WO2011110099A1

WO2011110099A1 - Enhanced plant-mediated rna interference in insects by utilizing cysteine protease

Info

Publication number: WO2011110099A1
Application number: PCT/CN2011/071718
Authority: WO
Inventors: 陈晓亚; 毛颖波; 薛学义; 林芝萍; 王凌健
Original assignee: 中国科学院上海生命科学研究院
Priority date: 2010-03-11
Filing date: 2011-03-11
Publication date: 2011-09-15
Also published as: CN102191267B; CN102191267A

Abstract

A method for enhancing plant-mediated RNA interference in insect by utilizing cysteine protease is provided, comprising: transferring constructs expressing dsRNA of insect's gene and constructs expressing cysteine protease of plants into plant cells, tissues or organs in order to express the said cysteine protease of plants and dsRNA of insect's gene in the plant cells, tissues or organs.

Description

Enhancement of plant-mediated insect RNA interference using cysteine proteases

The invention belongs to the field of biotechnology and botany. In particular, the invention relates to a method of enhancing plant-mediated insect RNA interference using a cysteine protease. Background technique

In agriculture, pest problems have always been an important factor affecting crop yields. Every year, people invest a lot of manpower and material resources to suppress pests to increase crop yields.

With the increased resistance of agricultural pests to pesticides and the consideration of environmental protection and sustainable development, new methods of insect resistance are urgently needed. The emergence of transgenic insect-resistant plants has alleviated this contradiction and made significant contributions to the development of agriculture, such as genetically modified insect-resistant soybeans and Bt insect-resistant cotton. However, research has been reported in succession. Over time, the resistance of various transgenic insect-resistant plants is declining, and the large-scale rare insect pests have begun to re-ignite. Therefore, there is an urgent need to find new ways to develop new transgenic insect-resistant plants to effectively and/or specifically combat plant pests and diseases.

The inventors have previously developed a method for inhibiting the growth of insects using a RNA interference mechanism using a plant as a carrier (Patent Application No.: 200610119029.7, the entire disclosure of which is incorporated herein by reference in its entirety). The method comprises introducing a forward and reverse insect gene (or fragment;) sequence into a plant, and expressing the dsRNA of the insect gene in the plant. When the insect feeds the transgenic plant, the target gene in the body is blocked by the RNA interference pathway. Inhibition, thereby inhibiting the growth and development of pests. Since a specific dsRNA can be designed based on the sequence of a particular gene of an insect, this technique can selectively inhibit the expression of specific genes in insects, opening up new directions for the development of more efficient and safe transgenic insect-resistant plants ( Mao et al., 2007). RNA interference efficiency and efficient target genes are key to the application of this technology.

However, further improvements are needed to increase the absorption of insects by molecules such as dsRNA, thereby increasing the effects of RNA interference. Summary of the invention

In view of the above problems, the inventors have found through research that plant cysteine protease can enhance the permeability of insect midgut to macromolecules such as dsRNA molecules and gossypol. Therefore, its combination with plant-mediated insect RNA interference technology can significantly enhance plant-mediated insect RNA interference.

A first aspect of the invention provides a plant-mediated insect using a cysteine protease A method of RNA interference, in which a plant expressing a dsRNA of an insect gene has been introduced into a cell, the method comprising transferring a construct expressing a plant cysteine protease into a cell, tissue or organ of the plant .

The present invention provides a method for enhancing plant-mediated insect RNA interference using a cysteine protease, the method comprising transferring a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease into a plant cell In the tissue, organ or organ, thereby expressing the plant cysteine protease and the dsRNA of the insect gene in a plant cell, tissue or organ.

Preferably, the herbivorous insect is a lepidopteran insect.

Another aspect of the present invention provides a method for improving plant resistance to insects, comprising transferring a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease into a plant cell, tissue or organ, The plant cysteine protease and the dsRNA of the insect gene are thereby expressed in plant cells, tissues or organs.

Another aspect of the present invention provides a plant cell comprising a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease.

Still another aspect of the invention provides a transgenic plant, tissue or progeny thereof comprising the above plant cell.

Another aspect of the invention provides a method of producing a transgenic plant having improved insect resistance, and a transgenic plant obtained by the method, the method comprising the step of transferring a parent of a construct expressing the insect gene dsRNA The plant is crossed with a parental plant into which a plant cysteine protease-expressing construct is introduced, and plant progeny co-expressed by the insect gene dsRNA and the plant cysteine protease are screened and obtained.

Another aspect of the invention provides a transgenic plant, tissue thereof or progeny thereof, comprising the plant cell of any one of claims 9-11.

Another aspect of the invention provides a method of producing a transgenic plant having improved insect resistance, the method comprising transferring a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease The plant cells, tissues or organs are regenerated into plant cells, tissues or organs.

Other advantages of the invention will be apparent from the following detailed description and examples. DRAWINGS

Figure 1 shows the sequence identity analysis of GhCP and CAB54307, and the results show that GhCP and CAB54307 has minor differences in nucleotide and protein levels. Figure 1A is an alignment of GhCP with nucleotides at the nucleotide level (open reading frame;). The box section represents the difference between the two. Figure 1B shows the alignment of GhCP and CAB54307 at the protein level. Marked with "*" for the conservative part of both.

Figure 2 shows the expression of GhCP and AtCP introduced into bacteria. Figure 2A is a schematic representation of the vector used, wherein the expression of the Venues, GhCP or AtCP fusion protein is driven by the T7 promoter. Fig. 2B shows the results of SDS-PAGE electrophoresis of total bacterial proteins expressing Venues, GhCP and AtCP, respectively, where Mark represents a protein molecular marker with a unit KD of kilodaltons.

Figure 3 shows that GhCP and AtCP can enhance the permeability of cotton bollworm to cotton phenol by the detection of gossypol concentration in the midgut of cotton bollworm. Fig. 3A: E. coli cells expressing Venus or GhCP were mixed with artificial diet, and 3 growing instar cotton bollworms were selected and divided into two groups, and the artificial feeds were fed separately. After two days of eating, transfer to an artificial diet containing a concentration of 0.1% gossypol and continue to culture for one day. The content of gossypol in the midgut cells was measured by staining with phloroglucinol. In Figure 3A, the left column represents Venus and the right column represents GhCP. Fig. 3B: The co// cells expressing Venus or AtCP were mixed with artificial diet, respectively, and subjected to an insect feeding test similar to that in Fig. 3A, and stained with phloroglucinol to detect the content of gossypol in the midgut cells. . In Figure 3B, the left column represents Venus and the right column represents AtCP.

Figure 4 is a real-time quantitative PCR assay for the transcription of GST 1 in the midgut of cotton bollworm. Figure 4A shows a schematic of an insect feeding experiment. Figure 4B shows RT-PCR detection of expression of GST 1 in insect midgut relative to internal standard ACT after two days of feeding wild-type Arabidopsis Col-0 (light color) or transgenic Arabidopsis thaliana AtdsGST l (dark). Figure 4C shows the ratio of GST 1 in the transgenic Arabidopsis thaliana AtdsGST 1 relative to the larvae fed wild-type Arabidopsis Col-0 (feeding the expression of GST 1 in transgenic Arabidopsis AtdsGST l larvae / feeding wild-type Arabidopsis thaliana The expression level of GST 1 in Col-0 larvae). In the figure: Venus: Before feeding Arabidopsis, the E. coli cells expressing Venus were mixed with artificial diet, and the 3-year-old cotton bollworms with the same growth were fed for two days for pretreatment; GhCP: E was replaced by GhCP instead of Venus. Coli cells, pretreated; AtCP: Pretreatment with E. coli cells expressing AtCP instead of Venus.

Figure 5 shows the expression of GhCP into Arabidopsis. Figure 5A is a schematic diagram of the construction of the carrier; Figure 5B is a

The transcript of GhCP in transgenic Arabidopsis AtGhCP was detected by RT-PCR, and Lane 5 was a negative control.

Figure 6 shows the enhanced permeability of gossypol by cotton bollworms reared by ATGhCP; the effect of RNAi is more pronounced after feeding dsGST, dsCYP6AE14 plant tissue. Figure 6A: The 3rd instar cotton bollworms with uniform growth were selected and divided into two groups, which were fed with wild-type Arabidopsis thaliana (Col-0) or transgenic Arabidopsis thaliana ATGhCP (ATGhCP two days later, and moved to a concentration of 0.1% gossypol. Artificial feed, continue to culture for one day. The content of gossypol in the midgut cells was detected by staining with phloroglucinol. Figure 6B: RT-PCR detection of wild type The expression of CYP6AEI4 and internal standard ^ T in the midgut of Helicoverpa armigera after two days of Arabidopsis Col-0 or transgenic Arabidopsis t Cl ^^. WT: Three-year-old cotton bollworm larvae of the same age were fed with Col-0 for two days, one group was divided into two groups, one group continued to eat Col-0 (light color), one group was transferred to ti3⁄4C P^7 dark color) and continued to culture for two days after CYP6AE14 expression. AtGhCP: Two-day-old Helicoverpa armigera larvae were fed with AtGhCP for two days and then divided into two groups for expression of CYP6AE14 after a similar feeding experiment. Figure 6C: The AtdsCYP6AE14 was plated with fc3⁄4GS7, and the feeding experiment described in Figure 6B was performed. The relative expression of GS7 in the midgut of Helicoverpa armigera was analyzed by RT-PCR.

Figure 7 shows the identification of the progeny of S. G zCi^ and transgenic cotton. The expression levels of GhCP4, dsGIP and NPTII in F 1 generation were detected by RT-PCR, and CK was R15. The black box is shown as 35S:: GhCP4/dsGIP co-expressed.

Figure 8 shows the resistance of c3⁄4G/P, 35S::GhCP4, S. G zO^/cfeG/P cotton to cotton bollworm, in which A: two-year-old cotton bollworms are divided into four groups, 36 in each group, fed with R15, respectively. dsGIP, 35S::GhCP4, SG 2C/^A3⁄4G/P cotton leaves, tested for weight for 5 days and 8 days. B: Two-instar cotton bollworms were fed R 15, dsGIP, 35S:: GhCP4, 35S:: GhCP4/dsGIP cotton leaves for 5 days.

Figure 9 shows the consumption of larvae on R15, dsGIP, 35S::GhCP4, S. G z P^feG/P cotton leaves, in which the second instar larvae eat different cotton leaves for 5 days and transfer to the corresponding Ri5, dsGIP, 35S::GhCP4, 35S::GhCP4/dsGIP Fresh cotton leaves After one day, the amount of cotton leaves consumed was determined. detailed description

A first aspect of the invention provides a method for enhancing plant-mediated insect RNA interference using a cysteine protease, characterized in that the method comprises constructing a plant and a plant expressing a double-stranded RNA (dsRNA) of an insect gene The construct of a cysteine protease is transferred into a plant cell, tissue or organ to thereby express the plant cysteine protease and the dsRNAo of the insect gene in the plant cell, tissue or organ

In a preferred embodiment, the insect gene is a gene essential for insect growth, or a gene capable of affecting insect growth and development under specific conditions (e.g., in the presence or induction of a pesticide, or a phytoalexin). In a more preferred embodiment, the insect gene is a gene expressed in the stomach or intestine of an insect. More preferably, the insect gene is a gene that is specifically expressed or highly expressed in the stomach or intestine of an insect.

The present invention is not particularly limited to the insect gene to be employed. In order to enable insects to be inhibited after taking the plants, the insect genes are usually genes necessary for insect growth or genes that affect insect growth and development under specific conditions. As used herein, the "gene necessary for insect growth" is in insects A gene that plays an important role in growth, development, metabolism, and reproduction (also known as "an important gene for insect growth";). The low or no expression of the gene will lead to abnormalities in the growth, development, metabolism, reproduction, etc. of the insect, and even lead to the death of the insect. When used in the present invention, the gene necessary for insect growth is a full-length gene or a gene fragment. As a preferred mode of the present invention, preferred fragments of the insect gene of the present invention are at least 50 bp in length, and may be, for example, 60 bp, 80 bp, 100 bp, 200 bp, 500 bp, 1000 bp. Of course, full-length genes can also be used. The specific conditions described are, for example, in the presence of a pesticide or a phytoalexin. Since the insect ingests the siRNA by oral administration, the insect gene is preferably a gene highly expressed in the stomach or intestine of an insect. The selection of a gene highly expressed in the stomach or intestine of an insect can, to a certain extent, prevent the siRNA of the genes of other tissues or organs of the insect from being affected by various barriers in the insect body (e.g., blocked or degraded) when exercising the interference effect. In a preferred embodiment of the present invention, the insect gene is selected from, but not limited to, a P450 gene (GIP), a glutathione-S-transferase gene (GST1), and a CYP6AE14 gene.

As used herein, the term "RNA interference (RNAi)" refers to a table in which small double-stranded RNA can efficiently and specifically block the expression of specific genes in the body, promote mRNA degradation, and induce cells to exhibit specific gene deletions. Type, which is also known as RNA intervention or intervention. RNA interference is a highly specific mechanism of gene silencing at the mRNA level. The term "small interfering RNA (siRNA)" refers to a short-segment double-stranded RNA molecule that is capable of degrading specific mRNAs with mRNAs of homologous complementary sequences. This process is the RNA interference pathway (RN A interference pathway; ). In the present invention, the basic principle of the RNA interference is: using a plant as a medium to express a double-stranded RNA (dsRNA;) of an insect gene (full length or part;) in a plant by a transgenic method. Processing to form high-abundance siRNA, when the insects feed on the transgenic plants, they also ingest a large amount of siRNA, which can inhibit the expression of the insect genes in the insects after entering the insects, and interfere with the normal insects. The growth and development even causes the death of insects, thereby reducing the feeding of insects to plants. Accordingly, another aspect of the present invention provides a method for improving plant resistance to insects, comprising transferring a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease into a plant cell, tissue or organ Thereby, the plant cysteine protease and the dsRNA of the insect gene are expressed in plant cells, tissues or organs.

In a preferred embodiment, the construct expressing the insect gene dsRNA is double-stranded, and the positive or negative strand thereof comprises the following formula I:

Seq Forward - X_Seq Reverse I

In the formula, Seq is a forward sequence or fragment of an insect gene, wherein the fragment is at least 50 bp in length;

Seq « is a sequence or fragment that is substantially complementary to Seq, where the fragment is at least 50 bp in length; X is located in Seq! The interval sequence between ^ and Seq «, and the interval sequence is not complementary to Seq _£ and Seq. The construct is capable of expressing a dsRNA that forms an insect gene of formula II in a plant cell, tissue or organ and is processed into a s iRNA in a plant.

Seq forward —^- \

I ' X

Seq reverse "^ type of work,

The definitions of Seq and Seq n X are as described above.

I represents a hydrogen bond formed between Seq and 36 (1, preferably a double-stranded RNA hydrogen bond).

In the above technical solution, the length of the spacer sequence to be employed is not particularly limited as long as it forms a construct with the forward sequence and the reverse sequence and is introduced into the body, and the dsRNA represented by the formula II can be formed. As a preferred mode of the present invention, the spacer sequence has a length of 80 to 300 bp; more preferably 100 to 250 bp.

As used herein, "substantially complementary" means that the sequences of the nucleotides are sufficiently complementary to interact in a predictable manner, such as to form a secondary structure (e.g., a stem-loop structure). Typically, at least 70% of the nucleotides of the two "substantially complementary" nucleotide sequences are complementary to each other; preferably, at least 80% of the nucleotides are complementary; more preferably, at least 90% of the nucleotides are complementary; further preferably, at least 95% of the nucleotides are complementary; such as 98%, 99% or 100%. Generally, there may be up to 7 mismatched nucleotides between two sufficiently complementary molecules; preferably, up to 6 mismatched nucleotides; more preferably, up to 5 mismatched nucleosides Acid; further preferred, having up to 4 mismatched nucleotides, such as having 0, 1, 2, 3, 4 mismatched nucleotides.

As used herein, a "complementary" sequence generally refers to a sequence that converts a sequence in the 5'-3' direction to its 3'-5' direction (eg, 5'ATCG 3 '→GCTA), and then takes its complementary sequence. (; such as GCTA → 5'CGAT 3 .

Those of ordinary skill in the art are familiar with the analysis of homology or identity, e.g., using different software analyses, such as BLAST, GCG, CLUSTAL, FASTA, ENTREZ, and the like.

"Homology" refers to sequence similarity between a reference sequence and a cloning insert of a new sequence or at least a fragment of an amino acid sequence encoded thereby. "Identity" or "similarity" refers to sequence similarity between two polynucleotide sequences or between two polypeptide sequences, and the "identity" comparison is more stringent.

In the present invention, "stringent conditions" means: (1) hybridization and washing at a lower ionic strength and a higher temperature. Deionization, such as 20 0.2 X SSC, 0.1% SDS, 60 ° C; or (2) Hybridization with denaturing agents, such as 50% (v/v) formamide, 0.1% calf serum / 0.1% Ficoll, 42° C or the like; or (3) the identity between only two sequences is at least 50% or more, preferably 60% or more, preferably at least 70% or more, preferably at least 80% or more, preferably at least 90. More than %, more preferably 95% or more hybridization occurs. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide of SEQ ID NO: 1 or SEQ ID NO. The plant cysteine protease of the present invention may be derived from Arabidopsis thaliana, cotton, corn, rice, wheat, and the like. Preferably, the cysteine protease involved in defense against insects and the like, such as the cysteine protease Mirl-CP from corn. Preferably, it has high sequence homology with cotton cysteine protease (GhCP) and Arabidopsis cysteine protease (AtCP) and also has the same biological activity as cysteine protease (as in the embodiment of the present invention) Other plant proteins described herein are also encompassed within the scope or equivalent ranges of the term "plant cysteine protease" of the invention. For example, the amino acid sequence of the plant cysteine protease is at least about 50%, 52%, 55%, 58% or 60% homologous or identical to SEQ ID NO. 1 or SEQ ID NO. Preferably at least about 62%, 65%, 68%, 70%, 72% or 75%, more preferably at least about 80%, 82%, 85%, 88% or 90%, most preferably at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher; at the nucleotide level, the homology or identity of the sequence is at least about 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80%, more preferably, at least about 82%, 85%, 90%, 95% or more of homology or identity . These proteases are, for example, but not limited to, selected from the following: NCBI accession numbers are selected from CAE 54307.1, XP 002310708.1, XP-002524912.1, ABQ10200. XP-002283263.1, BAE80740. XP-002326950.1, ABG33750.1, ACU20623.1, AAX84673 .1, ABK95110.1, XP 002284973.1, CAB 17076.1, XP—002510170.1, CAA53377.1, CAB 17074.1, CAB 16317.1, AAB68374. CAN61026. XP—002313136.1, XP—002306486.1, ABQ10202. XP—002285299.1, XP—002518705.1, XP — 002283282.1, AAK48495. ABD32628. AAK07730.1, BAG16377.1, BAD29954.1, BAC75923.1, BAG16371.1, CAB53515.1, AAL60580.1, ACB87490.1, CAA46863.1, AAD48496.1, ABQ10204.1 , NP— 568620.1, XP—002298740.1, AAQ62999. ABR19828. XP— 002863697.1, AAK62661.1, BAD29958.1, XP—002894032.1, ABR19827.1, BAD95392.1, AAL60579.1, NP—564497.1, BAH20463.1, BAF46304 .1, CAQ00105.1, BAD29960.1, ACU18666.1, NP-001149658.1, BAD29957.1, NP-195406.2, BAF02546.1, BAD29956. BAH111 64. CAA57538. Q94B08.2, BAF00916. BAD16614. BAC75927.1, P25776.2, NP 001148706.1, EEE61807.1, EEC78138.1, AAL60578.1 NP—566633.1, XP—002868998.1, NP—001105993.1, BAA14402. NP OO 1104879. CAE04498.2, XP—002883178.1, ABK24233.1, AAP41847.1, CAJ86180.1, AAC49455.1, AAB23155.1, P25251.1, ABK24495.1, AAA79915.1,

NP—001150266. 1. ACR34204.1, NP-001150196.1, CBI40282.3, BAF93840.

XP— 002448736. 1. BAF02547.1, ACI00280.1, CAQ00106.1, CBI19479.3,

XP— 002447300. 1. NP—001054211.2, AAB41816.1, .BAA14403. NP— 567377.1,

XP—002872576. 1, XP—002872575.1, BAJ33895. NP— 567376.1, AAM13065.

NP—567686.2, NP— 568620.1, AAL60580.1, XP 002863697.1, BAG16371.1,

XP— 002894032. 1. AAK62661.1, NP—564497.1, BAD95392.1, BAG16377.1

CAA20473.1, XP —002867702.1, AAL60579.1, ABG33750.1, AAX84673.1,

XP— 002510170. 1. CAN61026. K BAE80740. K XP— 002284973.1, BAC75923. K

XP—002326950. 1, XP—002518705.1, AAQ62999.1, ABQ 10202. ACU18666.

ABK95110.1, XP 002313136.1, ABD32628.1, CAB 17076.1, ACB87490.1,

XP— 002524912. 1. BAF46304.1, BAD29954.1, BAD16614.1, AAD48496.1

BAD29958.1, ABR19827.1, CAA46863.1, XP 002283263.1, CAB53515.1

XP—002285299.1, ABQ 10200.1, NP—001104879.1, ABQ10204. NP—001148706.1, BAD29957.1, BAD29960.1, CAB 17074.1, NP—001105993.1, AAB68374.1, NP—001149658.1, XP—002298740.1, BAH20463. BAC75927. XP— 002310708.1, CAQ00105.1, CAA53377.1, AAK48495.1, CAB 16317.1, ACU20623.1, AAA79915.1, CAE54307.1, ABK24495.1, ABR19828.1, ABQ10192.1, NP- 566634.2, BAC43113.1, NP — 001150266.1, ACR34204.1, BAF02546.1, XP—002989790.1, XP—002328138.1, BAH11164. K CAQ00106. ACI00280. ABK24233. EEE61807. P25776.2, BAD29956. EEC78138. ACC91281. XP—002283282.1, AAK07730. ABQ10197. AAP41847. Protease of XP-002990132.1, BAF93840. NP-001054211.2, XP-002447300.1, CAJ86180. CAE04498.2, BAA14402. NP- 566633.1, BAA14403. NM-001112101.1, NP-001105571.1. In a preferred embodiment of the invention, the plant cysteine protease is preferably cotton cysteine protease (GhCP) and Arabidopsis cysteine protease (AtCP), more preferably having SEQ ID NO: 1 And the amino acid sequence shown by SEQ ID NO: 2.

Typically, the construct is located on an expression vector. The constructs of the invention may be on the same expression vector, preferably on different expression vectors. The expression vector usually also contains a promoter, an origin of replication And/or marker genes, and optionally transcription termination signals, and the like. Other factors that are needed or helpful to achieve expression can also be used. For example, an expression vector can also include a nucleic acid encoding a signal peptide or a localization peptide that enables expression of the expressed nucleic acid or polypeptide to an intracellular organelle or compartment (eg, a chloroplast) or secretion through a membrane. Transcription termination signals, enhancers, and other nucleic acid sequences that affect gene expression can also be included in the expression vector. Those skilled in the art will be able to construct the expression vectors required for the present invention by methods well known in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as carrageenomycin, gentamicin, hygromycin, ampicillin resistance. The above expression vectors can be used to transform a suitable host. In the methods of the invention, the host may be any host suitable for carrying the expression vector and capable of delivering the expression vector to a plant cell. Preferably, the host is Agrobacterium.

The method of transferring the construct of the present invention into a plant cell (e.g., a plant cell having regenerative ability;), tissue or organ is also carried out using conventional techniques in the art, such as Agrobacterium transformation. For Agrobacterium transformation, T DNA sequences are preferably provided for Agrobacterium-mediated transfer to plant chromosomes. When the heterologous gene is not readily detectable, the construct preferably also has a selectable marker gene suitable for determining whether the plant cell has been transformed. In addition, heterologous sequences can also be integrated into sequences in the plant genome. These sequences may include transposon sequences for homologous recombination as well as Ti sequences that allow random insertion of heterologous expression cassettes into the plant genome. Suitable prokaryotic selectable markers include antibiotics (e.g., ampicillin, kanamycin, tetracycline;) resistance markers. Other DNA sequences encoding other functions may also be present in the vector, as is known in the art. Expression vectors can also be introduced into plant cells by electroporation. In this technique, plant protoplasts are electroporated in the presence of a plasmid containing the gene construct. Electrical pulses of high electric field strength reversibly penetrate the biofilm, allowing introduction of the plasmid. Electroporated plant protoplasts reform the cell wall, divide and form plant callus. Accordingly, another aspect of the present invention provides a plant cell comprising a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease.

Another aspect of the invention relates to a transgenic plant, tissue or progeny thereof comprising the above plant cell. The transgenic plants can be obtained by conventional means known to those skilled in the art. For example, all plants that can isolate protoplasts and grow into fully regenerated plants. The mode of regeneration varies from plant to plant, but it is usually first to provide a transformed protoplast suspension containing a copy of the heterologous gene. The callus is formed, and the shoots are induced from the callus, followed by the roots. In addition, embryos can be induced from protoplast suspensions. These embryos germinate like natural embryos to form plants. The medium usually contains various amino acids and hormones such as auxin and cytokinin.

Construction of an insect gene dsRNA expressing the same and construction of a plant cysteine protease The substance can be transferred into the same host plant cell for co-expression, or can be transferred to different plant cells and regenerated into plants, and then transferred to the plant expressing the insect gene dsRNA and transferred to the expression plant cyste Plant hybridization of the construct of the protease, screening for plant progeny that are co-expressed. Accordingly, the present invention also provides a method of producing a transgenic plant having improved insect resistance, the method comprising transferring a parent plant transformed with a construct expressing an insect gene dsRNA to an expression plant half The parental plant of the cysteine protease construct is crossed, and the plant progeny co-expressed by the insect gene dsRNA and the plant cysteine protease are screened and obtained.

The insect to which the present invention is applied is not particularly limited, and the insect may be any herbivorous insect that feeds on plants, for example, it may be a scutellaria, isoptera, coleoptera, diptera, hymenoptera. , Lepidoptera, Orthoptera, Hemiptera, Winged-winged insects or agricultural pests, such as the species of the genus Heliconia, the genus Heliconia, the genus Heliconia, the genus Diptera, the cotton leaf ripple night Moth, Lithoga, Moth, Moth, Moth, Moth, Moth, Moth, Moth, Moth, Moth, Moth, Moss Eucalyptus, Coleoptera, Coleoptera, Apple-shaped Moth, Coleus, Corn genus, Spodoptera frugiperda, Diamond, genus, genus, genus, genus, genus Genus, genus, genus, genus, genus, genus, genus, moth, moth, moth, moth, genus, genus, genus, genus, cabbage Moth, Tobacco hawk moth, Ulmus, European corn borer, Ultra small moth Genus, small eyed moth, red bollworm, cotton bollworm, potato tuber moth, pink butterfly, diamondback moth, genus, genus, genus, genus, leaf genus, armyworm, genus , Moth, Moth, Moth, Moth, Moth, Moth, Genus, Beet Ginger, Beet Steer, Valer, Genus, Pisces, Leaf A genus, ladybug, potato beetle, genus, genus, genus, genus, genus, genus, genus, genus, chafer, genus, genus, genus Genus, genus, genus, genus, genus, genus, genus, genus, genus, genus, genus, genus, genus, termite, genus, genus , single hummer, brown pheasant, cotton scorpion horse, African orange hard hummer. Preferably, the "insect" is an insect of the order Lepidoptera, and more preferably, the "insect" is an insect of the family Lepidoptera or the family Moth. More preferably, the insect refers to a cotton bollworm, a corn borer moth, and a budworm.

The present invention is not particularly limited as to the plant suitable for use in the present invention as long as it is suitable for performing a gene transformation operation such as various crops, flower plants, or forestry plants. The plant may be, for example, without limitation: a dicot, a monocot, or a gymnosperm. More specifically, the plants include, but are not limited to: wheat, barley, rye, rice, corn, sorghum, beets, apples, pears, plums, peaches, apricots, cherries, strawberries, raspberries, blackberries, beans , lentils, peas, soybeans, rapeseed, mustard, poppy, olean, sunflower, coconut, castor oil plant, cocoa beans, peanuts, gourd, cucumber, watermelon, cotton, linen, Hemp, jute, citrus, lemon, grapefruit, spinach, chicory, asparagus, cabbage, carrot, onion, potato, tomato, green pepper, avocado, cinnamon, camphor, tobacco, nuts, coffee, eggplant, sugar cane, tea, Pepper, vine, ramie, banana, natural rubber tree and ornamental plants.

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not intended to limit the scope of the invention. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, all of which are known to those skilled in the art. These techniques are fully described in the following literature: for example, Sambrook, Molecular Cloning, A Guide to Molecular Cloning, 2nd ed. (1989); DNA Cloning, Volumes I and II (DN Glover, 1985); Oligonucleotide Synthesis (Editing by MJ Gait, 1984); Nucleic Acid Hybridization (edited by BD Hames and SJ Higgins. 1984); Protein Purification: Principles and Practices, 2nd Edition (Springer-Verlag, NY), and the Manual of Experimental Immunology I -IV volume (edited by DC Weir and CC Blackwell 1986). Alternatively, follow the instructions provided by the reagent manufacturer. Example 1 Separation of cotton cysteine protease (GhCP) and Arabidopsis cysteine protease (AtCP)

According to the CAE54307 sequence information, the synthesis primer (FlGhCPF: ATGGAATTAACCCTTCTTTTC, FlGhCPR: GCAATGAATTC AAGC ACTGC), the cotton cysteine protease gene GhCP was amplified by PCR. The sequence was aligned with known cotton cysteine proteases and found to be G z P and

There are some differences in nucleotide and protein levels (Figure 1).

According to the AT2G34080. I sequence information, the synthetic primers (FlAtCPF: ATGGGTTATGCTAAATCAGC; FLAtCPR: TTAGGCAACCGAAACTTTATC), the Arabidopsis thaliana cysteine protease gene ^ CP was amplified by PCR, and the sequence identity analysis found that ^tCP was consistent with AT2G34080.

GhCP (SEQ ID NO: 1):

AtCP base acid sequence (SEQ ID NO: 2):

SVA Example 2 Expression of GhCP and AtCP in E. coli

The amHI and Sacl restriction sites were introduced before the start codon and stop codon of GhCP and AtCP, respectively, and GhCP and AtCP were introduced between pHI32a multiple cloning sites amHI and Sacl (Fig. 2A), respectively, to obtain corresponding The recombinant expression vector of the fragment of interest, designated pET32a/GhCP and pET32a/AtCP.

After transforming pET32a/GhCP and pET32a/AtCP into E. coli BL2I (DE3), select positive single colonies into 3 mL LB (containing 100 g/mL Amp) medium, and incubate at 37 ° C, 220 rpm until logarithmic growth. In the early stage, IPTG was added to a final concentration of 1 mM, and incubation was continued at 28 ° C for 2-3 hours. 1 mL of 1 mL of bacterial solution was centrifuged for 5 minutes. The pellet was suspended in 100 L of PBS, added to an equal volume of 2×SDS loading buffer, mixed, placed in a boiling water bath for 5 minutes, centrifuged at 12,000 g for 10 minutes, and the supernatant was taken for 10%. SDS-PAGE electrophoresis was carried out, and the expression was observed by Coomassie blue staining. GhCP and AtCP were found to be highly expressed in E. co!i BL2] (DE3) (Fig. 2B).

Using the same method, Venus protein was expressed in co!i BL2] (DE3) as a control for subsequent experiments. Example 3 Helicoverpa armigera (He/Zcove /7fl fl Zge ) enhances the permeability of gossypol after feeding coli cells expressing GhCP or AtCP protein

The 3rd-instar cotton bollworms with consistent growth were divided into two groups, which were fed with mixed expression of Venus protein or GhCP. Artificial feed of co//cell (take 250ml OD of 1.0 OD, centrifuge, take sediment, mix with 25g artificial feed (the formula and feeding method of artificial feed see Wang Yannian and other "Insect Artificial Feed Manual"). After two days of eating, transfer to an artificial diet containing 0.1% (mg/g) gossypol concentration and continue to culture for one day. The content of gossypol in the midgut cells was detected by staining with phloroglucinol. It was found that the larvae pretreated with co// cells expressing GhCP had higher gossypol content in the midgut cells than co// cells expressing Venus. Pretreated larvae (; control group X Figure 3A;). Similarly, larvae pretreated with co// cells expressing AtCP were also found to have significantly higher gossypol content in the midgut cells than in the control group (Fig. 3B). Example 4 Effect of GhCP and AtCP on plant-mediated insect RNA interference

The E. coli cells expressing Venus were mixed with artificial diet to feed the same growing 3rd instar cotton bollworm. Two days later, the two groups were transferred to Arabidopsis thaliana (Col-0) or transgenic Arabidopsis thaliana 04 ^03⁄4 ;) expressing homologous dsRNA to the GST 1 sequence of Helicoverpa armigera. Continue to train for 2 days. A schematic diagram of the insect feeding experiment is shown in Figure 4A. The expression of GST1 in the midgut tissue of the cotton bollworm at AtdsGSTl was found to be slightly lower than that of the cotton bollworm (control group) fed Col-0. E. coli cells expressing GhCP or AtCP were used instead of E. coli cells expressing Venus for the same feeding experiment. It was found that the cotton bollworm pretreated with GhCP or AtCP had significant expression of GS7 in the midgut after eating ti3⁄4GS7. Lower than the control group. This suggests that GhCP and AtCP enhance plant-mediated insect RNA interference. Example 5 Transgenic Arabidopsis thaliana expressing ghCP 04i /iCP)

(l) 35S: :GhCP expression vector construction

The constructed pET32a/GhCP vector was double digested with amHI and Sacl, and pBI121 (purchased from Clonetech) was double-digested with a HI and Sacl, and the GhCP fragment cleaved by the enzyme was substituted for GUS on PBI121. Inserted between a HI and Sacl to obtain a recombinant expression vector carrying the GhCP target fragment, referred to as the 35S::GhCP expression vector (Fig. 5A).

(2) Transformation of Agrobacterium tumefaciens

Use freeze-thaw method. Agrobacterium GV3 101 (purchased from Invitrogen) single colony to 3 ml LB medium (containing 25 g/ml rifamycin (Rif) and 100 g/ml gentamicin (Gen)), 28 °C, Incubate overnight at 220 rpm. 2 ml of the bacterial solution was transferred to 50 ml of LB medium (25 g/ml Rif and 100 g/ml Gen), and cultured at 28 ° C, 220 rpm until OD ₆₀₀ = 0.5 (about 6 hours). Place on ice for 30 minutes, centrifuge at 5000 g for 5 minutes at 4 °C. Resuspend in 10 ml 0. 15 M NaCl. Centrifuge at 5000 g for 5 minutes at 4 °C. Resuspend in 1 ml of 20 mM CaCl ₂ , 50 μl/tube fraction, freeze in liquid nitrogen, and store competent cells at -70 °C. Mixed with the target gene 50 μl of tube competent cells of vector 35S::GhCP, placed on ice for 30 minutes, and frozen for 1 minute in liquid nitrogen. The bacterial solution was thawed in a 37 ° C water bath for 5 minutes, and the ml ml medium was incubated at 28 ° C, 220 rpm for 2 to 4 hours. Plates of LB medium (25 g/ml Rif, 100 g/ml Gen and 50 g/ml kanamycin (Kan)) were taken at 50 to 100 μM.

(3) Transformation of Arabidopsis plants

Transformation of Arabidopsis plants was carried out using floral dip (Clough and Bent, 1998, Plant J. 16, 735-743). A single colony GV3101 containing the binary vector 35S::GhCP was added to 3 ml of LB medium (25 μηηύ Rif, 100 μηηύ Gen and 50 μηηύ Kan), and cultured at 28 ° C, 220 rpm for 12 hours. 1 ml of the bacterial solution was taken out and added to 50 ml of LB medium, and cultured at 28 ° C, 220 rpm for 12 hours. 5 ml of the bacterial solution was taken out and added to 250 ml of LB medium (100 g/ml Gen and 50 g/ml Kan), and cultured at 28 ° C, 220 rpm for 12 hours. Centrifuge at 4200 rpm (2900 g) for 15 minutes. The bacteria were suspended in 500 ml of a 5% sucrose solution containing 0.02% Silwet L-77. The flower bud part of the plant is soaked in the bacterial liquid for 5 seconds, placed in a plastic pot, moisturized, protected from light, 16 to 24 hours, and then the greenhouse grows to flowering seed. T _Q seeds were vernalized at 4 °C for 2 to 4 days, treated with 20% bleaching water (; White Cat Company, Shanghai) for 15 minutes, and washed with sterile water for 3 to 4 times. Hang on 0.5% agarose (55 ° C), spread on 0.6% agar in MS medium (containing 50 g / ml Kan or Hygo), 22 ° C, continuous light, about one week, green resistant seedlings transplanted Grow in nutrient soil (peat: vermiculite: perlite = 1:1:1).

(4) RT-PCR detection of transgenic plants

After 4 weeks of growth of the above-mentioned green resistant seedlings, RNA was extracted from the leaves and reverse transcribed. The expression level of GhCP in the transgenic plants was analyzed by RT-PCR. It was found that no signal was detected in the samples of the 9 samples, except for the samples. There are strong signals (Figure 5B). Seeds of plants No. 4 and No. 6 were selected and the next generation was propagated for subsequent experiments. Example 6 Effect of the midgut of the cotton bollworm on the permeability of gossypol and the effect on plant-mediated insect RNA interference after eating ^i /iCP tissue.

After two days of feeding the three-year-old cotton bollworm larvae with Col-0 and GhCP-expressing transgenic plants, the larvae were transferred to artificial diet containing 0.1% gossypol concentration for two days, and the midgut was extracted. Tricretin staining was used to detect the content of gossypol in midgut cells. It was found that the content of gossypol in the midgut cells of cotton bollworm pretreated with tGzCP was significantly higher than that of cotton bollworm pretreated with Col-0 (Fig. 6A;). The results showed that the permeability of gossypol increased by cotton bollworm pretreated with AtGhCP.

After two days of feeding the three-year-old cotton bollworm larvae with Col-0, they were divided into two groups, one group continued to eat. Col-0, a group of transgenic Arabidopsis thaliana AtdsCYP 6AE 14 expressing homologous dsRNA with the CYP6AE14 sequence of the Helicoverpa armigera (Methods see CN200610119029. 7, the entire disclosure of which is incorporated herein by reference) The expression of CYP6AEI4 in the intestine showed that the expression of the cotton bollworm CYP6AE14 fed the transgenic plant AtdsCYP6AE14 was decreased compared to the cotton bollworm (control group) fed Col-0. After two days of feeding the three-year-old cotton bollworm larvae with tG zCP, they were divided into two groups and the same feeding experiment was carried out. It was found that the reduction of the expression level of the cotton bollworm pretreated with AtGhCP after eating AtdsCW6AE14 became more obvious. A similar feeding experiment was performed with tc3⁄4GS7 instead of tc3⁄4C! 6 &7. It was also found that the reduction of GST1 expression was more pronounced in the cotton bollworm pretreated with AtGhCP after feeding t^GSr7 (Fig. 6B, C). _{0 The} results above indicate tG zCP Pretreatment can enhance plant-mediated insect RNA interference. Example 7 Production of insect-resistant transgenic cotton by hybridization

GhCP4 was introduced into cotton expression 5S::GhCP4, and it was found that the accumulation of gossypol in the larvae fed the transgenic cotton leaves increased, and the growth was inhibited. In order to obtain transgenic cotton with improved insect resistance, 35S::GhCP4 was hybridized with dsGIP transgenic cotton. F1 plants were obtained. Twenty-two F1 plants were identified. It was found that 3 of the 5 crosses with S. G i^ as the male parent dsGIP were co-expressed with G z P^, thinking that the female 35S:: Of the 17 crosses with GhCP4 as the male parent, 4 dsGIP and GhCP4 were co-expressed, resulting in a total of 7 35S::GhCP4/dsGIP transgenic hybrid cottons (Fig. 7).

Two-year-old cotton bollworms were divided into four groups, each with 36 heads, fed with R15, dsGIP, 35S::GhCP4, respectively.

35S::GhCP4/dsGIP cotton leaves, body weight was detected after 5 days, and the weight gain of cotton bollworms eating dsGIP and 35S::GhCP4 cotton leaves was found to be 67% of the control (larvae eating R15 cotton leaves), while eating 35S::GhCP4/ The growth of cotton bollworm in dsGIP cotton leaves was severely inhibited, and the weight gain was only 42% of the control (larvae eating R15 cotton leaves). After 8 days, the larval body weight was detected again. It was found that the growth of larvae of G/P, SG i^, 35S::GhCP4/dsGIP cotton leaves was slower than that of the control group, and the growth of larvae fed with S. G z P^feG/P cotton leaves was affected. Severe suppression (Figure 8). The second instar larvae were transferred to the corresponding R15 after 5 days of eating different cotton leaves, dsGIP, 35S::GhCP4, 35S::GhCP4/dsGIP fresh cotton leaves one day, and found larvae to dsGIP, 35S::GhCP4, 35S::GhCP4 The consumption of the /dsGIP cotton leaf is reduced, with the lowest loss on the 35S::GhCP4/dsGIP cotton leaf (Figure 9).

The above results indicate that overexpression of plant cysteine protease in dsGIP cotton can increase cotton resistance to cotton bollworm. While the invention has been described with respect to the specific embodiments of the present invention, it will be apparent to those skilled in the art Therefore, the appended claims are intended to cover all such modifications within the scope of the invention. All publications, patents and patent applications cited herein are hereby incorporated by reference. references:

1. Mao YB, Cai WJ, Wang JW, Hong GJ, Tao XY, Wang LJ, Huang YP, Chen XY (2007). Nature Biotechnology, 25: 1307-1313.

2. Pechan T, Cohen A, Williams WP, Luthe DS (2002). PNAS, 99: 13319-13323.

Claims

Rights request

A method for enhancing plant-mediated insect RNA interference by using a cysteine protease, wherein the plant has been transformed into a construct expressing an insect gene dsRNA, wherein the method comprises expressing the plant The construct of the cysteine protease is transferred into cells, tissues or organs of the plant.

2. The method according to claim 1, wherein the insect gene is a gene essential for insect growth, or a gene capable of affecting insect growth and development under specific conditions.

3. The method according to claim 1, wherein the plant is selected from the group consisting of: a dicotyledonous plant, a monocotyledonous plant, or a gymnosperm.

4. The method of claim 1 wherein the insect is selected from the group consisting of a herbivorous insect.

5. The method of claim 1, wherein the plant cysteine protease is selected from the group consisting of: a cotton cysteine protease or an Arabidopsis cysteine protease.

6. The method according to claim 1 or 5, wherein the plant cysteine protease is selected from the group consisting of (1) the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, or

(2) a protease having 50% or more homology with the amino acid sequence shown by SEQ ID NO: 1 or SEQ ID NO: 2 and having the same biological activity as the amino acid sequence shown by SEQ ID NO: 1 or SEQ ID NO: 2. .

7. The method according to claim 1, wherein the construct expressing the insect gene dsRNA is double-stranded, and the positive or negative strand thereof has the structure of the following formula I:

Seq forward _X_Seq reverse I

In the formula,

Seq ^ is a forward sequence or fragment of an insect gene, wherein the fragment is at least 50 bp in length;

Seq « is a sequence or fragment that is substantially complementary to the Seq forward, wherein the fragment is at least 50 bp in length _;

X is an interval sequence between Seq and Seq^, and the interval sequence is not complementary to Seq and Seq.

8. The method of claim 1 further comprising regenerating the cells, tissues or organs of the plant.

A plant cell, characterized in that the plant cell comprises a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease.

The plant cell according to claim 9, wherein the plant cysteine protease is selected from cotton cysteine protease or Arabidopsis cysteine protease.

The plant cell according to claim 10, wherein the plant is selected from the group consisting of: , monocotyledonous, or gymnosperm.

12. A method of increasing the insect resistance of a plant, the method comprising transferring a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease into a plant cell, tissue or organ.

A transgenic plant, a tissue thereof or a progeny thereof, which comprises the plant cell of any one of claims 9-11.

14. The transgenic plant, tissue or progeny thereof according to claim 13, wherein the transgenic plant, its tissue or its progeny is a plant seed.

15. A method of producing a transgenic plant having improved insect resistance, the method comprising: transferring a parental plant transformed with a construct expressing an insect gene dsRNA to a plant cysteine protease The parental plant of the construct is crossed, and the plant progeny co-expressed by the insect gene dsRNA and the plant cysteine protease are screened and obtained.

16. A method of producing a transgenic plant, the transgenic plant having improved insect resistance, the method comprising transferring a construct expressing an insect gene dsRNA and a construct expressing a plant cysteine protease into a plant cell, tissue or In the organ, the plant cell, tissue or organ is regenerated into a plant.

17. A transgenic plant obtained by the method of claim 15 or 16.