WO2011093470A1 - Pharmaceutical composition for treatment of bone diseases, which contains protein comprising bone morphogenetic protein receptor 1b (bmpr1b) extracellular domain or mutant thereof - Google Patents

Abstract

Disclosed is a pharmaceutical composition for the treatment of bone diseases, which contains, as an active ingredient: a protein that comprises a bone morphogenetic protein receptor 1B (BMPR1B) extracellular domain derived from a mammal or a mutant of the BMPR1B extracellular domain, said mutant having 85% or higher sequence identity with the amino acid sequence of the domain and having an effect of increasing the bone mass, bone density and/or bone strength; or a vector comprising a nucleic acid encoding the protein. Examples of the bone diseases may include osteoporosis, osteoarthritis, rheumatoid arthritis, bone diseases associated with malignant tumors or the like, and various bone diseases or disorders associated with the aforementioned diseases.

Description

Bone morphogenetic protein receptor 1B (BMPR1B) A pharmaceutical composition for treating bone disease containing a protein containing an extracellular domain or a variant thereof

The present invention is a novel therapeutic agent for bone diseases containing a protein containing the extracellular domain of bone morphogenetic protein receptor 1B (hereinafter referred to as BMPR1B) known as a TGF-β superfamily molecular receptor protein or a variant thereof. Regarding usage.
This finding was found from characterization of BMPR1B extracellular domain-expressing knock-in mice and mice administered with a protein containing BMPR1B extracellular domain.

The osteoporotic population has increased in the face of a super-aging society, and fractures resulting from it have become a major social problem. In particular, femoral neck fractures and vertebral body fractures lead to bedridden conditions, thereby significantly lowering the quality of life (QOL), leading to an increase in social and medical economic burden due to care and hospitalization treatment ( Non-Patent Documents 1 and 2). In recent years, it has been revealed that osteoporosis is greatly related to mortality in the elderly (Non-patent Documents 3 and 4). Against this background, prevention and treatment of osteoporosis is an important issue to be overcome. Osteoporosis (in which the bone mass is reduced while maintaining the ratio between bone mass and calcification) includes primary osteoporosis and secondary (secondary) osteoporosis, the former being traditionally postmenopausal osteoporosis and the elderly Refers to the pathological condition referred to as osteoporosis, the latter refers to the pathology of osteoporosis caused by changes in bone metabolism due to other diseases, endocrine, nutritional / metabolic, inflammatory, immobility, drug, Classified into blood disorders, congenital and other diseases. In the above classification, endocrine includes hyperparathyroidism, hyperthyroidism, hypogonadism, Cushing syndrome, growth hormone deficiency, diabetes, Addison's disease, calcitonin deficiency, etc. , Chronic debilitating disease, illness, severe liver disease (especially primary biliary cirrhosis), gastrectomy, scurvy, malabsorption syndrome (including celiac disease), hypophosphatemia, chronic kidney disease, idiopathic high Ca urine disease, hemochromatosis, amyloidosis, mastocytoma, sodium overdose, calcium intake deficiency, vitamin D, A excess, etc. are inflammatory, rheumatoid arthritis, paraarticular (prolonged bone resorption by inflammatory cytokines ) ・ Sarcoidosis is immobility, systemic, bed rest, paralysis, locality, after fracture, etc., and pharmacology is steroid (as an immunosuppressant, widely used for inflammatory diseases) Diseases treated with steroids include collagen disease, asthma, inflammatory bowel disease, organ transplantation, etc. Bone loss is a serious side effect of this therapy.), Methotrexate, heparin, warfarin, anti-keiren drugs・ Lithium, tamoxifen, etc. include multiple myeloma, lymphoma, leukemia, hemophilia, chronic hemolytic disease for blood diseases, congenital bone dysplasia, Marfan syndrome, Kleinfelter syndrome, Congenital myelogenous porphyria, cystic fibrosis, etc. due to other diseases are secondary to chronic obstructive pulmonary disease, liver disease, kidney disease, rheumatoid arthritis, pregnancy, hyperoxia, HIV infection, etc. It is listed as a causative disease of osteoporosis (Non-patent Document 5).

Among the above-mentioned diseases, osteoarthritis, rheumatoid arthritis, malignant tumor, bone disease associated with renal disease, and the like are listed as bone diseases having a great social impact in addition to primary osteoporosis.
Osteoarthritis is the most common disease in the musculoskeletal region, and it is said that there are 10 million affected people in Japan. The number of patients is expected to continue to increase as the population ages. Severe joint disorders are treated by artificial joint replacement surgery, but there is currently no report of a fundamental treatment method for symptoms with a moderate or lower disease level (Non-patent Document 6).

Rheumatoid arthritis is a chronic and progressive inflammatory disease mainly composed of polyarthritis, and it often involves destruction of the joints and deformation due to the involvement of surrounding cartilage and bones from the proliferation of the synovial membrane. . It has been reported that treatment with anti-rheumatic drugs (methotrexate) cannot sufficiently suppress the progression of joint destruction, and biological preparations targeting tumor necrosis factor (TNF) α have a significant effect on joint destruction inhibition It is considered a revolutionary drug. However, there is a concern as an adverse effect that the incidence of opportunistic infection, tuberculosis (extrapulmonary tuberculosis), pneumocystis pneumonia, etc. increases during its use (Non-patent Document 7).

Examples of bone diseases associated with malignant tumors include hypercalcemia associated with malignant tumors and bone metastases. Hypercalcemia causes anorexia and diuresis, with dehydration and associated renal dysfunction. Bone metastasis is particularly common in patients with breast cancer, prostate cancer, and lung cancer. Although bone metastasis itself is rarely fatal, it can cause bone pain, pathologic fractures, nerve paralysis, etc., so it often reduces the patient's quality of life. Control of bone metastasis is clinically important. This is a problem (Non-Patent Document 8). Bisphosphonate preparations are used to treat bone diseases associated with these malignant tumors, but problems due to side effects have been pointed out.

Among the bone diseases associated with kidney disease, a pathological condition in which bone is damaged due to renal tissue damage is called renal osteodystrophy. Bone disease in renal dialysis patients is mainly due to secondary hyperparathyroidism. Renal osteodystrophy progresses due to increased parathyroid hormone (PTH) concentration caused by hyperparathyroidism and insufficient production of, for example, bone morphogenetic protein (BMP) 7. Bone responsiveness to bone PTH is often reduced in dialysis patients, and chronic and significant increases in PTH levels cause fibrotic osteoarthritis (high bone rotation), but PTH levels remain in the reference range And aplastic osteopathy (low bone rotation).

When fibrotic osteoarthritis becomes severe, collagen fibers are irregularly formed and calcified as non-crystalline calcium phosphate to form woven bone, which promotes bone formation but easily breaks the bone. The basic treatment for fibrotic osteoarthritis is suppression of parathyroid hormone secretion, with the focus on calcium intake and active vitamin D administration. However, in the case of chronic kidney disease (CKD), especially dialysis patients, various controls such as food and water restriction are necessary, and when secondary hyperparathyroidism progresses, hypercalcemia is also a problem. Become. In addition, when prescribing active vitamin D, it is necessary to pay close attention to monitoring renal function (serum creatinine level) and serum calcium level.

Aplastic osteopathy also develops with long-term continuous use and overdose of active vitamin D preparations, or suppression of parathyroid hormone after parathyroidectomy (PTX).
Aplastic osteopathy has a higher fracture rate than fibrotic osteoarthritis and induces hypercalcemia and calcification of blood vessels and other soft tissues. The pathological condition is a state of low rotation bone in which both bone resorption and bone formation are suppressed, and there is no established treatment method (Non-patent Document 9).

Hyperphosphatemia and hypercalcemia caused by reduced bone phosphorus and calcium uptake (low turnover bone) and storage ability (high turnover bone) are ectopic (vascular) calcifications. It is considered as one of the causes. In patients with chronic renal failure, especially dialysis patients, more than 40% of deaths are due to cardiovascular complications, and arteriosclerosis with vascular calcification has attracted attention as an important disease state. Treatment of highly advanced calcified lesions in patients with chronic renal failure is still difficult and has a poor prognosis (Non-patent Document 10). Therefore, in addition to primary osteoporosis, osteoarthritis, rheumatoid arthritis, malignant tumors, bone diseases associated with renal diseases, vascular calcification associated with bone diseases, and development of drugs with fewer side effects are desired. ing.

Bone metabolism is thought to be controlled by the balance between the action of osteoblasts and osteoclasts, and osteoporosis occurs when the action of breaking bone exceeds that of making bone (Non-patent Document 11). In particular, postmenopausal women have decreased secretion of female hormones that play a role in protecting bones, resulting in decreased osteogenic bone formation and increased osteoclastic bone resorption activity. The possibility of presenting the symptoms is high (Non-patent Documents 12 and 13). For this reason, estrogen preparations have been used, but their use has been shown to increase the risk of thrombosis and breast cancer, and indications are being limited. Further, the use of a selective estrogen receptor modulator has been reported to increase the risk of deep vein thrombosis (Non-patent Document 14).

Currently, calcitonin, bisphosphonate, and the like are used as drugs that suppress the bone resorption activity of osteoclasts. Calcitonin is known to induce inactivation of osteoclasts by binding to the calcitonin receptor expressed on the surface of osteoclasts. It is clinically used not only for osteoporosis but also for hypercalcemia and bone Paget disease. Applied. However, the effectiveness against the fracture-suppressing effect is not clear, and it has been reported that the receptor expression is down-regulated by administration of calcitonin (Non-patent Documents 14 and 15). Bisphosphonates have a strong bone resorption inhibitory effect, and amino group-containing bisphosphonates such as andronate and risedronate are the mainstream therapeutic agents for osteoporosis in Japan. These bisphosphonate preparations inhibit the prenylation of lipid proteins by inhibiting farnesyl diphosphate synthase, thereby suppressing bone resorption function and inducing osteoclast apoptosis (Non-patent Document 16). However, as a problem with bisphonate preparations, the 2008 FDA issued a warning about severe skeletal, joint, and muscle pain. Further, side effects such as jaw osteonecrosis have been reported when used for a long period of time (2 to 3 years or more) after dental treatment (Non-patent Document 17). Anti-RANKL antibodies are expected as new bone resorption inhibitors other than the above. Anti-RANKL antibodies are also expected to be used as inhibitors for bone metastasis in prostate cancer, joint destruction inhibitors for rheumatoid arthritis, and therapeutic agents for multiple myeloma, and clinical development is underway. However, the report that the RANKL / RANK pathway is important for the survival and maintenance of dendritic cells (Non-Patent Document 18) and that RANK and RANKL-deficient mice cause lymph node dysplasia (Non-Patent Document 19, 20), there is concern about the effect of anti-RANKL antibody preparations on the immune system. In 2008, AMGEN reported an increase in the incidence of some infectious diseases in a clinical trial of an anti-RANKL antibody preparation (denosumab). In addition, recent clinical trial results reported the occurrence of osteonecrosis of the jaw as a side effect at almost the same rate as the bisphosphonate formulation. Intermittent administration treatment using PTH is the only osteogenesis-promoting agent that activates osteoblasts (Eli Lilly, Teriparatide, not approved in Japan), but cortical bone compared to cancellous bone mass promoting activity Since the thickness-accelerating activity is not so high, it is not different from other therapeutic agents such as bisphosphonate preparations, so it is considered that the effect of preventing fracture is not so high. In addition, Asahi Kasei Pharma reported on side effects such as palpitations, tachycardia, and blood pressure reduction, as well as problems such as bone and meat species observed in long-term administration studies in rats, and continued in Europe and the United States for more than 1.5 to 2 years. Because it is not approved for use in cancer patients, hypercalcemia caused by cancer bone metastasis and cancer [parathyroid hormone-related peptide (PTHrP) produced by tumor cells is It is impossible to use PTH for the treatment of the causative tumor associated humoral hypercalcemia or local osteolytic hypercalcemia].

Therefore, osteoporosis, hypercalcemia, bone Paget's disease, bone metastasis suppression, rheumatoid arthritis caused by decreased osteogenic ability of osteoblasts including postmenopausal women and increased bone resorption activity of osteoclasts Development of a drug that acts more effectively on destruction suppression and multiple myeloma and has fewer side effects is desired.
In addition, unlike osteoporosis, osteomalacia and Kuru disease are known as bone diseases caused by inhibiting only the calcification process. Bone is formed when a matrix layer made of collagen or the like is calcified by the deposition of hydroxyapatite, but this calcification is impaired, and the state of increased osteoids is osteomalacia. When it develops, it is called Kur disease. Symptoms include bone and joint pain such as limb pain, joint pain, back pain, back pain, etc., leading to gait disturbance and easy fracture. In the case of children, developmental disorders, deformed limbs such as O-legs, and pigeon breasts are observed. As a general treatment method, vitamin D, calcium, and phosphorus preparations are used in addition to dietary therapy, but surgery is the only coping therapy if there is a strong dysfunction due to deformation. Therefore, the development of a drug that is more effective against Kur disease and osteomalacia is desired.

As mentioned earlier, bone is always remodeled and controlled by the balance between osteoblast and osteoclast function, so to make a strong bone that is hard to break, simply increase the bone mass. Not necessarily. For example, osteogenesis such as marble bone disease (Non-patent document 21), Paget's disease of bone (Non-patent document 22), Kamrati-Engelmann disease (CED) (Non-patent documents 23, 24), etc. It is known that the balance of bone resorption becomes abnormal, and bone strength is decreased while an increase in bone mass is observed. In addition to quantitative factors typified by bone density, factors that determine bone strength mechanically include cancellous bone connectivity, cortical bone thickness and porosity, shape factors such as cross-sectional moment, calcification and bone Examples include qualitative factors such as fatigue (Non-patent Document 25). Therefore, development of an effective drug that not only increases bone mass but also helps improve bone strength is desired in the treatment of primary osteoporosis and secondary (secondary) osteoporosis.

In 1965, Urist found that ectopic bone formation was induced by injecting the insoluble fraction of bovine bone after 0.6M decalcification into rats subcutaneously, and the protein with bone forming ability was called Bone morphogenetic protein (BMP). (Non-patent document 26).
GDF (growth differentiation factor) / BMP is a growth factor with various functions belonging to the TGFβ superfamily, and the TGFβ superfamily includes TGFβ, activins / inhibins, Nodal, myostatin, and anti-Mullerian hormone. BMP family molecules bind to two different serine / threonine kinase receptors, and their signals are transmitted by Smad-dependent and independent pathways. So far, more than 15 types of BMP-related proteins have been identified and classified into several subgroups based on structure and function. BMP2 / 4 subgroup belongs to BMP2, BMP4 and Drosophila decapentaplegic, BMP7 subgroup belongs to BMP5, BMP6, BMP7, BMP8 and Drosophila gbb-60A, GDF5 subgroup belongs to GDF5, GDF6 and GDF7, 4 BMP9 and BMP10 belong to the second subgroup. All BMPs contain 7 cysteine residues, 6 of which form SS bridges in the molecule, and the remaining 1 is dimerized and used for intermolecular SS bridge formation. Unlike TGF-β family molecules, BMP family molecules are secreted in an active form, and BMP signals in vivo are regulated by secretory antagonists such as noggin, chordin, and DAN. BMPs exert their actions by binding to and activating receptors, which are composed of two types of receptors called type I serine / threonine kinase receptors and type II serine / threonine kinase receptors. ing. Seven types of receptors classified as Type I receptors [Activin receptor-like kinase (ALK) 1-7] have been reported, and five types of receptors classified as type II receptors (ActR2A, ActR2B, BMPR2, TGFβR2 and AMHR2) have been reported. Unlike TGFβ and activin, which selectively show high affinity for type II receptor, BMP shows binding affinity for both type I and type II receptors, and in particular BMP2 as BMP showing high affinity for type I, 9 and 10 have been reported. Furthermore, type III receptors (betaglycan, endoglin, RMG-a, b, c) called co-receptor further bind to the ligand / receptor complex composed of Type I receptor and type II receptor, It is known to regulate the binding affinity of. After the ligand-receptor complex is formed, BMP receptors (ALK1, ALK2, ALK3, ALK6) phosphorylate and activate Smad1 / Smad5 / Smad8. Smad molecules that are phosphorylated by activin or TGFβ receptor are also known as Smad2, Smad3, Smad4 called common mediator Smad (co-Smad) or Smad6, Smad7 called inhibitor Smad (I-Smad) . Activated Smad moves into the nucleus together with Smad4, forms a further complex with the nuclear transcription factor, and regulates the expression of the target gene by binding to the promoter region of the target gene. Although the Smad pathway is mainly considered as a signal transduction pathway of BMP, the presence of a non-Smad pathway (MAPK signal pathway such as p38MAPK, ERK or JNK) has been reported (Non-patent Documents 27 to 30).

BMPR1B (ALK6), one of the BMP receptors, is a single transmembrane receptor belonging to BMP receptor type I. CDw293 is known as another name of BMPR1B. BMPR1B has a serine / threonine kinase domain in the cell, and 10 highly conserved cysteine residues are found in the extracellular region. The amino acid homology between human-derived BMPR1A and BMPR1B is 42.1%, and all of them bind to BMP2, 4 and 7, but the binding affinity of BMPR2 and heterodimer is at least that of these three ligands. It is different. As a result of tissue expression analysis using mRNA of adult human samples, the most highly expressed tissue is prostate, the most highly expressed tissue is heart, brain, skeletal muscle, pancreas, thymus, prostate, testis, uterus, small intestine, low expression Is placenta, kidney, spleen, large intestine. In the mouse sample, expression is observed in the brain and expression is observed in the lung although it is lower, but the prostate is unanalyzed and is unknown (Non-patent Document 31).

BMPR1B belonging to the same family as BMPR1B, knockout mice (Non-Patent Documents 32, 33) and ActR2A (ACVRIIA) extracellular domain and Fc fusion protein (ACVRIIA-Fc) administered to mice (Non-patented) 34) both reported that bone formation was promoted, and a clinical trial using ACVRIIA-Fc was started at ACCELERON PHARMA for the purpose of developing a bone metastasis inhibitor for cancer. Non-patent document 35, Patent document 1).

In contrast, analysis of BMPR1B knockout mice revealed that axonal guidance abnormalities and hyperapoptosis in the retinal retina (Non-Patent Document 36), proliferation of phalangeal bone regions, especially prechondral cells, and chondrocyte differentiation inhibition (non- Patent Document 37) was observed. As described above, in the analysis of BMPR1B knockout mice, only eye, reproductive, and cartilage abnormalities have been reported, and nothing specifically indicating bone mass increase has been reported.

In addition, the expression of Runx2 / Cbfa1 and osteocalcin genes in 4 weeks old long bone samples of transgenic mice in which a vector ligated with the kinase domain deletion of BMPR1B was inserted downstream of the type I collagen promoter was observed compared to controls. A clear decrease in body length was also observed. Similarly, bone morphology, bone formation rate, and osteoid thickness were reduced from the results of bone morphometry of secondary tibial cancellous bone derived from 4-week-old transgenic mice. In addition, a decrease in bone density of the tibia and femur was observed during the growth period up to 12 weeks of age. The above results suggest that signal transduction via BMPR1B plays an important role in bone formation (Non-patent Document 38).

Also, deficit A2 type, deficit C type, or phalanxia-like symptom (represents a state where the finger joint is attached to the cartilage or bone and there is no movement of the joint. Analysis of the BMPR1B amino acid sequence of a patient who shows about 0.6% of congenital anomalies in the patient's surface, which is hypomorphic with no wrinkles that should be present on the surface of the finger), found an R to Q mutation at the 486th amino acid. It was done. The region where this amino acid is located is a highly conserved region at the C-terminus and is also called a nonactivating-non-downregulating box. This region is considered to be an important region in TGFβ type I receptor for regulation of activation by endocytosis and phosphorylation between TGFβ receptors. Furthermore, when BMPR1B gene expression vector was introduced into C2C12 strain and GDF5 was added, Smad signaling increased and non-Smad signaling increased alkaline phosphatase (ALP) activity in a dose-dependent manner, but R486Q to R486W mutations. The fact that both of the above-mentioned reactions induced by GDF5 are not observed by introducing a receptor into which is inserted can also indicate that signal transduction via BMPR1B is important for bone formation (Non-patent Document 39).

However, in all of the above reports, although signal transduction via BMPR1B is important for bone formation, its inhibition of signal transduction suggests a suppressive effect on bone formation, suggesting that it acts positively. There was no suggestion. Therefore, it was extremely difficult to predict that a fusion protein (BMPR1B-Fc) obtained by fusing the BMPR1B extracellular domain and the Fc body exhibits osteogenic activity in vivo.

WO2008 / 094708

With the aging of society, osteoporosis, osteoarthritis, rheumatoid arthritis, bone diseases associated with malignant tumors and related bone diseases are becoming increasingly important social issues, and research and development of bone disease treatments Has been widely and vigorously done. One of the most commonly used drugs at present is bisphosphonate, which is a highly effective drug, but recently its side effects have become a problem. Problems that should be overcome in other drugs have also been pointed out. Therefore, there is a strong demand for the development of a drug that acts more effectively on bone disease treatment and has fewer side effects.

Surprisingly, the inventors of the present invention, contrary to the conventional prediction, when a protein containing an extracellular domain derived from BMPR1B is highly expressed in vivo, or a protein containing an extracellular domain derived from BMPR1B in vivo. It has been found for the first time that all of these proteins have an effect on bone mass increase when administered.
The present inventors produced a mouse that overexpresses a fusion between a protein containing BMPR1B extracellular domain and Fc, and whitened the femur by overexpression of a fusion between the protein containing BMPR1B extracellular domain and Fc. Whitening of sternum, thickening of cortical bone thickness of femur and increase of cancellous bone and increase of cancellous bone of sternum, increase of unit bone mass of tibia, increase of osteoblast number, osteoblast surface and osteoid mass, lime We found an increase in calcification rate, calcification surface, and bone formation rate, a decrease in the number of osteoclasts and osteoclast surface, an increase in the cortical bone cross-sectional area of the femur, and an increase in the maximum load on the femur.

Based on these findings, bone disease therapeutic agents containing proteins containing the BMPR1B extracellular domain or a variant thereof as active ingredients are provided as new osteoporosis therapeutic agents, arthritis therapeutic agents, and bone disease associated with malignant tumors. It was shown that it can be done.
That is, the present invention includes the following features.
(1) It has an extracellular domain of bone morphogenetic protein receptor 1B (hereinafter referred to as BMPR1B) derived from a mammal, or a sequence identity of 85% or more with the amino acid sequence of the domain, and bone mass, bone density and / or Alternatively, a pharmaceutical composition for treating a bone disease comprising, as an active ingredient, a protein containing a mutant of the extracellular domain of BMPR1B having an action of increasing bone strength, or a vector containing a nucleic acid encoding the protein.

(2) The protein is a fusion protein of the extracellular domain or a variant thereof and a mammal-derived immunoglobulin Fc protein or a variant thereof, and the nucleic acid encoding the protein is a nucleic acid encoding the fusion protein. The composition according to (1).
(3) The composition according to (1) or (2), wherein the protein is chemically modified.
(4) The composition according to (3), wherein the chemical modification is a bond of one or more polyethylene glycol molecules.

(5) The composition according to (3), wherein the chemical modification is a sugar chain bond.
(6) The composition according to any one of (1) to (5), wherein the protein is a recombinant protein.
(7) The composition according to any one of (1) to (6), wherein the extracellular domain comprises the amino acid sequence of SEQ ID NO: 1 or 3.
(8) The composition according to any one of (1) to (6), wherein the nucleic acid encoding the protein containing the extracellular domain comprises the nucleotide sequence of SEQ ID NO: 2 or 4.

(9) The composition according to any one of (2) to (8), wherein the Fc protein comprises the amino acid sequence of SEQ ID NO: 8.
(10) The composition according to any one of (2) to (8), wherein the nucleic acid encoding the Fc protein comprises the nucleotide sequence of SEQ ID NO: 7.
(11) The composition according to any one of (2) to (10), wherein the fusion protein comprises the amino acid sequence of SEQ ID NO: 10 or 18.

(12) The composition according to any one of (2) to (10), wherein the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 9 or 17.
(13) The composition according to any one of (1) to (12), wherein the mammal is a human.
(14) The composition according to any one of (1) to (13), wherein the bone disease is a disease accompanied by a decrease in bone mass, bone density and / or bone strength.

(15) A method for treating a bone disease, comprising administering the composition of any one of (1) to (14) to a mammal.
(16) The method according to (15), wherein the mammal is a human.
(17) The method according to (15) or (16), wherein the bone disease is a disease accompanied by a decrease in bone mass, bone density and / or bone strength.

(18) The method according to any one of (15) to (17), wherein the composition is administered simultaneously or sequentially in combination with another bone disease therapeutic agent.

According to the present invention, bone mass, bone density and / or bone strength can be increased. Therefore, diseases associated with a decrease in bone mass, bone density and / or bone strength, such as bone diseases caused by osteoporosis, osteoarthritis, rheumatoid arthritis, malignant tumors, and various bone diseases or disorders related thereto It becomes possible to treat.

This figure shows H & E stained images of femoral pathological sections of 16-week-old USmBMPR1B-hFcm KI chimeric mice (right diagram) and control mice (left diagram). This figure shows the mBMPR1B-hFcm recombinant expression vector. The SDS-PAGE image of mBMPR1B-hFcm recombinant purified preparation is shown. From the left, molecular weight markers, recombinant purified preparations (reducing conditions, 3 μg), and recombinant purified preparations (non-reducing conditions, 6 μg) are shown, and the numerical values on the vertical axis show the molecular weight (kDa). This figure shows the hBMPR1B-hFcm recombinant expression vector. This figure shows that mBMPR1B-hFcm recombinant has activity to increase bone density, especially cancellous bone density. The vertical axis represents bone density (g / cm ³ ). The horizontal axis represents the administration group. This figure shows that mBMPR1B-hFcm recombinant has activity to increase bone mass, especially cortical bone mass. The vertical axis represents bone mass (mm ³ ). The horizontal axis represents the administration group. This figure shows that mBMPR1B-hFcm recombinant suppresses bone diseases caused by malignant tumors, particularly bone metastases. The vertical axis represents the bone fracture area (mm ² / mouse). The horizontal axis represents the administration group.

Hereinafter, the present invention will be described in detail.
The present invention, as described above, the BMPR1B extracellular domain derived from mammals, or BMPR1B having an action of increasing bone mass, bone density and / or bone strength, having 85% or more sequence identity with the amino acid sequence of the domain The present invention provides a pharmaceutical composition for treating a bone disease, which comprises, as an active ingredient, a protein comprising a mutant of the extracellular domain of the above, or a vector comprising a nucleic acid encoding the protein.

The present invention is based on the finding that the above fragment containing the extracellular domain of BMPR1B has a function of increasing bone mass, bone density and / or bone strength in mammals. That is, the present inventors produced a mouse that expresses the extracellular domain of BMPR1B from mouse ES cells using a knock-in method, or a fusion recombinant of a protein containing the extracellular domain of BMPR1B and Fc to the mouse. When administered, it was found for the first time that the bone mass, bone density, and / or bone strength of the bone site were increased to such an extent that they could be discriminated visually and sensorially compared to the wild type. According to the conventional knowledge, as described in the background art above, although signal transduction via BMPR1B is important for bone formation, it is considered that inhibition of signal transduction has a suppressive effect on bone formation. It was not even imagined to be involved in bone growth.

Thus, the present inventors have found that the extracellular domain of BMPR1B has a new useful function of increasing bone mass, bone density and / or bone strength. The pharmaceutical composition of the present invention can be used for the treatment of bone diseases that increase bone mass, bone density and / or bone strength at bone sites.
Hereinafter, the pharmaceutical composition of the present invention will be described more specifically.
<BMPR1B extracellular domain>
BMPR1B related to the present invention is a mammal-derived BMPR1B.

BMPR1B amino acid and nucleotide sequence information is available by accessing the US NCBI.
BMPR1B has been isolated from humans, mice, chimpanzees, dogs, cows, Japanese zelkova, zebrafish, etc., and sequence information has been published. In the present invention, the BMPR1B protein or the nucleic acid encoding the same is not limited to its origin, but is preferably derived from mammals such as primates including humans and rodents including mice. . For example, human BMPR1B has accession number NM_001203.2 or NP_001194.1, etc., and mouse BMPR1B has accession number NM_007560.3 or NP_031586.1, etc. to GenBank (US NCBI). It is registered.

The amino acid sequences of the extracellular region proteins of human and mouse BMPR1B are as follows.
Amino acid sequence of the extracellular region protein of human BMPR1B (SEQ ID NO: 1):
KKEDGESTAPTPRPKVLRCKCHHHCPEDSVNNICSTDGYCFTMIEEDDSGLPVVTSGCLGLEGSDFQCRDTPIPHQRRSIECCTERNECNKDLHPTLPPLKNRDFVDGPIHHR
Amino acid sequence of the extracellular region protein of mouse BMPR1B (SEQ ID NO: 3):
LLRSSGKLNVGTKKEDGESTAPTPRPKILRCKCHHHCPEDSVNNICSTDGYCFTMIEEDDSGMPVVTSGCLGLEGSDFQCRDTPIPHQRRSIECCTERNECNKDLHPTLPPLKDRDFVDGPIHHK
In the present invention, mammals include, but are not limited to, primates, livestock animals, rodents, ungulates, pet animals and the like. Preferred mammals are humans and mice.

<Variant of extracellular domain>
Mutants of the extracellular domain of the present invention include both natural mutants and artificial mutants, and are 85% or more, preferably 90% or more, such as 93% or more, 95% or more in the amino acid sequence of the extracellular domain. %, 97% or more, 98% or more, or 99% or more of an amino acid sequence having the ability to increase bone mass, bone density and / or bone strength.

Illustratively, the mutant is 85% or more, preferably 90% or more, such as 93% or more, 95% or more, 97% or more, 98% or more, in the amino acid sequence of SEQ ID NO: 1 or 3, or It contains an amino acid sequence having an identity of 99% or more and has the ability to increase bone mass, bone density and / or bone strength.
As used herein, the term “identity” refers to the degree of agreement between sequences when aligning two amino acid sequences so that the number of identical amino acid residues is maximized. Specifically, it is expressed as a percentage (%) of the number of identical amino acid residues to the total number of amino acid residues. When gaps are introduced as in FASTA, the number of gaps is also added to the total number of amino acid residues.

Proteins having 85% or more sequence identity can be searched using sequence homology search programs such as BLAST and FASTA by accessing sequence databases such as US NCBI and European EMBL [Altschul] , S. F. et al., J. Mol. Biol. 15, 403-410 (1990), Karlin, S. et al., Proc. Natl. Acad. Sci. USA, 87, 2264-2268 (1990) etc]. BLAST divides the sequence into fixed-length words, searches for similar fragments in word units, stretches them in both directions until the degree of similarity is maximized, performs local alignment, and finally combines these to make the final It is a method of performing a general alignment. FASTA also searches for fragments of sequences that match consecutively at high speed, performs local alignment by focusing on those fragments that have high similarity, and finally considers these gaps. Is an alignment method.

When introducing a mutation into the extracellular domain of the present invention, a mutation comprising substitution, deletion or addition may be performed, and the natural disulfide bond may not be broken and the natural conformation may be substantially retained. desirable. This can result in loss of the ability of the domain protein to increase bone mass, bone density and / or bone strength if it breaks natural disulfide bonds in the extracellular domain and alters its native conformation. This is because the ability may be greatly reduced.

As the mutagenesis method, if the sequence of the extracellular domain is known, a site-directed mutagenesis method using a PCR method using a primer synthesized based on that sequence (including a complementary mutant sequence) is preferable. [Kunkel et al., Proc. Natl. Acad. Sci. USA, 82, 488-492 (1985), F. M. Ausubel et al., Short Protocols in Molecular Biology, John Wiley & Sons (1995), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press (1989), etc.]. Mutation introduction kits (for example, Takara Shuzo) are also commercially available, and mutations can be introduced according to the instructions.

Briefly, Kunkel's method uses a plasmid containing DNA encoding an extracellular domain as a template, and a primer (including a complementary mutant sequence) phosphorylated at the 5 ′ end with T4 DNA polynucleotide kinase. And then synthesizing the DNA, and then ligating the ends with T4 DNA ligase to purify the DNA containing the desired mutation.
In the present invention, the mutation includes substitution, deletion, addition, insertion, or a combination thereof.

The substitution may be either conservative substitution or non-conservative substitution, but conservative substitution is preferable so as not to substantially change the conformation of the extracellular domain protein. Conservative substitutions can be made between amino acids with similar chemical and physical properties such as structural (e.g., branched, aromatic, etc.), electrical (e.g., acidic, basic, etc.), polar or hydrophobic, etc. Refers to replacement. Branched amino acids include valine, leucine and isoleucine. Aromatic amino acids include tyrosine, tryptophan, phenylalanine, histidine. Acidic amino acids include glutamic acid and aspartic acid. Basic amino acids include lysine, arginine, and histidine. Polar amino acids include serine, threonine, glutamine, asparagine, tyrosine, cysteine, glycine, proline and the like. Hydrophobic amino acids include alanine, valine, leucine, isoleucine, methionine and the like.

Deletion is the loss of one or more amino acid residues. Addition is the attachment of one or more amino acid residues to the N-terminus or C-terminus of the protein. Insertion is the joining of one or more amino acid residues inside a protein. Among these, deletion and insertion can be performed on the assumption that the conformation of the extracellular domain protein is not substantially changed. Therefore, deletion or insertion of about 1 to 10, preferably about 1 to 5 amino acid residues can be performed.

In the present invention, an increase in “bone mass, bone density and / or bone strength and bone strength” is accompanied by at least an increase in cancellous bone, thickening and proliferation of diaphysis, an increase in maximum load, and the like.
<Protein containing extracellular domain or its variant>
As explained above, one of the active ingredients of the pharmaceutical composition of the present invention is an extracellular domain of BMPR1B derived from a mammal, or has an amino acid sequence of 85% or more of the amino acid sequence of the domain, and bone mass , A variant thereof having an action of increasing bone density and / or bone strength.

Here, the expression “comprising” means that the heterologous peptide, polypeptide or protein is added to the extracellular domain or a variant thereof, as appropriate, if necessary, at the N-terminal or C-terminal side of the domain or the variant thereof. It means that they may be bonded or fused via a peptide linker (for example, 1 to 20 amino acids). For example, a preferred example of such a heterologous protein is a mammal-derived immunoglobulin Fc protein or a variant thereof. However, if such a heterologous protein is administered in vivo, it may cause a rejection reaction. Therefore, in order to avoid it as much as possible, the protein originally possessed by the administered mammal is used as the heterologous protein. It may be desirable to do.

A preferable Fc protein is a human immunoglobulin Fc protein in consideration of use in humans. The immunoglobulin class and subclass are not limited to the following, but any of IgG, IgD, IgE, IgM, IgA, IgG1, IgG2, IgG2a, IgG2b, IgG2c, IgG3, IgG4, IgA1, IgA2, etc. Although preferred for human use, it is desirable to use human immunoglobulin classes and subclasses. The Fc protein can improve the stability of an extracellular domain or a variant thereof in vivo. However, in this case, the Fc protein has a biological activity such as antibody-dependent cytotoxicity (ADCC) activity and / or complement-dependent cytotoxicity (CDC) activity, in order to avoid in vivo effects due to its biological activity. Therefore, it is desirable to introduce a mutation for suppressing, reducing or losing the biological activity as described above. Such a mutation is an amino acid substitution of, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acid residues in the amino acid sequence of an Fc protein derived from a mammal, and includes ADCC and Any amino acid substitution that decreases CDC activity, and specifically, can include substitution as exemplified in Example 1 described later. A preferred example of the Fc protein is a human IgG1 Fc variant comprising the amino acid sequence of SEQ ID NO: 8. The binding position of the Fc protein may be either the N-terminal side or the C-terminal side of the extracellular domain or a variant thereof, but the C-terminal side is preferred.

A specific example of the Fc fusion protein is a protein comprising any one of the amino acid sequences of SEQ ID NO: 10 and SEQ ID NO: 18, for example.
The extracellular domain in the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 is derived from the extracellular region protein of BMPR1B. The amino acid sequence of this domain has the ability to increase bone mass, bone density and / or bone strength. As long as it has, it may contain a mutation as described in the section <Variant of extracellular domain> above.

In the present invention, the protein containing the extracellular domain or a variant thereof does not necessarily need to be bound or fused with a heterologous peptide, polypeptide or protein. That is, the protein in the present invention may be a fragment of the extracellular region protein of the BMPR1B. Such fragments may contain mutations as described in the section <Variants of extracellular domain> above, as long as they have the ability to increase bone mass, bone density and / or bone strength.

The protein containing the extracellular domain of the present invention or a mutant thereof can be prepared by a conventional gene recombination technique. Briefly, the protein is prepared by preparing a DNA encoding the protein of the present invention, constructing an expression vector containing this DNA, transforming or transfecting prokaryotic or eukaryotic cells with the vector, Recovering the desired recombinant protein from the cultured cells. Protein purification is performed by appropriately combining conventional protein purification methods such as ammonium sulfate precipitation, organic solvent precipitation, dialysis, electrophoresis, chromatofocusing, gel filtration chromatography, ion exchange chromatography, affinity chromatography, and HPLC. Is possible.

The above DNAs and vectors are described in the following <Nucleic acids and vectors> section, Examples, etc., and can be referred to. In addition, the gene recombination technology is F. M. Ausube et al., Short Protocols in Molecular Biology, John Wiley & Sons (1995), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold. It is described in Spring Harbor Laboratory Press (1989) and can be used for the present invention.

The protein containing the extracellular domain or a variant thereof in the present invention may be chemically modified.
Chemical modifications include, but are not limited to, for example, glycosylation, polyethylene glycol (PEG), acetylation, amidation, phosphorylation and the like. Particularly preferred chemical modifications that can be utilized are glycosylation and pegylation.

PEGylation is the binding of one or more polyethylene glycol (PEG) molecules to amino acid residues such as the N-terminal amino group of proteins and the ε-amino group of lysine. Generally, a PEG molecule is attached to the free amino group of an amino acid. The average molecular weight of PEG is not limited to the following, but can be used in the range of about 3000 to about 50000. In order to bind PEG to protein, active groups such as carboxyl group, formyl (aldehyde) group, N-hydroxysuccinimide ester group, amino group, thiol group, and maleimide group are introduced into the terminal part of PEG to It can be reacted with a group such as an amino group, a carboxyl group, a thiol group, or a hydroxyl group.

Glycosylation is the attachment of a carbohydrate chain (ie, sugar chain) to an asparagine, serine or threonine residue of a protein. In general, sugar chain binding occurs by recognizing the sequence of Asn-X-Thr / Ser (where X is any amino acid residue other than Pro). When the amino acid sequence of the protein is modified so as to have such a sequence, a sugar chain can be introduced at a position different from the natural type. Usually, a recombinant protein can be glycosylated by expressing a nucleic acid encoding the recombinant protein in eukaryotic cells (yeast cells, animal cells, plant cells, etc.) by genetic recombination techniques. In the present invention, the sugar chain structure is not particularly limited, and it is considered that the sugar chain structure varies depending on the cell type selected for expression. For human use, human-derived cells, yeast cells capable of synthesizing human sugar chains, Chinese hamster ovary (CHO) cells, and the like can be used.

Acetylation and amidation are preferably performed mainly at the N-terminus or C-terminus of the protein. These reactions can be performed using, for example, alcohols such as aliphatic alcohols and fatty acids, and carboxylic acids. The number of carbon atoms in the alkyl moiety is, for example, about 1 to 20, but it is necessary to satisfy the conditions such as not impairing water solubility and nontoxicity.
<Nucleic acids and vectors>
The active ingredient of the composition of the present invention also includes a vector containing a nucleic acid encoding a protein containing the extracellular domain or a variant thereof.

The term “nucleic acid” as used herein includes both DNA and RNA, DNA includes genomic DNA and cDNA, and RNA includes mRNA.
For extracellular domains, mutants thereof, and proteins containing them, including <Fc protein fusion protein><BMPR1B extracellular domain>, <extracellular domain mutant> and <extracellular domain or mutation thereof As described in each section of Proteins Containing Body>, all the descriptions described in those sections are cited here. Accordingly, the nucleic acids in the present invention include nucleic acids encoding proteins containing the extracellular domain or a variant thereof described and specifically exemplified above.

Specifically, the nucleic acid is an extracellular region protein of human BMPR1B (SEQ ID NO: 1) and a nucleic acid encoding the amino acid sequence of the extracellular region protein of mouse BMPR1B (SEQ ID NO: 3) (SEQ ID NO: 2 and SEQ ID NO: Includes 4).
In consideration of expression of the nucleic acid in a eukaryotic cell and secretion of the expression product outside the cell, it may further include a nucleotide sequence encoding a signal sequence. Examples of the signal sequence include a signal sequence derived from BMPR1B, a signal sequence derived from human CD33, a signal sequence derived from human serum albumin, a signal sequence derived from human preprotrypsin, and the like.

The nucleic acid in the present invention includes a nucleic acid encoding a fusion protein of a protein containing the extracellular domain of BMPR1B or a variant thereof and the heterologous protein defined above. A preferable example of the heterologous protein is an immunoglobulin Fc protein derived from a mammal, and a human Fc protein is particularly preferable, but it is desirable to introduce a mutation so as to reduce or lose its biological activity (particularly ADCC and CDC). For example, SEQ ID NO: 7 shows a nucleotide sequence encoding a mutant human IgG1-derived Fc protein. Furthermore, SEQ ID NOs: 9 and 17 show nucleotide sequences encoding a fusion protein of the mutant human IgG1-derived Fc protein and a protein containing the extracellular domain of mouse or human-derived BMPR1B, respectively.

The nucleotide sequence encoding the fusion protein can further include a nucleotide sequence encoding a signal sequence. Examples of the signal sequence are a signal sequence derived from a human protein, such as a signal sequence derived from human BMPR1B, a signal sequence derived from human CD33, a signal sequence derived from human serum albumin, a signal sequence derived from human preprotrypsin, and the like.
Nucleic acid homologues encoding the above proteins can be obtained by using known techniques using primers and probes prepared from cDNA synthesized from mRNA encoding the human or mouse-derived BMPR1B gene. It can be obtained from a cDNA library prepared from a cell or tissue known to express the gene. Such techniques include PCR methods, hybridization methods (Southern method, Northern method, etc.) and the like.

The PCR method is a polymerase chain reaction, which involves a denaturation step (about 94 to 96 ° C, about 30 seconds to 1 minute) to dissociate double-stranded DNA into single strands, and a primer that is a single strand of a template. One cycle consisting of an annealing step (about 55 to 68 ° C, about 30 seconds to 1 minute) for binding to DNA and an extension step (about 72 ° C, about 30 seconds to 1 minute) to extend the DNA strand About 25 to 40 cycles. Also, before the denaturation step, preheating treatment at about 94 to 95 ° C. for about 5 to 12 minutes can be performed, and after the final cycle of the extension step, an extension reaction can be further performed at 72 ° C. for about 7 to 15 minutes. it can. PCR is performed with a commercially available thermal cycler in a PCR buffer containing a heat-resistant DNA polymerase [for example, AmpliTaq Gold (registered trademark) (Applied Biosystems), etc.], MgCl2, dNTP (dATP, dGTP, dCTP, dTTP), etc. In the presence of sense and antisense primers (size: about 17-30b, preferably 20-25b) and template DNA. The amplified DNA can be separated and purified (ethidium bromide staining) by agarose gel electrophoresis.

Hybridization is a technique for detecting a target nucleic acid by forming a double strand with a labeled probe having a length of about 20 to 100 b or more. In order to enhance selectivity, hybridization can generally be performed under stringent conditions. Stringent conditions consist of, for example, about 1-5 × SSC, hybridization at room temperature to about 40 ° C., and subsequent washing at about 0.1-1 × SSC, 0.1% SDS, about 45-65 ° C. Here, 1 × SSC refers to a solution of 150 mmol / L NaCl, 15 mmol / L Na-citric acid, pH 7.0. Such conditions will make it possible to detect nucleic acids with a sequence identity of about 80% or more, preferably 85% or more.

The nucleic acid is inserted into a vector and used for production of a protein which is an active ingredient of the pharmaceutical composition of the present invention, or the vector itself is formulated and used as a pharmaceutical composition.
Vectors include, for example, plasmids, phages, viruses and the like. Examples of plasmids include, but are not limited to, E. coli-derived plasmids (e.g., pRSET, pTZ19R, pBR322, pBR325, pUC118, pUC119, etc.), Bacillus subtilis-derived plasmids (e.g., pUB110, pTP5, etc.), yeast-derived plasmids (e.g., YEp13, YEp24, YCp50 etc.), Ti plasmids, etc., examples of phages include lambda phages, and examples of viral vectors include animal virus vectors such as retroviruses, vaccinia viruses, lentiviruses, adenoviruses, adeno-associated viruses, etc. And insect virus vectors such as baculovirus.

The vector may contain a polylinker or multicloning site for integrating the DNA of interest, and may contain several control elements to express the DNA. The control element includes, for example, a promoter, an enhancer, a poly A addition signal, a replication origin, a selection marker, a ribosome binding sequence, a terminator and the like.
Examples of selectable markers include drug resistance genes (e.g. neomycin resistance gene, ampicillin resistance gene, kanamycin resistance gene, puromycin resistance gene, etc.), auxotrophic complementary genes (e.g. dihydrofolate reductase (DHFR) gene, HIS3 gene, LEU2 gene) , URA3 gene, etc.].

The promoter may vary depending on the host cell.
Examples of host cells include, but are not limited to, bacteria such as Escherichia such as E. coli, Bacillus such as Bacillus subtilis, Pseudomonas such as Pseudomonas putida, Saccharomyces cerevisiae, Saccharomyces such as Schizosaccharomyces pombe And yeasts such as Candida and Pichia, animal cells such as CHO, COS, HEK293, NIH3T3 and NS0, insect cells such as Sf9 and Sf21, and plant cells.

When a bacterium such as E. coli is used as a host, examples of the promoter include trp promoter, lac promoter, PL or PR promoter.
When yeast is used as a host, examples of the promoter include gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter and the like.

When animal cells are used as hosts, examples of promoters include SRα promoter, SV40 promoter, LTR promoter, CMV promoter, human CMV early gene promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, metallothionein promoter, polyhedron promoter, etc. The
When plant cells are used as hosts, examples of promoters include CaMV promoter and TMV promoter.

Examples of transformation or transfection include electroporation method, spheroplast method, lithium acetate method, calcium phosphate method, Agrobacterium method, virus infection method, liposome method, microinjection method, gene gun method, lipofection method, etc. Can be mentioned.
The transformed host is cultured under culture conditions according to the types of bacteria, yeast, animal cells, and plant cells, and the target protein is recovered from the cells or from the culture solution.

In culture of microorganisms, a medium containing a carbon source, a nitrogen source, inorganic salts and the like that can be assimilated by the microorganism is used. As carbon sources, carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, alcohols such as ethanol and propanol, as nitrogen sources, ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium phosphate, etc. Inorganic acids, ammonium salts of organic acids, peptone, meat extract, corn steep liquor, etc., inorganic substances such as monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, Manganese sulfate, copper sulfate, calcium carbonate and the like are used.

In culturing animal cells, for example, a DMEM medium, RPMI1640 medium or the like is used as a basic medium, and a medium to which fetal calf serum (FCS) or the like is added is used.
As described above, the target protein can be recovered by conventional methods for protein purification, such as ammonium sulfate precipitation, organic solvent precipitation, dialysis, electrophoresis, chromatofocusing, gel filtration chromatography, ion exchange chromatography, affinity chromatography, It can be carried out by HPLC or the like.

When the vector is used for therapy, it is preferably a vector that is not integrated into the subject's genome and that infects cells but is unable to replicate, such as a non-viral vector. Such vectors include, for example, adeno-associated virus vectors, adenovirus vectors and the like. These vectors can include promoters, enhancers, polyadenylation sites, selectable markers, reporter genes, and the like. Examples of viral vectors are J. Virol. 67, 5911-5921 (1993), Human Gene Therapy, 5, 717-729 (1994), Gene Therapy, 1, 51-58 (1994), Human Gene Therapy, 5, 793-801 (1994), Gene Therapy, 1, 165-169 (1994) etc., or those improved vectors. Furthermore, an example of a non-viral vector is a human artificial chromosome vector, which is a vector composed of chromosome fragments containing human chromosome-derived centromeres and telomeres. The human chromosome fragment is not particularly limited, but includes, for example, human chromosome 14 fragment, human chromosome 21 fragment (International Publication No. WO2004 / 031385, JP 2007-295860, etc.). A method of inserting the nucleic acid as defined above into the vector and administering it to the bone part of the subject, or introducing the vector into a bone tissue or cell collected from the subject and returning it to the bone part of the subject, etc. The vector can be administered to the subject.
<Pharmaceutical composition>
The present invention further provides a composition for treating a bone disease comprising as an active ingredient a protein containing the extracellular domain of BMPR1B described above or a variant thereof, or a vector containing a nucleic acid encoding the protein.

The present invention also provides a method of treating a bone disease comprising administering the composition to a mammal.
In the present invention, the bone disease is a disease accompanied by a decrease in bone mass, bone density and / or bone strength. For example, osteoporosis, osteoarthritis, rheumatoid arthritis, malignant tumor {osteoclastoma, osteosarcoma, multiple occurrences Myeloma [Bone pain due to multiple myeloma is often found in the spinal cord and ribs and may be aggravated by exercise. If the same part hurts continuously, it may have caused a pathological fracture. If there is a lesion in the spine, it may cause spinal cord compression. In multiple myeloma, IL-6 is released by the expanded tumor cells. IL-6, also known as osteoclast activating factor (OAF), is involved in multiple myeloma because osteoclasts activated by IL-6 absorb and destroy bone. X-rays of the bones appear to have holes in the bones ("punched-out" resorptive lesions). In addition, bone destruction increases blood calcium concentration, resulting in hypercalcemia and various symptoms resulting therefrom. ]}, Hypercalcemia, Paget's disease of bone, Marble bone disease, Kamrachi-Engmann disease, Arthropathy, Primary hyperthyroidism, Osteopenia, Osteoporosis, Osteomalacia, Kur disease, Traumatic Includes bone diseases resulting from fractures, fatigue fractures, etc., and various bone diseases or disorders associated therewith. Osteoporosis includes primary osteoporosis and secondary (secondary) osteoporosis.Examples of primary osteoporosis include postmenopausal osteoporosis and senile osteoporosis, and secondary (secondary) osteoporosis causes include E.g. endocrine (hyperparathyroidism, hyperthyroidism, hypogonadism, Cushing syndrome, growth hormone deficiency, diabetes, Addison's disease, calcitonin deficiency, etc.), nutritional / metabolic [chronic debilitating disease, Ruizosis, severe liver disease (especially primary biliary cirrhosis), gastrectomy, scurvy, malabsorption syndrome (including celiac disease), hypophosphatemia, chronic kidney disease, idiopathic hypercalciuria, hemochroma Tosis, amyloidosis, mastocytoma, sodium overdose, calcium intake deficiency, vitamin D, A excess, etc.], inflammatory [rheumatoid arthritis, paraarticularity (increase bone resorption by inflammatory cytokines), Coidosis, etc.], immobility (systemic, bed rest, paralysis, locality, after fracture, etc.), drug-related [steroids (used widely in inflammatory diseases as immunosuppressive drugs. For diseases treated with steroids, Collagen disease, asthma, inflammatory bowel disease, organ transplantation, etc. Bone loss is a serious side effect of this therapy), methotrexate, heparin, warfarin, anti-keiren, lithium, tamoxifen, etc.], blood diseases [multiple occurrences Myeloma, lymphoma, leukemia, hemophilia, chronic hemolytic disease, etc.], congenital (such as osteogenesis imperfecta, Marfan syndrome, Kleinfelter syndrome, congenital myelogenous porphyria, cystic fibrosis), etc. Examples include diseases [chronic obstructive pulmonary disease, liver disease, kidney disease, rheumatoid arthritis, pregnancy, hyperoxia, HIV infection, etc.].

Further, in the present invention, the bone disease includes a bone disease caused by inhibition of only the calcification process, and examples thereof include Kur disease.
When the composition of the present invention is administered to a mammal having a bone disease, preferably a mammal having a disease accompanied by a decrease in bone mass, bone density and / or bone strength, the bone strength acts on the bone part. Increases quantity, bone density and / or bone strength, thereby enabling at least cancellous bone growth, diaphyseal thickening and proliferation, and the like.

The form (namely, preparation) of the composition of the present invention is not limited and includes both oral preparations and parenteral preparations. The preparation may contain other therapeutic agents for bone diseases in addition to the active ingredient of the present invention. Examples of such therapeutic agents include, but are not limited to, calcium preparations (calcium L-aspartate, calcium gluconate, calcium lactate, etc.), active vitamin D3 preparations (alpha-calcidol, calcitriol, etc.), Female hormone drugs (estriol, conjugated estrogens, etc.), calcitonin preparations (salmon calcitonin, elcatonin, etc.), vitamin K preparations (menatetrenone, etc.), bisphosphonate preparations (etidronate disodium, alendronate sodium hydrate, risedronate sodium) Hydrates, etc.), selective estrogen receptor modulators (such as raloxifene hydrochloride), ipriflavones, or anti-RANKL antibodies.

The other therapeutic agents described above can be administered to a mammal in combination with the composition of the present invention at the same time or sequentially in accordance with a treatment plan. Here, “continuously” means that another therapeutic agent may be administered after the composition of the present invention is administered, or the composition of the present invention is administered after the other therapeutic agent is administered. This means that the product may be administered, and that there is a time lag in the administration timing of both drugs. The term “simultaneously” means that the composition of the present invention and another therapeutic agent are administered at the same time, and in this case, the composition of the present invention contains another therapeutic agent to form one preparation. It may be configured.

Preferred forms are parenteral preparations, including but not limited to intravenous preparations, intramuscular preparations, intraperitoneal preparations, subcutaneous preparations, topical preparations and the like. Topical administration includes direct administration to the affected area such as skull, femur, sternum, vertebra, rib, etc., including active ingredients in artificial bone components such as hydroxyapatite. You may administer as a transplanted preparation made into the form. Examples of the preparation for parenteral administration include injections, drops, suppositories, transdermal absorption agents, liposomes, nanoparticle-encapsulated preparations, and the like.

Examples of oral preparations include tablets, pills, granules, capsules, powders, solutions, suspensions, delayed release preparations, enteric preparations and the like.
When the protein of the present invention is used as an active ingredient, the composition can contain a pharmaceutically acceptable excipient, a carrier such as a diluent, and an additive.
Carriers include, for example, saline, glycerol, ethanol, almond oil, vegetable oil, sucrose, starch, lactose and the like.

Additives include, for example, binders (for example, pregelatinized corn starch, hydroxypropylmethylcellulose, polyvinylpyrrolidone, etc.), lubricants (for example, magnesium stearate, talc, silica, etc.), dispersants (for example, polyvinylpyrrolidone, cornstarch, etc.) ), Suspension (e.g. talc, gum arabic etc.), emulsifier (e.g. lecithin, gum arabic etc.), disintegrant (potato starch, sodium starch glycolate, crospovidone etc.), buffer (e.g. phosphate, acetate) Citrate, tris salt, etc.), antioxidants (e.g., ascorbic acid, tocopherol, etc.), preservatives (e.g., sorbic acid, methyl p-hydroxybenzoate, propyl p-hydroxybenzoate, etc.), isotonic agents (e.g. For example, sodium chloride etc.), stabilizers (eg glycerol etc.) and the like can be included.

For enteric preparations, for example, polymers such as hydroxypropyl methylcellulose phthalate, methacrylic acid-methyl methacrylate copolymer, methacrylic acid-ethyl acrylate copolymer, hydroxypropyl acetate succinate are used.
The dosage of the pharmaceutical preparation should be appropriately determined according to the age, sex, weight, symptom, route of administration, etc. of the patient, and is not limited to the following, but for example, about 0.1 μg / kg to 100 mg / day for an adult. in the range of kg, preferably in the range of about 1 μg / kg to 10 mg / kg. The preparation may be administered every day during the treatment, or at intervals such as several days, two weeks, or one month.

Another active ingredient of the present invention is a vector comprising a nucleic acid encoding the extracellular domain protein of BMPR1B or a variant thereof.
Administration of this vector can be carried out in the same manner as the technique or technique used in gene therapy. The vector may be administered directly to the subject (in vivo method), or introduced into a cell collected from the subject, and the transformed cell expressing the desired BMPR1B extracellular domain is selected before the cell is used. It may be administered to a subject (ex vivo method). Gene delivery methods that can be used to administer the vector to the tissue or cell of interest include colloidal dispersion systems, liposome-derived systems, artificial virus envelopes, and the like. For example, the delivery system can use macromolecular complexes, nanocapsules, microspheres, beads, oil-in-water emulsions, micelles, mixed micelles, liposomes, and the like. Direct administration of the vector can be performed, for example, by intravenous injection (including infusion), intramuscular injection, intraperitoneal injection, subcutaneous injection, or the like. In addition, vector introduction (transformation) of a vector can be performed using a general gene introduction method such as a calcium phosphate method, a DEAE dextran method, an electroporation method, a lipofection method, or the like. The amount of the vector or transformant to be used varies depending on the administration route, the number of administrations, and the type of the subject, but can be appropriately determined using a method conventional in the art.
<Preparation of BMPR1B extracellular domain knock-in mouse>
The present invention has been found through a B cell-specific expression knock-in chimeric mouse for analyzing the in vivo function of the extracellular domain of BMPR1B and a method for producing the same.

BMPR1B extracellular domain knock-in chimeric mouse in the present invention Desirably, a fusion expression knock-in chimeric mouse of BMPR1B extracellular domain and Fc can be prepared, for example, according to an established method (International Publication No. WO2006 / 78072) it can. For example, in order to enable more efficient secretory expression in mouse B cells, the secretory signal sequence of BMPR1B is replaced with the secretory signal sequence of the mouse Igκ gene. When expressing a fusion with Fc described herein, it is preferable to use an Fc variant (hFcm) obtained by mutating a part of human IgG1-derived Fc to ADCC and CDC activity-reduced type. In addition, whether or not the nucleic acid (BMPR1B extracellular domain or a fusion of BMPR1B extracellular domain and hFcm) inserted in cells derived from knock-in ES cells is expressed is determined by RT-PCR using RNA derived from the cells Detection can be performed using Northern blotting and the like, and further, enzyme immunoassay (ELISA) using antibodies against the extracellular domain of BMPPR1B or hFcm, and Western blotting.

Human or mouse BMPR1B extracellular domain knock-in chimeric mouse, human or mouse BMPR1B extracellular domain and hFcm fusion expression knock-in chimeric mouse, and foreign cDNA expression unit is not inserted or only hFcm expression unit Control chimera mice produced using the inserted ES cells are subjected to pathological analysis, immunohistochemical analysis, serum biochemical examination, blood cell component measurement, etc. of each tissue, resulting from the expression of the BMPR1B extracellular domain Identify changes. In Example 3, which will be described later, as compared with the control chimeric mouse, the mouse BMPR1B extracellular domain knock-in chimeric mouse has a phenotype that is whitening of the femur and whitening of the sternum from Example 3-1. -2 increased thickness of femoral diaphyseal wall, increased cancellous bone, and increased cancellous bone of sternum, increased unit bone mass of tibia, number of osteoblasts, osteoblast surface, osteoids than Example 3-3 Increase in amount, increase in calcification rate / calcification surface / bone formation rate, and decrease in osteoclast number / osteoclast surface, increase of cortical bone cross-sectional area of femur from Example 3-4 From Example 3-5, an increase in the maximum load on the femur was observed.

Hereinafter, the present invention will be specifically described with reference to examples. However, the scope of the present invention is not limited by these examples.

Production of USmBMPR1B-hFcm KI chimeric mouse According to the method described in the Examples of International Publication No.WO2006 / 78072 pamphlet, mouse BMPR1B-cDNA (1509 bp including stop codon from start codon, SEQ ID NO: 4) and human IgG1Fc variant-cDNA ( A pUSmBMPR1B-hFcm KI vector was prepared from a linker sequence inserted for binding to the extracellular domain of BMPR1B from 702 bp including a stop codon, SEQ ID NO: 7).

Below, the mouse BMPR1B extracellular domain in SEQ ID NO: 5 and the downstream region from the extracellular domain including the transmembrane region are indicated by a boxed line and a double underline based on the information of GenBank accession numbers NM_007560.3 and NP_031586.1, respectively. Show.
SEQ ID NO: 5

The amino acid sequence encoded by SEQ ID NO: 5 (502 amino acids, SEQ ID NO: 6) is shown below.
SEQ ID NO: 6

The cDNA sequence and amino acid sequence of human IgG1-derived Fc variant (hFcm) are shown in SEQ ID NOs: 7 and 8, respectively. Known information [Tawara, T., et al., J. Immunology, 180, 2294-2298 (2008), Gross, JA, et al., Immunity, 15, 289-302 (2001), WO02 / 094852 pamphlet], the original cDNA sequence derived from human IgG1-derived Fc region, and the amino acid sequence portion mutated in order to change to ADCC activity-reduced type (the amino acid before and after the mutation is described from the N-terminal side. 20th from the N-terminus of the sequence described in No. 8: L → A, 21st from the N-terminus: L → E, 23rd from the N-terminus: G → A) is double underlined to change to a CDC activity-reduced type Enclosed cDNA and amino acid sequence portion (indicate the amino acid sequence before and after mutation. 108th from the N-terminal of the sequence shown in SEQ ID NO: 8: K → A, 117th from the N-terminal: P → S) with a box. The linker sequence (including the SfoI recognition sequence) added to the 5 ′ end of the original human IgG1-derived Fc sequence for binding to the C-terminal amino acid of the extracellular domain of BMPR1B is underlined. From known information [Gross, JA, et al., Immunity, 15, 289-302 (2001)], in order to change to a CDC activity-reduced type other than the above method, the 116th position from the N-terminal of the sequence described in SEQ ID NO: 8 It is also possible to mutate A to S.
SEQ ID NO: 7

The amino acid sequence encoded by SEQ ID NO: 7 (233 amino acids, SEQ ID NO: 8) is shown below.
SEQ ID NO: 8

The polynucleotide sequence from the start codon to the stop codon of the pUSmBMPR1B-hFcm KI vector expression unit [SEQ ID NO: 9: mouse Igκ signal sequence including intron region (underlined) downstream from 1378 bp including mouse BMPR1B-hFcm sequence Composed. The boxed portion indicates the mouse BMPR1B extracellular domain, the double-line portion indicates hFcm], and the amino acid sequence encoded by the cDNA (SEQ ID NO: 10: 378 amino acids. The underlined portion is the mouse Igκ signal sequence, the boxed portion. Indicates mouse BMPR1B extracellular domain, double underlined portion indicates hFcm). Mouse Igκ signal sequence information including the intron region was obtained from the UCSC mouse genome database based on MUSIGKVR1 (accession number K02159) obtained from GenBank.
SEQ ID NO: 9

SEQ ID NO: 10

USmBMPR1B-hFcm KI chimeric mouse that expresses a fusion of mouse BMPR1B extracellular domain and human Fcm in a B cell-specific manner using the pUSmBMPR1B-hFcm KI vector according to the method described in the examples of the pamphlet of International Publication No. WO2006 / 78072 Was made.

Confirmation of expression of fusion of mouse BMPR1B extracellular domain and human Fc mutant in USmBMPR1B-hFcm KI chimeric mouse 16-week-old USmBMPR1B-hFcm KI chimeric mouse (6 females, 4 males) serum prepared in Example 1 The fusion of the mouse BMPR1B extracellular domain present in human Fc variants was detected by ELISA.

96-well immobilized Anti-Human IgG (γ-Chain Specific, SIGMA, product number: I3382) to measure the serum concentration of fusion of mouse BMPR1B extracellular domain and human Fc variant by ELISA Add the evaluation sample or control sample (Recombinant Mouse Frizzled-7 / Fc Chimera, R & D systems, product number: 198-FZ) to the plate (Nunc, Maxi Soap), and incubate for 30 minutes at room temperature. The washing operation was performed three times with (-), and the peroxidase-labeled antibody Anti-Human IgG (Fc fragment) Peroxidase conjugate developed in Goat (SIGMA, product number: A0170) was added and incubated at room temperature for 30 minutes. Then, after washing operation 4 times with T-PBS (-), color was developed using Sumilon peroxidase coloring kit (Sumitomo Bakelite Co., Ltd., product number: ML-1120T), and absorbance at 450 nm was measured. Recombinant Mouse Frizzled-7 / Fc (molecular weight calculated from amino acid sequence: 43.5 kDa) and mouse BMPR1B-hFcm (molecular weight calculated from amino acid sequence: 39.9 kDa) to values obtained using Recombinant Mouse Frizzled-7 / Fc as a standard ) And the molecular weight ratio (0.92) were integrated to measure the serum concentration of the fusion of mouse BMPR1B extracellular domain and human Fc variant.

As a result, the average concentration of 6 females is 297 μg / ml, the average concentration of 4 males is 321 μg / ml, and the results of measurement using serum derived from control individuals are all below the detection limit for 10 females and 10 males. Met.
These results suggest that the mouse BMPR1B extracellular domain and human Fc mutant are expressed in vivo and circulate in the blood.

Analysis of USmBMPR1B-hFcm KI chimeric mice
3-1. Autopsy findings Using the USmBMPR1B-hFcm KI chimeric mouse prepared in Example 1 above, an autopsy (6 females, 4 males) was performed at 16 weeks of age, and the femur and sternum were observed. . As a result, as a characteristic change, whitening of the femur and whitening of the sternum were observed in the USmBMPR1B-hFcm KI chimeric mouse compared to the control mice (5 females, 5 males). The number of individuals in which changes were observed is described below.
3-1-1. Femur Of USmBMPR1B-hFcm KI chimeric mice subjected to necropsy, whitening was observed in 2 mice and slightly whitening was observed in 4 mice compared to the control group (10 individuals).
3-1-2. Sternum Among 10 USmBMPR1B-hFcm KI chimeric mice subjected to necropsy, whitening was observed in 4 mice and whitening was observed slightly in 1 individual compared to the control group (10 individuals).

These results indicate that femoral whitening and sternum whitening may be caused by overexpression of mouse BMPR1B extracellular domain-human Fc mutant.
3-2. Pathological Findings USmBMPR1B-hFcm from observation of 10-week-old control chimeric mice and USmBMPR1B-hFcm KI chimeric mice from 10 femurs and sternum using Hematoxylin-Eosin (H & E) stained pathological sections In KI chimeric mice, thickening of the diaphyseal wall thickness of the femur (Table 1), an increase in cancellous bone (FIG. 1), and an increase in cancellous bone in the sternum were observed compared to control mice. The number of individuals in which each change was observed is described below.
3-2-1. Femur An increase in cancellous bone was observed in 7 of 10 USmBMPR1B-hFcm KI chimeric mice compared to 10 control mice subjected to necropsy. Furthermore, as a result of measuring the diaphyseal wall thickness for the cross section at three points of the femur (30%, 50%, and 80% from the proximal end), the minimum diaphyseal wall thickness of 30% from the proximal end and the 50% point The maximum and minimum diaphyseal wall thickness values were higher than the controls (Table 1).

3-2-2. Sternum Increased cancellous bone was observed in 5 out of 10 USmBMPR1B-hFcm KI chimeric mice compared to 10 control mice subjected to necropsy.
From these results, it was suggested that thickening of the femoral diaphysis wall thickness and cancellous bone increase and cancellous bone increase in the sternum were caused by overexpression of the mouse BMPR1B extracellular domain-human Fc mutant.
3-3. Bone morphology measurement of tibia using 16-week-old USmBMPR1B-hFcm KI chimeric mice
3-3-1. Bone morphology measurement Before autopsy, in order to obtain each data of calcification rate, calcification surface, bone formation rate, sodium bicarbonate (Kanto Chemical Co., Ltd., product number: 37116-00) A calcein solution (calcium chelator) prepared by dissolving calcein (Donjin Chemical Co., Ltd., product number: 340-00433) in a 2% aqueous solution was subcutaneously administered at a dose of 16 mg / kg. The calcein solution was administered 6 days before and 1 day before necropsy. At necropsy, the tibia was collected and a non-decalcified slice of the tibia was prepared, and then toluidine blue staining (TB staining), alkaline phosphatase staining (ALP staining), and tartrate-resistant acid phosphatase (TRAP staining) were performed. In order to prepare a sliced specimen, the tibial sample was previously embedded with GMA (Glycolmethacrylate) resin. Unit bone mass (BV / TV), which is a parameter related to bone structure, and the number of osteoblasts (Ob. .Pm), osteoblast surface (Ob.S / BS), osteoid mass (OV / BV), mineralization rate (MAR), mineralization surface (MS / BS), bone formation rate (BFR / BS), The number of osteoclasts (Oc.N / B.Pm) and osteoclast surface (Oc.S / BS), which are parameters related to bone resorption, were measured.
3-3-2. Unit bone mass As a result of measuring unit bone mass using tibial samples derived from 6 control mice and 6 USmBMPR1B-hFcm KI chimeric mice that were necropsied at 16 weeks of age (female individuals), control individuals As the unit bone mass (mean value) of USmBMPR1B-hFcm KI chimeric mice increased compared to the group, the increase in unit bone mass of the secondary cancellous bone of the tibia metaphysis was caused by mouse BMPR1B extracellular domain-human Fc It was suggested that it was caused by overexpression of the mutant (Table 2).
3-3-3. Number of osteoblasts, osteoblast surface, and osteoid mass Using tibial samples from six control mice and six USmBMPR1B-hFcm KI chimeric mice that were necropsied at 16 weeks of age (female individuals) As a result of measuring the number of osteoblasts, osteoblast surface, and osteoid mass, an increase (average value) in the USmBMPR1B-hFcm KI chimeric mouse population was observed in all items compared to the control population. The increase in osteoblast number, osteoblast surface, and osteoid mass in the cancellous secondary cancellous bone was possibly caused by overexpression of mouse BMPR1B extracellular domain-human Fc mutant (Table 2). ).

3-3-4 Calcification rate, calcification surface, bone formation rate Calcification rate using tibia from 6 control mice, 6 USmBMPR1B-hFcm KI chimeric mice, autopsy performed at 16 weeks of age (female individuals) As a result of measuring the calcification surface and bone formation rate, the calcification rate, calcification surface and bone formation rate of the USmBMPR1B-hFcm KI chimeric mouse population increased (average value) compared to the control population, It was suggested that calcification of the secondary cancellous bone of the tibial metaphysis was promoted by overexpression of mouse BMPR1B extracellular domain-human Fc variant (Table 3).
3-3-5. Osteoclast number / osteoclast surface The number of osteoclasts using the tibia derived from 6 control mice and 6 USmBMPR1B-hFcm KI chimeric mice that were necropsied at 16 weeks of age (female individuals) As a result of measuring the osteoclast surface, all of them decreased (average value) compared to the control population, so the number of osteoclasts and osteoclast surface of the secondary cancellous part of the tibial metaphysis were the mouse BMPR1B extracellular domain- The possibility that it was decreased by overexpression of human Fc mutant was shown (Table 3).

3-4. Measurement of the cortical bone cross-sectional area of the femur At the autopsy, the femur was collected, 2D micro CT imaging was performed at a point 50% from the proximal end, and the cortical bone cross-sectional area at the 50% point was measured from the proximal end.
As a result of measuring the cortical bone cross-sectional area using 6 femurs derived from 6 control mice and 6 USmBMPR1B-hFcm KI chimeric mice subjected to necropsy at 16 weeks of age (female individuals), USmBMPR1B- The increase in the mean value of the hFcm KI chimeric mouse population indicated that femoral cortical cross-sectional area increase may be caused by overexpression of mouse BMPR1B extracellular domain-human Fc mutant (Table 4). ).

3-5. Measurement of femoral bone strength At autopsy, femurs were collected and subjected to a three-point bending test. In the test, the distance between fulcrums was 6 mm, and the maximum load (N) was measured by applying a load to the midpoint.
As a result of measuring the maximum load using the femur from six control mice and six USmBMPR1B-hFcm KI chimeric mice that were necropsied at 16 weeks of age (female individuals), the USmBMPR1B-hFcm KI chimeric mouse individuals compared to the control population Increased group values indicated that the maximum femoral load increase could be caused by overexpression of the mouse BMPR1B extracellular domain-human Fc variant (Table 5).

Expression and preparation of mBMPR1B-hFcm recombinant
4-1. Construction of mBMPR1B-hFcm recombinant expression vector 4-1-1. Construction of pLN1V5 vector BamHI / NheI / SalI site at 5 'end and XhoI site at 3' end (V5 tag + Stop codon) A sense oligo DNA (V5S) and an antisense oligo DNA (V5AS) against it were synthesized.
V5S: GATCCGCTAGCGTCGACGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTGAC
(SEQ ID NO: 11)
V5AS: TCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGTCGACGCTAGCG
(SEQ ID NO: 12)
The synthetic oligo DNA was introduced into the BamHI-XhoI site on the pLN1 vector described in the report of Kakeda et al. [Gene Ther., 12, 852-856 (2005)] to construct a pLN1V5 vector.
4-1-2.mBMPR1B-hFcm DNA fragment synthesis
BamHI-kozak-kSP-Fw: CGGGATCCACCATGGAGACAGACAC
(SEQ ID NO: 13)
hFc-NotI-Rv: ATAGTTTAGCGGCCGCTCATTTACCCGGAGACAGG
(SEQ ID NO: 14)
The following is a polynucleotide sequence (1378 bp, SEQ ID NO: 9) from the start codon to the stop codon of cDNA of mBMPR1B-hFcm recombinant, and an amino acid sequence (378 amino acids, sequence) including the signal sequence of mBMPR1B-hFcm encoded by the cDNA The number 10) is shown.
SEQ ID NO: 9

SEQ ID NO: 10
METDTLLLWVLLLWVPGSTGLLRSSGKLNVGTKKEDGESTAPTPRPKILRCKCHHHCPEDSVNNICSTDGYCFTMIEEDDSGMPVVTSGCLGLEGSDFQCRDTPIPHQRRSIECCTERNECNKDLHPTLPPLKDRDFVDGPIHHKAEPRSSDKTHTCPPCPAPEAEGAPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCAVSNKALPASIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK
Prepare a reaction solution using Prime STAR HS DNA Polymerase (Takara Bio Inc.) according to the package insert, and add 10 pmol of each of the primers of SEQ ID NOs: 13 and 14 in a 50 μL reaction solution and mouse BMPR1B-hFcm cDNA (SEQ ID NO: 9) as a template. Add and incubate at 98 ° C for 1 minute, then amplify for 30 cycles with 98 ° C for 10 seconds, 62 ° C for 5 seconds, and 72 ° C for 1 minute and 30 seconds, and separate the resulting 1405 bp amplified fragment on a 0.8% gel It was collected. The amplified fragment (BamHI mBMPR1B hFcm NotI) was recovered from the recovered gel using QIAquick Gel Extraction Kit (Qiagen) according to the package insert.
4-1-3. Construction of mBMPR1B-hFcm recombinant expression vector The PCR-amplified fragment recovered in Example 4-1-2 was enzymatically digested with BamHI and NotI (Roche Diagnostics), and separated and recovered on a 0.8% agarose gel. . The enzyme-treated fragment was recovered from the recovered gel using a QIAquick Gel Extraction Extraction Kit (Qiagen) according to the package insert. A vector in which NotI site was added to the pLN1V5 vector prepared in Example 4-1-1 was prepared, the enzyme-treated fragment obtained above was introduced into the BamHI / NotI site, and the mBMPR1B-hFcm recombinant expression vector ( Fig. 2) was constructed.
4-2. Transient expression of mBMPR1B-hFcm recombinant using mBMPR1B-hFcm recombinant expression vector
4-2-1. Preparation of expression vector for gene introduction The mBMPR1B-hFcm recombinant expression vector obtained in Example 4-1-3 is introduced into Escherichia coli DH5α, and DNA is purified from the resulting transformant using a plasmid purification kit. (Qiagen plasmid Maxi kit, Qiagen).
4-2-2. Vector introduction and secretory expression into cultured cells Free style 293F cells (Invitrogen) were used with Freestyle 293 Expression Medium (Invitrogen) at 37 ° C, 5% CO ₂ , 125 rpm, cell density Was cultured in the range of 2 × 10 ⁵ to 3 × 10 ⁶ cells / mL. When cultured in 1 L of medium, 13.7 mg of expression vector and 35 mL of Opti-MEM I Reduced Serum Medium (Invitrogen) and 1.3 mL of 293 fectin Transfection Reagent 33.7 mL of Opti-MEM I Reduced Serum Medium Each solution was prepared and incubated at room temperature for 5 minutes. After incubation, the two solutions were mixed and incubated for another 20-30 minutes at room temperature. Thereafter, the expression vector treated by the above method was added to a medium containing 1 × 10 ⁹ cells / L of Free style 293F cells and cultured for 3 days.
4-3 Purification and preparation of recombinant mBMPR1B-hFcm
4-3-1. Pretreatment of culture supernatant The supernatant of the culture solution obtained in Example 4-2-2 is collected and filtered with a 0.22 μm filter (Fast PES Filter Unit, 1000 mL, Nalgen Nunk International). And then cooled at 4 ° C. When stored frozen, it was again filtered through a 0.22 μm filter after thawing.
4-3-2. Affinity Chromatography The composition of the acidic buffer (pH 2.7) used was 1.24 g of boric acid (Nacalai Tesque), disodium hydrogen phosphate / 12 water (Wako Pure Chemical Industries) 7.16 g, citric acid Dissolve monohydrate (Nacalai Tesque) 4.20g and sodium chloride (Pure Chemical Co., Ltd.) 8.77g in Milli-Q water and dilute 1mol / L hydrochloric acid [12mol / L Hydrochloric acid (Pure Chemical Co., Ltd.) 12 times with Milli-Q water Solution] was added to 15.55 mL and made up to 1 L with milli-Q water.

The composition of the neutral buffer (pH 7.3) used was 1.24 g of boric acid (Nacalai Tesque), 7.16 g of disodium hydrogen phosphate and 12 water (Wako Pure Chemical Industries), citric acid monohydrate (Nacalai Tesque) ) 4.20g, 8.77g of sodium chloride (Pure Chemical Co., Ltd.) dissolved in Milli-Q water, 5mol / L sodium hydroxide solution [Sodium hydroxide (Pure Chemical Co., Ltd.) 10g dissolved in Milli-Q water to make 50mL] 11.7 Add mL and make up to 1 L with Milli-Q water.

The composition of the neutralization buffer used was 13.1 g of sodium dihydrogen phosphate dihydrate (Kanto Chemical Co., Ltd.) and 41.5 g of disodium hydrogen phosphate / 12 water (Wako Pure Chemical Industries, Ltd.) dissolved in milli-Q water. 1L.
The pretreated culture supernatant was applied to a Protein A column (Hi Trap Protein A HP 1 mL, GE Healthcare Bioscience) equilibrated with a neutral buffer (pH 7.3). Then, the column is washed with 10 mL or more of neutral buffer (pH 7.3), then washed with 10 mL or more of the buffer prepared by adding sodium chloride to PBS to adjust the sodium chloride concentration to 1.85 mol / L, and again in 15 mL. The column was washed with a neutral buffer (pH 7.3). Thereafter, 5 mL of the column was washed with 20% acidic buffer (pH 2.7). After completion of the washing operation, 40 mL of acidic buffer (pH 2.7) was added to the column with a gradient of 20% to 100% to recover the target protein. AKTAexplorer10s (GE Healthcare Bioscience) was used for the separation and purification operation. Endotoxin removal treatment was performed before use.
4-3-3. Preparation of purified sample The purified sample obtained in Example 4-3-2 was concentrated using an ultrafiltration membrane VIVASPIN20 10,000 MWCO PES (Sartorius Stedim Japan). Then, it replaced with PBS using NAP-25Columns (GE Healthcare Bioscience). After completion of the concentration and replacement operation, filtration was performed with a 0.22 μm filter (Millex GV, Nihon Millipore). Concentration operation was performed in a clean bench as much as possible. All steps performed in Example 4-3 were performed in a cold room (4 ° C.) or on ice, except for work on a clean bench.

From the final purified product, SDS-PAGE (CBB staining), a monomer was detected under reducing conditions, and a dimer was detected under non-reducing conditions (FIG. 3).
The protein concentration was measured from A280 nm and calculated from the specific extinction coefficient (E1%, 1 cm = 8.2).

Production of UShBMPR1B-hFcm KI chimeric mouse According to the method described in the examples of International Publication No.WO2006 / 78072 pamphlet, human BMPR1B-cDNA (1509 bp including the stop codon from start codon, SEQ ID NO: 15) and human IgG1Fc variant-cDNA ( A pUShBMPR1B-hFcm KI vector is prepared from a linker sequence inserted for binding to the extracellular domain of BMPR1B from 702 bp including a stop codon and SEQ ID NO: 7).

Below, the human BMPR1B extracellular domain in SEQ ID NO: 15 and the downstream region from the extracellular domain including the transmembrane region are indicated by a boxed line and a double underline based on the information of GenBank accession numbers NM_001203.2 and NP_001194.1, respectively. Show.
SEQ ID NO: 15

The amino acid sequence encoded by SEQ ID NO: 15 (502 amino acids, SEQ ID NO: 16) is shown below.
SEQ ID NO: 16

The cDNA sequence and amino acid sequence of human IgG1-derived Fc variant (hFcm) are shown in SEQ ID NOs: 7 and 8, respectively. Known information [Tawara, T., et al., J. Immunology, 180, 2294-2298 (2008), Gross, JA, et al., Immunity, 15, 289-302 (2001), WO02 / 094852 pamphlet] of the original human IgG1-derived Fc region sequence, which was mutated to change to ADCC activity-reduced type and the amino acid sequence portion (the amino acid before and after mutation from the N-terminal side is described. 20th from the N-terminus of the sequence described in No. 8: L → A, 21st from the N-terminus: L → E, 23rd from the N-terminus: G → A) is double underlined to change to a CDC activity-reduced type Enclosed cDNA and amino acid sequence portion (indicate the amino acid sequence before and after mutation. 108th from the N-terminal of the sequence shown in SEQ ID NO: 8: K → A, 117th from the N-terminal: P → S) with a box. The linker sequence (including the SfoI recognition sequence) added to the 5 ′ end of the original human IgG1-derived Fc sequence for binding to the C-terminal amino acid of the extracellular domain of BMPR1B is underlined. From known information [Gross, JA, et al., Immunity, 15, 289-302 (2001)], in order to change to a CDC activity-reduced type other than the above method, the 116th position from the N-terminal of the sequence described in SEQ ID NO: 8 It is also possible to mutate A to S.
SEQ ID NO: 7

The amino acid sequence encoded by SEQ ID NO: 7 (233 amino acids, SEQ ID NO: 8) is shown below.
SEQ ID NO: 8

The polynucleotide sequence from the start codon to the stop codon of the pUShBMPR1B-hFcm KI vector expression unit (SEQ ID NO: 17: mouse Igκ signal sequence including the intron region (underlined part) downstream from 1342 bp including the human BMPR1B-hFcm sequence Composed. The boxed line part is the human BMPR1B extracellular domain, the double line part is hFcm], and the amino acid sequence encoded by the cDNA (SEQ ID NO: 18: 366 amino acids. The underlined part is the mouse Igκ signal sequence, the part of the boxed line Indicates the human BMPR1B extracellular domain, and the double underlined portion indicates hFcm). Mouse Igκ signal sequence information including the intron region is obtained from the UCSC mouse genome database based on MUSIGKVR1 (accession number K02159) obtained from GenBank.
SEQ ID NO: 17

SEQ ID NO: 18

UShBMPR1B-hFcm KI chimeric mouse that expresses a fusion of human BMPR1B extracellular domain and human Fcm in a B cell-specific manner using the pUShBMPR1B-hFcm KI vector according to the method described in the examples of the pamphlet of International Publication No. WO2006 / 78072 Is made.

Construction of hBMPR1B-hFcm recombinant expression vector
6-1-1.Construction of pLN1V5 vector Sense oligo DNA (V5S) with BamHI / NheI / SalI site at the 5 ′ end and XhoI site at the 3 ′ end (V5 tag + Stop codon) and its antisense oligo DNA ( Synthesize V5AS).
V5S: GATCCGCTAGCGTCGACGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGTGAC
(SEQ ID NO: 11)
V5AS: TCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGTCGACGCTAGCG
(SEQ ID NO: 12)
The synthetic oligo DNA is introduced into the BamHI-XhoI site on the pLN1 vector described in the report by Kakeda et al. [Gene Ther., 12, 852-856 (2005)] to construct the pLN1V5 vector.
6-1-2.Synthesis of hBMPR1B-hFcm DNA fragment
BamHI-kozak-kSP-Fw: CGGGATCCACCATGGAGACAGACAC
(SEQ ID NO: 13)
hFc-NotI-Rv: ATAGTTTAGCGGCCGCTCATTTACCCGGAGACAGG
(SEQ ID NO: 14)
The polynucleotide sequence from the start codon to the stop codon of the cDNA of hBMPR1B-hFcm recombinant (1342 bp, SEQ ID NO: 17) and the amino acid sequence of hBMPR1B-hFcm encoded by the cDNA (366 amino acids, SEQ ID NO: 18) are shown below. .
SEQ ID NO: 17

SEQ ID NO: 18
METDTLLLWVLLLWVPGSTGKKEDGESTAPTPRPKVLRCKCHHHCPEDSVNNICSTDGYCFTMIEEDDSGLPVVTSGCLGLEGSDFQCRDTPIPHQRRSIECCTERNECNKDLHPTLPPLKNRDFVDGPIHHRAEPRSSDKTHTCPPCPAPEAEGAPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCAVSNKALPASIEKTISKAKGQPREPQVYTLPPSRDELTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGK
Prepare a reaction solution using Prime STAR HS DNA Polymerase (Takara Bio Inc.) according to the package insert, and add 10 pmol each of the primers of SEQ ID NOs: 13 and 14 in a 50 μL reaction solution, and human BMPR1B-hFcm cDNA (SEQ ID NO: 17) as a template. Add and incubate at 98 ° C for 1 minute, then amplify for 30 cycles with 98 ° C for 10 seconds, 62 ° C for 5 seconds, and 72 ° C for 1 minute and 30 seconds, and separate the resulting 1369 bp amplified fragment on a 0.8% gel to recover. From the recovered gel, an amplified fragment (BamHI hBMPR1B hFcm NotI) is recovered using the QIAquick Gel Extraction Kit (Qiagen) according to the package insert.
6-1-3. Construction of hBMPR1B-hFcm recombinant expression vector The PCR-amplified fragment recovered in Example 6-1-2 was enzymatically digested with BamHI and NotI (Roche Diagnostics), 0.8% Separate and collect on an agarose gel. Using the QIAquick Gel Extraction Extraction Kit (Qiagen), collect the enzyme-treated fragments from the collected gel according to the package insert. A vector in which NotI site was added to the pLN1V5 vector prepared in Example 6-1-1 was prepared, the enzyme-treated fragment obtained above was introduced into the BamHI / NotI site, and the hBMPR1B-hFcm recombinant expression vector ( Fig. 4) is constructed.
6-2. Transient expression of hBMPR1B-hFcm recombinant using hBMPR1B-hFcm recombinant expression vector
6-2-1. Preparation of expression vector for gene introduction The hBMPR1B-hFcm recombinant expression vector obtained in Example 6-1-3 was introduced into Escherichia coli DH5α, and the plasmid was purified from the resulting transformant using a plasmid purification kit. (Qiagen plasmid Maxi kit, Qiagen).
6-2-2. Vector introduction and secretory expression into cultured cells Using Freestyle 293F cells (Invitrogen) with Freestyle 293 Expression Medium (Invitrogen), cell density under conditions of 37 ° C, 5% CO ₂ , 125 rpm Incubate in the range of 2x10 ⁵ to 3x10 ⁶ cells / mL. When cultured in 1 L of medium, 13.7 mg of expression vector and 35 mL of Opti-MEM I Reduced Serum Medium (Invitrogen) and 1.3 mL of 293 fectin Transfection Reagent 33.7 mL of Opti-MEM I Reduced Serum Medium Prepare each solution with, and incubate for 5 minutes at room temperature. After incubation, mix the two solutions and incubate for an additional 20-30 minutes at room temperature. Thereafter, the expression vector treated by the above method is added to a medium containing 1 × 10 ⁹ cells / L of Free style 293F cells and cultured for 3 days.
6-3.Purification and preparation of recombinant hBMPR1B-hFcm
6-3-1. Pretreatment of culture supernatant The supernatant of the culture solution obtained in Example 6-2-2 was collected and filtered with a 0.22 μm filter (Fast PES Filter Unit, 1000 mL, Nargen Nunk International). And cool at 4 ° C. If frozen, thaw and then filter again through a 0.22 μm filter.
6-3-2. Affinity Chromatography The composition of the acidic buffer (pH 2.7) used was 1.24 g of boric acid (Nacalai Tesque), disodium hydrogen phosphate and 12 water (Wako Pure Chemical Industries, Ltd.) 7.16 g, citric acid Hydrate (Nacalai Tesque) 4.20 g, Sodium chloride (Junsei) 8.77 g dissolved in Milli-Q water, 1 mol / L hydrochloric acid [12 mol / L (Junsei)) diluted 12 times with Milli-Q water ] Add 15.55mL and make up to 1L with Milli-Q water.

The composition of the neutral buffer (pH 7.3) used was 1.24 g of boric acid (Nacalai Tesque), 7.16 g of disodium hydrogen phosphate and 12 water (Wako Pure Chemical Industries, Ltd.), citric acid monohydrate (Nacalai Tesque) 4.20g, 8.77g of sodium chloride (Pure Chemical Co., Ltd.) dissolved in Milli-Q water, 5mol / L sodium hydroxide solution [Sodium hydroxide (Wako Pure Chemical Industries) 10g dissolved in Milli-Q water to make 50mL] Add 11.7mL and make 1L with Milli-Q water.

The composition of the neutralization buffer used is sodium dihydrogen phosphate dihydrate (Kanto Chemical Co., Ltd.) 13.1 g and disodium hydrogen phosphate-12 water (Wako Pure Chemical Industries, Ltd.) 41.5 g dissolved in Milli-Q water, 1 L It is what.
The pretreated culture supernatant is applied to a Protein A column (Hi Trap Protein A HP 1 mL, GE Healthcare Bioscience) equilibrated with neutral buffer (pH 7.3). After that, wash the column with 10 mL or more of neutral buffer (pH 7.3), then wash with 10 mL or more of the buffer prepared by adding sodium chloride to PBS to adjust the sodium chloride concentration to 1.85 mol / L, and again 15 mL neutral. Wash the column with buffer (pH 7.3). Thereafter, the column is washed with 5 mL with 20% acidic buffer (pH 2.7). After the washing operation is completed, 40 mL of acidic buffer (pH 2.7) is added to the column in a gradient of 20% to 100% to recover the target protein. For the separation and purification operation, AKTAexplorer10s (GE Healthcare Bioscience Co., Ltd.) is used. Perform endotoxin removal treatment before use.
6-3-3. Preparation of purified sample The purified sample obtained in Example 6-3-2 is concentrated using an ultrafiltration membrane VIVASPIN20 10,000 MWCO PES (Sartorius Stedim Japan). After that, it is replaced with PBS using NAP-25Columns (GE Healthcare Bioscience). After completion of the concentration and replacement operation, filtration is performed with a 0.22 μm filter (Millex GV, Nihon Millipore). Concentrate as much as possible in a clean bench. All steps performed in Example 6-3 are performed in a cold room (4 ° C.) or on ice, except for work on a clean bench.

From the final purified product, SDS-PAGE (CBB staining), a monomer is detected under reducing conditions and a dimer is detected under non-reducing conditions.
The protein concentration is calculated from the specific extinction coefficient (E1%, 1 cm = 8.5) by measuring A280 nm.

Analysis of mBMPR1B-hFcm recombinant mice
7-1. Administration to normal mice
In order to evaluate the physiological effect on the bone tissue by the recombinant mouse BMPR1B-hFcm (mBMPR1B-hFcm), a mouse administration experiment was conducted. Mice were introduced with C57BL / 6 (Charles River Japan) at 7 weeks of age, and after habituation, tests were conducted from the age of 8 weeks. The mBMPR1B-hFcm recombinant prepared by the method described in Example 4 was used as a test substance. The group composition consists of three groups: vehicle administration group (PBS group), mBMPR1B-hFcm 3 mg / kg administration group, mBMPR1B-hFcm 30 mg / kg administration group, each of the administration substances three times at a frequency of once every 10 days, It was administered via the tail vein. The first administration day was Day 0, and the mice were subjected to necropsy on Day 30, 10 days after the third administration.
7-2. Bone structure analysis The tissue of the femur was collected at autopsy and fixed with 70% ethanol to prepare a sample for bone structure analysis.
For specimens from 5 individuals in the PBS group, 8 individuals in the mBMPR1B-hFcm 3 mg / kg administration group, and 5 individuals in the mBMPR1B-hFcm 30 mg / kg administration group that were necropsied, using the SKYSCAN 1174 (SkyScan desktop micro CT scanner) Bone density (BMD) in cancellous bone and bone mass (BV) in cortical bone were measured. As a result, it was shown that the mBMPR1B-hFcm recombinant administration group increased in a dose-dependent manner compared with the PBS group (FIGS. 5 and 6). Thus, mBMPR1B-hFcm was shown to have an activity to increase bone density by increasing bone mass.

8-1. Breast cancer bone metastasis model mouse preparation mouse Breast cancer bone metastasis model mouse was prepared for the purpose of evaluating the efficacy of recombinant BMPR1B-hFcm (mBMPR1B-hFcm) as a treatment for cancerous bone lesions (bone metastasis). . The breast cancer bone metastasis model is a female SCID mouse (6 weeks old, CB17 / Icr-Prkdc <scid> / CrlCrlJ Japan Charles River) according to a known method (Clin Cancer Res 2009; 15 (11) June 1 3751-3759). It was prepared by inoculating the left ventricle with 0.1 mL of human breast cancer cell line MDA-MB-231 cells (5 × 10 ⁶ cells / mL).
8-2. Analysis of bone marrow model mice with mBMPR1B-hFcm recombinant breast cancer
8-2-1 Administration to breast cancer bone metastasis model mice From the next day after cancer cell transplantation, mBMPR1B-hFcm recombinants have a medicinal effect on bone destruction caused by bone metastasis. Administration was performed for the purpose of evaluation. The mBMPR1B-hFcm recombinant prepared by the method described in Example 4 was used as a test substance. The day of cancer cell inoculation was defined as day 0, and evaluation was performed on day 35. During this time, the mBMPR1B-hFcm recombinant was administered into the tail vein four times at a frequency of once every 10 days at doses of 3 mg / kg and 30 mg / kg. Non-cancer cell inoculation group (Normal group), cancer cell inoculation / non-test substance administration group (Vehicle administration group), cancer cell inoculation / mBMPR1B-hFcm 3 mg / kg administration group (mBMPR1B-hFcm 3 mg / kg) Administration group) and cancer cell transplantation / mBMPR1B-hFcm 30 mg / kg administration group (mBMPR1B-hFcm 30 mg / kg administration group) were set and administered.
8-2-2 Evaluation of bone destruction due to bone metastasis of mBMPR1B-hFcm recombinant-administered bone metastasis model mice The mice described in Example 2-1 above were subjected to soft X-ray photography on day 35, and the femur distal Quantitative evaluation was performed by observation and image analysis of the edge, proximal tibia, and proximal humerus. As a result, in the Vehicle administration group, bone destruction due to bone metastasis at the distal end of the femur, the proximal end of the tibia, and the proximal end of the humerus was observed as compared with the Normal group. On the other hand, in the mBMPR1B-hFcm 3 mg / kg administration group and the mBMPR1B-hFcm 30 mg / kg administration group, suppression of bone destruction due to bone metastasis was observed as compared to the Vehicle group. As a result of calculating and quantifying the bone destruction area (Lesion area), the mBMPR1B-hFcm 3 mg / kg administration group and mBMPR1B-hFcm 30 mg / kg administration group suppressed the bone destruction area compared to the Vehicle group. Was observed (FIG. 7).
From the above results, it was shown that mBMPR1B-hFcm suppresses bone destruction caused by breast cancer bone metastasis. Moreover, mBMPR1b-hFcm was shown to suppress bone diseases caused by malignant tumors, especially bone metastasis.

All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety.

According to the present invention, bone mass, bone density and / or bone strength can be increased. Therefore, it is possible to treat osteoporosis, osteoarthritis, rheumatoid arthritis, bone diseases associated with malignant tumors, and various diseases or disorders related thereto without causing side effects.

SEQ ID NO: 9--Description of artificial sequence: DNA encoding fusion protein
SEQ ID NO: 10-description of artificial sequence: fusion protein SEQ ID NO: 11-description of artificial sequence: sense oligo DNA
SEQ ID NO: 12--Description of Artificial Sequence: Sense Oligo DNA
SEQ ID NO: 13-description of artificial sequence: primer SEQ ID NO: 14-description of artificial sequence: primer SEQ ID NO: 17-description of artificial sequence: DNA encoding the fusion protein
SEQ ID NO: 18--Description of Artificial Sequence: Fusion Protein

Claims (18)

1. It has an extracellular domain of bone-morphogenetic-protein-receptor--1B (hereinafter referred to as BMPR1B) derived from a mammal, or a sequence identity of 85% or more with the amino acid sequence of the domain, and bone mass, bone density and / or bone strength A pharmaceutical composition for treating a bone disease, comprising as an active ingredient a protein comprising a mutant of the extracellular domain of BMPR1B having an increasing action, or a vector comprising a nucleic acid encoding the protein.
2. The protein is a fusion protein of the extracellular domain or a variant thereof and a mammal-derived immunoglobulin Fc protein or a variant thereof, and the nucleic acid encoding the protein is a nucleic acid encoding the fusion protein; The composition of claim 1.
3. 3. The composition according to claim 1 or 2, wherein the protein is chemically modified.
4. 4. The composition according to claim 3, wherein the chemical modification is a bond of one or more polyethylene glycol molecules.
5. 4. The composition according to claim 3, wherein the chemical modification is a sugar chain bond.
6. The composition according to any one of claims 1 to 5, wherein the protein is a recombinant protein.
7. The composition according to any one of claims 1 to 6, wherein the extracellular domain comprises the amino acid sequence of SEQ ID NO: 1 or 3.
8. The composition according to any one of claims 1 to 6, wherein the nucleic acid encoding the protein containing the extracellular domain comprises the nucleotide sequence of SEQ ID NO: 2 or 4.
9. The composition according to any one of claims 2 to 8, wherein the Fc protein comprises the amino acid sequence of SEQ ID NO: 8.
10. The composition according to any one of claims 2 to 8, wherein the nucleic acid encoding the Fc protein comprises the nucleotide sequence of SEQ ID NO: 7.
11. The composition according to any one of claims 2 to 10, wherein the fusion protein comprises the amino acid sequence of SEQ ID NO: 10 or 18.
12. The composition according to any one of claims 2 to 10, wherein the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 9 or 17.
13. The composition according to any one of claims 1 to 12, wherein the mammal is a human.
14. The composition according to any one of claims 1 to 13, wherein the bone disease is a disease accompanied by a decrease in bone mass, bone density and / or bone strength.
15. A method for treating a bone disease, comprising administering the composition according to any one of claims 1 to 14 to a mammal.
16. The method according to claim 15, wherein the mammal is a human.
17. 17. The method according to claim 15 or 16, wherein the bone disease is a disease accompanied by a decrease in bone mass, bone density and / or bone strength.
18. The method according to any one of claims 15 to 17, wherein the composition is administered simultaneously or sequentially in combination with another bone disease therapeutic agent.

Images