WO2011098805A1 - Sanglifehrin based compounds - Google Patents

Abstract

There are provided inter alia compounds of formula (I) for use as cyclophilin inhibitors and/or as immunosuppressants.

Description

SANGLIFEHRIN BASED COMPOUNDS

Introduction

The present invention relates to sanglifehrin analogues, that are useful as cyclophilin inhibitors, e.g. in the treatment of viral infection especially infection by RNA viruses such as Hepatitis C virus (HCV) and Human Immunodeficiency Virus (HIV) and/or as

immunosuppressants e.g. for use in prophylaxis of transplant rejection and as anti-inflammatory agents, e.g. for use in treatment of inflammatory disorders. The present invention also provides methods for their use in medicine, in particular for the treatment of HCV infection and for use as an immunosuppressant or anti-inflammatory agent, and in diseases where inhibition of the Mitochondrial Permeability Transition Pore (mPTP) is useful such as muscular dystrophy.

Background of the invention

Hepatitis C

Hepatitis C virus (HCV) is a positive strand RNA virus, and infection is a leading cause of post-transfusional hepatitis. HCV is the most common chronic blood borne infection, and the leading cause of death from liver disease in United States. The World Health Organization estimates that there are more than 170 million chronic carriers of HCV infection, which is about 3% of the world population. Among the un-treated HCV-infected patients, about 70%-85% develop chronic HCV infection, and are therefore at high risk to develop liver cirrhosis and hepatocellular carcinoma. In developed countries, 50-76% of all cases of liver cancer and two- thirds of all liver transplants are due to chronic HCV infection (Manns et al, 2007).

In addition to liver diseases, chronically infected patients may also develop other chronic HCV-related diseases, and serve as a source of transmission to others. HCV infection causes non-liver complications such as arthralgias (joint pain), skin rash, and internal organ damage predominantly to the kidney. HCV infection represents an important global health-care burden, and currently there is no vaccine available for hepatitis C (Strader et al., 2004;

Jacobson et al. 2007; Manns et al., 2007 Pawlotsky, 2005; Zeuzem & Hermann, 2002).

Treatment of HCV

The current standard of care (SoC) is subcutaneous injections of pegylated interferon-a (pIFNa) and oral dosing of the antiviral drug ribavirin for a period of 24-48 weeks. Success in treatment is defined by sustained virologic response (SVR), which is defined by absence of HCV RNA in serum at the end of treatment period and 6 months later. Overall response rates to SoC depend mainly on genotype and pretreatment HCV RNA levels. Patients with genotype 2 and 3 are more likely to respond to SoC than patients infected with genotype 1 (Melnikova, 2008; Jacobson et al., 2007). A significant number of HCV patients do not respond adequately to the SoC treatment, or cannot tolerate the therapy due to side effects, leading to frequent issues with completion of the full course. The overall clinical SVR rate of SoC is only around 50% (Melnikova, 2008). Development of resistance is another underlying factor for failure of treatment (Jacobson et al. et al. 2007). SoC is also contraindicated in some patients who are not considered candidates for treatment, such as patients with past significant episodes of depression or cardiac disease. Side effects of the SoC, which frequently lead to discontinuation of treatment include a flu-like illness, fever, fatigue, haematological disease, anaemia, leucopaenia, thrombocytopaenia, alopecia and depression (Manns et al., 2007).

Considering the side effects associated with the lengthy treatments using SoC, development of resistance, and suboptimum overall rate of success, more efficacious and safer new treatments are urgently needed for treatment of HCV infection. The objectives of new treatments include improved potency, improved toxicity profile, improved resistance profile, improved quality of life and the resulting improvement in patient compliance. HCV has a short life cycle and therefore development of drug resistance during drug therapy is common.

Novel, specifically targeted antiviral therapy for hepatitis C (STAT-C) drugs are being developed that target viral proteins such as viral RNA polymerase NS5B or viral protease NS3 (Jacobson et al, 2007; Parfieniuk et al., 2007). In addition, novel compounds also are being developed that target human proteins (e.g. cyclophilins) rather than viral targets, which might be expected to lead to a reduction in incidence of resistance during drug therapy (Manns et al., 2007; Pockros, 2008; Pawlotsky J-M, 2005).

Cyclophilin inhibitors

Cyclophilins (CyP) are a family of cellular proteins that display peptidyl-prolyl cis-trans isomerase activity facilitating protein conformation changes and folding. CyPs are involved in cellular processes such as transcriptional regulation, immune response, protein secretion, and mitochondrial function. HCV virus recruits CyPs for its life cycle during human infection.

Originally, it was thought that CyPs stimulate the RNA binding activity of the HCV non-structural protein NS5B RNA polymerase that promotes RNA replication, although several alternative hypotheses have been proposed including a requirement for CyP PPIase activity. Various isoforms of CyPs, including A and B, are believed to be involved in the HCV life cycle (Yang et al., 2008; Appel et al., 2006; Chatterji et al., 2009; Gaither et al., 2010). The ability to generate knockouts in mice (Colgan et al., 2000) and human T cells (Braaten and Luban, 2001 ) indicates that CyPA is optional for cell growth and survival.. Similar results have been observed with disruption of CyPA homologues in bacteria (Herrler et al., 1994), Neurospora (Tropschug et al., 1989) and Saccharomyces cerevisiae (Dolinski et al. 1997). Therefore, inhibiting CyPs represent a novel and attractive host target for treating HCV infection, and a new potential addition to current SoC or STAT-C drugs, with the aim of increasing SVR, preventing emergence of resistance and lowering treatment side effects.

NIM-811 , 3 SCY-635,

Cyclosporine A (Inoue et al. 2003) ("CsA") and its closely structurally related non- immunosuppressive clinical analogues DEBIO-025 (Paeshuyse et al. 2006; Flisiak et al. 2008), NIM81 1 (Mathy et al. 2008) and SCY-635 (Hopkins et al., 2009) are known to bind to cyclophilins, and as cyclophilin inhibitors have shown in vitro and clinical efficacy in the treatment of HCV infection (Crabbe et al., 2009; Flisiak et al. 2008; Mathy et al. 2008; Inoue et al., 2007; Ishii et al., 2006; Paeshuyse et al., 2006). Although earlier resistance studies on CsA showed mutations in HCV NS5B RNA polymerase and suggested that only cyclophilin B would be involved in the HCV replication process (Robida et al., 2007), recent studies have suggested an essential role for cyclophilin A in HCV replication (Chatterji et al. 2009; Yang et al., 2008). Considering that mutations in NS5A viral protein are also associated with CsA resistance and that NS5A interacts with both CyPA and CypB for their specific peptidyl-prolyl cis/trans isomerase (PPIase) activity, a role for both cyclophilins in viral life cycle is further suggested (Hanoulle et al., 2009).

The anti-HCV effect of cyclosporine analogues is independent of the

immunosuppressive property, which is dependent on calcineurin. This indicated that the essential requirement for HCV activity is CyP binding and calcineurin binding is not needed. DEBIO-025, the most clinically advanced cyclophilin inhibitor for the treatment of HCV, has shown in vitro and in vivo potency against the four most prevalent HCV genotypes (genotypes 1 , 2, 3, and 4). Resistance studies showed that mutations conferring resistance to DEBIO-025 were different from those reported for polymerase and protease inhibitors, and that there was no cross resistance with STAT-C resistant viral replicons. More importantly, DEBIO-025 also prevented the development of escape mutations that confer resistance to both protease and polymerase inhibitors (Crabbe et al., 2009).

However, the CsA-based cyclophilin inhibitors in clinical development have a number of issues, which are thought to be related to their shared structural class, including: certain adverse events that can lead to a withdrawal of therapy and have limited the clinical dose levels; variable pharmacokinetics that can lead to variable efficacy; and an increased risk of drug-drug interactions that can lead to dosing issues.

The most frequently occurring adverse events (AEs) in patients who received DEBIO- 025 included jaundice, abdominal pain, vomiting, fatigue, and pyrexia. The most clinically important AEs were hyperbilirubinemia and reduction in platelet count (thrombocytopaenia). Peg-IFN can cause profound thrombocytopaenia and combination with DEBIO-025 could represent a significant clinical problem. Both an increase in bilirubin and decrease in platelets have also been described in early clinical studies with NIM-81 1 (Ke et al., 2009). Although the hyperbilirubinemia observed during DEBIO-025 clinical studies was reversed after treatment cessation, it was the cause for discontinuation of treatment in 4 out of 16 patients, and a reduction in dose levels for future trials. As the anti-viral effect of cyclophilin inhibitors in HCV is dose related, a reduction in dose has led to a reduction in anti-viral effect, and a number of later trials with CsA-based cyclophilin inhibitors have shown no or poor reductions in HCV viral load when dosed as a monotherapy (Lawitz et al., 2009; Hopkins et al., 2009; Nelson et al., 2009). DEBIO-025 and cyclosporine A are known to be inhibitors of biliary transporters such as bile salt export pumps and other hepatic transporters (especially MRP2/cMOAT/ABCC2) (Crabbe et al., 2009). It has been suggested that the interaction with biliary transporters, in particular MRP2, may be the cause of the hyperbilirubinaemia seen at high dose levels of DEBIO-025 (Nelson et al., 2009).

Moreover, DEBIO-025 and cyclosporine A are substrates for metabolism by cytochrome P450 (especially CYP3A4), and are known to be substrates and inhibitors of human P- glycoprotein (MDR1 ) (Crabbe et al., 2009). Cyclosporine A has also been shown to be an inhibitor of CYP3A4 in vitro (Niwa et al., 2007). This indicates that there could be an increased risk of drug-drug interactions with other drugs that are CYP3A4 substrates, inducers or inhibitors such as for example ketoconazole, cimetidine and rifampicin. In addition, interactions are also expected with drugs that are subject to transport by P-glycoprotein (e.g. digoxin), which could cause severe drug-drug interactions in HCV patients receiving medical treatments for other concomitant diseases (Crabbe et al. 2009). CsA is also known to have highly variable pharmacokinetics, with early formulations showing oral bioavailability from 1 -89% (Kapurtzak et al., 2004). Without expensive monitoring of patient blood levels, this can lead to increased prevalence of side effects due to increased plasma levels, or reduced clinical response due to lowered plasma levels.

Considering that inhibition of cyclophilins represent a promising new approach for treatment of HCV, there is a need for discovery and development of more potent and safer CyP inhibitors for use in combination therapy against HCV infection.

Sanglifehrins

Sanglifehrin A (SfA) and its natural congeners belong to a class of mixed non-ribosomal peptide/polyketides, produced by Streptomyces sp. A92-3081 10 (also known as DSM 9954) (see WO 97/02285), which were originally discovered on the basis of their high affinity to cyclophilin A (CyPA). SfA is the most abundant component in fermentation broths and exhibits approximately 20-fold higher affinity for CyPA compared to CsA. This has led to the suggestion that sanglifehrins could be useful for the treatment of HCV (WO2006/138507). Sanglifehrins have also been shown to exhibit a lower immunosuppressive activity than CsA when tested in vitro (Sanglier et al., 1999; Fehr et al., 1999). SfA binds with high affinity to the CsA binding site of CyPA (Kallen et al., 2005;).

Immunosuppressive action of sanglifehrins

The immunosuppressive mechanism of action of SfA is different to that of other known immunophilin-binding immunosuppressive drugs such as CsA, FK506 and rapamycin. SfA does not inhibit the phosphatase activity of calcineurin, the target of CsA (Zenke et al. 2001 ), instead its immunosuppressive activity has been attributed to the inhibition of interleukin-6 (Hartel et al., 2005), interleukin-12 (Steinschulte et al., 2003) and inhibition of interleukin-2- dependent T cell proliferation (Zhang & Liu, 2001 ). However, the molecular target and mechanism through which SfA exerts its immunosuppressive effect is hitherto unknown.

The molecular structure of SfA is complex and its interaction with CyPA is thought to be mediated largely by the macrocyclic portion of the molecule. In fact, a macrocyclic compound (hydroxymacrocycle) derived from oxidative cleavage of SfA has shown strong affinity for CyPA (Sedrani et al., 2003). X-ray crystal structure data has shown that the hydroxymacrocycle binds to the same active site of CyPA as CsA. Analogues based on the macrocycle moiety of SfA have also previously been shown to be devoid of immunosuppressive properties (Sedrani et al., 2003), providing opportunity for design of non-immunosuppressive CyP inhibitors for potential use in HCV therapy.

Converse to this, there is also an opportunity to develop immunosuppressive agents with low toxicity for use in such areas as prophylaxis of transplant rejection, autoimmune, inflammatory and respiratory disorders, including Crohn's disease, Behcet syndrome, uveitis, psoriasis, atopic dermatitis, rheumatoid arthritis, nephritic syndrome, aplastic anaemia, biliary cirrhosis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease (COPD) and celiac disease. Sanglifehrins have been shown to have a novel mechanism of immunosuppressive activity (Zenke et al., 2001 ), and there is therefore an opportunity to develop agents with a mechanism of action different to current clinical agents, such as cyclosporine A, rapamycin and FK506. Sanglifehrin A has been shown to be 10 fold less potent than Cyclosporine A, so the ideal novel agent would have improved potency and/or therapeutic window.

General comments on sanglifehrins

One of the issues in drug development of compounds such as sanglifehrins are the low solubilities if these highly lipophilic molecules. This can lead to issues with poor bioavailability, an increased chance of food effect, more frequent incomplete release from the dosage form and higher interpatient variability. Poorly soluble molecules also present many formulation issues, such as severely limited choices of delivery technologies and increasingly complex dissolution testing, with limited or poor correlation to in vivo absorption. These issues are often sufficiently formidable to halt development of many compounds (Hite et al., 2003).

Other therapeutic uses of cyclophilin inhibitors

Human Immunodeficiency Virus (HIV)

Cyclophilin inhibitors, such as CsA and DEBIO-025 have also shown potential utility in inhibition of HIV replication. The cyclophilin inhibitors are thought to interfere with function of CyPA during progression/completion of HIV reverse transcription (Ptak et al., 2008). However, when tested clinically, DEBIO-025 only reduced HIV-1 RNA levels≥0.5 and >1 Iog10 copies/mL in nine and two patients respectively, whilst 27 of the treated patients showed no reduction in HIV-1 RNA levels (Steyn et al., 2006). Following this, DEBIO-025 was trialled in HCV/HIV coinfected patients, and showed better efficacy against HCV, and the HIV clinical trials were discontinued (see Watashi et al., 2010).

Treatment of HIV

More than 30 million people are infected by HIV-1 worldwide, with 3 million new cases each year. Treatment options have improved dramatically with the introduction of highly active antiretroviral therapy (HAART) (Schopman et al., 2010), By 2008, nearly 25 antiretroviral drugs had been licensed for treatment of HIV-1 , including nine nucleoside reverse transcriptase inhibitors (NRTI), four non-nucleoside reverse transcriptase inhibitors (NNRTI), nine protease inhibitors (PI), one fusion inhibitor, one CCR5 inhibitor and one integrase inhibitor (Shafer and Schapiro, 2008). However, none of these current regimens lead to complete viral clearance, they can lead to severe side effects and antiviral resistance is still a major concern. Therefore, there still remains a need for new antiviral therapies, especially in mechanism of action classes where there are no approved drugs, such as is the case for cyclophilin inhibitors.

Inhibition of the Mitochondrial Permeability Transition Pore (mPTP)

Opening of the high conductance permeability transition pores in mitochondria initiates onset of the mitochondrial permeability transition (MPT). This is a causative event, leading to necrosis and apoptosis in hepatocytes after oxidative stress, Ca²⁺ toxicity, and

ischaemia/reperfusion. Inhibition of Cyclophilin D (also known as Cyclophilin F) by cyclophilin inhibitors has been shown to block opening of permeability transition pores and protects cell death after these stresses. Cyclophilin D inhibitors may therefore be useful in indications where the mPTP opening has been implicated, such as muscular dystrophy, in particular Ullrich congenital muscular dystrophy and Bethlem myopathy (Millay et al., 2008, WO2008/084368, Palma et al., 2009), multiple sclerosis (Forte et al., 2009), diabetes (Fujimoto et al., 2010), amyotrophic lateral sclerosis (Martin 2009), bipolar disorder (Kubota et al., 2010), Alzheimer's disease (Du and Yan, 2010), Huntington's disease (Perry et al., 2010), recovery after myocardial infarction (Gomez et al., 2007) and chronic alchohol consumption (King et al., 2010). Further therapeutic uses

Cyclophilin inhibitors have potential activity against other viruses, such as Varicella- zoster virus (Ptak et al., 2008), Influenza A virus (Liu et al., 2009), Severe acute respiratory syndrome coronavirus and other human and feline coronaviruses (Chen et al., 2005, Ptak et al., 2008), Dengue virus (Kaul et al., 2009), Yellow fever virus (Qing et al., 2009), West Nile virus (Qing et al., 2009), Western equine encephalitis virus (Qing et al., 2009), Cytomegalovirus (Kawasaki et al., 2007) and Vaccinia virus (Castro et al., 2003).

There are also reports of utility of cyclophilin inhibitors and cyclophilin inhibition in other therapeutic areas, such as in cancer (Han et al., 2009). Therefore there remains a need to identify novel cyclophilin inhibitors, which may have utility, particularly in the treatment of HCV infection, but also in the treatment of other disease areas where inhibition of cyclophilins may be useful, such as HIV infection, muscular dystrophy, Ullrich congenital muscular dystrophy, Bethlem myopathy, multiple sclerosis, diabetes, amyotrophic lateral sclerosis, bipolar disorder, Alzheimer's disease, Huntington's disease, myocardial infarction and chronic alcohol consumption or aiding recovery after myocardial infarction. Preferably, such cyclophilin inhibitors have improved properties over the currently available cyclophilin inhibitors, including one or more of the following properties: improved water solubility, improved potency against HCV, reduced toxicity (including hepatotoxicity), improved pharmacological profile, such as high exposure to target organ (e.g. liver in the case of HCV) and/or long half life (enabling less frequent dosing), reduced drug-drug interactions, such as via reduced levels of CYP3A4 metabolism and inhibition and reduced (Pgp) inhibition (enabling easier multi-drug combinations) and improved side-effect profile, such as low binding to MRP2, leading to a reduced chance of hyperbilirubinaemia, lower immunosuppressive effect, improved activity against resistant virus species, in particular CsA and CsA analogue (e.g DEBIO-025) resistant virus species and higher therapeutic (and/or selectivity) index. The present invention discloses novel sanglifehrin analogues which may have one or more of the above properties. In particular, the present invention discloses novel ester derivatives, which are anticipated to have improved potency against HCV, for example as shown by a low replicon EC50.

In addition, there is also a need to develop novel immunosuppressive agents, which may have utility in the prophylaxis of transplant rejection, or in the treatment of autoimmune, inflammatory and respiratory disorders. Preferably, such immunosuppressants have improved properties over the known sanglifehrins, including one or more of the following properties:

improved water solubility, improved potency in immunosuppressive activity, such as might be seen in t-cell proliferation assays, reduced toxicity (including hepatotoxicity), improved pharmacological profile, such as high exposure to target organ and/or long half life (enabling less frequent dosing), reduced drug-drug interactions, such as via reduced levels of CYP3A4 metabolism and inhibition and reduced (Pgp) inhibition (enabling easier multi-drug

combinations) and improved side-effect profile. The present invention discloses novel sanglifehrin analogues which may have one or more of the above properties. In particular, the present invention discloses novel ester derivatives, which have improved immunosuppressive potency, for example as shown by a low t-cell proliferation IC50.

Summary of the invention

The present invention provides novel macrocyclic sanglifehrin analogues, which have been generated by semisynthetic modification of native sanglifehrins. These analogues may be generated by dihydroxylation of a sanglifehrin, such as SfA, followed by cleavage to generate the aldehydic macrocycle, followed by further chemistry, including Horner-Emmons type reactions, to generate molecules with a variety of substituents to replace the aldehyde. As a result, the present invention provides macrocylic ester analogues of SfA, methods for the preparation of these compounds, and methods for the use of these compounds in medicine or as intermediates in the production of further compounds.

Therefore, in a first aspect, the present invention provides macrocyclic esters and derivatives thereof according to formula (I) below, or a pharmaceutically acceptable salt thereof:

wherein:

Ri represents alkyl, alkenyl, cycloalkyl, cycloalkenyl, alkylcycloalkyl, alkylcycloalkenyl, alkenylcycloalkyi, alkenylcycloalkenyl, aryl, heteroaryl, alkylaryl, alkylheteroaryl, alkenylaryl or alkenylheteroaryl any of which groups may optionally be substituted by monocylic aryl or monocyclic heteroaryl;

or Ri represents hydrogen;

and wherein one or more carbon atoms of Ri not being part of an aryl or heteroaryl group are optionally replaced by a heteroatom selected from O, N and S(0)_p in which p represents 0, 1 or 2 and wherein one or more carbon atoms of Ri are optionally replaced by carbonyl;

provided that R-i does not represent methyl or -CHMe₂;

and wherein one or more carbon atoms of an R-i group may optionally be substituted by one or more halogen atoms;

R₃ represents H or (CO)_xalkyl;

R₄ represents H or OH;

R₅ represents H, OH or =0;

n represents a single or double bond save that when n represents a double bond R₄ represents H ; and

m represents a single or double bond save that when m represents a double bond R₅ represents H;

x represents 0 or 1 ; including any tautomer thereof; or an isomer thereof in which the C26, 27 C=C bond shown as trans is c/^'s; and including a methanol adduct thereof in which a ketal is formed by the combination of the C-53 keto (if present) and the C-15 hydroxyl group and methanol.

Certain compounds represented by the structure of formula (I) in which R-i represents methyl or -CHMe₂ (herewith not claimed) are disclosed in Sedrani et al (2003) (see Scheme 3 on p3853, specifically compounds 8 and 9).

The above structure shows a representative tautomer and the invention embraces all tautomers of the compounds of formula (I) for example keto compounds where enol compounds are illustrated and vice versa.

Specific tautomers that are included within the definition of formula (I) are those in which (i) the C-53 keto group forms a hemiketal with the C-15 hydroxyl, or (ii) the C-15 and C-17 hydroxyl can combine with the C-53 keto to form a ketal. All numberings use the system for the parent sanglifehrin A structure.

Definitions

The articles "a" and "an" are used herein to refer to one or to more than one (i.e. at least one) of the grammatical objects of the article. By way of example "an analogue" means one analogue or more than one analogue.

As used herein the term "analogue(s)" refers to chemical compounds that are structurally similar to another but which differ slightly in composition (as in the replacement of one atom by another or in the presence or absence of a particular functional group).

As used herein the term "sanglifehrin(s)" refers to chemical compounds that are structurally similar to sanglifehrin A but which differ slightly in composition (as in the

replacement of one atom by another or in the presence or absence of a particular functional group), in particular those generated by fermentation of Streptomyces sp. A92-3081 10.

Examples include the sanglifehrin-like compounds discussed in WO97/02285 and WO98/07743, such as sanglifehrin B.

As used herein, the term "HCV" refers to Hepatitis C Virus, a single stranded, RNA, enveloped virus in the viral family Flaviviridae.

As used herein, the term "HIV" refers to Human Immunodeficiency Virus, the causative agent of Human Acquired Immune Deficiency Syndrome.

As used herein, the term "bioavailability" refers to the degree to which or rate at which a drug or other substance is absorbed or becomes available at the site of biological activity after administration. This property is dependent upon a number of factors including the solubility of the compound, rate of absorption in the gut, the extent of protein binding and metabolism etc. Various tests for bioavailability that would be familiar to a person of skill in the art are described herein (see also Egorin et al. 2002).

The term "water solubility" as used in this application refers to solubility in aqueous media, e.g. phosphate buffered saline (PBS) at pH 7.4, or in 5% glucose solution. Tests for water solubility are given below in the Examples as "water solubility assay".

As used herein, the term "macrocyclic ester" refers to a ester referred to above as representing the invention in its broadest aspect, for example a compound according to formula (I) above, or a pharmaceutically acceptable salt thereof. These compounds are also referred to as "compounds of the invention" or "derivatives of sanglifehrin" or "sanglifehrin analogues" and these terms are used interchangeably in the present application.

The pharmaceutically acceptable salts of compounds of the invention such as the compounds of formula (I) include conventional salts formed from pharmaceutically acceptable inorganic or organic acids or bases as well as quaternary ammonium acid addition salts. More specific examples of suitable acid salts include hydrochloric, hydrobromic, sulfuric, phosphoric, nitric, perchloric, fumaric, acetic, propionic, succinic, glycolic, formic, lactic, maleic, tartaric, citric, palmoic, malonic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, fumaric, toluenesulfonic, methanesulfonic, naphthalene-2-sulfonic, benzenesulfonic hydroxynaphthoic, hydroiodic, malic, steroic, tannic and the like. Hydrochloric acid salts are of particular interest. Other acids such as oxalic, while not in themselves pharmaceutically acceptable, may be useful in the preparation of salts useful as intermediates in obtaining the compounds of the invention and their pharmaceutically acceptable salts. More specific examples of suitable basic salts include sodium, lithium, potassium, magnesium, aluminium, calcium, zinc, Ν,Ν'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N- methylglucamine and procaine salts. References hereinafter to a compound according to the invention include both compounds of formula (I) and their pharmaceutically acceptable salts.

As used herein, the term "alkyl" represents a straight chain or branched alkyl group, containing typically 1 -10 carbon atoms, for example a Ci_-6 alkyl group. "Alkenyl" refers to an alkyl group containing two or more carbons (for example 2-10 carbons e.g. 2-6 carbons) which is unsaturated with one or more double bonds.

Examples of alkyl groups include C₁-4 alkyl groups such as methyl, ethyl, n-propyl, i-propyl, and n-butyl. Examples of alkenyl groups include C_2-4alkenyl groups such as -CH=CH₂ and -

As used herein, the term "cycloalkyl" represents a cyclic alkyl group, containing typically 3- 10 carbon atoms, optionally branched, for example cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. A branched example is 2-methylcyclopentyl. "Cycloalkenyl" refers to a cyclic alkenyl group containing typically 5-10 carbon atoms, for example cyclopentyl, cyclohexenyl or cycloheptenyl. Cycloalkyl and cycloalkenyl groups may for example be monocyclic or bicyclic (including spirocyclic) but are suitably monocyclic.

As used herein, the term "cycloalkyl" represents a cyclic alkyl group, containing typically 3- 10 carbon atoms, optionally branched, for example cyclobutyl, cyclopentyl, cyclohexyl or cycloheptyl. A branched example is 2-methylcyclopentyl. "Cycloalkenyl" refers to a cyclic alkenyl group containing typically 5-10 carbon atoms, for example cyclopentyl, cyclohexenyl or

cycloheptenyl. Cycloalkyl and cycloalkenyl groups may for example be monocyclic or bicyclic (including spirocyclic) but are suitably monocyclic.

As used herein, the term "heterocyclyl" represents a cycloalkyl group in which one or more one or more ring carbon atoms (e.g. 1 , 2 or 3 ring carbon atoms such as 1 or 2 e.g. 1 ) are replaced by heteroatoms selected from O, N and S. Examples include morpholinyl, piperidinyl, pyrrolidinyl, piperazinyl and N-methyl piperazinyl.

As used herein, the term "heterocyclenyl" represents a cycloalkenyl group in which one or more one or more ring carbon atoms (e.g. 1 , 2 or 3 ring carbon atoms such as 1 or 2 e.g. 1 ) are replaced by heteroatoms selected from O, N and S.

Examples of aryl groups include (except where indicated) monocyclic groups i.e. phenyl and bicyclic rings (e.g. 9 and 10 membered rings) which are aromatic or (in the case of bicyclic rings contain at least one aromatic ring). For example a bicyclic ring may be fully aromatic e.g. naphthyl or may be partially aromatic (e.g. containing one aromatic ring), such as tetraline, indene or indane. Preferred aryl is phenyl. Aryl groups may optionally be substituted e.g. with one or more (e.g. 1 , 2 or 3) substituents e.g. selected from alkyl (eg Ci_-4alkyl), hydroxyl, CF₃, halogen, alkoxy (e.g. Ci_-4alkoxy), nitro, -S0₂Me, cyano and -CONH₂.

Examples of heteroaryl groups include (except where indicated) monocyclic groups (e.g. 5 and 6 membered rings) and bicyclic rings (e.g. 9 and 10 membered rings) which are aromatic or (in the case of bicyclic rings contain at least one aromatic ring) and contain one or more heteroatoms (e.g. 1 , 2, 3 or 4) heteroatoms selected from N, O and S. Examples of 5 membered heteroaryl rings include pyrrole, furan, thiophene, oxazole, oxadiazole, thiazole and triazole. Examples of 6 membered heteroaryl rings include pyridine, pyrimidine and pyrazine. Examples of bicyclic rings include fully aromatic rings such as quinoline, quinazoline, isoquinoline, indole, cinnoline, benzthiazole, benzimidazole, purine and quinoxaline and partially aromatic rings such as chromene, chromane, tetrahydroquinoline, dihydroquinoline, isoindoline and indoline. Monocyclic heteroaryl groups are preferred. The aforementioned heteroaryl groups may be optionally substituted as described above for aryl groups.

When bicyclic aryl and heteroaryl groups are partially aromatic, the connection to the remainder of the molecule may be through the aromatic portion or through the non-aromatic portion.

The term "treatment" includes prophylactic as well as therapeutic treatment. Figure Legend

Figure 1 : A: HPLC Profile of Harvest Whole Broth Sample of sanglifehrin A, 5 &

sanglifehrin B, 7, (monitored at 240nm)

B: UV spectrum of sanglifehrin A, 5

Figure 2: ¹H NMR of compound 10

Figure 3: ¹H NMR of compound 11

Figure 4: ¹H NMR of compound 12

Figure 5: ¹H NMR of compound 16

Figure 6: Synthesised DNA fragment containing a region of homology upstream of the reductive loop of sanglifehrin module 12 (SEQ ID NO: 1 ).

Figure 7: MGo013 + MGo14 PCR product with inserted G at position1978 (SEQ ID NO: 4).

Description of the Invention

The present invention provides sanglifehrin macrocylic ester analogues, as set out above, methods for preparation of these compounds and methods for the use of these compounds in medicine.

In one embodiment, the compound is a methanol adduct thereof in which a ketal is formed by the combination of the C-53 keto and the C-15 hydroxyl groups and methanol. In another embodiment it is not.

When the group Ri includes S(0)_p, the variable p suitably represents 0 or 1. In one embodiment p represents 0 in another embodiment p represents 1 . In another embodiment p represents 2.

When Ri represents -alkylaryl, an example includes Ci_-2alkylaryl e.g. benzyl.

When Ri represents -alkenylaryl, an example includes C_2-3alkenylaryl e.g. - ethenylphenyl.

When Ri represents -alkylheteroaryl, an example includes Ci_-2alkylheteraryl e.g. - methylpyridinyl.

When Ri represents -alkenylheteroaryl, an example includes C_2-3alkenylheteroaryl e.g. -ethenylpyridinyl.

In one embodiment R-i represents alkyl, alkenyl, cycloalkyi, cycloalkenyl, alkylcycloalkyi, alkylcycloalkenyl, alkenylcycloalkyl, alkenylcycloalkenyl, aryl, heteroaryl, alkylaryl,

alkylheteroaryl, alkenylaryl or alkenylheteroaryl. In one embodiment, R-i represents C_4-io alkyl, alkenyl, cycloalkyl, cycloalkenyl, alkylcycloalkyl, alkylcycloalkenyl, alkenylcycloalkyl, alkenylcycloalkenyl, aryl, heteroaryl, alkylaryl, alkylheteroaryl, alkenylaryl or alkenylheteroaryl any of which groups may optionally be substituted by monocylic aryl or monocyclic heteroaryl;

or Ri represents hydrogen;

and wherein one or more carbon atoms of Ri not being part of an aryl or heteroaryl group are optionally replaced by a heteroatom selected from O, N and S(0)_p in which p represents 0, 1 or 2 and wherein one or more carbon atoms of Ri are optionally replaced by carbonyl.

In one embodiment R-i represents aryl or heteroaryl substituted by monocyclic aryl or monocyclic heteroaryl. R-i may, for example, represent 4-biphenylyl in which either of the phenyl rings is optionally substituted.

In certain embodiments a carbon atom of Ri is replaced by a heteroatom.

If -CH₃ is replaced by N, the group formed is -NH₂-. If -CH₂- is replaced by N, the group formed is -NH-. If -CHR- is replaced by N the group formed is -NR-. Hence nitrogen atoms within Ri may be primary, secondary or tertiary nitrogen atoms.

When a carbon atom of Ri is replaced by a heteroatom, it is suitably replaced by O or N, especially O.

In certain embodiments, a carbon atom of Ri is replaced by a heteroatom such that Ri represents heterocyclyl, heterocyclenyl, alkylheterocyclyl, alkylheterocyclenyl, alkenylheterocyclyl or alkenylheterocyclenyl.

When R-i contains more than one heteroatom, these should typically be separated by two or more carbon atoms.

When R-i contains a heteroatom, suitably the heteroatom is not positioned adjacent to the O atom to which R-i is attached.

In one embodiment, R-i does not contain any heteroatom.

When a carbon atom of Ri is replaced by a carbonyl, the carbonyl is suitably located adjacent to another carbon atom or a nitrogen atom. Suitably carbonyl groups are not located adjacent to sulphur or oxygen atoms.

For example Ri may represent -COCi_-3alkyl e.g. -COMe.

Suitably a carbon atom of Ri is not replaced by a carbonyl.

In an embodiment, Ri represents Ci_-6alkyl (such as C _4-6 alkyl), C_2-6alkenyl,

7cycloalkyl or Ci_-4alkylC₅-₇cycloalkenyl.

In an embodiment, R-i may represent aryl or heteroaryl optionally substituted by monocyclic aryl or monocyclic heteroaryl,

or -C_2-4alkenyl.

When R-i represents alkyl suitably it represents C _4-i₀ alkyl (e.g. C _4-6 alkyl). Suitably Ri is selected from C _2-io alkyl (e.g. C _2-6 alkyl such as C ₄-6 alkyl), C _2-io alkenyl (e.g. C 2-6 alkenyl such as C _4-6 alkenyl) and aryl.

Thus, in one embodiment R-i is selected from C_4-6 alkyl, C _2-6 alkenyl and aryl.

Suitably Ri groups do not comprise a C=C moiety adjacent to a heteroatom. Suitably Ri groups do not comprise a terminal C=C moiety which is adjacent to the O group shown in formula

(I)-

When one or more carbon atoms of an R-i group are substituted by one or more halogen atoms, exemplary halogen atoms are F, CI and Br, especially F and CI particularly F.

For example Ri moieties may be substituted by up to 6 halogen atoms (e.g. F atoms) for example up to 3 halogen atoms (e.g. F atoms).

An exemplary halogenated Ri moiety is -CF₃.

Suitably carbon atoms of an Ri group are not substituted by one or more halogen atoms i.e Ri represents alkyl, alkenyl, cycloalkyl, cycloalkenyl, alkylcycloalkyl, alkylcycloalkenyl, alkenylcycloalkyi, alkenylcycloalkenyl, aryl, heteroaryl, alkylaryl, alkylheteroaryl, alkenylaryl or alkenylheteroaryl any of which groups may optionally be substituted by monocylic aryl or monocyclic heteroaryl;

or Ri represents hydrogen;

and wherein one or more carbon atoms of Ri not being part of an aryl or heteroaryl group are optionally replaced by a heteroatom selected from O, N and S(0)_p in which p represents 0, 1 or 2 and wherein one or more carbon atoms of Ri are optionally replaced by carbonyl;

provided that R-i does not represent methyl or -CHMe₂.

Exemplary Ri groups include -CH₂CH=CH₂, ethyl, n-propyl, n-butyl, t-butyl, i-butyl, - CH₂C(Me)₃,n-pentyl, -CH₂CH₂C(Me)₃, n-hexyl, n-heptyl, -cyclopentyl, -methylcyclohexyl, phenyl, - methylphenyl, -methylpyridinyl, thiazole, triazole, imidazole, oxazole, furan, thiophene and tetrazole, for example are selected from -CH₂CH=CH₂, n-butyl, t-butyl, i-butyl, -CH₂C(Me)₃,n- pentyl, -CH₂CH₂C(Me)₃, n-hexyl, n-heptyl, -cyclopentyl, -methylcyclohexyl, phenyl, -methylphenyl, -methylpyridinyl, thiazole, triazole, imidazole, oxazole, furan, thiophene and tetrazole.

Further exemplary R-i groups include those aryl or heteroaryl groups just mentioned in which the aryl or heteroaryl group is substituted.

Further exemplary R-i groups include cyclohexyl and methylcyclopentyl.

Suitably x represents 0.

Suitable R₃ represents H or (CO)_xCi_-4alkyl e.g. H or Ci_-4alkyl such as H or methyl, especially H.

Suitably n represents bond.

Suitably m represents bond.

Suitably R4 represents OH. Suitably R₅ represents =0.

In a suitable embodiment of the invention, R-i represents CH₂CH=CH2, R3 represents H, R₄ represents OH, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

In another suitable embodiment of the invention, R-i represents CH₂CH₃, R₃ represents H, R₄ represents OH, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

In another suitable embodiment of the invention, R-i represents C(CH₃)₃, R₃ represents H, R₄ represents OH, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

In another suitable embodiment of the invention, R-i represents phenyl, R₃ represents H, R₄ represents OH, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

In another suitable embodiment of the invention, R-i represents C(CH₃)₃, R₃ represents H, R₄ represents H, n represents a double bond, m represents bond and R₅ represents =0 as represented by the following structure:

In another suitable embodiment of the invention, R-i represents C(CH₃)₃, R₃ represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as

represented by the following structure:

In another suitable embodiment of the invention, R-i represents CH₂CH=CH2, R3 represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

In another suitable embodiment of the invention, R-i represents CH₂CH₃, R₃ represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as

represented by the following structure:

In another suitable embodiment of the invention, R-i represents phenyl, R₃ represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

In another series of suitable embodiments, R₃ represents H, R₄ represents OH, n represents a single bond, m represents a single bond and R₅ represents =0 as represented by the following structure:

In some embodiments the double bond at the C26,27 position (by reference to the structure of sanglifehrin A) may be in the cis form instead of the trans form.

In a suitable embodiment of the invention, the double bond at the C26,27 position is in the cis form, as represented by the following formula:

Such compounds may be produced during chemical synthesis.

In general, the compounds of the invention are prepared by semi-synthetic derivatisation of a sanglifehrin. Sanglifehrins may be prepared using methods described in WO97/02285 and WO98/07743, which documents are incorporated in their entirety, or additional methods described herein. Sanglifehrins have also been produced by complex total synthetic chemistry which is capable of producing low amounts of material following extensive laboratory work. Semisynthetic methods for generating the sanglifehrin macrocylic aldehyde are described in US6, 124,453, Metternich et al., 1999, Banteli et al., 2001 and Sedrani et al., 2003.

In general, a process for preparing certain compounds of formula (I) or a pharmaceutically acceptable salt thereof comprises:

• dihydroxylation of sanglifehrin A or other naturally occurring analogue of sanglifehrin (e.g. Sanglifehrin B) or an analogue thereof having variation at the positions denoted by variables R₃, F¾, R₅, n and m;

• oxidative cleavage of the 1 ,2-diol to yield an aldehyde; and

• coupling said aldehyde with a stabilised carbanion (or canonical form thereof), such as a phosphonate carbanion, using a compound of formula II.

This is shown retrosynthetically below:

Wherein for sanglifehrin A, R₇ =

R₈ groups, which may be the same or different, independently represent alkyl (e.g. C ₄alkyl) or benzyl.

Hence, a process for preparing compounds of the invention comprises reacting a compound of formula II with an aldehydic macrocycle (compound of formula III).

The preparation of compounds of formula III have been described previously (Metternich et al. 1999). Briefly, a sanglifehrin, such as SfA, is dihydroxylated using modified Sharpless conditions (catalytic osmium tetroxide). The use of the chiral ligands aids in promoting selectivity. The resultant diol can then be cleaved oxidatively, using for instance sodium periodate. The resultant compound of formula III can then be used as a substrate for derivatisation to an homologated ester. Typically a compound of formula II is dissolved in an aprotic solvent, cooled and the treated with a base, for example sodium hydride. A compound of formula III is then added and the reaction warmed in temperature. After a suitable period of time the reaction is stopped and the compound of formula I is purified by standard conditions (e.g. preparative HPLC, preparative TLC etc).

Compounds of formula II may be known or readily synthesised from available alcohols (R₁OH). As shown in scheme 1 (below) the alcohol may be used to treat chloroacetyl chloride or similar to form an alpha-chloroester. The alpha-chloroester is then treated in an Arbuzov reaction to generate the compound of formula II. Other routes to compounds of formula II will be apparent to one skilled in the art.

formula II

Scheme 1

If desired or necessary, protecting groups may be employed to protect functionality in the aldehydic macrocycle, acid macrocycle or the amine, as described in T. W. Green, P. G. M. Wuts, Protective Groups in Organic Synthesis, Wiley-lnterscience, New York, 1999, 49-54, 708-71 1 .

The methanol adduct may be prepared by fermentation and isolation from broth, or may be prepared from sanglifehrin A (WO97/02285).

In addition to the specific methods and references provided herein a person of skill in the art may also consult standard textbook references for synthetic methods, including, but not limited to Vogel's Textbook of Practical Organic Chemistry (Furniss et al., 1989) and March's Advanced Organic Chemistry (Smith and March, 2001 ).

Polyketide biosynthetic engineering methods have also been described to enable generation of compounds of formula I where R₄=H and n=bond. This involves replacing the reductive loop of sanglifehrin module 12 (see WO2010/034243 and Qu et al., 201 1 ), with a reductive loop conferring active dehydratase (DH), enoyl reductase (ER) and ketoreductase (KR) domains (e.g. the reductive loops from rapamycin modules 13,7 or 1 (Aparicio et al., 1996), erythromycin module 4 (Bevitt et al., 1992) or sanglifehrin module 6 (Qu et al., 201 1 )). An individual skilled in the art will appreciate that a suitable reductive loop could be identified in a type I polyketide synthase module on the basis of homology to published sequences (eg Aparicio et al 1996), and consequently that this change could be accomplished by the introduction of any such loop containing the three active domains, DH, ER and KR. Methods for polyketide biosynthetic engineering and the concept of a reductive loop are described in WO98/01546 and WO00/01827.

It is obvious to someone skilled in the art that these compounds can be synthesised de novo from commercially available compounds, i.e. total synthesis. The synthesis of the tripeptide and subsequent macrocycle formation has been described (Cabrejas et al, 1999). A process such as this could be modified to generate compounds of the invention.

Other compounds of the invention may be prepared by methods known per se or by methods analogous to those described above.

A sanglifehrin macrocycle of the invention may be administered alone or in combination with other therapeutic agents. Co-administration of two (or more) agents allows for lower doses of each to be used, thereby reducing side effect, can lead to improved potency and therefore higher SVR, and a reduction in resistance.

Therefore in one embodiment, the sanglifehrin macrocycle of the invention is coadministered with one or more therapeutic agent s for the treatment of HCV infection, taken from the standard of care treatments. This could be an interferon (e.g. pIFNa and/or ribavirin).

In an alternative embodiment, a sanglifehrin macrocycle of the invention is co-administered with one or more other anti-viral agents, such as a STAT-C (specifically targeted agent for treatment of HCV), which could be one or more of the following: Non-nucleoside Polymerase inhibitors (e.g. ABT-333, ABT-072, BMS 791325, IDX375, VCH-222, Bl 207127, ANA598, VCH- 916, GS 9190, PF-00868554 (Filibuvir) or VX-759), Nucleoside or nucleotide polymerase inhibitors (e.g. 2'-C-methylcytidine, 2'-C-methyladenosine, R1479, PSI-6130, R7128, R1626, PSI 7977 or IDX 184), Protease inhibitors (e.g. ABT-450, ACH-1625, Bl 201355, BILN-2061 , BMS-650032, CTS 1027, Danoprevir, GS 9256, GS 9451 , MK 5172, IDX 320, VX-950(Telaprevir),

SCH503034(Boceprevir), TMC435350, MK-7009 (Vaneprivir), R7227/ITMN-191 , EA-058, EA-063 or VX 985), NS5A inhibitors (e.g. A-831 , BMS 790052, BMS 824393, CY-102 or PPI-461 ), silymarin, NS4b inhibitors, serine C-palmitoyltransferase inhibitors, Nitazoxanide or viral entry inhibitors (e.g. PRO 206).

In an alternative embodiment, a sanglifehrin macrocycle of the invention is co-administered with one or more other anti-viral agents (such as highly active antiretroviral therapy (HAART)) for the treatment of HIV, which could be one or more of the following: nucleoside reverse transcriptase inhibitors (NRTI) (e.g. Emtricitabine or Tenofovir), non-nucleoside reverse transcriptase inhibitors (NNRTI) (e.g. Rilipivirine or Efavirenz), protease inhibitors (PI) (e.g. Ritonavir or Lopinavir), fusion inhibitors (e.g. Maraviroc or Enfuvirtide), CCR5 inhibitors (e.g. Aplaviroc or Vicriviroc), maturation inhibitors (e.g. Bevirimat), CD4 monoclonal antibodies (e.g. Ibalizumab) and integrase inhibitors (e.g. Eltiegravir).

The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (compound of the invention) with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The compounds of the invention will normally be administered orally in the form of a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form. Depending upon the disorder and patient to be treated, as well as the route of administration, the compositions may be administered at varying doses.

For example, the compounds of the invention can be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed- or controlled-release

applications.

Such tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone,

hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.

Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.

A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g. povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (e.g. sodium starch glycolate, cross-linked povidone, cross-linked sodium

carboxymethyl cellulose), surface-active or dispersing agent. Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example,

hydroxypropylmethylcellulose in varying proportions to provide desired release profile.

Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a

predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The active ingredient may also be presented as a bolus, electuary or paste.

It should be understood that in addition to the ingredients particularly mentioned above the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.

Advantageously, agents such as preservatives and buffering agents can be dissolved in the vehicle. To enhance the stability, the composition can be frozen after filling into the vial and the water removed under vacuum. The dry lyophilized powder is then sealed in the vial and an accompanying vial of water for injection may be supplied to reconstitute the liquid prior to use.

The dosage to be administered of a compound of the invention will vary according to the particular compound, the disease involved, the subject, and the nature and severity of the disease and the physical condition of the subject, and the selected route of administration. The appropriate dosage can be readily determined by a person skilled in the art.

The compositions may contain from 0.1 % by weight, preferably from 5-60%, more preferably from 10-30% by weight, of a compound of invention, depending on the method of administration.

It will be recognized by one of skill in the art that the optimal quantity and spacing of individual dosages of a compound of the invention will be determined by the nature and extent of the condition being treated, the form, route and site of administration, and the age and condition of the particular subject being treated, and that a physician will ultimately determine appropriate dosages to be used. This dosage may be repeated as often as appropriate. If side effects develop the amount and/or frequency of the dosage can be altered or reduced, in accordance with normal clinical practice.

Further aspects of the invention include:

-A compound according to the invention for use as a pharmaceutical;

-A compound according to the invention for use as a pharmaceutical for the treatment of viral infections (especially RNA virus infections) such as HCV or HIV infection or as an

immunosuppressant or an anti-inflammatory agent; -A compound according to the invention for use as a pharmaceutical for the treatment of muscular dystrophy;

-A pharmaceutical composition comprising a compound according to the invention together with a pharmaceutically acceptable diluent or carrier;

-A pharmaceutical composition comprising a compound according to the invention together with a pharmaceutically acceptable diluent or carrier further comprising a second or subsequent active ingredient, especially an active ingredient indicated for the treatment of viral infections such as HCV or HIV infection or as an immunosuppressant or an anti-inflammatory agent;

-A method of treatment of viral infections (especially RNA virus infections) such as HCV or HIV infection or muscular dystrophy which comprises administering to a subject a therapeutically effective amount of a compound according to the invention;

-Use of a compound according to the invention for the manufacture of a medicament for the treatment of viral infections such as HCV or HIV infection or as an immunosuppressant or an anti-inflammatory agent.

General Methods

Materials and Methods

Bacterial strains and growth conditions

The sanglifehrin producer Streptomyces sp. A92-3081 10 (DSM no 9954, purchased from DSMZ, Braunschweig, Germany) also termed BIOT-4253 and BIOT-4370 is maintained on medium oatmeal agar, MAM, or ISP2 (see below) at 28 °C.

Streptomyces sp. A92-3081 10 was grown on oatmeal agar at 28 °C for 7-10 days. Spores from the surface of the agar plate were collected into 20% w/v sterile glycerol in distilled and storec in 0.5-ml aliquots at -80 °C. Frozen spore stock was used for inoculating seed media SGS or SM25- 3. The inoculated seed medium was incubated with shaking between 200 and 300 rpm at 5.0 or 2.1 cm throw at 27 °C for 24 hours. The fermentation medium SGP-2 or BT6 were inoculated with 2.5%- 10% of the seed culture and incubated with shaking between 200 and 300 rpm with a 5 or 2.5 err throw at 24 °C for 4-5 days. The culture was then harvested for extraction.

Media Recipes

Water used for preparing media was prepared using Millipore Elix Analytical Grade Watei Purification System

SGS Seed Medium Ingredient (and supplier) Recipe

Glucose (Sigma, G7021 ) 7.50 g

Glycerol (Fisher scientific, G/0650/25) 7.50 g yeast extract (Becton Dickinson, 212770) 1.35 g malt extract (Becton Dickinson, 218630) 3.75 g potato starch (soluble) (Signma, S2004) 7.50 g

NZ-amine A (Sigma, C0626) 2.50 g toasted soy flour, Nutrisoy (ADM, 063-160) 2.50 g

L-asparagine (Sigma, A0884) 1.00 g

CaC0₃ (Calcitec, V/40S) 0.05 g

NaCI (Fisher scientific, S/3160/65) 0.05 g

KH₂PO₄ (Sigma, P3786) 0.25 g

K₂HPO₄ (Sigma, P5379) 0.50 g

MgS0₄.7H₂0 (Sigma, M7774) 0.10 g trace element solution B 1.00 ml_ agar 1.00 g

SAG471 Antifoam (GE Silicones, SAG471 ) * 0.20 ml_

RO H₂0 to final vol. of ** 1.00 L pre-sterilisation pH was adjusted to pH 7.0 with 10M NaOH/10M H₂S0₄

sterilised by heating 121 °C, 20-30 min (autoclaving) Notes

^* antifoam only used in seed fermenters, NOT seed flasks ^**final volume adjusted accordingly to account for seed volume

Trace Element Solution B

Ingredient Recipe

FeS0₄.7H₂0 (Sigma, F8633) 5.00 g

ZnS0₄.7H₂0 (Sigma, Z0251 ) 4.00 g

MnCI₂.4H₂0 (Sigma, M8530) 2.00 g

CuS0₄.5H₂0 (Aldrich, 20,919-8) 0.20 g

(ΝΗ₄)₆Μθ7θ₂4 (Fisher scientific, A/5720/48) 0.20 g

CoCI₂.6H₂0 (Sigma, C2644) 0.10 g

H3BO3 (Sigma, B6768) 0.10 g

Kl (Alfa Aesar, A12704) 0.05 g H₂S0₄ (95%) (Fluka, 84720) 1.00 mL

RO H₂0 to final vol. of 1.00 L

SGP2 Production Medium

Ingredient Recipe

toasted soy flour (Nutrisoy) (ADM, 063-160) 20.00

Glycerol (Fisher scientific, G/0650/25) 40.00

MES buffer (Acros, 172595000) 19.52

SAG471 Antifoam (GE Silicones, SAG471 ) ^*0.20 mL

RO H₂0 to final vol. of 1.00 L pre-sterilisation pH adjusted to pH 6.8 with 10M NaOH

sterilised by heating 121 °C, 20-30 min (autoclaving)

Notes

^* final volume adjusted accordingly to account for seed

volume

^** antifoam was used only in fermentors not flasks

Analysis of culture broths by LC-UV and LC-UV-MS

Culture broth (1 mL) and ethyl acetate (1 mL) is added and mixed for 15-30 min followed by centrifugation for 10 min. 0.4 mL of the organic layer is collected, evaporated to dryness and then re-dissolved in 0.20 mL of acetonitrile.

HPLC conditions:

C18 Hyperclone BDS C18 Column 3u, 4.6 mm x 150 mm

Fitted with a Phenomenex Analytical C18 Security Guard Cartridge (KJO-4282)

Column temp at 50 °C

Flow rate 1 mL/min

Monitor UV at 240 nm

Inject 20 uL aliquot

Solvent gradient:

0 min: 55% B

1 .0 min: 55% B

6.5 min: 100% B

10.0 min: 100% B

10.05 min: 55% B 13.0 min: 55% B

Solvent A is Water + 0.1 % Formic Acid

Solvent B is Acetonitrile + 0.1 % Formic Acid

Under these conditions SfA elutes at 5.5 min

Under these conditions SfB elutes at 6.5 min

LCMS is performed on an integrated Agilent HP1 100 HPLC system in combination with a Bruker Daltonics Esquire 3000+ electrospray mass spectrometer operating in positive ion mode using the chromatography and solvents described above.

Synthesis

All reactions are conducted under anhydrous conditions unless stated otherwise, in oven dried glassware that is cooled under vacuum, using dried solvents. Reactions are monitored by LC-UV-MS, using an appropriate method, for instance the method described above for monitoring culture broths.

QC LC-MS method

HPLC conditions:

C18 Hyperclone BDS C18 Column 3u, 4.6 mm x 150 mm

Fitted with a Phenomenex Analytical C18 Security Guard Cartridge (KJO-4282)

Column temp at 50 °C

Flow rate 1 mL/min

Monitor UV at 210, 240 and 254 nm

Solvent gradient:

0 min: 10% B

2.0 min: 10% B

15 min: 100% B

17 min: 100% B

17.05 min: 10% B

20 min: 10% B

Solvent A is Water + 0.1 % Formic Acid

Solvent B is Acetonitrile + 0.1 % Formic Acid MS conditions

MS operates in switching mode (switching between positive and negative), scanning from 150 to 1500 amu.

In vitro analysis LC-MS method (e.g. for solubility assessment)

Using an API-4000 instrument

HPLC conditions:

Ultimate AQ-C18 (2.1x50mm, 3μΜ)

Column temp at 50 °C

Flow rate 0.4 mL/min

Solvent gradient A1 (e.g. for cpd 1 ):

0.2 min: 10% B

0.7 min: 60% B

1 .1 min: 60% B

1 .4 min: 98% B

2.3 min: 98% B

2.4 min: 10% B

3.5 min: stop

Solvent gradient A2 (e.g. for cpd 5):

0.3 min: 10% B

0.9 min: 95% B

1 .9 min: 95% B

2.0 min: 10% B

3.0 min: stop

Solvent A is H₂O-0.025% FA- 1 mM NH₄OAC

Solvent B is MeOH-0.025% FA- 1 mM NH₄OAC

Solvent gradient A3 (e.g. for cpds 11 and 12):

0.2 min: 10% B

0.7 min: 70% B

1 .1 min: 70% B

1 .4 min: 98% B

2.1 min: 98% B 2.2 min: 10% B

3.5 min: stop

Solvent A is H₂O-0.025% FA- 1 mM NH₄OAC

Solvent B is MeOH-0.025% FA- 1 mM NH₄OAC

Solvent gradient A4 (e.g. for compound 12):

0.2 min: 10% B

0.7 min: 60% B

1 .1 min: 60% B

1 .4 min: 95% B

2.3 min: 95% B

2.4 min: 10% B

3.5 min: stop

Solvent A is H₂O-0.025% FA- 1 mM NH₄OAC

Solvent B is MeOH-0.025% FA- 1 mM NH₄OAC negative scan mode

MRM setup:

transitions [Da]

hydroxymacrocycle, 6 (IS): 741 .5→ 294.3

1 602.2→ 156.0

12 835.6→ 503.4

positive scan mode,

MRM setup:

transitions [Da]

5 1088.8→ 503.2

7 1070.9→ 503.2

In vitro replicon assay for assessment of HCV antiviral activity

Antiviral efficacy against genotype 1 HCV may be tested as follows: One day before addition of the test article, Huh5.2 cells, containing the HCV genotype 1 b l389luc-ubi-neo/NS3- 375.1 replicon (Vrolijk et al., 2003) and subcultured in cell growth medium [DMEM (Cat No. 41965039) supplemented with 10% FCS, 1 % non-essential amino acids (1 1 140035), 1 % penicillin/streptomycin (15140148) and 2% Geneticin (10131027); Invitrogen] at a ratio of 1.3- 1 .4 and grown for 3-4 days in 75cm² tissue culture flasks (Techno Plastic Products), were harvested and seeded in assay medium (DMEM, 10% FCS, 1 % non-essential amino acids, 1 % penicillin/streptomycin) at a density of 6 500 cells/well (Ι ΟΟμ-Jwell) in 96-well tissue culture microtitre plates (Falcon, Beckton Dickinson for evaluation of the anti-metabolic effect and CulturPlate, Perkin Elmer for evaluation of antiviral effect). The microtitre plates are incubated overnight (37°C, 5% C0₂, 95-99% relative humidity), yielding a non-confluent cell monolayer. Dilution series are prepared; each dilution series is performed in at least duplicate. Following assay setup, the microtitre plates are incubated for 72 hours (37°C, 5% C0₂, 95-99% relative humidity).

For the evaluation of anti-metabolic effects, the assay medium is aspirated, replaced with 75μΙ_ of a 5% MTS (Promega) solution in phenol red-free medium and incubated for 1 .5 hours (37°C, 5% C0₂, 95-99% relative humidity). Absorbance is measured at a wavelength of 498nm (Safire², Tecan) and optical densities (OD values) are converted to percentage of untreated controls.

For the evaluation of antiviral effects, assay medium is aspirated and the cell monolayers are washed with PBS. The wash buffer is aspirated, 25μΙ_ of Glo Lysis Buffer (Cat. N°. E2661 , Promega) is added after which lysis is allowed to proceed for 5min at room temperature. Subsequently, 50μΙ_ of Luciferase Assay System (Cat. N°. E1501 , Promega) is added and the luciferase luminescence signal is quantified immediately (1000ms integration time/well, Safire², Tecan). Relative luminescence units are converted to percentage of untreated controls.

The EC50 and EC90 (values derived from the dose-response curve) represent the concentrations at which respectively 50% and 90% inhibition of viral replication would be observed. The CC50 (value derived from the dose-response curve) represents the

concentration at which the metabolic activity of the cells would be reduced to 50 % of the metabolic activity of untreated cells. The selectivity index (SI), indicative of the therapeutic window of the compound, is calculated as CC50/EC50.

A concentration of compound is considered to elicit a genuine antiviral effect in the HCV replicon system when, at that particular concentration, the anti-replicon effect is above the 70% threshold and no more than 30% reduction in metabolic activity is observed.

In vitro replicon assay for assessment of HCV antiviral activity in genotypes 1a and 2a

The replicon cells (subgenomic replicons of genotype 1 a (H77) and 2a (JFH-1 )) were grown in Dulbecco's modified essential media (DMEM), 10% fetal bovine serum (FBS), 1 % penicillin-streptomycin (pen-strep), 1 % glutamine, 1 % non-essential amino acids, 250 μg ml G418 in a 5% C0₂ incubator at 37°C. All cell culture reagents were purchased from Mediatech (Herndon, VA).

The replicon cells were trypsinized and seeded at 5 x 10³ cells per well in 96-well plates with the above media without G418. On the following day, the culture medium was replaced with DMEM containing compounds serially diluted in the presence of 5% FBS.The HCV replicon antiviral assay examines the effects of compounds in a serial of compound dilutions. Briefly, the cells containing the HCV replicon were seeded into 96-well plates. Test article was serially diluted with DMEM plus 5% FBS. The diluted compound was applied to appropriate wells in the plate. After 72 hr incubation at 37°C, the cells were processed. The intracellular RNA from each well was extracted with an RNeasy 96 kit (Qiagen). The level of HCV RNA was determined by a reverse transcriptase-real time PCR assay using TaqMan® One-Step RT-PCR Master Mix Reagents (Applied Biosystems, Foster City, CA) and an ABI Prism 7900 sequence detection system (Applied Biosystems) a as described previously (Vrolijk et al., 2003). The cytotoxic effects were measured with TaqMan® Ribosomal RNA Control Reagents (Applied Biosystems) as an indication of cell numbers. The amount of the HCV RNA and ribosomal RNA were then used to derive applicable IC50 values (concentration inhibiting on replicon replication by 50%)..

Assessment of water solubility

Water solubility may be tested as follows: A 10 mM stock solution of the sanglifehrin analogue is prepared in 100% DMSO at room temperature. Triplicate 0.01 mL aliquots are made up to 0.5 mL with either 0.1 M PBS, pH 7.3 solution or 100% DMSO in amber vials. The resulting 0.2 mM solutions are shaken, at room temperature on an IKA® vibrax VXR shaker for 6 h, followed by transfer of the resulting solutions or suspensions into 2 mL Eppendorf tubes and centrifugation for 30 min at 13200 rpm. Aliquots of the supernatant fluid are then analysed by the LCMS method as described above.

Alternatively, solubility in PBS at pH7.4 may be tested as follows: A calibration curve is generated by diluting the test compounds and control compounds to 40μΜ, 16μΜ, 4μΜ, 1 .6μΜ, 0.4μΜ, 0.16μΜ, 0.04μΜ and 0.002μΜ, with 50% MeOH in Η₂0. The standard points are then further diluted 1 :20 in MeOH:PBS 1 :1 . The final concentrations after 1 :20 dilution are 2000nM, 800nM, 200nM, 80nM, 20nM, 8nM, 2nM and 1 nM. Standards are then mixed with the same volume (1 :1 ) of ACN containing internal standard (hydroxymacrocycle, 6). The samples are centrifuged (5min, 12000rpm), then analysed by LC/MS.

MeOH/buffer

MeOH/H₂0(1 :1 ) Working (1 :1 ) Final

Solution(uL) (uL) solution (μΜ) Solution( L) (ML) solution(nM)

10mM 10 240 → 400

Test compounds are prepared as stock solutions in DMSO at 10mM concentration. The stock solutions are diluted in duplicate into PBS, pH7.4 in 1 .5ml_ Eppendorf tubes to a target concentration of 100μΜ with a final DMSO concentration of 1 % (e.g. 4μΙ_ of 10mM DMSO stock solution into 396μΙ_ 100mM phosphate buffer). Sample tubes are then gently shaken for 4 hours at room temperature. Samples are centrifuged (10min, 15000rpm) to precipitate undissolved particles. Supernatants are transferred into new tubes and diluted (the dilution factor for the individual test article is confirmed by the signal level of the compound on the applied analytical instrument) with PBS. Diluted samples are then mixed with the same volume (1 :1 ) of MeOH. Samples are finally mixed with the same volume (1 :1 ) of ACN containing internal standard (hydroxymacrocycle, 6) for LC-MS/MS analysis.

Assessment of cell permeability

Cell permeability may be tested as follows: The test compound is dissolved to 10mM in DMSO and then diluted further in buffer to produce a final 10μΜ dosing concentration. The fluorescence marker lucifer yellow is also included to monitor membrane integrity. Test compound is then applied to the apical surface of Caco-2 cell monolayers and compound permeation into the basolateral compartment is measured. This is performed in the reverse direction (basolateral to apical) to investigate active transport. LC-MS/MS is used to quantify levels of both the test and standard control compounds (such as Propanolol and Acebutolol).

In vivo assessment of pharmacokinetics

In vivo assays may also be used to measure the bioavailability of a compound. Generally, a compound is administered to a test animal (e.g. mouse or rat) both intravenously (i.v.) and orally (p.o.) and blood samples are taken at regular intervals to examine how the plasma concentration of the drug varies over time. The time course of plasma concentration over time can be used to calculate the absolute bioavailability of the compound as a percentage using standard models. An example of a typical protocol is described below.

Mice are dosed with 1 , 10, or 100 mg/kg of the compound of the invention or the parent compound i.v. or p.o.. Blood samples are taken at 5, 10, 15, 30, 45, 60, 90, 120, 180, 240, 360, 420 and 2880 minutes and the concentration of the compound of the invention or parent compound in the sample is determined via HPLC. The time-course of plasma concentrations can then be used to derive key parameters such as the area under the plasma concentration- time curve (AUC - which is directly proportional to the total amount of unchanged drug that reaches the systemic circulation), the maximum (peak) plasma drug concentration, the time at which maximum plasma drug concentration occurs (peak time), additional factors which are used in the accurate determination of bioavailability include: the compound's terminal half life, total body clearance, steady-state volume of distribution and F%. These parameters are then analysed by non-compartmental or compartmental methods to give a calculated percentage bioavailability, for an example of this type of method see Egorin et al. 2002, and references therein.

In vivo assessment of oral and intravenous pharmacokinetics (specific method)

For sanglifehrin analogues, whole blood was analysed. Compounds were formulated in 5% ethanol / 5% cremophor EL / 90% saline for both p.o. and i.v. administration. Groups of 3 male CD1 mice were dosed with either 1 mg/kg i.v. or 10mg/kg p.o. Blood samples (40μΙ_) were taken via saphenous vein, pre-dose and at 0.25, 0.5, 2, 8, and 24 hours, and diluted with an equal amount of dH₂0 and put on dry ice immediately. Samples were stored at -70°C until analysis. The concentration of the compound of the invention or parent compound in the sample was determined via LCMS as follows:20 μΙ_ of blood:H₂0 (1 :1 , v/v)/PK sample was added with 20 μΙ_ Internal standard (hydroxyl macrocycle, 6) at 100 ng/mL, 20 μΙ_ working solution/MeOH and 150 μΙ_ of ACN, vortexed for 1 minute at 1500 rpm, and centrifuged at 12000 rpm for 5 min. The supernatant was then injected into LC-MS/MS. The time-course of blood concentrations was plotted and used to derive area under the whole blood concentration-time curve (AUC - which is directly proportional to the total amount of unchanged drug that reaches the systemic circulation). These values were used to generate the oral bioavailability (F%) and other PK parameters where possible.

In vitro assessment of cytotoxicity

Huh-7 and HepG2 cells obtained from ATCC were grown in Dulbecco's modified essential media (DMEM) containing 10% fetal bovine serum (FBS), 1 % penicillin-streptomycin (pen-strep) and 1 % glutamine; whereas CEM cells (human T-cell leukemia cells obtained from ATCC) were grown in RPMI 1640 medium with 10% FBS, 1 % pen-strep and 1 % glutamine.

Fresh human PBMCs were isolated from whole blood obtained from at least two normal screened donors. Briefly, peripheral blood cells were pelleted/washed 2-3 times by low speed centrifugation and resuspension in PBS to remove contaminating platelets. The washed blood cells were then diluted 1 :1 with Dulbecco's phosphate buffered saline (D-PBS) and layered over 14 mL of Lymphocyte Separation Medium (LSM; cellgrow by Mediatech, Inc.; density 1 .078+/- 0.002 g/ml; Cat.# 85-072-CL) in a 50 mL centrifuge tube and centrifuged for 30 minutes at 600 X g. Banded PBMCs were gently aspirated from the resulting interface and subsequently washed 2X with PBS by low speed centrifugation. After the final wash, cells were counted by trypan blue exclusion and resuspended at 1 x 10⁷ cells/mL in RPMI 1640 supplemented with 15 % Fetal Bovine Serum (FBS), 2 mM L-glutamine, 4 μg/mL PHA-P. The cells were allowed to incubate for 48-72 hours at 37°C. After incubation, PBMCs were centrifuged and resuspended in RPMI 1640 with 15% FBS, 2 mM L-glutamine, 100 U/mL penicillin, 100 g/mL streptomycin, 10 μg/mL gentamycin, and 20 U/mL recombinant human IL-2.

Compound cytotoxicity was evaluated by testing half-log concentrations of each compound in triplicate against the cells described above. Cell containing medium alone served as the cell control (CC). Huh-7 and HepG2 cells were seeded in 96-well plates at a

concentration of 5 x 10³ cells per well. On the following day, the media was aspirated, and 100μί of corresponding media containing 5% FBS was added. Test drug dilutions were prepared at a 2X concentration in microtiter tubes and 100 μί of each concentration was placed in appropriate wells in a standard format. After 72 hours, the cells were processed for cytotoxicity assessment.

PBMCs were diluted in fresh medium and plated in the interior wells of a 96 well round bottom microplate at 5 x 10⁴ cells/well in a volume of 100 L. Similarly, CEM cells were plated at 1 x 10⁴ cells/well. Then, 100μί of 2X preparations of the test drugs were added in appropriate wells in a standard format. The cultures were maintained for six to seven days and then processed for cytotoxicity determination.

Cytotoxicity was determined using CytoTox-ONE™ homogeneous membrane integrity assay kit (Promega). The assay measures the release of lactate dehyrodgenase (LDH) from cells with damaged membranes in a fluorometric, homogeneous format. LDH released into the culture medium is measured with a coupled enzymatic assay that results in the conversion of resazurin into a fluorescent resorufin product. The amount of fluorescence produced is proportional to the number of lysed cells. Six serially diluted concentrations of each compound were applied to the cells to derive where applicable TC50 (toxic concentration of the drug decreasing cell viability by 50%) and TC90 (toxic concentration of the drug decreasing cell viability by 90%) values.

In vitro assessment of inhibition of MDR1 and MRP2 transporters

To assess the inhibition and activation of the MDR1 (P-glycoprotein 1 ) and MRP2 transporters, an in vitro ATPase assay from Solvo Biotechnology Inc. can be used (Glavinas et al., 2003). The compounds (at 0.1 , 1 , 10 and 100μΜ) are incubated with MDR1 or MRP2 membrane vesicles both in the absence and presence of vanadate to study the potential ATPase activation. In addition, similar incubations are conducted in the presence of

verapamil/sulfasalazine in order to detect possible inhibition of the transporter ATPase activity. ATPase activity is measured by quantifying inorganic phosphate spectrophotometrically.

Activation is calculated from the vanadate sensitive increase in ATPase activity. Inhibition is determined by decrease in verapamil/sulfasalazine mediated ATPase activity.

In vitro mixed lymphocyte reaction (MLR) assay for assessment of immunosuppressant activity

Immunosuppressant activity was tested as follows: Peripheral blood mononuclear cell (PBMC) populations were purified from the blood of two normal, unrelated volunteer donors (A & B), using centrifugation over histopaque. Cells were counted and plated out at 1 x 10⁵ cells per well in 96 well plates in RPMI media, with supplements and 2% Human AB serum.

Culture conditions included: cell populations A & B alone and a mixed population of cells A&B in the absence or presence of test compounds, each at 6 different concentrations. Compounds were tested at doses ranging from 10μΜ to 0.0001 μΜ in 1 -log increments. Control wells contained a comparable concentration of vehicle (0.5% DMSO) to that present in the test compound wells. Cultures were established in triplicate in a 96 well plate and incubated at 37°C in 5% C0₂ in a humidified atmosphere. 3H-thymidine was added on day 6 after assay set up and harvested 24hrs later. The levels of proliferation between the different culture conditions were then compared.

The ability of each dilution of test compound to inhibit proliferation in the MLR was calculated as percentage inhibition. This allowed estimation of the IC₅₀ (concentration of test compound which resulted in a 50% reduction of counts per minute). In order to calculate the IC₅₀, the X axis was transformed to a log scale. Non-linear regression was used to fit to the mean data points. A sigmoidal variable slope was selected.

In vitro assay for assessment of HIV antiviral activity

Antiviral efficacy against HIV may be tested as follows: Blood derived CD4+ T- lymphocytes and macrophages are isolated as described previously (Bobardt et al., 2008). Briefly, human PBMCs were purified from fresh blood by banding on Ficoll-Hypaque (30 min, 800 g, 25°C). Primary human CD4+ T cells were purified from PBMCs by positive selection with anti-CD4 Dynabeads and subsequent release using Detachabead. Cells were cultured in RPMI medium 1640 (Invitrogen) supplemented with 10% FCS, MEM amino acids, L-glutamine, MEM vitamins, sodium pyruvate, and penicillin plus streptomycin and were subsequently activated with bacterial superantigen staphylococcal enterotoxin B (SEB; 100 ng/ml) and mitomycin C- killed PBMC from another donor (10:1 PBMC:CD4 cell ratio). Three days after stimulation, cells were split 1 :2 in medium containing IL-2 (200 units/ml final concentration). Cultures were then split 1 :2 every 2 days in IL-2 medium and infected with HIV at 7 days after stimulation. For generating primary human macrophages, monocytes were purified from human PBMCs by negative selection and activated and cultured at a cell concentration of 106/ml in DMEM, supplemented with 10% FCS, MEM amino acids, L-glutamine, MEM vitamins, sodium pyruvate, and penicillin (100 units/ml), streptomycin (100 mg/ml), and 50 ng/ml recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and maintained at 37°C in a humidified atmosphere supplemented with 5% C0₂. To obtain monocyte-derived macrophages, cells were allowed to adhere to plastic and cultured for 6 days to allow differentiation.

CD4+ HeLa cells, Jurkat cells, activated CD4+ peripheral blood T-lymphocytes and macrophages (500,000 cells/100 μΙ_) were incubated with pNL4.3-GFP (X4 virus) or pNL4.3- BaL-GFP (R5 virus) (100 ng of p24) in the presence of increasing concentrations of test article, Forty-eight hours later, infection was scored by analyzing the percentage of GFP-positive cells by FACS and EC₅₀ calculated.

ELISA analysis of Cyp-NS5A interaction.

This assay was used to measure the disruption of Cyp-NS5A complexes, which can be used to show the potency of interaction with Cyclophilin D. Briefly, production and purification of recombinant GST, GST-CypD and Con1 NS5A-His proteins was carried out as described previously (Chatterji et al., 2010). Nunc MaxiSorb 8-well strip plates were coated with GST or GST-CypD for 16 h at 4^°C and blocked. Recombinant NS5A-His (1 ng/mL) was added to wells in 50 μΙ_ of binding buffer (20 mM Tris pH 7.9, 0.5 M NaCI, 10% glycerol, 10 mM DTT and 1 % NP-40) for 16 h at 4^°C. Captured NS5A-His was subsequently detected using mouse anti-His antibodies (1 g/mL) (anti-6xHis, Clontech) and rabbit anti-mouse-horseradish peroxidase phosphatase (HRP) antibodies (1 :1000 dilution). All experiments were conducted twice using two different batches of recombinant CypD and NS5A proteins.

Anti-PPIAse analysis of cyclophilin inhibition An alternative methodology for analysing interaction with cyclophilins is described as follows: The PPIase activity of recombinant CypD, produced by thrombin cleavage of GST-CypD, was determined by following the rate of hydrolysis of N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide by chymotrypsin. Chymotrypsin only hydrolyzes the trans form of the peptide, and hydrolysis of the cis form, the concentration of which is maximized by using a stock dissolved in trifluoroethanol containing 470 mM LiCI, is limited by the rate of cis-trans isomerization. CypD was equilibrated for 1 h at 5°C with selected test article using a drug concentration range from 0.1 to 20 nM. The reaction was started by addition of the peptide, and the change in absorbance was monitored spectrophotometrically at 10 data points per second. The blank rates of hydrolysis (in the absence of CypD) were subtracted from the rates in the presence of CypD. The initial rates of the enzymatic reaction were analyzed by first-order regression analysis of the time course of the change in absorbance.

EXAMPLES

Example 1 - Production of sanglifehrin A and its natural congers in 15-L stirred bioreactors with secondary seed

Vegetative cultures were prepared by inoculating 0.2 mL from a spore stock of

Streptomyces sp. A92-3081 10 into 400ml_ seed medium SGS in 2-L Erlenmeyer flasks with foam plugs.

The culture flasks were incubated at 27°C, 250 rpm (2.5 cm throw) for 24 h.

From the seed culture, 300 mL was transferred into 15 litres of primary seed medium SGS containing 0.02% antifoam SAG 471 , in a 15 L Braun fermentor. The fermentation was carried out for 24 hours at 27 °C, with starting agitation set at≥ 300rpm aeration rate at 0.5 VA /M and dissolved oxygen (DO) level controlled with the agitation cascade at≥30% air saturation.

From the secondary seed culture prepared in the fermentor, 600 mL was taken under aseptic conditions and transferred into 15 litres of production medium SGP-2 containing 0.02% antifoam SAG 471 , in 15 L Braun fermentor. The fermentation was carried out for 5 days at 24 °C, with starting agitation set at 300 rpm, aeration rate at 0.5 VA /M and dissolved oxygen (DO) level controlled with the agitation cascade at≥30% air saturation.

SfA was seen to be produced at 10-20 mg/L in fermentation broths.

Example 2 - Extraction and purification of sanglifehrin A

The whole broth (30 L) was clarified by centrifugation. The resulting cell pellet was extracted twice with ethyl acetate (2 x 10 L), each by stirring for 1 hour with overhead paddle stirrer and leaving to settle before pumping off solvent. The ethyl acetate layers were then combined (-20 L) and the solvent removed under reduced pressure at 40°C to obtain an oily residue. This oily residue was then suspended in 80:20 methanol :water (total volume of 500 mL), and twice extracted with hexane (2 x 500 mL). The 80:20 methanokwater fraction was then dried under reduced pressure to yield a crude dry extract which contained SfA and SfB. This extract was dissolved in methanol (100 ml), mixed with 15 g Silica gel and dried to a powder. The powder was loaded into a silica gel column (5 x 20 cm) packed in 100% CHCI₃. For every one litre of elution solvent the methanol concentration was increased stepwise by 1 % and 250 ml fractions collected. After three litres of solvent elution the methanol concentration was increased stepwise by 2% up to 8%. Fractions containing SfA and / or SfB were combined and reduced in vacuo to dryness and SfA and SfB purified by preparative HPLC. Preparative HPLC was achieved over a Waters XTerra Prep MS C18 OBD 10mm (19 x 250 mm) column running with solvent A (water) and solvent B (acetonitrile) at 20 ml/min with the following timetable: t = 0 mins, 55% B

t = 4 mins, 55% B

t = 30mins, 100% B

t = 32mins, 100% B

t = 36mins, 55% B

Fractions containing SfA were combined and taken to dryness.

Example 3 - Synthesis of 8 (aldehydic macrocycle)

-dihydroxysanglifehrin, 9

sanglifehrin A (SFA), 5 26, 27-dihydroxysanglifehrin, 9

To a stirred solution of sanglifehrin A, 5 (135 mg, 0.1238 mmol), (DHQ)₂PHAL (5.76 mg, 0.0074 mmol), 2.5 wt % solution of osmium tetroxide in ie f-butyl alcohol (47 uL, 0.0037 mmol), and methanesulfonamide (23.6 mg, 0.2476 mmol) in ie f-butyl alcohol (4 ml.) were added at room temperature together with a solution of potassium ferricyanide (122.3 mg, 0.3714 mmol) and potassium carbonate (51.3 mg, 0.3714 mmol) in 4 mL of water. After stirring for 1 h, a solution of saturated aqueous sodium sulfite (187.3 mg, 1 .4857 mmol) was added. The resulting mixture was stirred for 30 min and then extracted with three portions of ethyl acetate. The organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by Combiflash using reverse phase column (C18 column, A = H₂0, B = acetonitrile, t = 2 min, B = 0%; t = 4 min, B = 30%, t = 9min, B = 35%; t = 12min, B = 45%; t = 16 min, B = 70%) to afford 26,27-dihydroxysanglifehrin, 9 (102 mg, 70 %) as a white solid. QC LC-MS, RT = 5.3 mins, m/z = 1 124.8 [M+H]⁺, 1 122.7 [M- H]- 3.2 The preparation of the aldehydic macrocycle, 8

26, 27-dihydroxysanglifehrin, 9 aldehydic macrocycle, 8

To a solution of 26, 27-dihydroxysanglifehrin, 9 (60.0 mg, 0.053 mmol) in THF and water (2:1 , 5 ml. ) was added sodium periodate (22.8 mg,0.107 mmol). The resulting mixture was stirred at room temperature for 2 h, and saturated aqueous sodium bicarbonate was added. This mixture was extracted with three portions of ethyl acetate. The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by Combiflash using reverse phase column (C18 column, A = water, B = CH₃CN, t = 3 min, B = 0%; t = 12 min, B = 40 %; t = 17 min, B = 40%, t = 21 min, B = 70%) to afford the aldehydic macrocycle, 8 (35 mg, 90 %) as a white solid. QC LC- MS, RT = 4.0 mins, m/z = 761.4 [M+Na]⁺, 737.3 [M-H]^"

Example 4 - Synthesis of 10

To a solution of allyl 2-(diethoxyphosphoryl)acetate (28.4 ul, 0.1353 mmol) dissolved in CH₃CN(1 ml) were added K₂C0₃(28.4 mg,0.2055 mmol) and compound 8 (50 mg,0.0677 mmol). The reaction was stirred at room temperature and further portions of K₂C0₃( each time 14 mg) were added at 6, 24 and 30 hours, The reaction was stirred for 48 h at room

temperature and quenched with water. The reaction was extracted with ethyl acetate

(3^*20ml).The organic phase was dried over sodium sulfate and evaporated .the residue was purified by Pre-HPLC (9 mg, 8%). Example 5 - Synthesis of 11

To a solution of ethyl 2-(diethoxyphosphoryl)acetate (30 ul, 0.14 mmol) dissolved in CH₃CN(1 ml) were added K₂CO₃ (30 mg, 0.21 mmol) and 8 (50 mg, 0.07 mmol).The reaction was stirred at room temperature for 20 h and another batch of K₂C0₃ ( 30 mg) and ethyl 2- (diethoxyphosphoryl)acetate (30 ul, 0.14 mmol) were added, The reaction was stirred for a weekend at room temperature and quenched with water (5 ml). The reaction was extracted with ethyl acetate (3^*20ml).The organic phase was dried over sodium sulfate and evaporated .the residue was purified by Pre-HPLC (16.5 mg, 30%).

E

To a suspension of ie f-butyl 2-(diethoxyphosphoryl)acetate (25.5 uL, 0.108 mmol) dissolved in MeCN (1 .0 mL) was added K₂C0₃ (22.5 mg, 0.163 mmol) and BC500 (20 mg, 0.0271 mmol). The reaction was stirred at room temperature for 56 h. The mixture was quenched with water and extracted with EA (3^*10 mL). The organic phase was dried over sodium sulfate and evaporated. The residue was purified by Prep-HPLC to give 4.6 mg pure product (yield, 20%).

Example 7 - Synthesis of 16

13 1

To a solution of 13 (1 g, 10.626 mmol), Et₃N (1.075 g, 10.626 mmol) in dry DCM (50 mL) was added dropwise chloroacetyl chloride (1 .2 g, 10.626 mmol). The reaction mixture was stirred at rt for 3 h, poured into ice water, and extracted with ethyl acetate. The organic layer was washed with brine and dried over Na₂S0₄, filtered, concentrated in vacua. The reside was purified by flash chromatographed on silica to give the desired compound 14 (1 .8 g, 99% yield).

7.2 Synthesis of intermediate 15

14 15

A mixture of 14 (170 mg, 1 mmol) and triethyl phosphite (332 mg, 2 mmol) was stirred at

140D overnight. The reaction mixture was cooled to room temperature and was purified by combiflash to give intermediate 15 (90 mg, 33%) as a colourless oil.

7.2 Synthesis of 16

To a solution of 15 (65 mg, 0.188 mmol) in THF (1.0 mL) was added NaH (1.4 mg, 0.056 mmol) in anhydrous THF (0.2 mL) at 0 °C with stirring. The solution was then stirred at room temperature until it became clear. Then 8 (35 mg, 0.047 mmol) was added to the clear solution and the mixture stirred at rt for 3 h. The mixture was quenched with water (10 mL) and extracted with EA (20 mL^*3). The organic layer was washed with brine and dried over Na₂S0₄, filtered, evaporated. The residue was purified by pre-HPLC and pre-TLC (Acetone / petroleum ether = 3:2) to obtained 0.6 mg of 16 as a white solid.

Example 8 - Biological data - In vitro evaluation of HCV antiviral activity in the replicon system Compounds were analysed in the replicon assay as described in the General Methods. Cyclosporine A, 1 , sanglifehrin A, 5, and the hydroxymacrocycle, 6 were included as a comparison.

As can be seen, 10, 11 and 12 are all very potent in the Huh5.2 replicon assay (as shown by the low EC50), with good selectivity against the cell line (as shown by a high selectivity index). The previously described macrocylic sanglifehrin hydroxymacrocycle, 6, is much less potent at HCV inhibition, and cyclosporine A, 1 and sanglifehrin A, 5 are less potent and both have poorer selectivity indices.

Example 9 - Solubility in PBS

Solubility of the compounds in PBS pH 7.4 was analysed as described in the General Methods. Cyclosporine A, 1 and sanglifehrin A, 5 were included as a comparison.

As can be seen, the compounds of the invention, 10, 11 and 12 all have increased solubility when compared to sanglifehrin A (5) and some improvement over cyclosporine A (1 ).

Example 10 - Biological data - In vitro evaluation of HCV antiviral activity in other genotypes

Compounds were analysed in the 1 a and 2a replicon assay as described in the General Methods. Sanglifehrin A, 5, was included as a comparison.

As can be seen, 12 is more potent in the 1 a and 2a replicon assays than Sanglifehrin A (as shown by the low EC50), and shows activity across genotypes. In addition, the CC50 for Sanglifehrin A and compound 12 was >500nM, showing that the activity of 12 was selective.

Example 11 - Biological data - mouse in vivo oral and iv PK

To assess the pharmacokinetics of the compounds in an in vivo setting, compounds were dosed po at 10mg/kg and / at 1 mg/kg to groups of male CD1 mice. Pharmacokinetic analysis was carried out as described in the general methods. The PK parameters are shown below.

As can be seen, 12 has improved oral bioavailability compared to compound 11 and

sanglifehrin A, whilst compound 11 has improved oral bioavailability compared to sanglifehrin A.

Example 12 - Biological data - In vitro evaluation of cytotoxicity

Cytotoxicity of compounds was evaluated against in the hepatocyte cell lines Huh7 and HepG2, human PBMCs and the cancer cell line CEM, as described in the general methods. Sanglifehrin A, 5, was included as a comparison. The maximum concentration tested was 50μΜ.

According to the TC50 values, 12 was less cytotoxic than sanglifehrin A in three out of the four cell lines tested.

Example 13 - Biological data - In vitro evaluation of t-cell proliferation inhibition

Inhibition of antiCD3/antiCD28 stimulated t-cell inhibition was carried out as described in the general methods. Cyclosporine A and Sanglifehrin A were included for comparison. The values shown are the average of two runs.

Name T-cell IC50

(μΜ)

Sanglifehrin A, 5 1 .46

12 0.12 According to the IC50 data, 12 is >10 fold more potent at inhibition of antiCD3/antiCD28 stimulated cell proliferation than the natural compound sanglifehrin A, 5.

Example 14 - Biological data - Inhibition of cyclophilin D

To investigate the interaction of test compounds with cyclophilin D, the CypD-NS5A disruption system was used, as described in the general methods.

As can be seen, the compound of the invention, 12, shows potent disruption of the CypD-NS5A complex, at a more potent level than CsA, 1. It was also confirmed that these assays gave comparable data (and similar rank orders) to a PPIase assay measuring direct inhibition of CypD isomerase activity (data not shown - see general methods for details of methodology).

E

Compound 12 (22 mg, 26.3 μηηοΙ) was dissolved in dioxane (1.5 mL) and treated with 2M HCI (130 μί, 0.26 mmol). The reaction was shaken for 4 days on an orbital shaker.

The reaction was stopped by the addition of water (2 mL) and the resultant aqueous mixture extracted with ethyl actetate (5 x 4 mL). The combined organics were washed with water (1 x 20 mL), dried with a small portion of Na₂S0₄, and removed in vacuo.

The crude reaction mixture was then purified by preparative HPLC. A phenomenex C18 XTerra column (5 micron, 25 cm x 22.5 mm) was used with solvent pumped at 21 mL/min. Solvent A was water and solvent B was acetonitrile. The column was run isocratically at 50 % B. Pure fractions of compound 12 were identified by HPLC-MS, combined and taken to dryness (6.1 mg, 28% isolated yield).

Example 16 - Generation of bio-engineered Streptomyces sp. A92-3081 10 (DSM9954) (BIOT- 4370) strains in which the reductive loop of module 12 of the biosynthetic cluster for sanglifehrin biosynthesis is replaced by the reductive loop from rapamycin module 13 or sanglifehrin module 6 using a reductive loop swap strategy.

The reductive loop of sanglifehrin module 12 contains a ketoreductase which is responsible for the hydroxyl group at C17 of the sanglifehrin molecule. The reductive loops from both rapamycin module 13 and sanglifehrin module 6 contain all of the functional domains to result in full processing of the beta-keto group to result in a methylene; specifically they contain a keto reductase to reduce the keto to a hydroxyl group, a dehydratase to remove water and result in a double bond, and an enoyl reductase to reduce the double bond to a methylene. Vectors pMGo136 and pMGo137 are vectors to engineer the replacement of the reductive loop of module 12 of the biosynthetic cluster for sanglifehrin biosynthesis with the reductive loop from rapamycin module 13 or sanglifehrin module 6, respectively.

Positions of DNA fragments used in this example are given according to the sequence available in January 201 1 but reported as approximate because Genbank DNA sequences can be updated.

The vectors are constructed as follows:

16.1 The DNA homologous to the upstream flanking region of the reductive loop of sanglifehrin module 12.

This 2072 bp DNA fragment (SEQ ID NO: 1 ) shown in Figure 6 contains a region of homology upstream of the reductive loop of sanglifehrin module 12 (approximately from 86654 bp - 88798 bp in the published sequence Genbank accession number FJ809786.1 ) along with additional sequences both 5' and 3' to incorporate restriction enzyme sequences to aid cloning. This fragment (SEQ ID NO:1 ) was synthesised by GenScript (860 Centennial Ave., Piscataway, NJ 08854, USA) and provided, according to the GenScript protocol with 12 protective flanking bases on each side which do not participate in the cloning beyond this point, in pUC57 resulting in plasmid pMGo128.

16.2 Cloning of DNA homologous to the downstream flanking region of the reductive loop of sanglifehrin module 12.

Oligos MGo013 (SEQ ID NO: 2) and MGo014 (SEQ ID NO: 3) were used to amplify a 1994 bp DNA fragment (SEQ ID NO: 4) in a standard PCR reaction using cosmid pTL3102 (Qu et al. 201 1 ) DNA as the template and KOD Hot Start DNA polymerase. A 5' extension was designed in each oligo to introduce restriction sites to facilitate cloning of the amplified fragment. Alternatively, genomic DNA from Streptomyces sp. A92-3081 10 (DSM9954) (BIOT-4370) could have been used as the template for this PCR reaction to give the same DNA fragment, or the DNA fragment could be obtained by DNA synthesis for example using GenScript (860

Centennial Ave., Piscataway, NJ 08854, USA). The resulting 1995 bp PCR product (SEQ ID NO: 4) contains a region of homology downstream of the reductive loop of sanglifehrin module 12 (approximately from 90415 bp - 92381 bp in the published sequence genbank accession number FJ809786.1 ) with an undesired insertion, G at position 1978 (see Figure 7; inserted G is bold and underlined). The 1995 bp PCR product (SEQ ID NO: 4) was cloned into pUC19 (New England Biolabs) that had been linearised with Sma\ and dephosphorylated, resulting in plasmid pMGo123.

MGo013 5 ' GCTCTCGAGGCGGCTAGCCTCCCTGCCCGAGGCCG

Xhol Nhel

(SEQ ID NO: 2)

MGo014 5 ' AGAAAGCTTCGGCCCGGTCGGCGCCCTGGGCC

Hindlll

(SEQ ID NO: 3)

The orientation of the 1995 bp PCR product (SEQ ID NO: 4) in pUC19 was such that the Hind\\\ site on the insert was adjacent to the Hind\\\ site of the pUC19 polylinker. The sequence of the insert in pMGo123 was confirmed by sequencing.

In order to avoid the region containing the additional base, a shorter downstream region was targeted as follows: Oligos MGo037 (SEQ ID NO: 5) and MGo038 (SEQ ID NO: 6) were used to amplify a 1956 bp DNA fragment (SEQ ID NO: 7) in a standard PCR reaction using plasmid pMGo123 DNA as the template and KOD Hot Start DNA polymerase. A 5' extension was designed in each oligo to introduce restriction sites to facilitate cloning of the amplified fragment. The 1956 bp PCR product (SEQ ID NO: 7) contains a region of homology

downstream of the reductive loop of sanglifehrin module 12 (approximately from 90415 bp - 92343 bp in the published sequence Genbank accession number FJ809786.1 ). The 1956 bp PCR product (SEQ ID NO: 7) was cloned into pUC19 (New England Biolabs) that had been linearised with Sma\ and dephosphorylated, resulting in plasmid pMGo125.

MGo037 5 ' GCTCTCGAGGCGGCTAGCCTCCCTG

Xhol Nhel

(SEQ ID NO: 5)

MGo038 5 ' AAAAAGCTTGCGGGGTCGGGGGTGCCGGCGGCGAC

Hindlll

(SEQ ID NO: 6) The orientation of the 1956 bp PCR product (SEQ ID NO: 7) in pUC19 was such that the Hind\\\ site on the insert was adjacent to the Hind\\\ site of the pUC19 polylinker. The sequence of the insert in pMGo125 was confirmed by sequencing.

16.3 Cloning strategy for generating pMGol 36 and pMGol 37.

The upstream and downstream regions of homology of the sanglifehrin reductive loop of module 12 are cloned together as follows: The 2065 bp upstream region is excised from pMGo128 by digestion with EcoRI and Xho\ and the 1944 bp downstream region is excised from pMGo125 by digestion with Xho\ and Hind\\\. Both fragments are cloned together into the large backbone fragment generated when pUC19 (New England Biolabs) is digested with EcoRI and Hind\\\ in a three part ligation. Plasmids containing both inserts correctly cloned are identified by restriction enzyme analysis, one correct plasmid is designated pMGo130.

pMGo130 is designed such that a reductive loop on a suitable NheUBglW fragment, can be cloned into the Nhe\ and BglW sites to yield a portion of a type I PKS module in which the DNA sequence is in frame and can be translated to give an amino acid sequence. The exact positioning of these sites in the in-coming loop is crucial in maintaining the frame of the sequence and this translation into a functional amino acid sequence.

Source of rapamycin module 13 reductive loop: Rapamycin module 13 reductive loop has been used previously as a donor loop in other systems (eg. Gaisser et al., 2003). Rapamycin module 13 loop, flanked by appropriate regions of homology from avermectin module 2 is present in pPF137 (Gaisser et al., 2003). pPF137 is constructed from pJLK137 as described in Gaisser et al 2003. The full description of the construction of pJLK137 is contained within International patent application WO00/01827/1998 and references therein. A brief summary follows: The rapamycin module 13 loop was isolated by PCR amplification using the following oligos.

5 ' TAAGATCTTCCGACCTACGCCTTCCAAC

Bglll

(SEQ ID NO: 8)

5 ' TAATGCATCGACCTCGTTGCGTGCCGCGGT

Nsil

(SEQ ID NO: 9)

which contain introduced restriction enzyme sites, and using the template rapamycin cos 31 (Schwecke et al. 1995). This fragment was cloned into pUC18 previously digested with Sma\ and dephoshorylated to give pJLK120. This loop was then introduced into pJLK133, which was constructed as follows: The linker was removed from pJLK1 17 on a Bgl\\INhe\ fragment and cloned between 2 regions of homology to avermectin module 2 to give pJLK133. The rapamycin module 13 reductive loop was cloned from pJLK120 as a Bgl\\/Nsi\ fragment into Bgl\\/Nsi\ digested pJLK133.

pJLK1 17 (refer to International patent application WO00/01827/1998 and references therein) is an expression plasmid containing a PKS gene comprising the erythromycin loading module, the first and the second extension modules of the erythromycin PKS and the erythromycin chain terminating thioesterase, except the DNA segment between the end of the acyltransferase (AT) and the beginning of the acyl carrier protein (ACP) has been substituted by a synthetic oligonucleotide linker containing the recognition sites of the following restriction enzymes; Ανή\, BglW, Sna \, Pst\, Spe\, Nsi\, Bsu36\, and Nhe\ and was made in multiple steps as described in the patent application. These restriction enzyme sites were selected because they can be incorporated with minimal disruption to the original protein sequence in module 2 of the erythromycin PKS. The first linker containing vector, pJLK1 14 contains the generated by annealing the oligos Plf (SEQ ID NO: 10) and Plb (SEQ ID NO: 1 1 ).

Plf

5' CTAGGCCGGGCCGGACTGGTAGATCTGCCTACGTATCCTTTCCAGGGCAAGCGGTTCTGGCTGCAGCC

GGACCGCACTAGTCCTCGTGACGAGGGAGATGCATCGAGCCTGAGGGACCGGTT

(SEQ ID NO: 10)

Plb

5 ' AACCGGTCCCTCAGGCTCGATGCATCTCCCTCGTCACGAGGACTAGTGCGGTCCGGCTGCAGCCAGAA

CCGCTTGCCCTGGAAAGGATACGTAGGCAGATCTACCAGTCCGGCCCGGC

(SEQ ID NO: 1 1 )

The plasmid pJLK1 17 was constructed by replacing the 5' end of the linker of pJLK1 14 with a fragment in which the only difference is that the Hpa\ site, GTTAAC is replaced by an Nhe\ site, GCTAGC.

The source of the rapamycin module 13 reductive loop in this example is pPF137. One skilled in the art will appreciate that it is not necessary to follow this complex series of steps in order to obtain this fragment. The same fragment maybe obtained as follows: First the multiple cloning region of pUC18, or pUC19 may be replaced by a synthetic linker containing the sites BglW, Nsi\ and Nhe\ for example this could be achieved by digesting the pUC vector with EcoRI and Hind\\\ and using two oligonucleotides to make a synthetic linker with the sites listed above, which, when annealed, leave the appropriate overhangs to ligate into the digested backbone. Incorporating the sequence of the linker of pJLK1 17 between the Nsi\ and Nhe\ sites will provide part of the required sequence and the remainder can be obtained by PCR amplification from a cosmid such as rapamycin cos 31 or genomic DNA of Streptomyces hygroscopicus NRRL 5491 and the oligos shown as SEQ ID NO: 08 and SEQ IP NO: 09. This provide the rapamycin module 13 loop on a Bgl\\/Nsi\ fragment which can be cloned into the Bgl\\/Nsi\ sites of the modified pUC vector and then the desired loop cloned out as a Bgl\\/Nhe\ fragment.

Alternatively, the rapamycin module 13 loop could be amplified directly as a Bgl\\/Nhe\ fragment for example using the oligos SEQ ID NO: 8 as shown above and SEQ ID NO:12

5 ' TAGCTAGCCGGGCGCTCAGGGGCTGCGAGCCGACCT

(SEQ ID NO: 12)

The rapamycin module 13 reductive loop was cloned from pPF137 into pKC1 139WMB02 as a Bgl\\/N e\ fragment to give pKC1 139WMB02-137. pKC1 139WMB02 is a pKC1 139-based plasmid and contains a 7.8 kb DNA fragment containing the rapamycin module 1 1 reductive loop and flanking regions. It has been engineered such that the reductive loop can be excised as a Bgl\\/Nhe\ fragment and replaced with other loops. pKC1 139WMB02-137 was constructed to effect a loop swap in rapamycin and contains the rapamycin module 13 reductive loop with flanking regions from rapamycin module 1 1. In this example, rapamycin module 13 loop is cloned from pKC1 139WMB02-137 as a Bgl\\/N e\ fragment. This is the identical fragment that can be obtained from pPF137, or pJLK120 or by carrying out an equivalent PCR reaction using the oligo sequences provided and genomic DNA and cloning it into a suitable vector such as pUC18 or pUC19.

The sanglifehrin reductive loop of module 6 is obtained as follows: Oligos MGo019 (SEQ ID NO: 13) and MGo020 (SEQ ID NO: 14) are used to amplify a 3176 bp DNA fragment (SEQ ID NO: 15) in a standard PCR reaction using KOD Hot Start DNA polymerase and the 5 kb - 6 kb fraction of AlwN\ digested genomic DNA from Streptomyces sp. A92-3081 10 (DSM9954) (BIOT-4370) as the template. This fraction contains the 5402 bp AlwW fragment of the sanglifehrin gene cluster (approximately from 56578 bp - 61979 bp in the published sequence genbank accession number FJ809786.1 ). Alternatively, undigested genomic DNA from Streptomyces sp. A92-3081 10 (DSM9954) (BIOT-4370) is used as the template. Genomic DNA is obtained using the Edge BioSystems bacterial genomic DNA purification kit (Edge BioSystems, 201 Perry Parkway, Suite 5, Gaithersburg, MD 20877, USA). A 5' extension is designed in each oligo to introduce restriction sites to facilitate cloning of the amplified fragment in-frame with the flanking regions. The 3176 bp PCR product (SEQ ID NO: 15) contains the reductive loop of sanglifehrin module 6 (approximately from 57166 bp - 60326 bp in the published sequence genbank accession number FJ809786.1 ). The 3176 bp PCR product (SEQ ID NO: 15) is cloned into pUC19 (New England Biolabs) that has been linearised with Sma\ and dephosphorylated, resulting in plasmid pMGo127.

MGo019 5 ' CCGTAGATCTGCCCACCTACGCCTTCCAGCGCG Bglll

(SEQ ID NO: 13)

MGo 02 0 5 ' TCCGGCTAGCCGTTGGGGCAGCGCGG

Nhel

(SEQ ID NO: 14)

pKC1 139WMB02-137 and pMGo127 are each digested with Nhe\ and BglW to isolate the rapamycin module 13 reductive loop and the sanglifehrin module 6 reductive loop. Each loop is cloned into pMGo130 digested with Nhe\ and BglW. Insert-containing plasmids are analysed by restriction enzyme analysis, one correct plasmid containing rapamycin module 13 reductive loop is designated pMGo132 and one correct plasmid containing sanglifehrin module 6 reductive loop is designated pMGo133.

pMGo132 and pMGo133 each contain an appropriate DNA insert to effect a reductive loop swap in sanglifehrin module 12 by double recombination. Each insert is cloned as an EcoRI/H/ndlll fragment into pKC1 139 digested with EcoRI and HindW\ to provide suitable plasmid functions for transformation of Streptomyces sp. and selection of transformants as well as a temperature sensitive origin. Insert-containing plasmids are analysed by restriction enzyme analysis, one correct plasmid containing the fragment with rapamycin module 13 reductive loop is designated pMGo136 and one correct plasmid containing the fragment with sanglifehrin module 6 reductive loop is designated pMGo137.

16.4 Conjugation of Streptomyces sp. A92-3081 10 (DSM9954) (BIOT-4370) and engineering of a reductive loop swap in sanglifehrin module 12.

Plasmids pMGo136 and pMGo137 are transformed into E. coli ET12567 pUZ8002 using standard techniques and selected on 2TY plates containing apramycin (50 μg mL), kanamycin (25 μg mL) and chloramphenicol (12.5 μg mL). The resulting strains are used to inoculate 3 mL of liquid 2TY containing apramycin (50 μg ml), kanamycin (25 μg mL) and chloramphenicol (12.5 μg mL) and incubated overnight at 37°C, 250rpm. 0.8 mL of each culture is used to inoculate 10 mL liquid 2TY containing apramycin (50 μg mL), kanamycin (25 μg mL) and chloramphenicol (12.5 μg mL) in a 50 mL Falcon tube and incubated at 37°C 250 rpm until OD₆oonm ~0.5 is reached. The resulting cultures are centrifuged at 3500 rpm for 10 min at 4°C, washed twice with 10 mL 2TY medium using centrifugation to pellet the cells after each wash. The resulting pellets are resuspended in 0.5 mL 2TY and kept on ice ready for use. This process is timed to coincide with the completion of preparation of Streptomyces spores described below.

Spores of Streptomyces sp. A92-3081 10 (DSM9954) (BIOT-4370) are harvested from a 1 -2 week old confluent plate by resuspending in ~3 mL 20 % glycerol and splitting equally between 2 Eppendorf tubes. Alternatively, -1.5 mL of a cryopreserved spore suspension prepared in the same way is used. Spores are centrifuged (6000 rpm, 5 min room temperature) and washed twice with 1 mL 50 mM TES buffer before resuspending in 0.5 mL 50 mM TES buffer. This tube is heat shocked at 50°C for 10 min in a water bath before adding 0.5 mL of TSB medium and incubating in an Eppendorf Thermomixer compact at 37°C for 4-5 hours.

The prepared E. coli ET12567 pUZ8002 pMGo136 and £. coli ET12567 pUZ8002 pMGo137 are each mixed with BIOT-4370 at ratios 1 :1 (100 μΐ each strain) and 1 :3 (100 μΐ E. coli + 300 μ\- BIOT-4370) and immediately spread on R6 plates and transferred to a 37°C incubator. After approximately 2 hours incubation these plates are overlaid with 2 mL of sterile water containing nalidixic acid to give a final in-plate concentration of 50 μg L. Plates are returned to the 37°C incubator overnight before overlaying with 2 mL of sterile water containing apramycin to give a final in-plate concentration of 20-25 μg L. Alternatively, the plates are initially incubated for 16-18 hours, then overlaid with the nalidixic acid solution and allowed to dry for 1 -2 hours before being overlaid with the apramycin solution. Ex-conjugant colonies appear after -4-7 days and are patched onto ISP4 media containing apramycin (25 μg L) and nalidixic acid (50 μg L) and incubated at 37°C. Incubation at 37°C in the presence of apramycin should ensure that integration of the plasmid occurs, since the temperature sensitive origin does not function at this temperature. Integration should occur in one of the flanking regions where there is homology between the genome and the plasmid insert. Once adequate mycelial growth is observed strains are repatched to ISP4 media containing apramycin (25 μg L) at 37°C and allowed to sporulate. Strains are then subcultured three times (to promote removal of the temperature sensitive plasmid) by patching to ISP4 (without antibiotic) and incubating at 37°C for 3-4 days each time. Strains are finally patched onto ISP4 and incubated at 28°C to allow for sporulation (5-7 days). Spores are harvested and serially diluted onto ISP4 plates at 28°C to allow selection of single colonies. Sporulated single colonies are doubly patched to ISP4 plates with and without apramycin (25 μg L) to identify colonies which loose the plasmid and allowed to grow -7 days before testing for production of sanglifehrins and sanglifehrin analogues. Strains selected for analysis are those that do not grow in the presence of apramycin, indicating loss of the resistance marker desirably by secondary recombination.

16.5 Screening strains for production of sanglifehrins and sanglifehrin analogues in falcon tubes

A single -7 mm agar plug of each well sporulated patch is used to inoculate 7 mL of sterile SM25-3 media and incubated at 27°C 200 rpm in a 2 inch throw shaker. After 48 hours of growth 0.7 mL of each culture is transferred to a sterilised falcon tube containing 7 mL of SGP6 media (30 g/L Nutrisoy (Toasted Soy Flour), 60 g/L glycerol, 21 g/L MOPS; pH 6.8) with 5 % HP20 resin. Cultures are grown at 24°C 300 rpm on a 1 inch throw shaking incubator for 5 days before harvest. 0.8 mL of each bacterial culture is removed and aliquoted into a 2 mL Eppendorf tube ensuring adequate dispersal of the resin in throughout the culture prior to aliquoting. 0.8 mL acetonitrile and 15 μ\- of formic acid are added and the tube mixed for 30 min. The mixture is cleared by centrifugation and 150 μ\- of the extract removed into a HPLC vial and analysed by HPLC.

16.6 Analysis of strains for reversion to wild type or module 12 loop swap.

Extracts of strains are analysed by HPLC. Strains that produced sanglifehrin A and B are not analysed further as this result indicates reversion to wild type. Strains lacking sanglifehrin A and B production and showing peaks consistent with the production of 17-deoxy-sanglifehrin A and 17-deoxy-sanglifehrin B are taken forward.

16.7 Isolation of 17-deoxysanglifehrin A and generation of synthetic derivatives.

A strain producing 17-deoxy sanglifehrin A is then grown using a similar method to that described in Example 1 , the compound isolated using a similar method to that described in Example 2, and the aldehyde generated using a similar method to that described in example 3. This is then used as a template for semisynthesis as described to generate compounds of formula 1 .

References

Aparicio JF, Molnar, I, et al. (1996) Organisation of the biosynthetic gene cluster for rapamycin in Streptomyces hygroscopicus analysis of the enzymatic domains in the modular polyketide synthase. " Gene 169:9-16

Appel, N., T. Schaller, et al. (2006). "From structure to function: new insights into hepatitis C virus RNA replication." J Biol Chem 281 (15): 9833-6.

Banteli, R., J. Wagner, et al. (2001 ). "Synthesis of derivatives of the novel cyclophilin-binding immunosuppressant sanglifehrin A with reduced numbers of polar functions." Bioorg

Med Chem Lett 11 (12): 1609-12.

Bevitt, D.J., Cortes, J. et al. (1992). "6-deoxyerythronolide D synthase 2 from

Saccharopolyspora erythraea. Cloning of the structural gene, sequence analysis and inferred domain structure of the multifunctional enzyme." J. Biochem. 204:39-49

Bobardt, M.D., Cheng, G. et al., (2008). "Hepatitis C virus NS5A anchor peptide disrupts human immunodeficiency virus". Proc. Natl. Acad. Sci. USA 105(14):5525-5530.

Castro, A.P., Carvalho, T.M., et al., (2003). "Redisribution of cyclophilin A to viral factories

during vaccinia virus infection and its incorporation into mature particles." J. Virol.

77:9052-9068 Chatterji, U., M. Bobardt, et al. (2009). "The isomerase active site of cyclophilin A is critical for

HCV replication." J Biol Chem. 284:16998-17005

Chatterji, U., et al., (2010) HCV resistance to cyclosporin A does not correlate with a resistance of the NS5A-cyclophilin A interaction to cyclophilin inhibitors. J Hepatol. 53(1 ): p. 50-6. Chen, Z., Mi, L. et al., (2005). "Function of HAb18G/CD147 in invasion of host cells by severe acute respiratory syndrome coronavirus". J. Infect. Pis. 191 :755-760

Colgan, J., M. Asmal, et al. (2000). "Isolation, characterization and targeted disruption of mouse ppia: cyclophilin A is not essential for mammalian cell viability." Genomics 68(2): 167-78. Crabbe, R., G. Vuagniaux, et al. (2009). "An evaluation of the cyclophilin inhibitor Debio 025 and its potential as a treatment for chronic hepatitis C." Expert Opin Investig Drugs

18(2): 21 1 -20.

Dolinski, K., S. Muir, et al. (1997). "All cyclophilins and FK506 binding proteins are, individually and collectively, dispensable for viability in Saccharomyces cerevisiae." Proc Natl Acad Sci U S A 94(24): 13093-8.

Du, H., and Yan, S.S. (2010). "Unlocking the Door to Neuronal Woes in Alzheimer's Disease:

Αβ and Mitochondrial Permeability Transition Pore". Pharmaceuticals 3:1936-1948

E. Lawitz, R. R., T. Nguyen, M. Huang, J. Ke, J. Praestgaard, D. Serra, M. Koziel, T. Evans

(2009). "Safety And Antiviral Efficacy Of 14 Days Of The Cycophilin Inhibitor Nim81 1 In Combination With Pegylated Interferon .2a In Relapsed Genotype 1 Hcv Infected Patients." Journal of Hepatology 50(S1 ): S379.

Egorin, M. J., T. F. Lagattuta, et al. (2002). "Pharmacokinetics, tissue distribution, and

metabolism of 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin (NSC

707545) in CD2F1 mice and Fischer 344 rats." Cancer Chemother Pharmacol 49(1 ): 7- 19.

Fehr, T., J. Kallen, et al. (1999). "Sanglifehrins A, B, C and D, novel cyclophilin-binding

compounds isolated from Streptomyces sp. A92-3081 10. II. Structure elucidation, stereochemistry and physico-chemical properties." J Antibiot (Tokyo) 52(5): 474-9.

Flisiak, R., A. Horban, et al. (2008). "The cyclophilin inhibitor Debio-025 shows potent anti- hepatitis C effect in patients coinfected with hepatitis C and human immunodeficiency virus." Hepatology 47(3): 817-26.

Forte, M., Gold, B.G. et al., (2007). "Cyclophilin D inactivation protects axons in experimental autoimmune encephalomyelitis, an animal model of multiple sclerosis. Proc. Natl. Acad. Sci. USA 104:7558-7563.

Fujimoto, K., Chen, Y. et al. (2010). "Targeting cyclophilin D and the mitochondrial permeability transition enhances β-cell survival and prevents diabetes in Pdx1 deficiency". Proc. Natl. Acad. Sci. USA 107: 10214-10219

Furniss, B. S., Furniss, A.I., Vogel, A.I., Ed. (1989). Vogel's Textbook of Practical Organic Chemistry, Prentice Hall.

Gaither, L. A., Borawski, J., Anderson, L. J., Balabanis, K. A. et al., (2010). "Multiple cyclophilins involved in different cellular pathways mediate HCV replication" Virology 397: 43-55 Glavinas, H., Krajcsi, P., Cserepes, J., Sarkadi, B. (2004). "The role of ABC transporters in drug resistance, metabolism and toxicity." Curr. Drug. Deliv. 1 (1 ): 27-42.

Gomez, L, H. Thibault, et al. (2007). "Inhibition of mitochondrial permeability transition improves functional recovery and reduces mortality following acute myocardial infarction in mice."

Am J Physiol Heart Circ Physiol 293(3): H1654-61.

Goto, K., Watashi, K., Inoue, D., Hijikata, M., Shimotohno, K. (2009) "Identification of cellular and viral factors related to anti-hepatitis C virus activity of cyclophilin inhibitor" Cancer

Science 100(10): 1943-1950

Hanoulle, X., Badillo A, Wieruszeski JM, Verdegem D, Landrieu I, Bartenschlager R, Penin F,

Lippens G (2009). "Hepatitis C virus NS5A protein is a substrate for the Peptidyl-Prolyl cis/trans isomerase activity of Cyclophilins A and B." J Biol Chem. 284:13589-13601 Han, X., Yoon, S.H. et al., "Cyclosporin A and sanglifehrin A enhance chemotherapeutic effect of cisplatin in C6 glioma cells" Oncology Reports 23:1053-1062

Hartel, C, P. Iblher, et al. (2006). "Immunosuppressive activity of the immunophilin-binding drug

Sanglifehrin A in human whole blood: potent inhibition of interleukin-6 produced by lymphocytes and monocytes." Scand J Immunol 63(1 ): 26-34.

Herrler, M., H. Bang, et al. (1994). "Cloning and characterization of ppiB, a Bacillus subtilis gene which encodes a cyclosporin A-sensitive peptidyl-prolyl cis-trans isomerase." Mol

Microbiol 11 (6): 1073-83.

Hite, M., Turner, S., Federici, C. (2003). "Part 1 : Oral delivery of poorly soluble drugs".

Pharmaceutical Manufacturing and Packing Sourcer. Summer 2003 issue.

Hopkins, S. Gavis, D. et al., (2009). "Safety, plasma pharmacokinetics, and anti-viral activity of

SCY-635 in adult patients with chronic hepatitis C virus infection." Journal of Hepatology

50(S1 ): S36. Inoue, K., K. Sekiyama, et al. (2003). "Combined interferon alpha2b and cyclosporin A in the treatment of chronic hepatitis C: controlled trial." J Gastroenterol

38(6): 567-72.

Inoue, K., T. Umehara, et al. (2007). "Evaluation of a cyclophilin inhibitor in hepatitis C virus- infected chimeric mice in vivo." Hepatology 45(4): 921 -8.

Ishii, N., K. Watashi, et al. (2006). "Diverse effects of cyclosporine on hepatitis C virus strain replication." J Virol 80(9): 4510-20.

Ke, J., Rozier, R. et al., (2009). "Safety, And Tolerability Of Nim81 1 , A Novel Cyclophilin

Inhibitor For HCV, Following Single And Multiple Ascending Doses In Healthy Volunteers And Hcv-lnfected Patients." Journal of Hepatology 50(S1 ): S229.

Jacobson, I., McHutchison, JG, Sulkowski, M. (2007). Gastroenterol & Hepatol 3(S34): 1 -10. Kallen, J., R. Sedrani, et al. (2005). "Structure of human cyclophilin A in complex with the novel immunosuppressant sanglifehrin A at 1 .6 A resolution." J Biol Chem 280(23): 21965-71 . Kawasaki, H., E. S. Mocarski, et al. (2007). "Cyclosporine inhibits mouse cytomegalovirus

infection via a cyclophilin-dependent pathway specifically in neural stem/progenitor cells." J Virol 81 (17): 9013-23.

King, A.L., Swain, T.M. et al., (2010) "Chronic ethanol consumption enhances sensitivity to

Ca²⁺-mediated opening of the mitochondrial permeability transition pore and increases cyclophilin D in liver" Am J Physiol Gastrointest Liver Physiol 299(4):G954-966

Kubota, M., Kasahara, T. et al., (2010). "Therapeutic implications of down-regulation of

cyclophilin D in bipolar disorder". International Journal of Neuropsychopharmacology

13(10):1355-1368

Liu, X., Sun, L. et al., (2009). "Cyclophilin A interacts with influenza A virus M1 protein and impairs the early stage of the viral replication". Cell Microbiol. 11 :730-741 .

Malouitre, S., Dube, H. et al., (2010). "Mitochondrial targeting of cyclosporin A enables selective inhibition of cyclophilin-D and enhanced cytoprotection after glucose and oxygen deprivation" Biochem. J. 425:137-148

Manns, M. P., G. R. Foster, et al. (2007). "The way forward in HCV treatment-finding the right path." Nat Rev Drug Discov 6(12): 991 -1000.

Martin Cabrejas, L. M., S. Rohrbach, et al. (1999). "Macrolide Analogues of the Novel

Immunosuppressant Sanglifehrin: New Application of the Ring-Closing Metathesis

Reaction." Angew Chem Int Ed Engl 38(16): 2443-2446.

Martin, L.J. (2010). "The mitochondrial permeability transition pore: A molecular target for

amyotrophic lateral sclerosis therapy". Biochimica et Biophysica Acta 1802:186-197 Mathy, J. E., S. Ma, et al. (2008). "Combinations of cyclophilin inhibitor NIM81 1 with hepatitis C

Virus NS3-4A Protease or NS5B polymerase inhibitors enhance antiviral activity and suppress the emergence of resistance." Antimicrob Agents Chemother 52(9): 3267-75. Melnikova, I. (2008). "Hepatitis C therapies." Nature Rev Drug Disc 7: 799-800.

Metternich, R., Denni, D., Thai, B, Sedrani, R. (1999). "Toward a Total Synthesis of the

Immunosuppressant Sanglifehrin A. Preparation of Two Relay Compounds by

Degradation and Their Use in the Reassembly of the Natural Product." J. Org. Chem.

64: 9632-9639.

Millay, D. P., M. A. Sargent, et al. (2008). "Genetic and pharmacologic inhibition of

mitochondrial-dependent necrosis attenuates muscular dystrophy." Nat Med 14(4): 442- 7.

Nelson, D. R., Ghalib, R.H., Sulkowski, M., Schiff, E., Rustgi, V., Pockros, P.J., Wang, C,

Decosterd Kerhuel, D., and P. Grosgurin, Porchet, H., Crabbe, R. (2009). "Efficacy And Safety Of The Cyclophilin Inhibitor Debio 025 In Combination With Pegylated Interferon Alpha-2a And Ribavirin In Previously Null-Responder Genotype 1 Hcv Patients." Journal of Hepatoloqy 50(S1 ): S40.

Niwa, T., Yamamoto, S, Saito, M, Shiraga, T, Takagi, A. (2007). "Effect of Cyclosporine and

Tacrolimus on Cytochrome P450 Activities in Human Liver Microsomes." Yakugaku

Zasshi 127(1 ): 209-216.

Paeshuyse, J., A. Kaul, et al. (2006). "The non-immunosuppressive cyclosporin DEBIO-025 is a potent inhibitor of hepatitis C virus replication in vitro." Hepatology 43(4): 761 -70.

Palma, E., Tiepolo, T. et al., (2009). "Genetic ablation of cyclophilin D rescues mitochondrial defects and prevents muscle apoptosis in collagen VI myopathic mice" Human Molecular

Genetics 18:2024-2031

Parfieniuk, A., J. Jaroszewicz, et al. (2007). "Specifically targeted antiviral therapy for hepatitis

C virus." World J Gastroenterol 13(43): 5673-81 .

Pawlotsky, J. M. (2000). "Hepatitis C virus resistance to antiviral therapy." Hepatology 32(5):

889-96.

Pawlotsky, J. M. (2005). "Current and future concepts in hepatitis C therapy." Semin Liver Pis

25(1 ): 72-83.

Pawlotsky, J. M. (2006). "Virology of hepatitis B and C viruses and antiviral targets." J Hepatol

44(1 Suppl): S10-3.

Pemberton, T. J. and J. E. Kay (2003). "Cyclophilin sensitivity to sanglifehrin A can be

correlated to the same specific tryptophan residue as cyclosporin A." FEBS Lett 555(2): 335-40.

Perry, G.M., Tallaksen-Greene, S. et al., (2010). "Mitochondrial calcium uptake capacity as a therapeutic target in the R6/2 mouse model of Huntington's disease". Human Molecular

Genetics 19(17):3354-3371

Pockros, P. (2008). "Emerging Therapies for Chronic Hepatitis C Virus." Gastroenterol and

Hepatology 4(10): 729-734.

Ptak, R. G., P. A. Gallay, et al. (2008). "Inhibition of human immunodeficiency virus type 1

replication in human cells by Debio-025, a novel cyclophilin binding agent." Antimicrob

Agents Chemother 52(4): 1302-17.

Qing, M., Yang, F.(2009). "Cyclosporine Inhibits Flavivirus Replication through Blocking the

Interaction between Host Cyclophilins and Viral NS5 Protein" Antimicrob Agents

Chemother 53(8) :3226-3235

Robida, J. M., H. B. Nelson, et al. (2007). "Characterization of hepatitis C virus subgenomic replicon resistance to cyclosporine in vitro." J Virol 81 (1 1 ): 5829-40.

Sanglier, J. J., V. Quesniaux, et al. (1999). "Sanglifehrins A, B, C and D, novel cyclophilin- binding compounds isolated from Streptomyces sp. A92-3081 10. I. Taxonomy, fermentation, isolation and biological activity." J Antibiot (Tokyo) 52(5): 466-73. Schneider, M. D. (2005). "Cyclophilin D: knocking on death's door." Sci STKE 2005(287): pe26. Schopman, N.C.T., ter Brake, O. and Berkhout, B. (2010). "Anticipating and blocking HIV-1 escape by second generation antiviral shRNAs" Retrovirology 7:52

Sedrani, R., J. Kallen, et al. (2003). "Sanglifehrin-cyclophilin interaction: degradation work, synthetic macrocyclic analogues, X-ray crystal structure, and binding data." J Am Chem

Soc 125(13): 3849-59.

Shafer, R.W., and Schapiro, J.M. (2008). "HIV-1 Drug Resistance Mutations: an Updated

Framework for the Second Decade of HAART". AIDS Rev. 10(2):67-84

Smith, M. B. a. M., J. , Ed. (2001 ). March's advanced organic chemistry, John Wiley and Sons

Inc., UK.

Steinschulte, C, T. Taner, et al. (2003). "Cutting edge: sanglifehrin A, a novel cyclophilin- binding immunosuppressant blocks bioactive IL-12 production by human dendritic cells."

J Immunol 171 (2): 542-6.

Steyn, D., Richman, D. et al., (2006). "A double-blind placebo-controlled study in HIV-1 -infected subjects on the safety, pharmacokinetics, and antiviral effect of cyclophilin A targeting

Debio-025". Int. Conf. Retroviruses Opportunistic Infec. 13:Abs 516

Strader, D. B., T. Wright, et al. (2004). "Diagnosis, management, and treatment of hepatitis C."

Hepatoloqy 39(4): 1 147-71 .

Tropschug, M., I. B. Barthelmess, et al. (1989). "Sensitivity to cyclosporin A is mediated by cyclophilin in Neurospora crassa and Saccharomyces cerevisiae." Nature 342(6252):

953-5.

Vrolijk, J. M., A. Kaul, et al. (2003). "A replicon-based bioassay for the measurement of

interferons in patients with chronic hepatitis C." J Virol Methods 110(2): 201 -9.

Watashi, K. (2010). "Alisporivir, a cyclosporine derivative that selectively inhibits cyclophilin, for the treatment of HCV infection". Curr. Opp. Invest. Drugs 11 (2):213-224

Xie, H., Xia, W. et al., (2007). "Evaluation of hepatitis B virus replication and proteomic analysis of HepG2.2.15 cell line after cyclosporine A treatment". Acta Pharmacol. Sin. 7:975-984 Yang, F., J. M. Robotham, et al. (2008). "Cyclophilin A is an essential cofactor for hepatitis C virus infection and the principal mediator of cyclosporine resistance in vitro." J Virol

82(1 1 ): 5269-78.

Zenke, G., U. Strittmatter, et al. (2001 ). "Sanglifehrin A, a novel cyclophilin-binding compound showing immunosuppressive activity with a new mechanism of action." J Immunol

166(12): 7165-71 .

Zeuzem, S. and E. Herrmann (2002). "Dynamics of hepatitis C virus infection." Ann Hepatol

1 (2): 56-63.

Zhang, L. H. and J. O. Liu (2001 ). "Sanglifehrin A, a novel cyclophilin-binding

immunosuppressant, inhibits IL-2-dependent T cell proliferation at the G1 phase of the cell cycle." J Immunol 166(9): 561 1 -8.

All references including patent and patent applications referred to in this application are incorporated herein by reference to the fullest extent possible.

Throughout the specification and the claims which follow, unless the context requires otherwise, the word 'comprise', and variations such as 'comprises' and 'comprising', will be understood to imply the inclusion of a stated integer or step or group of integers but not to the exclusion of any other integer or step or group of integers or steps.

Claims

Claims

1 . A compound according to formula (I) below, or a pharmaceutically acceptable salt thereof:

wherein:

Ri represents alkyl, alkenyl, cycloalkyl, cycloalkenyl, alkylcycloalkyl, alkylcycloalkenyl, alkenylcycloalkyi, alkenylcycloalkenyl, aryl, heteroaryl, alkylaryl, alkylheteroaryl, alkenylaryl or alkenylheteroaryl any of which groups may optionally be substituted by monocylic aryl or monocyclic heteroaryl;

or Ri represents hydrogen;

and wherein one or more carbon atoms of Ri not being part of an aryl or heteroaryl group are optionally replaced by a heteroatom selected from O, N and S(0)_p in which p represents 0, 1 or 2 and wherein one or more carbon atoms of Ri are optionally replaced by carbonyl;

provided that R-i does not represent methyl or -CHMe₂;

and wherein one or more carbon atoms of an R-i group may optionally be substituted by one or more halogen atoms;

R₃ represents H or (CO)_xalkyl;

R₄ represents H or OH;

R₅ represents H, OH or =0;

n represents a single or double bond save that when n represents a double bond R₄ represents H ; and

m represents a single or double bond save that when m represents a double bond R₅ represents H;

x represents 0 or 1 ;

including any tautomer thereof; or an isomer thereof in which the C26, 27 C=C bond shown as trans is c/^'s; and including a methanol adduct thereof in which a ketal is formed by the combination of the C-53 keto (if present) and the C-15 hydroxyl group and methanol.

2. A compound according to claim 1 wherein R-i represents alkyl, alkenyl, cycloalkyi, cycloalkenyl, alkylcycloalkyi, alkylcycloalkenyl, alkenylcycloalkyi, alkenylcycloalkenyl, aryl, heteroaryl, alkylaryl, alkylheteroaryl, alkenylaryl or alkenylheteroaryl any of which groups may optionally be substituted by monocylic aryl or monocyclic heteroaryl;

or Ri represents hydrogen;

and wherein one or more carbon atoms of Ri not being part of an aryl or heteroaryl group are optionally replaced by a heteroatom selected from O, N and S(0)_p in which p represents 0, 1 or 2 and wherein one or more carbon atoms of Ri are optionally replaced by carbonyl;

provided that R-i does not represent methyl or -CHMe₂.

3. A compound according to claim 2 wherein R-i represents C_4-io alkyl, alkenyl, cycloalkyi, cycloalkenyl, alkylcycloalkyi, alkylcycloalkenyl, alkenylcycloalkyi, alkenylcycloalkenyl, aryl, heteroaryl, alkylaryl, alkylheteroaryl, alkenylaryl or alkenylheteroaryl any of which groups may optionally be substituted by monocylic aryl or monocyclic heteroaryl;

or Ri represents hydrogen;

and wherein one or more carbon atoms of Ri not being part of an aryl or heteroaryl group are optionally replaced by a heteroatom selected from O, N and S(0)_p in which p represents 0, 1 or 2 and wherein one or more carbon atoms of Ri are optionally replaced by carbonyl.

4. A compound according to claim 1 wherein Ri is selected from C _2-io alkyl, C _2-io alkenyl and aryl.

5. A compound according to claim 4 wherein R-i is selected from C ₂-6 alkyl, C _2-6 alkenyl and aryl.

6. A compound according to claim 5 wherein R-i is selected from C_4-6 alkyl, C _2-6 alkenyl and aryl.

7. A compound according to any one of claims 1 to 6, wherein independently or in any combination:

R₃ represents H or (CO)_xCi_-4alkyl, wherein x is as defined in claim 1 ;

n represents a single bond;

m represents a single bond;

R₄ represents OH; and

R₅ represents =0.

8. A compound according to any one of claims 1 to 7, wherein x represents 0.

9. A compound according to any one of claims 1 to 8, wherein R₃ represents H or methyl.

10. A compound according to any one of claims 1 to 9 wherein R₅ represents C=0.

1 1 . A compound according to claim 1 or a pharmaceutically acceptable salt thereof wherein:

Ri represents CH₂CH=CH2, R3 represents H, R₄ represents OH, n represents a single bond, m represents a single bond and R₅ represents =0 as represented by the following structur

Ri represents CH₂CH₃, R₃ represents H, R₄ represents OH, n represents a single bond, m represents a single bond and R₅ represents =0 as represented by the following structure:

Ri represents C(CH₃)₃, R₃ represents H, R₄ represents OH, n represents a single bond, m represents a single bond and R₅ represents =0 as represented by the following structure:

including any tautomer thereof; or an isomer thereof in which the C26, 27 C=C bond shown as trans is c/^'s; and including a methanol adduct thereof in which a ketal is formed by the combination of the C-53 keto (if present) and the C-15 hydroxyl group and methanol.

12. A compound according to claim 1 or a pharmaceutically acceptable salt thereof wherein:

Ri represents C(CH₃)₃, R₃ represents H, R₄ represents H, n represents a double bond, m represents bond and R₅ represents =0 as represented by the following structure:

Ri represents C(CH₃)₃, R₃ represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

Ri represents CH₂CH=CH2, R₃ represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

Ri represents CH₂CH₃, R₃ represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

Ri represents phenyl R₃ represents H, R₄ represents H, n represents bond, m represents bond and R₅ represents =0 as represented by the following structure:

including any tautomer thereof; or an isomer thereof in which the C26, 27 C=C bond shown as trans is c/s; and including a methanol adduct thereof in which a ketal is formed by the combination of the C-53 keto (if present) and the C-15 hydroxyl group and methanol.

13. A compound according to any one of claims 1 to 6 or a pharmaceutically acceptable salt thereof wherein: R₃ represents H, R₄ represents OH, n represents a single bond, m represents a single bond and R₅ represents =0 as represented by the following structure:

wherein R₁₀ represents -ORi and Ri is as defined in any one of claims 1 to 6;

including any tautomer thereof; or an isomer thereof in which the C26, 27 C=C bond shown as trans is c/s; and including a methanol adduct thereof in which a ketal is formed by the combination of the C-53 keto (if present) and the C-15 hydroxyl group and methanol.

14. A compound according to claim 13 or a pharmaceutically acceptable salt thereof wherein R₁₀ is selected from a group listed in the following table:

including any tautomer thereof; or an isomer thereof in which the C26, 27 C=C bond shown as trans is c/^'s; and including a methanol adduct thereof in which a ketal is formed by the combination of the C-53 keto (if present) and the C-15 hydroxyl group and methanol.

15. A compound according to any one of claims 1 to 14 for use as a pharmaceutical.

16. A compound according to any one of claims 1 to 14 for use as a pharmaceutical for the treatment of viral infections such as HCV or HIV infection or as an immunosuppressant or an anti-inflammatory agent.

17. A pharmaceutical composition comprising a compound according to any one of claims 1 to 14 together with a pharmaceutically acceptable diluent or carrier.

18. A pharmaceutical composition comprising a compound according to any one of claims 1 to 14 together with a pharmaceutically acceptable diluent or carrier further comprising a second or subsequent active ingredient.

19. A method of treatment of viral infections such as HCV or HIV infection or for use as an immunosuppressant or an anti-inflammatory agentwhich comprises administering to a subject a therapeutically effective amount of a compound according to any one claims 1 to 14.

20. A process for preparing a compound according to any one of claims 1 to 14 which comprises reacting a compound of formula II O O

I I

R.OT -¾R₈

Formula II wherein F is as defined in any one of claims 1 to 14 and R₈ is Ci_₆ alkyl or benzyl; with an aldehydic macrocycle (compound of formula III):

wherein R₃, R₄, R₅, m and n are as defined in any one of claims 1 to 14.