occurrence of R1 is independently CrC6 alkyl;
each occurrence of R4 is independently -C(0)CH(R7)NHC(0)OR';
each occurrence of R7 is independently C]-C<s alkyl, Ci-C6 silylalkyl or 4 to 7- membered heterocyclo alkyl; and
each occurrence of t is independently 1 or 2.
1 . The compound of claim 15, wherein C is:
Figure imgf000178_0001
wherein R12 is an optional single ring substituent selected from F, -OCH3, pyridyl,
-OCH2CH2OH, -OCH2CH2OC(0)CH3, cyclopropyl and thiophenyl.
The compound of any of cl n C
Figure imgf000178_0002
18. The compound of claim 1 , having the formula;
Figure imgf000179_0001
and pharmaceutically acceptable salts thereof,
wherein
each occurrence of R4 is:
Figure imgf000179_0002
each occurrence of Z is independently -Si(Rx)2- or-C(Ry)2-;
each occurrence of Rx is independently Ci-C6 alkyl, or two Rx groups that are attached to the same Si atom, combine to form a -(CH2)4- or -(CH2)5- group; and
each occurrence of Ry is independently H or F;
such that at least one occurrence of Z is™Si(Rx) -.
19. The compound of any one of claims 15-18, wherein one occurrence of Z is - Si(CH3)2-.
20. The compound of any one of claims 15-19, wherein one occurrence of Z is -CF2-.
21. The dihydrochloride salt of a compound of any of claims 1-20.
22. The compound of claim 1 having the structure:
Figure imgf000179_0003
Figure imgf000180_0001
Figure imgf000181_0001
Figure imgf000181_0002
Figure imgf000182_0001
Figure imgf000183_0001
Figure imgf000183_0002
Figure imgf000184_0001
Figure imgf000184_0002
Figure imgf000184_0003
Figure imgf000185_0001
or a pharmaceutically acceptable salt thereof.
23. The compound of claim 1 having the structure:
Figure imgf000186_0001
Figure imgf000187_0001
Figure imgf000187_0002
Figure imgf000188_0001
Figure imgf000189_0001
Figure imgf000189_0002
Figure imgf000190_0001
Figure imgf000190_0002
Figure imgf000190_0003
Figure imgf000191_0001
or a stereoisomer thereof.
24. A pharmaceutical composition comprising an effective amount of the compound of any of claims 1-23, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
25. The pharmaceutical composition according to claim 24, further comprising a second therapeutic agent selected from the group consisting of HCV antiviral agents,
immunomodulators, and anti-infective agents.
26. The pharmaceutical composition according to claim 25, further comprising a third therapeutic agent selected from the group consisting of HCV protease inhibitors, HCV NS5A inhibitors and HCV NS5B polymerase inhibitors.
27. Use of the compound according to any of claims 1-23, or a pharmaceutically acceptable salt thereof, in the preparation of a medicament for inhibiting HCV NS5B activity or for preventing and/or treating infection by HCV in a patient in need thereof.
28. A method of treating a patient infected with HCV comprising the step of administering an amount of the compound according to any of claims 1-23, or a pharmaceutically acceptable salt thereof, effective to prevent and/or treat infection by HCV in said patient.
29. The method according to claim 28, further comprising the step of administering pegylated-interferon alpha and an HCV protease to said patient.
30. The method according to claim 28 or 29, further comprising the step of
administering ribavirin to said patient.
PCT/US2011/027117 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases WO2011112429A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
JP2012557114A JP2013522202A (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
MA35291A MA34147B1 (en) 2010-03-09 2011-03-04 SILYL FUSIONED TRICYCLIC COMPOUNDS AND METHODS OF USE IN THE TREATMENT OF VIRAL DISEASES
MX2012010392A MX2012010392A (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases.
CN2011800233538A CN102918049A (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
EA201290882A EA201290882A1 (en) 2010-03-09 2011-03-04 Condensed tricyclic silane compounds and methods of their use for the treatment of viral diseases
SG2012063780A SG183526A1 (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
KR1020127026331A KR20130008040A (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
EP11707763.6A EP2545060B1 (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
CA2792121A CA2792121A1 (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
BR112012022125A BR112012022125A2 (en) 2010-03-09 2011-03-04 compound, dihydrochloride salt, pharmaceutical composition, use of the compound, and method for treating a patient
AU2011224698A AU2011224698A1 (en) 2010-03-09 2011-03-04 Fused Tricyclic Silyl Compounds and methods of use thereof for the treatment of viral diseases
ES11707763.6T ES2558554T3 (en) 2010-03-09 2011-03-04 Condensed tricyclic silyl compounds and methods of their use for the treatment of viral diseases
TNP2012000416A TN2012000416A1 (en) 2010-03-09 2012-08-15 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
ZA2012/06716A ZA201206716B (en) 2010-03-09 2012-09-07 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US31201610P 2010-03-09 2010-03-09
US61/312,016 2010-03-09
US37193510P 2010-08-09 2010-08-09
US61/371,935 2010-08-09

Publications (1)

Publication Number Publication Date
WO2011112429A1 true WO2011112429A1 (en) 2011-09-15

Family

ID=43939669

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/027117 WO2011112429A1 (en) 2010-03-09 2011-03-04 Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases

Country Status (25)

Country Link
US (1) US8609635B2 (en)
EP (1) EP2545060B1 (en)
JP (1) JP2013522202A (en)
KR (1) KR20130008040A (en)
CN (1) CN102918049A (en)
AR (1) AR080676A1 (en)
AU (1) AU2011224698A1 (en)
BR (1) BR112012022125A2 (en)
CA (1) CA2792121A1 (en)
CL (1) CL2012002489A1 (en)
CO (1) CO6592102A2 (en)
CR (1) CR20120460A (en)
DO (1) DOP2012000243A (en)
EA (1) EA201290882A1 (en)
EC (1) ECSP12012147A (en)
ES (1) ES2558554T3 (en)
MA (1) MA34147B1 (en)
MX (1) MX2012010392A (en)
NI (1) NI201200139A (en)
PE (1) PE20130062A1 (en)
SG (1) SG183526A1 (en)
TN (1) TN2012000416A1 (en)
TW (1) TW201136943A (en)
WO (1) WO2011112429A1 (en)
ZA (1) ZA201206716B (en)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012068234A3 (en) * 2010-11-17 2013-01-17 12Gilead Sciences, Inc. Antiviral compounds
US8541424B2 (en) 2008-12-23 2013-09-24 Abbott Laboratories Anti-viral compounds
US8546405B2 (en) 2008-12-23 2013-10-01 Abbott Laboratories Anti-viral compounds
US8552047B2 (en) 2011-02-07 2013-10-08 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US8575135B2 (en) 2011-11-16 2013-11-05 Gilead Sciences, Inc. Antiviral compounds
JP2014500861A (en) * 2010-10-26 2014-01-16 プレシディオ ファーマシューティカルズ インコーポレイテッド Hepatitis C virus inhibitor
US8669234B2 (en) 2009-05-13 2014-03-11 Gilead Sciences, Inc. Antiviral compounds
US8686026B2 (en) 2010-06-10 2014-04-01 Abbvie Inc. Solid compositions
US8691938B2 (en) 2009-06-11 2014-04-08 Abbvie Inc. Anti-viral compounds
US8716454B2 (en) 2009-06-11 2014-05-06 Abbvie Inc. Solid compositions
US8765731B2 (en) 2009-07-16 2014-07-01 Vertex Pharmaceuticals Incorporated Benzimidazole analogues for the treatment or prevention of flavivirus infections
US8779156B2 (en) 2010-03-24 2014-07-15 Vertex Pharmaceuticals Incorporated Analogues for the treatment or prevention of flavivirus infections
US8859595B2 (en) 2010-08-26 2014-10-14 Rfs Pharma, Llc Potent and selective inhibitors of hepatitis C virus
US8937150B2 (en) 2009-06-11 2015-01-20 Abbvie Inc. Anti-viral compounds
US20150057246A1 (en) * 2011-09-14 2015-02-26 Michael P. Dwyer Silyl-containing heterocyclic compounds and methods of use thereof for the treatment of viral diseases
US9034832B2 (en) 2011-12-29 2015-05-19 Abbvie Inc. Solid compositions
US9278922B2 (en) 2009-04-15 2016-03-08 Abbvie Inc. Anti-viral compounds
US9326973B2 (en) 2012-01-13 2016-05-03 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US9333204B2 (en) 2014-01-03 2016-05-10 Abbvie Inc. Solid antiviral dosage forms
US9393256B2 (en) 2011-09-16 2016-07-19 Gilead Pharmasset Llc Methods for treating HCV
US9394279B2 (en) 2009-06-11 2016-07-19 Abbvie Inc. Anti-viral compounds
US9546160B2 (en) 2011-05-12 2017-01-17 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US9717712B2 (en) 2013-07-02 2017-08-01 Bristol-Myers Squibb Company Combinations comprising tricyclohexadecahexaene derivatives for use in the treatment of hepatitis C virus
US9770439B2 (en) 2013-07-02 2017-09-26 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US9775831B2 (en) 2013-07-17 2017-10-03 Bristol-Myers Squibb Company Combinations comprising biphenyl derivatives for use in the treatment of HCV
US10039779B2 (en) 2013-01-31 2018-08-07 Gilead Pharmasset Llc Combination formulation of two antiviral compounds
US10086011B2 (en) 2013-08-27 2018-10-02 Gilead Pharmasset Llc Combination formulation of two antiviral compounds
US10201584B1 (en) 2011-05-17 2019-02-12 Abbvie Inc. Compositions and methods for treating HCV
US10617675B2 (en) 2015-08-06 2020-04-14 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US10800789B2 (en) 2012-05-16 2020-10-13 Gilead Pharmasset Llc Antiviral compounds
US11203599B2 (en) 2014-06-11 2021-12-21 Gilead Pharmasset Llc Solid forms of an antiviral compound
US11484534B2 (en) 2013-03-14 2022-11-01 Abbvie Inc. Methods for treating HCV

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190127365A1 (en) 2017-11-01 2019-05-02 Merck Sharp & Dohme Corp. Inhibitors of hepatitis c virus replication
EA020898B1 (en) 2009-03-27 2015-02-27 Мерк Шарп Энд Домэ Корп. Inhibitors of hepatitis c virus replication
EP2430015B1 (en) 2009-05-12 2015-06-17 Merck Sharp & Dohme Corp. Fused tricyclic compounds useful for the treatment of viral diseases
JP2012528194A (en) 2009-05-29 2012-11-12 メルク・シャープ・アンド・ドーム・コーポレーション Antibacterial compounds composed of three aligned aryl moieties for treating diseases such as hepatitis C
WO2010138791A1 (en) 2009-05-29 2010-12-02 Schering Corporation Antiviral compounds composed of three linked aryl moieties to treat diseases such as hepatitis c
US20130156731A1 (en) 2009-12-22 2013-06-20 Kevin X. Chen Fused tricyclic compounds and methods of use thereof for the treatment of viral diseas
MA34147B1 (en) 2010-03-09 2013-04-03 Merck Sharp & Dohme SILYL FUSIONED TRICYCLIC COMPOUNDS AND METHODS OF USE IN THE TREATMENT OF VIRAL DISEASES
EP2621501A4 (en) * 2010-09-29 2014-04-09 Merck Sharp & Dohme Polycyclic heterocycle derivatives and methods of use thereof for the treatment of viral diseases
US9254292B2 (en) 2010-09-29 2016-02-09 Merck Sharp & Dohme Corp. Fused tetracycle derivatives and methods of use thereof for the treatment of viral diseases
WO2012122716A1 (en) 2011-03-17 2012-09-20 Merck Sharp & Dohme Corp. Tetracyclic xanthene derivatives and methods of use thereof for treatment of viral diseases
WO2013030750A1 (en) 2011-09-01 2013-03-07 Lupin Limited Antiviral compounds
EP2812326A1 (en) 2012-02-10 2014-12-17 Lupin Limited Antiviral compounds with a dibenzooxaheterocycle moiety
CN104302636B (en) 2012-04-25 2017-03-29 施万生物制药研发Ip有限责任公司 Hepatitis C virus inhibitor
SI2850075T1 (en) 2012-04-25 2017-06-30 Theravance Biopharma R&D Ip, Llc Piperazine-piperidine compounds as hepatitis c virus inhibitors
WO2014110687A1 (en) 2013-01-16 2014-07-24 Merck Sharp & Dohme Corp. Thiazolyl-substitued tetracyclic compounds and methods of use thereof for treatment of viral diseases
WO2017197055A1 (en) 2016-05-10 2017-11-16 C4 Therapeutics, Inc. Heterocyclic degronimers for target protein degradation
EP3455218A4 (en) 2016-05-10 2019-12-18 C4 Therapeutics, Inc. C3-carbon linked glutarimide degronimers for target protein degradation
WO2017197036A1 (en) 2016-05-10 2017-11-16 C4 Therapeutics, Inc. Spirocyclic degronimers for target protein degradation
CN110382487B (en) * 2017-03-22 2021-04-02 正大天晴药业集团股份有限公司 Silicon-containing compounds for use against hepatitis c virus infection
CN112679365A (en) * 2021-03-15 2021-04-20 南京桦冠生物技术有限公司 Industrial preparation method of 6-bromonaphthalene-1, 2-diamine

Citations (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4634697A (en) 1983-10-04 1987-01-06 Shionogi & Co., Ltd. Carboxyalkenamidocephalosporins
US4812561A (en) 1986-07-02 1989-03-14 Shionogi & Co., Ltd. Crystalline hydrate of oral cephalosporin and its composition
WO1989004669A1 (en) 1987-11-18 1989-06-01 Chiron Corporation Nanbv diagnostics and vaccines
EP0381216A1 (en) 1989-02-01 1990-08-08 Asahi Glass Company Ltd. Hydrochlorofluorocarbon azeotropic or azeotropic-like mixture
US5017380A (en) 1986-07-02 1991-05-21 Shionogi & Co., Ltd. Gelatin hard capsule containing crystalline hydrate of oral cephalosporin
WO1998014181A1 (en) 1996-09-30 1998-04-09 Regents Of The University Of California Treatment and prevention of hepatic disorders
WO1998017679A1 (en) 1996-10-18 1998-04-30 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hepatitis c virus ns3 protease
WO1998022496A2 (en) 1996-11-18 1998-05-28 F. Hoffmann-La Roche Ag Antiviral peptide derivatives
WO1999007734A2 (en) 1997-08-11 1999-02-18 Boehringer Ingelheim (Canada) Ltd. Hepatitis c inhibitor peptide analogues
US20020068702A1 (en) 2000-07-21 2002-06-06 Marguerita Lim-Wilby Novel peptides as NS3-serine protease inhibitors of hepatitis C virus
US20020160962A1 (en) 2000-07-21 2002-10-31 Saksena Anil K. Novel peptides as NS3-serine protease inhibitors of hepatitis C virus
WO2003006490A1 (en) 2001-07-11 2003-01-23 Vertex Pharmaceuticals Incorporated Bridged bicyclic serine protease inhibitors
WO2003087092A2 (en) 2002-04-11 2003-10-23 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hepatitis c virus ns3 - ns4 protease
WO2004039859A1 (en) 2002-10-30 2004-05-13 Sumitomo Chemical Company, Limited High-molecular compounds and polymerer light emitting devices made by using the same
US6767991B1 (en) 1997-08-11 2004-07-27 Boehringer Ingelheim (Canada) Ltd. Hepatitis C inhibitor peptides
US6800434B2 (en) 2000-07-21 2004-10-05 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
WO2004092161A1 (en) 2003-04-11 2004-10-28 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hcv ns3-ns4a protease
US6838475B2 (en) 2000-07-21 2005-01-04 Schering Corporation Imidazolidinones as NS3-serine protease inhibitors of hepatitis C virus
US6846802B2 (en) 2000-04-05 2005-01-25 Schering Corporation Macrocyclic NS3-serine protease inhibitors of hepatitis C virus comprising N-cyclic P2 moieties
US20050038037A1 (en) 2001-06-06 2005-02-17 Schering Aktiengesellschaft Platelet adenosine diphosphate receptor antagonists
US20050101770A1 (en) 2003-11-10 2005-05-12 Presta Leonard G. Interleukin-10 antibodies
US6894072B2 (en) 2002-01-23 2005-05-17 Schering Corporation Compounds as NS3-serine protease inhibitors of hepatitis C virus
US20050119168A1 (en) 2003-09-26 2005-06-02 Schering Corporation Macrocyclic inhibitors of hepatitis C virus NS3-serine protease
US6911428B2 (en) 2000-12-12 2005-06-28 Schering Corporation Diaryl peptides as NS3-serine protease inhibitors of hepatitis C virus
US6914122B2 (en) 2000-04-19 2005-07-05 Schering Corporation Macrocyclic NS-3 serine protease inhibitors of hepatitis C virus comprising alkyl and aryl alanine P2 moieties
US20050209164A1 (en) 2004-02-27 2005-09-22 Schering Corporation Cyclobutenedione-containing compounds as inhibitors of hepatitis C virus NS3 serine protease
WO2005087731A1 (en) 2004-02-27 2005-09-22 Schering Corporation Sulfur compounds as inhibitors of hepatitis c virus ns3 serine protease
US20050249702A1 (en) 2004-05-06 2005-11-10 Schering Corporation (1R,2S,5S)-N-[(1S)-3-amino-1-(cyclobutylmethyl)-2,3-dioxopropyl]-3-[(2S)-2-[[[(1,1-dimethylethyl)amino]carbonyl]amino]-3,3-dimethyl-1-oxobutyl]-6,6-dimethyl-3-azabicyclo[3.1.0]hexane-2-carboxamide as inhibitor of hepatitis C virus NS3/NS4a serine protease
WO2006019832A1 (en) 2004-07-22 2006-02-23 Ptc Therapeutics, Inc. Thienopyridines for treating hepatitis c
WO2006019831A1 (en) 2004-07-14 2006-02-23 Ptc Therapeutics, Inc. Methods for treating hepatitis c
US7012066B2 (en) 2000-07-21 2006-03-14 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US20060276511A1 (en) 2005-06-06 2006-12-07 Michael Serrano-Wu Inhibitors of HCV replication
US7173057B2 (en) 2004-02-27 2007-02-06 Schering Corporation Ketoamides with cyclic P4'S as inhibitors of NS3 protease of hepatitis C virus
US7186747B2 (en) 2004-02-27 2007-03-06 Schering Corporation Compounds as inhibitors of hepatitis C virus NS3 serine protease
US7192957B2 (en) 2004-02-27 2007-03-20 Schering Corporation Compounds as inhibitors of hepatitis C virus NS3 serine protease
US7205330B2 (en) 2004-02-27 2007-04-17 Schering Corporation Inhibitors of hepatitis C virus NS3 protease
US7244721B2 (en) 2000-07-21 2007-07-17 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US7253160B2 (en) 2003-11-20 2007-08-07 Schering Corporation Depeptidized inhibitors of hepatitis C virus NS3 protease
US20070274951A1 (en) 2006-02-09 2007-11-29 Xiao Tong Combinations comprising HCV protease inhibitor(s) and HCV polymerase inhibitor(s), and methods of treatment related thereto
US20080044380A1 (en) 2006-08-11 2008-02-21 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
US20080044379A1 (en) 2006-08-11 2008-02-21 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
US20080050336A1 (en) 2006-08-11 2008-02-28 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
US7342041B2 (en) 2004-02-27 2008-03-11 Schering Corporation 3,4-(cyclopentyl)-fused proline compounds as inhibitors of hepatitis C virus NS3 serine protease
WO2008082488A1 (en) 2006-12-22 2008-07-10 Schering Corporation 4, 5-ring annulated indole derivatives for treating or preventing of hcv and related viral infections
WO2008082484A1 (en) 2006-12-22 2008-07-10 Schering Corporation 4,5-ring annulated indole derivatives for treating or preventing of hcv and related viral infections
WO2008083351A2 (en) 2006-12-29 2008-07-10 Genifuel Corporation Controlled growth environments for algae cultivation
WO2008124148A2 (en) 2007-04-10 2008-10-16 Schering Corporation Sulfur compounds as inhiibitors of hepatitis c virus ns3 serine protease
US7449447B2 (en) 2003-08-26 2008-11-11 Schering Corporation Peptidomimetic NS3-serine protease inhibitors of hepatitis C virus
WO2008136815A2 (en) 2006-12-22 2008-11-13 Schering Corporation 5, 6-ring annulated indole derivatives and use thereof
US20080311075A1 (en) 2007-05-17 2008-12-18 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
US7476686B2 (en) 2002-11-19 2009-01-13 Achillion Pharmaceuticals, Inc. Substituted aryl thioureas and related compounds; inhibitors of viral replication
US20090022688A1 (en) 2003-04-11 2009-01-22 Farmer Luc J Inhibitors of serine protease, particularly hcv ns3-ns4a protease
US20090020478A1 (en) 2007-07-19 2009-01-22 Bayer Material Science Ag Processes for the regeneration of an anion exchanger loaded with hexachlorostannate
US7485625B2 (en) 2003-12-11 2009-02-03 Schering Corporation Inhibitors of hepatitis C virus NS3/NS4a serine protease
US7494988B2 (en) 2000-04-03 2009-02-24 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hepatitis C virus NS3 protease
WO2009032124A1 (en) 2007-08-29 2009-03-12 Schering Corporation Substituted indole derivatives and methods of use thereof
WO2009032125A1 (en) 2007-08-29 2009-03-12 Schering Corporation 2,3-substituted azaindole derivatives for treating viral infections
US20090068140A1 (en) 2006-08-11 2009-03-12 Bristol-Myers Squibb Company Hepatitis c virus inhibitors
WO2009032116A1 (en) 2007-08-29 2009-03-12 Schering Corporation 2, 3-substituted indole derivatives for treating viral infections
WO2009032123A2 (en) 2007-08-29 2009-03-12 Schering Corporation Tetracyclic indole derivatives and their use for treating or preventing viral infections
US20090081636A1 (en) 2005-04-11 2009-03-26 Mingjun Huang Pharmaceutical compositions for and methods of inhibiting HCV replication
CN101462999A (en) 2007-12-21 2009-06-24 上海药明康德新药开发有限公司 Fluoro or difluoro-2-azabicyclo [2.2.1] heptane-3-carboxyl acid derivatives, and preparation thereof
US20090202483A1 (en) 2008-02-13 2009-08-13 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
WO2009102633A1 (en) * 2008-02-13 2009-08-20 Bristol-Myers Squibb Company Hepatitis c virus inhibitors
WO2010065681A1 (en) 2008-12-03 2010-06-10 Presidio Pharmaceuticals, Inc. Inhibitors of hcv ns5a
WO2010065674A1 (en) 2008-12-03 2010-06-10 Presidio Pharmaceuticals, Inc. Inhibitors of hcv ns5a

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5935982A (en) * 1997-02-28 1999-08-10 The University Of North Carolina At Chapel Hill Methods of treating retroviral infection and compounds useful therefor
US6183121B1 (en) * 1997-08-14 2001-02-06 Vertex Pharmaceuticals Inc. Hepatitis C virus helicase crystals and coordinates that define helicase binding pockets
AU1099000A (en) 1998-10-05 2000-04-26 Axys Pharmaceuticals, Inc. Novel compounds and compositions for treating hepatitis c infections
TR200103147T1 (en) * 1999-12-27 2002-06-21 Japan Tobacco Inc. Fused ring compounds and their use as drugs.
US7547702B2 (en) * 2000-09-20 2009-06-16 Ortho-Mcneil Pharmaceutical, Inc. 4-amino-quinazolines
JP2007504152A (en) * 2003-08-27 2007-03-01 ビオタ， インコーポレイテッド Novel tricyclic nucleosides or nucleotides as therapeutic agents
US20070049593A1 (en) * 2004-02-24 2007-03-01 Japan Tobacco Inc. Tetracyclic fused heterocyclic compound and use thereof as HCV polymerase inhibitor
US7153848B2 (en) * 2004-08-09 2006-12-26 Bristol-Myers Squibb Company Inhibitors of HCV replication
US7994360B2 (en) * 2005-05-16 2011-08-09 Xtl Biopharmaceuticals Ltd. Benzofuran compounds
US7473784B2 (en) * 2005-08-01 2009-01-06 Bristol-Myers Squibb Company Benzothiazole and azabenzothiazole compounds useful as kinase inhibitors
TW200831084A (en) * 2006-11-21 2008-08-01 Genelabs Tech Inc Anti-viral compounds
WO2008098368A1 (en) * 2007-02-16 2008-08-21 Boehringer Ingelheim International Gmbh Inhibitors of hepatitis c ns3 protease
US7906655B2 (en) * 2008-08-07 2011-03-15 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US8420686B2 (en) * 2009-02-17 2013-04-16 Enanta Pharmaceuticals, Inc. Linked diimidazole antivirals
CA2753313A1 (en) 2009-02-23 2010-08-26 Presidio Pharmaceuticals, Inc. Inhibitors of hcv ns5a
US8101643B2 (en) * 2009-02-27 2012-01-24 Enanta Pharmaceuticals, Inc. Benzimidazole derivatives
US8426458B2 (en) * 2009-02-27 2013-04-23 Enanta Pharmaceuticals, Inc. Hepatitis C Virus inhibitors
EA020898B1 (en) * 2009-03-27 2015-02-27 Мерк Шарп Энд Домэ Корп. Inhibitors of hepatitis c virus replication
EP2430015B1 (en) * 2009-05-12 2015-06-17 Merck Sharp & Dohme Corp. Fused tricyclic compounds useful for the treatment of viral diseases
WO2010138791A1 (en) * 2009-05-29 2010-12-02 Schering Corporation Antiviral compounds composed of three linked aryl moieties to treat diseases such as hepatitis c
JP2012528194A (en) 2009-05-29 2012-11-12 メルク・シャープ・アンド・ドーム・コーポレーション Antibacterial compounds composed of three aligned aryl moieties for treating diseases such as hepatitis C
US8221737B2 (en) * 2009-06-16 2012-07-17 Enanta Pharmaceuticals, Inc. Hepatitis C virus inhibitors
JP2013512246A (en) * 2009-11-25 2013-04-11 メルク・シャープ・アンド・ドーム・コーポレーション Condensed tricyclic compounds and derivatives useful for the treatment of viral diseases
US8377980B2 (en) 2009-12-16 2013-02-19 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US20130156731A1 (en) * 2009-12-22 2013-06-20 Kevin X. Chen Fused tricyclic compounds and methods of use thereof for the treatment of viral diseas
MA34147B1 (en) 2010-03-09 2013-04-03 Merck Sharp & Dohme SILYL FUSIONED TRICYCLIC COMPOUNDS AND METHODS OF USE IN THE TREATMENT OF VIRAL DISEASES

Patent Citations (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4634697A (en) 1983-10-04 1987-01-06 Shionogi & Co., Ltd. Carboxyalkenamidocephalosporins
US4812561A (en) 1986-07-02 1989-03-14 Shionogi & Co., Ltd. Crystalline hydrate of oral cephalosporin and its composition
US4933443A (en) 1986-07-02 1990-06-12 Shionogi & Co., Ltd. Method for preparing crystalline hydrate of oral celphalosporin and its composition
US5017380A (en) 1986-07-02 1991-05-21 Shionogi & Co., Ltd. Gelatin hard capsule containing crystalline hydrate of oral cephalosporin
WO1989004669A1 (en) 1987-11-18 1989-06-01 Chiron Corporation Nanbv diagnostics and vaccines
EP0381216A1 (en) 1989-02-01 1990-08-08 Asahi Glass Company Ltd. Hydrochlorofluorocarbon azeotropic or azeotropic-like mixture
WO1998014181A1 (en) 1996-09-30 1998-04-09 Regents Of The University Of California Treatment and prevention of hepatic disorders
WO1998017679A1 (en) 1996-10-18 1998-04-30 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hepatitis c virus ns3 protease
WO1998022496A2 (en) 1996-11-18 1998-05-28 F. Hoffmann-La Roche Ag Antiviral peptide derivatives
WO1999007734A2 (en) 1997-08-11 1999-02-18 Boehringer Ingelheim (Canada) Ltd. Hepatitis c inhibitor peptide analogues
US6767991B1 (en) 1997-08-11 2004-07-27 Boehringer Ingelheim (Canada) Ltd. Hepatitis C inhibitor peptides
US7494988B2 (en) 2000-04-03 2009-02-24 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hepatitis C virus NS3 protease
US6846802B2 (en) 2000-04-05 2005-01-25 Schering Corporation Macrocyclic NS3-serine protease inhibitors of hepatitis C virus comprising N-cyclic P2 moieties
US6914122B2 (en) 2000-04-19 2005-07-05 Schering Corporation Macrocyclic NS-3 serine protease inhibitors of hepatitis C virus comprising alkyl and aryl alanine P2 moieties
US6800434B2 (en) 2000-07-21 2004-10-05 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US7244721B2 (en) 2000-07-21 2007-07-17 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US7169760B2 (en) 2000-07-21 2007-01-30 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US6838475B2 (en) 2000-07-21 2005-01-04 Schering Corporation Imidazolidinones as NS3-serine protease inhibitors of hepatitis C virus
US7012066B2 (en) 2000-07-21 2006-03-14 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US20020068702A1 (en) 2000-07-21 2002-06-06 Marguerita Lim-Wilby Novel peptides as NS3-serine protease inhibitors of hepatitis C virus
US20020160962A1 (en) 2000-07-21 2002-10-31 Saksena Anil K. Novel peptides as NS3-serine protease inhibitors of hepatitis C virus
US20050176648A1 (en) 2000-07-21 2005-08-11 Schering-Plough Corporation Novel peptides as NS3-serine protease inhibitors of hepatitis C virus
US6911428B2 (en) 2000-12-12 2005-06-28 Schering Corporation Diaryl peptides as NS3-serine protease inhibitors of hepatitis C virus
US20050038037A1 (en) 2001-06-06 2005-02-17 Schering Aktiengesellschaft Platelet adenosine diphosphate receptor antagonists
WO2003006490A1 (en) 2001-07-11 2003-01-23 Vertex Pharmaceuticals Incorporated Bridged bicyclic serine protease inhibitors
US6894072B2 (en) 2002-01-23 2005-05-17 Schering Corporation Compounds as NS3-serine protease inhibitors of hepatitis C virus
WO2003087092A2 (en) 2002-04-11 2003-10-23 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hepatitis c virus ns3 - ns4 protease
US7273885B2 (en) 2002-04-11 2007-09-25 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly HCV NS3-NS4A protease
WO2004039859A1 (en) 2002-10-30 2004-05-13 Sumitomo Chemical Company, Limited High-molecular compounds and polymerer light emitting devices made by using the same
US7476686B2 (en) 2002-11-19 2009-01-13 Achillion Pharmaceuticals, Inc. Substituted aryl thioureas and related compounds; inhibitors of viral replication
US20090022688A1 (en) 2003-04-11 2009-01-22 Farmer Luc J Inhibitors of serine protease, particularly hcv ns3-ns4a protease
WO2004092161A1 (en) 2003-04-11 2004-10-28 Vertex Pharmaceuticals Incorporated Inhibitors of serine proteases, particularly hcv ns3-ns4a protease
US7449447B2 (en) 2003-08-26 2008-11-11 Schering Corporation Peptidomimetic NS3-serine protease inhibitors of hepatitis C virus
US20050119168A1 (en) 2003-09-26 2005-06-02 Schering Corporation Macrocyclic inhibitors of hepatitis C virus NS3-serine protease
US20050101770A1 (en) 2003-11-10 2005-05-12 Presta Leonard G. Interleukin-10 antibodies
US7442695B2 (en) 2003-11-20 2008-10-28 Schering Corporation Depeptidized inhibitors of hepatitis C virus NS3 protease
US7253160B2 (en) 2003-11-20 2007-08-07 Schering Corporation Depeptidized inhibitors of hepatitis C virus NS3 protease
US7485625B2 (en) 2003-12-11 2009-02-03 Schering Corporation Inhibitors of hepatitis C virus NS3/NS4a serine protease
US7173057B2 (en) 2004-02-27 2007-02-06 Schering Corporation Ketoamides with cyclic P4'S as inhibitors of NS3 protease of hepatitis C virus
US7186747B2 (en) 2004-02-27 2007-03-06 Schering Corporation Compounds as inhibitors of hepatitis C virus NS3 serine protease
US7425576B2 (en) 2004-02-27 2008-09-16 Schering Corporation Compounds as inhibitors of hepatitis C virus NS3 serine protease
US7192957B2 (en) 2004-02-27 2007-03-20 Schering Corporation Compounds as inhibitors of hepatitis C virus NS3 serine protease
WO2005087731A1 (en) 2004-02-27 2005-09-22 Schering Corporation Sulfur compounds as inhibitors of hepatitis c virus ns3 serine protease
US7205330B2 (en) 2004-02-27 2007-04-17 Schering Corporation Inhibitors of hepatitis C virus NS3 protease
US7342041B2 (en) 2004-02-27 2008-03-11 Schering Corporation 3,4-(cyclopentyl)-fused proline compounds as inhibitors of hepatitis C virus NS3 serine protease
US20070042968A1 (en) 2004-02-27 2007-02-22 Schering Corporation Sulfur compounds as inhibitors of Hepatitis C virus NS3 serine protease
US20050209164A1 (en) 2004-02-27 2005-09-22 Schering Corporation Cyclobutenedione-containing compounds as inhibitors of hepatitis C virus NS3 serine protease
US20050249702A1 (en) 2004-05-06 2005-11-10 Schering Corporation (1R,2S,5S)-N-[(1S)-3-amino-1-(cyclobutylmethyl)-2,3-dioxopropyl]-3-[(2S)-2-[[[(1,1-dimethylethyl)amino]carbonyl]amino]-3,3-dimethyl-1-oxobutyl]-6,6-dimethyl-3-azabicyclo[3.1.0]hexane-2-carboxamide as inhibitor of hepatitis C virus NS3/NS4a serine protease
WO2006019831A1 (en) 2004-07-14 2006-02-23 Ptc Therapeutics, Inc. Methods for treating hepatitis c
WO2006019832A1 (en) 2004-07-22 2006-02-23 Ptc Therapeutics, Inc. Thienopyridines for treating hepatitis c
US20090081636A1 (en) 2005-04-11 2009-03-26 Mingjun Huang Pharmaceutical compositions for and methods of inhibiting HCV replication
US20060276511A1 (en) 2005-06-06 2006-12-07 Michael Serrano-Wu Inhibitors of HCV replication
US20070274951A1 (en) 2006-02-09 2007-11-29 Xiao Tong Combinations comprising HCV protease inhibitor(s) and HCV polymerase inhibitor(s), and methods of treatment related thereto
US20080044379A1 (en) 2006-08-11 2008-02-21 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
US20090068140A1 (en) 2006-08-11 2009-03-12 Bristol-Myers Squibb Company Hepatitis c virus inhibitors
US20080050336A1 (en) 2006-08-11 2008-02-28 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
US20080044380A1 (en) 2006-08-11 2008-02-21 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
WO2008136815A2 (en) 2006-12-22 2008-11-13 Schering Corporation 5, 6-ring annulated indole derivatives and use thereof
WO2008082484A1 (en) 2006-12-22 2008-07-10 Schering Corporation 4,5-ring annulated indole derivatives for treating or preventing of hcv and related viral infections
WO2008082488A1 (en) 2006-12-22 2008-07-10 Schering Corporation 4, 5-ring annulated indole derivatives for treating or preventing of hcv and related viral infections
WO2008083351A2 (en) 2006-12-29 2008-07-10 Genifuel Corporation Controlled growth environments for algae cultivation
WO2008124148A2 (en) 2007-04-10 2008-10-16 Schering Corporation Sulfur compounds as inhiibitors of hepatitis c virus ns3 serine protease
US20080311075A1 (en) 2007-05-17 2008-12-18 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
US20090020478A1 (en) 2007-07-19 2009-01-22 Bayer Material Science Ag Processes for the regeneration of an anion exchanger loaded with hexachlorostannate
WO2009032125A1 (en) 2007-08-29 2009-03-12 Schering Corporation 2,3-substituted azaindole derivatives for treating viral infections
WO2009032116A1 (en) 2007-08-29 2009-03-12 Schering Corporation 2, 3-substituted indole derivatives for treating viral infections
WO2009032123A2 (en) 2007-08-29 2009-03-12 Schering Corporation Tetracyclic indole derivatives and their use for treating or preventing viral infections
WO2009032124A1 (en) 2007-08-29 2009-03-12 Schering Corporation Substituted indole derivatives and methods of use thereof
CN101462999A (en) 2007-12-21 2009-06-24 上海药明康德新药开发有限公司 Fluoro or difluoro-2-azabicyclo [2.2.1] heptane-3-carboxyl acid derivatives, and preparation thereof
US20090202483A1 (en) 2008-02-13 2009-08-13 Bristol-Myers Squibb Company Hepatitis C Virus Inhibitors
WO2009102633A1 (en) * 2008-02-13 2009-08-20 Bristol-Myers Squibb Company Hepatitis c virus inhibitors
WO2010065681A1 (en) 2008-12-03 2010-06-10 Presidio Pharmaceuticals, Inc. Inhibitors of hcv ns5a
WO2010065668A1 (en) 2008-12-03 2010-06-10 Presidio Pharmaceuticals, Inc. Inhibitors of hcv ns5a
WO2010065674A1 (en) 2008-12-03 2010-06-10 Presidio Pharmaceuticals, Inc. Inhibitors of hcv ns5a

Non-Patent Citations (53)

* Cited by examiner, † Cited by third party
Title
"Bioreversible Carriers in Drug Design", 1987, AMERICAN PHARMACEUTICAL ASSOCIATION AND PERGAMON PRESS
"Comprehensive Heterocyclic Chemistry", ELSEVIER
"Comprehensive Organic Chemistry", ELSEVIER
"Comprehensive Organic Functional Group Transformations"
"Comprehensive Organic Transformation", WILY-CVH
"Handbook of Pharmaceutical Salts. Properties, Selection and Use", 2002, WILEY-VCH
"The Orange Book", FOOD & DRUG ADMINISTRATION
A. L. BINGHAM ET AL., CHEM. COMMUN., 2001, pages 603 - 604
ANDERSON ET AL.: "The Practice of Medicinal Chemistry", 1996, ACADEMIC PRESS
ANGEW CHEM. INT. ED. ENGL., vol. 40, 2001, pages 4544
BEAULIEU ET AL., CURRENT OPINION IN INVESTIGATIONAL DRUGS, vol. 5, 2004, pages 838
BIO WORLD TODAY, vol. 9, no. 217, 10 November 1998 (1998-11-10), pages 4
CHOSHI ET AL., J ORG. CHEM., vol. 62, 1997, pages 2535 - 2543
DIMASI ET AL., J VIROL, vol. 71, no. 10, 1997, pages 7461 - 7469
E. C. VAN TONDER ET AL., AAPS PHARMSCITECHOURS., vol. 5, no. 1, 2004
ELZOUKI ET AL., J HEPAT, vol. 271, 1997, pages 42 - 48
FANTA ET AL., SYNTH., 1974, pages 9 - 21
GREENE ET AL.: "Protective Groups in Organic Synthesis", 1999, WILEY-INTERSCIENCE
GUDASHEVA ET AL., J. MED. CHEM THER., vol. 31, 1996, pages 151
HAMADA ET AL., ORGANIC LETTERS, vol. 20, 2009, pages 4664 - 4667
HOLLAND ET AL., PATHOLOGY, vol. 30, no. 2, 1998, pages 192 - 195
HUANG, Y ET AL., VIROLOGY, vol. 364, 2007, pages 1 - 9
INGALLINELLA ET AL., BIOCHEMISTRY, vol. 37, no. 25, 1998, pages 8906 - 8914
J. AM. CHEM. SOC, vol. 73, 1997, pages 4297
JAN M. VROLIJK ET AL.: "A replicons-based bioassay for the measurement of interferons inpatients with chronic hepatitis C", J. VIROLOGICAL METHODS, vol. 110, 2003, pages 201
K. DEL CARMEN ET AL., ANNALS OF HEPATOLOGY, vol. 3, 2004, pages 54
KATO ET AL., GASTROENTEROLOGY., vol. 125, no. 6, 2003, pages 1808 - 17
KRICKA ET AL., CHEM. REW., vol. 74, 1974, pages 101 - 123
KRICKA ET AL., J. CHEM. SOC. PERKIN TRANS I, 1973, pages 859 - 863
KRICKA ET AL., J. CHEM. SOC. PERKIN TRANS L, 1973, pages 859 - 863
KURFUERST ET AL., COLL. CZECH. CHEM. COMM., vol. 54, 1989, pages 1705 - 1715
LAMBALLERIE ET AL., J GEN VIROL, vol. 78, no. 1, 1997, pages 45 - 51
LANDRO, BIOCHEMISTRY, vol. 36, no. 31, 1997, pages 9340 - 9348
LLINÀS-BRUNET ET AL., BIOORG MED CHEM LETT, vol. 8, no. 13, 1998, pages 1713 - 1718
LOHMANN ET AL., SCIENCE, vol. 285, no. 5424, 1999, pages 110 - 3
M. CAIRA ET AL., J. PHARMACEUTICAL SCI., vol. 93, no. 3, 2004, pages 601 - 611
MALCOLM ET AL., ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 50, 2006, pages 1013 - 1020
MARTIN ET AL., BIOCHEMISTRY, vol. 37, no. 33, 1998, pages 11459 - 11468
MARTIN ET AL., PROTEIN ENG, vol. 10, no. 5, 1997, pages 607 - 614
NI ET AL., CURRENT OPINION IN DRUG DISCOVERY AND DEVELOPMENT, vol. 7, no. 4, 2004, pages 446
P. GOULD, INTERNATIONAL J. OF PHARMACEUTICS, vol. 33, 1986, pages 201 - 217
PIETSCHMANN, T.; BARTENSCHLAGER, R., CURRENT OPINION IN DRUG DISCOVERY RESEARCH, vol. 4, 2001, pages 657 - 664
S. BERGE ET AL., JOURNAL OF PHARMACEUTICAL SCIENCES, vol. 66, no. 1, 1977, pages 1 - 19
SAROJA ET AL., J. ORG. CHEM., vol. 69, 2004, pages 987 - 990
SCOTT ET AL., J. AM. CHEM. SOC., vol. 106, 1984, pages 4630
SIMMONDS ET AL., J GEN VIROL, vol. 74, no. 11, 1993, pages 2391 - 2399
SIMMONDS ET AL., J GEN VIROL, vol. 75, no. 5, 1994, pages 1053 - 1061
STEVEN S. CARROLL ET AL.: "lnhibition of Hepatitis C Virus RNA Replication by 2'-Modified Nucleoside Analogs", J. BIOLOGICAL CHEMISTRY, vol. 278, no. 14, 2003, pages 11979, XP002316770, DOI: doi:10.1074/jbc.M210914200
T. HIGUCHI; V. STELLA, PRO-DRUGS AS NOVEL DELIVERY SYSTEMS, vol. 14, 1987
T. W. GREENE ET AL.: "Protective Groups in Organic Synthesis", 1991, WILEY
TAN ET AL., NATURE REVIEWS, vol. 1, 2002, pages 867
TANJI ET AL., J. VIROL., vol. 69, 1995, pages 3980 - 3986
YI ET AL., J VIRAL., vol. 78, no. 15, 2004, pages 7904 - 15

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8541424B2 (en) 2008-12-23 2013-09-24 Abbott Laboratories Anti-viral compounds
US8546405B2 (en) 2008-12-23 2013-10-01 Abbott Laboratories Anti-viral compounds
US9249138B2 (en) 2008-12-23 2016-02-02 Abbvie Inc. Anti-viral compounds
US9163017B2 (en) 2008-12-23 2015-10-20 Abbvie Inc. Anti-viral compounds
US9278922B2 (en) 2009-04-15 2016-03-08 Abbvie Inc. Anti-viral compounds
US8822430B2 (en) 2009-05-13 2014-09-02 Gilead Pharmasset Llc Antiviral compounds
US9981955B2 (en) 2009-05-13 2018-05-29 Gilead Pharmasset Llc Antiviral compounds
US8669234B2 (en) 2009-05-13 2014-03-11 Gilead Sciences, Inc. Antiviral compounds
US9511056B2 (en) 2009-05-13 2016-12-06 Gilead Pharmasset Llc Antiviral compounds
US8841278B2 (en) 2009-05-13 2014-09-23 Gilead Pharmasset Llc Antiviral compounds
US8921514B2 (en) 2009-06-11 2014-12-30 Abbvie Inc. Anti-viral compounds
US8716454B2 (en) 2009-06-11 2014-05-06 Abbvie Inc. Solid compositions
US9586978B2 (en) 2009-06-11 2017-03-07 Abbvie Inc. Anti-viral compounds
US8691938B2 (en) 2009-06-11 2014-04-08 Abbvie Inc. Anti-viral compounds
US8937150B2 (en) 2009-06-11 2015-01-20 Abbvie Inc. Anti-viral compounds
US9394279B2 (en) 2009-06-11 2016-07-19 Abbvie Inc. Anti-viral compounds
US10028937B2 (en) 2009-06-11 2018-07-24 Abbvie Inc. Anti-viral compounds
US10039754B2 (en) 2009-06-11 2018-08-07 Abbvie Inc. Anti-viral compounds
US8765731B2 (en) 2009-07-16 2014-07-01 Vertex Pharmaceuticals Incorporated Benzimidazole analogues for the treatment or prevention of flavivirus infections
US8779156B2 (en) 2010-03-24 2014-07-15 Vertex Pharmaceuticals Incorporated Analogues for the treatment or prevention of flavivirus infections
US8686026B2 (en) 2010-06-10 2014-04-01 Abbvie Inc. Solid compositions
US9932326B2 (en) 2010-08-26 2018-04-03 Cocrystal Pharma, LLC Potent and selective inhibitors of hepatitis C virus
US9181227B2 (en) 2010-08-26 2015-11-10 Cocrystal Pharma, Inc. Potent and selective inhibitors of hepatitis C virus
US8859595B2 (en) 2010-08-26 2014-10-14 Rfs Pharma, Llc Potent and selective inhibitors of hepatitis C virus
US9309260B2 (en) 2010-10-26 2016-04-12 Presidio Pharmaceuticals, Inc. Inhibitors of hepatitis C virus
JP2014500861A (en) * 2010-10-26 2014-01-16 プレシディオ ファーマシューティカルズ インコーポレイテッド Hepatitis C virus inhibitor
US9085587B2 (en) 2010-10-26 2015-07-21 Presidio Pharmaceuticals, Inc. Inhibitors of hepatitis C virus
US9156823B2 (en) 2010-11-17 2015-10-13 Gilead Pharmasset Llc Antiviral compounds
US10344019B2 (en) 2010-11-17 2019-07-09 Gilead Pharmasset Llc Antiviral compounds
WO2012068234A3 (en) * 2010-11-17 2013-01-17 12Gilead Sciences, Inc. Antiviral compounds
US9340520B2 (en) 2011-02-07 2016-05-17 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US8552047B2 (en) 2011-02-07 2013-10-08 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US9546160B2 (en) 2011-05-12 2017-01-17 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US10201584B1 (en) 2011-05-17 2019-02-12 Abbvie Inc. Compositions and methods for treating HCV
US10201541B1 (en) 2011-05-17 2019-02-12 Abbvie Inc. Compositions and methods for treating HCV
US20150057246A1 (en) * 2011-09-14 2015-02-26 Michael P. Dwyer Silyl-containing heterocyclic compounds and methods of use thereof for the treatment of viral diseases
EP2755982A4 (en) * 2011-09-14 2015-03-25 Merck Sharp & Dohme Silyl-containing heterocyclic compounds and methods of use thereof for the treatment of viral diseases
US10456414B2 (en) 2011-09-16 2019-10-29 Gilead Pharmasset Llc Methods for treating HCV
US9393256B2 (en) 2011-09-16 2016-07-19 Gilead Pharmasset Llc Methods for treating HCV
US9221833B2 (en) 2011-11-16 2015-12-29 Gilead Pharmasset Llc Antiviral compounds
US8921341B2 (en) 2011-11-16 2014-12-30 Gilead Pharmasset Llc Antiviral compounds
US9051340B2 (en) 2011-11-16 2015-06-09 Gilead Pharmasset Llc Antiviral compounds
US9809600B2 (en) 2011-11-16 2017-11-07 Gilead Pharmasset Llc Antiviral compounds
US9868745B2 (en) 2011-11-16 2018-01-16 Gilead Pharmasset Llc Antiviral compounds
US8940718B2 (en) 2011-11-16 2015-01-27 Gilead Pharmasset Llc Antiviral compounds
US10807990B2 (en) 2011-11-16 2020-10-20 Gilead Pharmasset Llc Antiviral compounds
US8575135B2 (en) 2011-11-16 2013-11-05 Gilead Sciences, Inc. Antiviral compounds
US9034832B2 (en) 2011-12-29 2015-05-19 Abbvie Inc. Solid compositions
US9326973B2 (en) 2012-01-13 2016-05-03 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US10800789B2 (en) 2012-05-16 2020-10-13 Gilead Pharmasset Llc Antiviral compounds
US10039779B2 (en) 2013-01-31 2018-08-07 Gilead Pharmasset Llc Combination formulation of two antiviral compounds
US11484534B2 (en) 2013-03-14 2022-11-01 Abbvie Inc. Methods for treating HCV
US9717712B2 (en) 2013-07-02 2017-08-01 Bristol-Myers Squibb Company Combinations comprising tricyclohexadecahexaene derivatives for use in the treatment of hepatitis C virus
US9770439B2 (en) 2013-07-02 2017-09-26 Bristol-Myers Squibb Company Hepatitis C virus inhibitors
US9775831B2 (en) 2013-07-17 2017-10-03 Bristol-Myers Squibb Company Combinations comprising biphenyl derivatives for use in the treatment of HCV
US10086011B2 (en) 2013-08-27 2018-10-02 Gilead Pharmasset Llc Combination formulation of two antiviral compounds
US11116783B2 (en) 2013-08-27 2021-09-14 Gilead Pharmasset Llc Combination formulation of two antiviral compounds
US11707479B2 (en) 2013-08-27 2023-07-25 Gilead Sciences, Inc. Combination formulation of two antiviral compounds
US10105365B2 (en) 2014-01-03 2018-10-23 Abbvie Inc. Solid antiviral dosage forms
US9744170B2 (en) 2014-01-03 2017-08-29 Abbvie Inc. Solid antiviral dosage forms
US9333204B2 (en) 2014-01-03 2016-05-10 Abbvie Inc. Solid antiviral dosage forms
US11203599B2 (en) 2014-06-11 2021-12-21 Gilead Pharmasset Llc Solid forms of an antiviral compound
US10617675B2 (en) 2015-08-06 2020-04-14 Bristol-Myers Squibb Company Hepatitis C virus inhibitors

Also Published As

Publication number Publication date
AR080676A1 (en) 2012-05-02
EP2545060B1 (en) 2015-11-25
EP2545060A1 (en) 2013-01-16
SG183526A1 (en) 2012-09-27
CN102918049A (en) 2013-02-06
CL2012002489A1 (en) 2012-11-30
ZA201206716B (en) 2013-05-29
CR20120460A (en) 2012-11-01
ECSP12012147A (en) 2012-10-30
ES2558554T3 (en) 2016-02-05
US8609635B2 (en) 2013-12-17
DOP2012000243A (en) 2012-12-31
MA34147B1 (en) 2013-04-03
MX2012010392A (en) 2012-10-03
US20110223134A1 (en) 2011-09-15
BR112012022125A2 (en) 2016-11-01
AU2011224698A1 (en) 2012-11-01
NI201200139A (en) 2013-01-24
JP2013522202A (en) 2013-06-13
CO6592102A2 (en) 2013-01-02
EA201290882A1 (en) 2013-04-30
TN2012000416A1 (en) 2014-01-30
KR20130008040A (en) 2013-01-21
PE20130062A1 (en) 2013-02-28
CA2792121A1 (en) 2011-09-15
TW201136943A (en) 2011-11-01

Similar Documents

Publication Publication Date Title
EP2545060B1 (en) Fused tricyclic silyl compounds and methods of use thereof for the treatment of viral diseases
EP2621279B1 (en) Fused tetracycle derivatives and methods of use thereof for the treatment of viral diseases
EP2685984B1 (en) Tetracyclic xanthene derivatives and methods of use thereof for the treatment of viral diseases
EP2621932A1 (en) Tetracyclic heterocycle compounds for treating hepatitis c viral infection
EP2516430A1 (en) Fused tricyclic compounds and methods of use thereof for the treatment of viral diseases
WO2012040923A1 (en) Tetracyclic indole derivatives and methods of use thereof for the treatment of viral diseases
EP2435424A1 (en) Antiviral compounds composed of three linked aryl moieties to treat diseases such as hepatitis c
WO2012018534A2 (en) Substituted biphenylene compounds and methods of use thereof for the treatment of viral diseases
WO2012040924A1 (en) Fused tetracyclic heterocycle compounds and methods of use thereof for treatment of viral diseases
MX2013003631A (en) Tetracyclic indole derivatives for treating hepatitis c virus infection.
WO2012003642A1 (en) Fused tricyclic compounds and use thereof for treating viral diseases
WO2014110687A1 (en) Thiazolyl-substitued tetracyclic compounds and methods of use thereof for treatment of viral diseases
EP2755982A1 (en) Silyl-containing heterocyclic compounds and methods of use thereof for the treatment of viral diseases
EP2755981A1 (en) Silyl-containing heterocyclic compounds and methods of use thereof for the treatment of viral diseases
WO2014110688A1 (en) Thiophene- sub stitued tetracyclic compounds and methods of use thereof for the treatment of viral diseases
EP3393585A1 (en) Silane-containing heterocyclic compounds and methods of use thereof for the treatment of viral diseases

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180023353.8

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11707763

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 221485

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 7255/CHENP/2012

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2792121

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 12012501748

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 2012557114

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 001466-2012

Country of ref document: PE

Ref document number: MX/A/2012/010392

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 12155041

Country of ref document: CO

Ref document number: CR2012-000460

Country of ref document: CR

WWE Wipo information: entry into national phase

Ref document number: 1201004599

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 2011707763

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20127026331

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201290882

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 12867

Country of ref document: GE

ENP Entry into the national phase

Ref document number: 2011224698

Country of ref document: AU

Date of ref document: 20110304

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012022125

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012022125

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120831