WO2011082386A1

WO2011082386A1 - Specific amplification of fetal dna sequences from a mixed, fetal-maternal source

Info

Publication number: WO2011082386A1
Application number: PCT/US2010/062652
Authority: WO
Inventors: Stephen A. Brown
Original assignee: The Trustees Of Columbia University In The City Of New York
Priority date: 2009-12-31
Filing date: 2010-12-31
Publication date: 2011-07-07

Abstract

The present invention provides a method of selectively amplifying hypomethylated DNA sequences from a mixed source. The invention provides for selective amplification of trophob last/fetal DNA sequences from DNA mixtures that contain a high proportion of non-trophoblast/fetal DNA. The invention also provides methods of using the amplified fetal DNA sequences for aneuploidy detection.

Description

SPECIFIC AMPLIFICATION OF FETAL DNA SEQUENCES FROM A MIXED, FETAL- MATERNAL SOURCE

FIELD OF THE INVENTION

[0001] The present invention provides a method of selectively amplifying

hypomethylated DNA sequences from a mixed source. The invention provides for selective amplification of trophoblast/fetal DNA sequences from DNA mixtures that contain a high proportion of non-trophoblast/fetal DNA. The invention also provides methods of using the amplified fetal DNA sequences for aneuploidy detection.

BACKGROUND OF THE INVENTION

[0002] Chromosome abnormalities represent a significant cause of prenatal morbidity and mortality as well as a major cause of severe developmental delay in long-term survivors. Given the maternal age dependence of common trisomies and the marked rise in average maternal age, it is clear that the importance of screening aneuploidy will continue to increase.

[0003] Current options for aneuploidy testing are inadequate. At present, invasive testing by chorionic villus sampling ("CVS") or amniocentesis is presented as an option to all women 35 years old and older and to other women with known elevated risk of aneuploidy. Thus, the majority of women, because they do not fall into these categories, are not offered invasive testing. Maternal age functions poorly as a screening test since most babies are born to women less than 35, and only about 1 in 250 women at age 35 will have a trisomy discovered by amniocentesis.

[0004] Over the past 20 years, there have been improvements in the efficiency of maternal serum screening for trisomy 21 ("T21"). The present state-of-the-art screening using maternal serum from two gestational time points as well as ultrasound has a -95% "sensitivity" for detection of T21 with a 5% false positive rate. See e.g. Wald N.J., et al. 111 :521-31. (2004). There are, however, three major drawbacks with this type of testing. First, it does not provide a diagnosis, but rather a probability of Down syndrome. A

"positive" result is defined as a risk of Down syndrome greater than or equal to a 35 year-old woman. Thus, most women with a "positive" result still have to consider an invasive procedure, such as amniocentesis, even though the chance of actually finding Down syndrome is still less than 1%. Second, this testing is limited to trisomy 21 and 18. The third problem is that it is only 95% sensitive. A 95% sensitivity in a screening test such as this has great value from the public health perspective, but for many patients, the 5% chance to miss T21 is unacceptable. Non-invasive tests with much higher positive predictive values and higher sensitivities would be much more useful to patients and would immediately replace existing screening methods.

[0005] Cell-free fetal DNA (believed to be derived from placenta/trophoblast) is present in maternal plasma in virtually all pregnancies beginning early in the first trimester and continuing until delivery. Bischoff, F.Z., et al., Hum. Reprod. Update 11 :59-67 (2005). Multiple studies have demonstrated that fetal sex can be determined by amplification of Y chromosome specific sequences in maternal plasma derived DNA and other reports have shown that fetal Rh blood group genotype can be determined as well. However, its use for predictive testing is limited by the fact that the circulating fetal DNA is present in small quantity and is mixed with a much larger quantity of maternal DNA. Estimates, which are all based on quantitative PCR, suggest that there may be the equivalent of 50-200 genome equivalents of fetal DNA per ml of whole blood depending on gestational age and other parameters. Bischoff et al. 2005 Hum Reprod Update 11 :59-67). The origins of maternal plasma derived DNA are unclear as well. Many investigators have assumed that it is likely to be derived from trophoblast, since this is the tissue most in contact with the maternal circulation. Direct evidence for this comes from a single publication, which identified placental mosaicism for a Y chromosome abnormality. Flori E, et al., Case report. Hum. Reprod. 19:723-4 (2004). Despite this early success in demonstrating the presence of fetal DNA in maternal plasma, the major problems in prenatal diagnosis, such as determining the presence of common trisomies has not been accomplished using maternal plasma derived DNA. This is due to the fact that fetal DNA in maternal plasma exits as a mixture with maternal DNA, and the maternal component is more abundant. Thus, amplification of sequences common to the fetus and mother do not distinguish the fetal amplification products from the maternal products. Thus far, it has only been through the use of primers specific for sequences that are not present in the maternal component (such as the Y chromosome) that selective amplification of fetal sequences has been accomplished. Physical separation techniques have been used to enhance the ratio of the fetal component of plasma derived DNA. Li Y, et al. Jama 293:843-9 (2005); Li Y, et al. Prenat. Diagn. 24:896-8 (2004a); Li Y, et al, Clin. Chem. 50: 1002-11. Nevertheless, such techniques are unlikely to ever yield fetal DNA of sufficient purity to allow routine prenatal diagnosis.

[0006] Samples from the uterine cervix of pregnant women have been shown to contain fetal cells, and this represents another potential source of fetal DNA that could be used for noninvasive prenatal diagnosis. The literature on this topic has focused on two issues: 1) the reliability of recovering fetal cells from the uterine cervix and methods to improve it and 2) methods for separating fetal cells from the large background of maternal cells. Although various prenatal diagnoses have been performed using fetal cells and DNA derived from cervical samples, both of these issues remain significant hindrances to the routine use of this idea. The highest reported success rate for obtaining fetal cells from maternal cervical samples was 82%, and this was only when the semi-invasive technique of saline instillation was used. Cioni R, et al, Prenat. Diagn. 25: 198-202 (2005). Both morphologic (Tutschek B, et al, Prenat. Diagn. 15:951-60 (1995); Bussani C, et al, Mol. Diagn. 8:259-63 (2004)) and immunologic (Katz-Jaffe M.G., et al, Bjog 112:595-600 (2004)) means have been used to separate fetal from maternal cells, and both have been shown to enrich for the percentage of fetal cells. However, DNA obtained from these methods is likely to be highly contaminated with maternal DNA. In addition, no large or systemic studies have been reported.

[0007] Clearly, a method that would allow the detection and analysis of trophoblast (and hence fetal) DNA sequences in a sample when they are in a mixture with maternal DNA (such as from maternal plasma or the uterine cervix) would be extremely useful. The samples could then be analyzed directly without extensive physical separation of maternal and fetal cells or DNA. Alternatively, physical methods for fetal DNA enrichment could be combined with trophoblast/fetal specific amplification to enhance the benefits of both. Thus, there remains a need for a method that would provide selective amplification of fetal DNA obtained from a mixed fetal/maternal DNA source. The present invention fulfills this need.

SUMMARY OF THE INVENTION

[0008] The present invention relates to methods for diagnostic evaluation of diseases and conditions by detection of populations of differentially methylated nucleic acids in a mixed population of nucleic acids. The invention provides a method for selective

amplification of hypomethylated DNA from a mixture of DNAs from different sources that are distinguishable by their levels of methylation. Such mixtures include, but are not limited to, fetal DNA and maternal DNA in plasma of a pregnant woman and mixtures of tumor and normal DNA in body fluids. The method is particularly valuable where the less methylated component of the mixture is relatively small. The method comprises digesting the DNA with a methylation sensitive enzyme, ligating the digested DNA with a linker, subjecting the ligated DNA to linker-mediated PCR amplification to obtain PCR products, separating the desired PCR products from the other components of the amplification reaction, ligating the PCR products, and amplifying the ligated PCR products. In one embodiment the PCR products are separated by capture on a support and then amplified. According to the invention, the separated PCR products have, or are treated to have, complementary ends that can be ligated together. In one embodiment, the ligated PCR products are predominantly in the form of high molecular weight (HMW) DNAs. In another embodiment, the ligated PCR products are primarily in the form of closed circles. In another embodiment, the ligated PCR products comprise high molecular weight DNAs and closed circles. In an embodiment of the invention, the ligated PCR products are isothermally amplified.

[0009] In a specific embodiment of the invention, a method is provided for the selective amplification of hypomethylated fetal DNA derived from a subject sample. The method of the invention comprises digesting the DNA isolated from a subject sample with a methylation sensitive enzyme, ligating linkers to the ends of the digested DNA; subjecting the digested DNA to linker-mediated PCR amplification, separating the PCR products, digesting the separated PCR products with a restriction enzyme that recognizes a restriction site contained partly or entirely within the linkers, ligating the separated PCR products, and subjecting the ligated products to isothermal amplification to selectively amplify

hypomethylated DNA and produce methylation-sensitive representations of the DNA. In a further embodiment, the PCR primers used in the linker-mediated PCR are conjugated to a moiety useful in the subsequent separation of the PCR products. In one embodiment the PCR primers are conjugated to biotin. In a further embodiment, the PCR products are purified by capturing the moiety with a capturing agent bound to a solid support. In one embodiment the linker-mediated PCR primer is biotinylated and the resulting PCR products are purified using a biotin binding protein (e.g., avidin or streptavidin) linked to a support (e.g., agarose, sepharose, or magnetic beads). In one embodiment the PCR products are freed from the support by cleaving with a restriction enzyme that recognizes a restriction site created by the ligation of the linker to the DNA digested with the methylation sensitive enzyme. In one embodiment the linker is cleaved with Mlu I.

[0010] In one embodiment, the invention comprises digesting DNA isolated from a subject sample with a methylation sensitive enzyme, ligating linkers to the ends of the digested DNA such that a new restriction site is generated at or near the site of ligation, subjecting the digested DNA to linker-mediated PCR amplification using biotinylated primers, separating the desired PCR amplification by digestion of the newly formed restriction site and capture of the biotinylated linkers to a solid support, ligating the separated PCR products, and subjecting the ligated products to isothermal amplification to selectively amplify hypomethylated DNA and produce methylation-sensitive representations of the DNA.

[0011] In one embodiment, the selective amplification of hypomethylated DNA produces a methylation-sensitive representation from the DNA sample that is used to identify methylation-sensitive gene loci. In another embodiment, the copy number of the

methylation-sensitive gene sequences is determined. In one method of evaluation, DNA prepared by the above method is hybridized to a custom-made oligonucleotide microarray. In one embodiment, the oligonucleotides at each position of the array correspond to one of the DNA restriction fragments or portions thereof that could be theoretically created during the first digestion step using the methylation sensitive enzyme. The intensity of signal at each array address is dependent on the amount of probe (i.e., a labeled methylation-sensitive representation) that corresponds to the address. Thus, array addresses for which signal intensity is high are relatively less methylated. By various comparisons of microarray data from, e.g., control DNA, normal differentially methylated test DNA, and abnormal differentially methylated test DNA, typical methylation profiles can be derived.

Methylation/microarray results from samples obtained from subjects whose status is unknown are compared with the body of normal data. When comparing samples containing fetal DNA, deviations from normal are indicative of aneuploidy.

[0012] The present invention further provides a method for identifying fetal-specific hypomethylated DNA regions comprising, separately preparing methylation-sensitive representations from fetal and maternal DNA using a method described above; labeling the fetal DNA and maternal DNA to produce labeled fetal DNA probes and labeled maternal DNA probes, hybridizing the labeled DNA probes to arrays of oligonucleotides, wherein said arrays of oligonucleotides corresponds to predicted restriction fragments, or portions thereof, for a given methylation-sensitive enzyme, comparing the relative intensity of the labeled fetal DNA probes and labeled maternal DNA probes with each other to identify oligonucleotides of the array that detect relatively larger amounts of fetal DNA probe; and identifying the hybridized oligonucleotide detecting relatively higher amounts of fetal DNA probe as corresponding to fetal-specific hypomethylated regions. In one embodiment, the two representations are labeled with different labels (e.g. , different fluorochromes) and hybridized to the same array. In another embodiment, the labeled probes are hybridized to separate, identical microarrays. In one embodiment, the maternal DNA control is from peripheral blood cells. In another embodiment, the maternal DNA is from serum or plasma of a nonpregnant female. In another embodiment, the maternal DNA control is a pool of DNA from peripheral blood of two or more females or serum or plasma from two or more non-pregnant females.

[0013] The present invention also provides a method for identifying fetal-specific hypomethylated DNA regions comprising, separately preparing methylation-sensitive representations from a mixed fetal/maternal source and from maternal DNA using a method described above, labeling the fetal/maternal DNA representation and the maternal DNA representation to produce labeled fetal/maternal DNA probes and labeled maternal DNA probes, hybridizing the labeled DNA probes to arrays of oligonucleotides, wherein said array of oligonucleotides corresponds to predicted restriction fragments, or portions thereof, for a given methylation-sensitive enzyme, comparing the relative intensity of the labeled fetal/maternal DNA probes and labeled maternal DNA probes with each other to identify oligonucleotides that detect relatively larger amounts of fetal DNA probe, and identifying the hybridized oligonucleotides detecting relatively higher amounts of fetal DNA probe as corresponding to fetal-specific hypomethylated regions. In one embodiment, the two representations are labeled with different labels (e.g. , different fluorochromes) and hybridized to the same array. In another embodiment, the labeled probes are hybridized to separate, substantially identical, microarrays. In one embodiment, the maternal DNA is from peripheral blood cells. In another embodiment, the maternal DNA is from serum or plasma of a non-pregnant female. In another embodiment, the maternal DNA is a pool of DNA from two or more non-pregnant females.

[0014] The present invention further provides a method for detecting fetal aneuploidy in a subject. The method comprises preparing methylation-sensitive representations from a pregnant patient derived mixed DNA sample using a method described above followed by labeling the DNA to produce labeled fetal DNA probes. The labeled DNA probes are hybridized to an oligonucleotide array, wherein said array of oligonucleotides correspond to predicted restriction fragments, or portions thereof, for the methylation specific enzyme. Such hybridization will lead to the generation of a methylation profile of the fetal DNA, wherein the profile comprises the methylation status of multiple loci. The methylation profile of the pregnant patient sample is then compared to the methylation profile of a control generated by the same technique. In one embodiment, the control is serum or plasma from a non-pregnant female. In another embodiment, the control is a pool of DNA from serum or plasma of two or more non-pregnant females. In such embodiments, the methylation differences between the patient derived mixed sample and the control sample are evaluated to identify those that are unusually high (indicating high copy number) or low (indicating low copy number) as compared to the methylation differences observed for mixed fetal/maternal DNA from one or more pregnant females carrying a euploid (normal) fetus. High or low copy number at one or more gene locus is indicative of chromosome duplications, deficiencies, translocations, and the like. In one embodiment, the normal control is a mixed fetal/maternal DNA sample from a pregnant female carrying a euploid (normal) fetus.

[0015] Methylation profiles of patient samples can be compared to control samples or to normal samples. The comparisons can be to normals or controls tested simultaneously, or to normal or control values recorded in a database. In one embodiment in which patient samples are compared to control samples or normal samples, the patient DNA probe and the control or normal DNA probe are labeled with two different labels and the hybridization of labeled probes is to one array. In another embodiment in which patient samples are compared to control samples or normal samples, the patient DNA probe and the control or normal DNA probe are labeled with the same or different labels, and the hybridization of the labeled probes is to different, substantially identical, arrays.

[0016] In an embodiment of the invention, the subject DNA sample to be used in the methods of the invention, is derived from plasma or serum. In yet another embodiment of the invention, the methylation specific enzyme is HpyCh4-IV, Clal, Acll or BstBI. In one embodiment, the methylation specific enzyme is HpyCh4-IV. In another embodiment of the invention, the linker-mediated PCR amplification is performed for about 5 to about 20 cycles. In another embodiment of the invention, the linker-mediated PCR amplification is performed for about 8 to about 15 cycles. In yet another embodiment of the invention, the linker- mediated PCR amplification is performed for 12 cycles or 13 cycles or 14 cycles. [0017] One embodiment of the invention provides a kit containing the necessary reagents to perform the methods of the present invention along with instructions. In one embodiment the kit comprises reagents and instructions for detecting and determining copy number of hypomethylated regions in fetal DNA from a mixed fetal-maternal source. In one embodiment the kit comprises a methylation sensitive enzyme, linker DNA, PCR primers for linker-mediated PCR, a restriction enzyme for removing the linkers from the PCR products, the microarray for the detecting hypomethylated regions and instructions for performing the process.

[0018] One embodiment provides a microarray for the detection of hypomethylated regions wherein the microarray comprises oligonucleotides selected by (a) parsing the genome into segments that are bounded by two sites for the methylation sensitive restriction enzyme in question (ACGT for HpyCh4-IV) and less than 500 base pairs long; (b) utilizing an algorithm to analyze the sequence of these fragments, with the goal of finding suitable sequence for representation on the microarray. For example, appropriate oligonucleotides will have one or more of the following characteristics: (i) greater than about 40 nucleotides of unique sequence, or greater than about 60 nucleotides of unique sequence; (ii) a GC of about 40% to about 60%), and (iii) should not contain significant repetitive or simple sequences, for example runs of greater than about 15 of a single base. In one embodiment, the microarray comprises a subset of these oligonucleotides that are useful in the detection of aneuploidy- associated hypomethylated DNA. In one embodiment, this subset of oligonucleotides is identified by (i) separately preparing methylation-sensitive representations from fetal and maternal DNA using the method described above; (ii) labeling the fetal representations and maternal representations to produce labeled fetal DNA probes and labeled maternal DNA probes; (iii) hybridizing the labeled DNA probes to arrays of oligonucleotides, wherein said array of oligonucleotides corresponds to predicted restriction fragments, or portions thereof, for a given methylation-sensitive enzyme; (iv) comparing the relative intensity of the fetal and maternal derived probes with each other to identify oligonucleotides that detects the differential amount of fetal DNA probe; (v) identifying the hybridized oligonucleotide from step (iv) as a corresponding to fetal-specific hypomethylated region; and (vi) comparing the identified fetal-specific hypomethylated regions from multiple patients to determine a subset of oligonucleotides that are useful in detecting aneuploidy in patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Scheme showing methylation-sensitive amplification process.

[0020] Figure 2: Microarray comparison of methylation-sensitive amplified DNA from trophoblast (TB) and peripheral blood (PB). Plot of M data vs. A data. Positive M values indicate loci with greater signal intensity from TB than from PB. Black and gray dots represent human genomic loci, except gray cluster centered at M=0, which represent random oligonucleotides and Escherichia coli genomic loci. The vertical band at A=12 indicates a subset of loci used for the validation study.

[0021 ] Figure 3 : A 9 : 1 mixture of normal blood DNA and normal trophoblast DNA is compared with a 9: 1 mixture of normal blood DNA and trisomy 21 (T21) trophoblast DNA. The T21 trophoblast is XY and the normal DNA is XX. Multiple array segments

corresponding to each identified chromosomes are evaluated for probe hybridization, and the proportion of segments yielding a signal above or below a predetermined threshold is plotted. (Y-axis). The X-axis represents chromosome number, except: 22 = X-chromosome, 23 = Y- chromosome. A higher proportion of array segments from chromosome 21 indicate aberrant copy number. Chromosome 21 is ~4.3 SDs above the mean.

[0022] Figure 4a: A 9: 1 mixture of normal blood DNA and normal trophoblast DNA is compared with a 9:1 mixture of normal blood DNA and trisomy 18 (T18) trophoblast DNA. The T18 trophoblast is XX and the normal DNA is XY. Multiple array segments corresponding to each identified chromosomes are evaluated for probe hybridization, and the proportion of segments yielding a signal above or below a predetermined threshold is plotted. (Y-axis). The X-axis represents chromosome number, except: 23 = X-chromosome. A higher proportion of array segments from chromosome 18 indicate aberrant copy number. Chromosome 18 is ~6 SDs above the mean.

[0023] Figure 4b: A second mixture of 9: 1 mixture of normal blood DNA and normal trophoblast DNA is compared with a 9: 1 mixture of normal blood DNA and trisomy 18 (T18) trophoblast DNA. (See, Fig. 4a). The X-axis represents chromosome number, except: 23 = X-chromosome. A higher proportion of array segments from chromosome 18 indicate aberrant copy number. Chromosome 18 is ~6 SDs above the mean. DETAILED DESCRIPTION OF THE INVENTION

[0024] The present invention provides a method of selectively amplifying

hypomethylated DNA sequences from a mixed sample from a subject. Accordingly, the method is useful for identifying fetal and maternal DNAs that are differentially methylated. Further, the method is capable of selective amplification of hypomethylated (e.g., fetal specific) sequences from DNA mixtures that contain a high proportion of normal (e.g., maternal) DNA, and is thus useful for detecting fetal DNA in a mixture of fetal and maternal DNA. By detecting differences in amounts of fetal DNA from different chromosomal segments, the invention provides a non-invasive method for detection of fetal aneuploidy. As exemplified, detection of aneuploidy at chromosomes 13, 18, and 21 is shown. The invention is useful for determining ploidy of genetic loci from any fetal chromosome, and thus to diagnose chromosomal duplications, deletions, translocations, and the like. The method is generally useful for identifying and detecting hypomethylated DNAs from other sources, such as tumors and neoplasms, in a mixed sample.

[0025] As discussed above, the present invention relies on differences in methylation between fetal DNA and maternal DNA to detect fetal DNA in a mixed source, and allows for the use of non-invasive samples containing a mixture of fetal and maternal DNA. Invasive procedures such as chorionic villus sampling ("CVS") and amniocentesis can provide pure fetal DNA that can be used for prenatal diagnosis. Although these procedures are routinely used, they have associated risks. On the other hand, several non-invasive routes are available for obtaining fetal DNA mixed with maternal DNA, including recovery of cell free DNA that is present in maternal plasma and through the recovery of exfoliated fetal cells from the maternal uterine cervix.

[0026] The methods of the present invention enable the use of fetal/maternal DNA mixtures, utilizing differences in DNA methylation of fetal and maternal DNA to selectively amplify fetal-specific sequences from mixed fetal/maternal DNA samples. This method thus provides for prenatal testing of fetal chromosomal abnormalities using DNA derived from mixed fetal/maternal sources such as from maternal plasma. Another mixed source is from a cervical swab. Here, the source of maternal DNA contaminating cervical samples is cervical epithelium, which is similar to DNA derived from skin fibroblasts. Gene mapping experiments using Southern blots with methylation sensitive digests have not shown significant differences between whole blood and fibroblast DNA. Thus, both maternal whole blood and fibroblast DNAs are useful as a basis for comparison with fetal DNA. [0027] As mentioned, the methods described herein may be used for detection of DNAs from one source in a mixed sample of cells or cellular materials from a subject. The method involves digesting DNA from a mixed source from a subject, subjecting the digested DNA to linker-mediated PCR, separating the desired PCR amplification products, ligating the products, and isothermally amplifying the ligated products. The method is generally useful for selectively amplifying and identifying hypomethylated DNA associated with a disease or disorder, even though the amount of hypomethylated DNA present in the mixed sample is small relative to the amount of DNA from the same loci from other sources in the sample. As exemplified herein, the method is used to distinguish fetal DNA in a mixture of fetal and maternal DNA. The method is also useful for selectively amplifying and identifying hypomethylated DNA from a tumor in a mixed patient sample. See, e.g., WO 2009/002891, which is incorporated by reference. In one such embodiment, DNA from serum or plasma is tested for hypomethylated genetic loci associated with a tumor, such as an ovarian tumor.

[0028] Linker-mediated PCR

[0029] Generally, linker-mediated PCR begins with digesting DNA with a restriction enzyme and ligating double stranded linkers to the digested ends. PCR is then performed with a primer that corresponds to the linker and fragments up to about 1.5 kb are amplified. See Saunders, R.D., et al, Nucleic Acids Res. 17:9027-37 (1989) and Lisitsyn, N.A., et al, Cold Spring Harb. Symp. Quant. Biol. 59:585-7 (1994). Using this technique, it has been possible to amplify DNA from a single cell and to subsequently detect aneuploidy by using the amplified product to perform comparative hybridization. Klein, C.A., et al, Proc. Natl. Acad. Sci. U S A 96:4494-9 (1999). In another study, amplified representations were used to detect single genomic copy number variations by using them as hybridization probes to BAC microarrays. Guillaud-Bataille, M., et al, Nucleic Acids Res. 32:el 12 (2004).

[0030] In this method, the frequency of digestion of the restriction enzyme determines the complexity of the amplified product that results. By choosing an enzyme that cuts infrequently, the complexity of the amplified representation can be reduced to a fraction of the starting genomic DNA making the subsequent hybridization step much easier to perform. This has been particularly useful in settings where one wishes to perform comparative hybridizations between two complex genomic sources. A striking example is a technique called "ROMA" (Representational Oligonucleotide Microarray Analysis) that has been instrumental in revealing a high degree of genomic copy number variation in humans. Lucito, R., et al, Genome Res. 13:2291-305 (2003); Sebat, J., et al, Science 305:525-8 (2004); Jobanputra, V., et al, Genet Med 7: 111-8 (2005).

[0031] Accordingly, in the linker-mediated PCR step of the present invention, a sample of DNA is obtained and digested with a CpG methylation sensitive enzyme to form digested DNA with digested ends. In one embodiment, the DNA sample is mixed, comprising trophoblast and maternal (peripheral blood) DNA. In another embodiment, the sample comprises normal host DNA and tumor DNA. By using a CpG methylation sensitive restriction enzyme to cleave DNA prior to linker ligation, amplification of fragments bounded by unmethylated sites is favored. In a setting in which there is a mixture of DNAs from two different sources, one less methylated than the other, digestion with a methylation sensitive enzyme followed by linker ligation and amplification allows the selective amplification of fragments defined by differentially methylated sites. Methylation sensitive enzymes are known in the art and include, but are not limited to, HpyCh4-IV, Clal, Acll, and BstBI. As discussed and exemplified below, useful restriction sites are generated when linkers are attached to the digested DNA. Thus, taking for example the four restriction enzymes just mentioned, each cleaves unmethylated DNA and leaves a 5'-CG overhang. When HpyCh4-IV or Acll is used, the 5'-CG overhang is followed by T or TT respectively. Linkers can be selected that, when ligated to the 5 '-end of the GCT, generate a new restriction site. As exemplified below, an Mlul site is created {i.e., ACGCGT) that allows amplification products to be separated from the linker sequences. Similarly, when Clal or BstBI is used, the 5'-CG overhang is followed by AT or AA, respectively. One of skill in the art would select linkers accordingly. The invention is not limited to methylation sensitive enzymes that leave 5'-GC overhangs. For example, methylation specific enzymes blocked by CpG methylation are not limited to enzymes that have recognition sequences with CG at the center, but include enzymes with CG at other locations within the recognition site as well.

[0032] After the DNA obtained from the mixed sample is digested with a methylation specific enzyme as discussed above, the DNA is then ligated to linkers. In one embodiment the linkers have a built in restriction site or part of a restriction site, which can later be used to provide compatible sticky ends for ligation of PCR products generated using the linkers. For example, the sticky ends may be used to ligate the PCR products prior to isothermal amplification. A restriction enzyme site that produces sticky ends upon digestion is preferred. For example, Mlu I provides sticky ends. [0033] After ligating the linker, the resulting DNA is amplified using primers that bind to a site within the linker. PCR amplification is then carried out. The number of cycles may vary. In one embodiment, the number of cycles will create a size-selected representation of digested fragments. In one embodiment of the invention, about 5 to about 15 cycles of amplification are carried out. In one embodiment, about 8 to about 14 cycles of amplification are carried out. In further embodiments, the number of amplification cycles is 9, 10, 11, 12, or 13 cycles. According to the invention, one or more of the PCR primers can be conjugated with an affinity-capture moiety useful in subsequent purification steps. In one embodiment the affinity-capture moiety is biotin. Another such affinity-capture moiety is digoxigenin.

[0034] Purification of the linker-mediated PCR products

[0035] The linker-mediated PCR amplification described preferentially amplifies unmethylated DNAs, but does not provide sufficient product to be useful for array hybridization. While the products can be reamplified, it is useful to remove linker, template, and primer nucleic acids, prior to subsequent steps. Low molecular weight DNAs can be removed, for example, by passing the reaction mixture over a column. Also, to remove digested source DNA, biotin-linked reaction products can be bound to a solid support and washed.

[0036] To maximize the selectivity of the amplification of hypomethylated DNA sequences, it is also useful to remove non-specifically amplified products from the linker- mediated PCR products. For example, mispriming leads to undesired amplification of polynucleotides that are not bounded by methylation sensitive restriction sites on both ends. Accordingly, the method of the invention provides for separation (purification) of desired amplification products {e.g., from amplification products lacking an Mlu I cleavage site initially formed by linker addition) of the linker-mediated PCR. In an embodiment of the invention, the primers used for linker-mediated PCR incorporate a moiety useful for affinity capture of the primers, and consequently the amplification products, to a solid support. When the linkers are designed to generate a restriction site upon ligation to the digested DNA and the linker-mediated amplification primers are designed to maintain the restriction site, legitimate amplification products, but not misprimed products, can then be cleaved from the solid support. In one embodiment, the PCR primer is biotinylated and the PCR products are immobilized to a solid support using a biotin binding protein linked to a support. Biotin binding proteins include e.g. avidin, streptavidin , and NeutrAvidin. In one embodiment the biotin binding protein is streptavidin. In another embodiment, the PCR primer is linked to digoxigenin, which is then immobilized to a solid support using an anti-digoxigenin antibody. Solid supports include, without limitation, agarose, sepharose, and magnetic beads.

[0037] In one embodiment, the PCR primers for linker-mediated PCR are biotinylated and the resulting PCR products are purified using streptavidin linked to magnetic beads. Other components that are not bound to the support can then be washed away. The desired amplified product is then freed from the support using a restriction endonuclease that recognizes a restriction site contained partially or entirely within the linkers. In one embodiment the restriction enzyme is Mlu I.

[0038] In separating desired from undesired amplification products, affinity capture and digestion with a restriction enzyme can be carried out in any order or simultaneously. For example, the amplification products may be bound to a solid support, followed by digestion to release the desired amplification products. Alternatively, the amplification products may be digested first, followed by capture of the undesired amplification products which retain the biotin moiety.

[0039] As noted above, the linkers and amplification primers for linker-mediated PCR may be designed such that a useful restriction site is formed by ligation of the linker to a DNA cleaved by a methylation sensitive enzyme. For example, the recognition sequence for Mlu I (ACGCGT) overlaps with the recognition sequence for the methylation sensitive restriction enzyme HpyCh4-IV (ACGT) such that when the DNA is cleaved with HpyCh4- IV, and subsequently ligated to a linker that includes the sequence, CGCGT, at the 5' end, the restriction site for Mlu I is created. Following linker-mediated PCR and binding of the PCR products to a support via a moiety such as biotin, when Mlu I is used to free the PCR products from the linkers and support, non-specific amplification products will be largely remain bound to the linker and support because they do not contain the entire Mlu I recognition sequence. Thus, the desired linker-mediated PCR products can be separated from non-specific amplification products, which remain bound to the support.

[0040] Amplification of the linker-mediated PCR products

[0041] Once the linker-mediated PCR products are cleaved and separated from the linkers, the PCR products are then treated with T4 DNA ligase. In one embodiment, the PCR products in the ligation reaction are in sufficiently high concentration to promote

intermolecular ligation and formation of high molecular weight DNA products, consisting of different PCR products linked end-to-end. The high molecular weight products are heterogeneous in length and composition and contain random combinations of the digested PCR amplification products. When inspected by gel electrophoresis, such ligation products typically appear as smears, due to the length heterogeneity. In embodiments of the invention the high molecular weight products contain an average of at least 10 of such digested PCR amplification products (e.g., Mlu I fragments), or an average of at least 25 of such

amplification products, or an average of at least 50 of such amplification products, or an average of at least 100 of such amplification products. Accordingly, in embodiments of the invention, the high molecular weight products average at least 1000 bases (1 kilobase; 1 kb), or average at least 5 kb, or average at least 10 kb, or average at least 20 kb in length. The molecular weights can be determined, for example, by observation of the sizes of

electrophoresed ligation products.

[0042] In another embodiment of the invention, the purified PCR products are present at low concentration in the ligation reaction, such that formation of closed circular DNAs by intramolecular ligation is favored.

[0043] The ligations are then used as template for isothermal amplification.

Isothermal amplification is known in the art and is generally a one cycle amplification of DNA using exonuclease-resistant random primers and a DNA polymerase with great processivity. In one embodiment of the invention, the ligated PCR products are amplified using cp29 DNA polymerase using primers resistant to the 3 '-5' exonuclease activity of the polymerase. One non-limiting exemplary way to make exonuclease-resistant primers is by using thiophosphate linkages for the two 3' terminal nucleotides. Typically, the random primers are hexamers.

[0044] Any isothermal amplification procedure, include multiple strand displacement (MSD) may be used. MSD provides an enormous degree of amplification while introducing little bias. Notably, MSD amplification has a preference for high molecular weight templates. Self-ligation of the Mlu I digested PCR products as described above results in efficient polymerization of the low molecular weight products into higher molecular weight DNAs that can be efficiently amplified by MSD. Kits are available from, e.g., Amersham and are used following the manufacturer's recommendations. The isothermal amplification products of the ligated PCR products are copies of all or part of the high molecular weight DNAs made by ligation. Where ligation leads to circularization of the PCR products, isothermal rolling circle amplification of circular ligation products results in formation of concatenated structures consisting of multiple copies of the circular template. [0045] Separation and isothermal amplification of the linker-mediated amplification products produces methylation-sensitive representations useful for microarray analysis from as little as 1 ng of starting DNA.

[0046] Array Design

[0047] The present invention further provides for the use of oligonucleotide microarrays for identification of regions of the genome that are hypomethylated in fetal DNA. In a specific embodiment, the method comprises, (i) separately preparing methylation- sensitive representations from cell-free plasma DNA from subjects and normal controls using the method described above; (ii) labeling the methylation-sensitive representations of fetal DNA and control DNA to produce labeled fetal DNA probes and labeled normal DNA probes; (iii) hybridizing the labeled DNA probes to arrays of oligonucleotides, wherein said array of oligonucleotides corresponds to predicted restriction fragments, or portions thereof, for a given methylation-sensitive enzyme; (iv) comparing the relative intensity of the normal and fetal derived probes with each other to identify oligonucleotides that detect the differential amount of fetal DNA probe; and (v) identifying the hybridized oligonucleotide from step (iv) as a corresponding to fetal-specific hypomethylated region.

[0048] The present invention further provides a method for detecting aneuploidy in a subject. The method comprises selective amplification of unmethylated DNA derived from a subject sample comprising mixed fetal and maternal DNA (and optionally, for comparison, from a normal sample comprising mixed euploid fetal and maternal DNA) using the method described above followed by labeling the amplified DNA to produce labeled DNA probes wherein the subject derived probes and normal sample derived probes have different labels (e.g., different fluorochromes). The labeled DNA probes are hybridized to an oligonucleotide array, wherein said array of oligonucleotides correspond to predicted restriction fragments for the methylation specific enzyme. The array data is analyzed to ascertain the relative signal strengths from the hybridized probes and determine whether segments are differentially amplified from the subject sample as compared to euploid controls. Such analysis will lead to the generation of methylation profiles of the fetal DNAs, wherein the profiles comprise the methylation status of the subject fetal DNA and the methylation status of the euploid fetal DNA at multiple loci. The methylation profile of the subject sample is then compared to the methylation profile from known subjects generated by the same technique to determine if the methylation profile from the test subject sample indicates the presence of aneuploidy. In one embodiment the test subject and control probes are hybridized to two separate arrays. In another embodiment, test subject probes are hybridized and compared to known profiles of aneuploid and/or normal fetal DNA.

[0049] The arrays to be used in the practice of the invention may be generated using methods well known to those of skill in the art. In one embodiment of the invention, the arrays will contain nucleic acid fragments generated through enzymatic digestion of genomic DNA with the methylation sensitive enzyme utilized in the selective amplification step. In another embodiment, the oligonucleotides on the array correspond to all or a subset of the nucleic acid fragments, or a portion thereof, that could be generated by the methylation sensitive restriction enzyme (i.e., the fragments that could be generated if the DNA was entirely unmethylated). In one embodiment, the oligonucleotides on the microarray may be fabricated in any manner known in the art for example synthesized in situ (on the microarray slide) or spotted on the microarray slide.

[0050] In one embodiment, a microarray of the invention includes oligonucleotides corresponding to restriction fragments between about 100 and about 1500 base pairs (bp). In another embodiment, the microarray consists of oligonucleotides corresponding to restriction fragments between about 100 and about 500 bp. Typically, the oligonucleotide is a portion of about 25 to about 100 nucleotides, or about 40 to about 75 nucleotides of the restriction fragment. In one embodiment, 60 mer oligonucleotides are used. Each restriction fragment may be represented by a single oligonucleotide or multiple oligonucleotides on the microarray. In one embodiment, the oligonucleotides are targeted to gene or GC rich sequence. In another embodiment, regions rich in repetitive elements are avoided.

[0051] Certain studies have shown that methylation differences are more common in gene-rich portions of the genome. Therefore, in one embodiment, an array design is used in the practice of the invention that targets areas in the genome that have high gene content.

[0052] Array Hybridization

[0053] Array hybridizations may be carried out by commercial services according to their standard protocols. In one embodiment of the invention, hybridizations are performed as two color "comparisons," with the "test" DNA labeled with one fluorochrome and the "control" DNA labeled with a second fluorochrome. This approach minimizes artifacts and uniformity problems since the exact same experimental conditions apply to both the "test" and "control" samples. As discussed above, an appropriate control for each hybridization is a different normal subject (e.g. a pregnant female carrying a euploid fetus). It should be understood that, because the data analysis involves results of comparative hybridizations that include multiple loci from different chromosomes, other controls and standards are also appropriate for comparison with the test subject. For example, the comparison of each test subject can be to a control sample containing DNA from more than one normal subject. Further, the test subject can be compared to a database containing information from normal subjects and optionally subjects bearing aneuploid fetuses.

[0054] The microarray detection may be performed by any method known in the art. The DNA samples (i.e., the methylation-sensitive representations) may be labeled with labels useful for detection on a microarray including, but not limited to, fluorescent labels, luminescent labels, gold particle labels, and electrochemical labels.

[0055] Data Analysis

[0056] Comparative hybridization to microarrays has been used extensively to profile gene expression as well as to identify genomic copy number variation, and there are abundant methods of data analysis for microarray data of this type. In the present invention, the data may be used to assess genomic distribution of fetal-specific differential methylation and to assess overall differences in relative signal intensity between microarray data sets.

[0057] Existing bioinformatics methods for evaluating alterations in genome copy number, for example, may be used for data analysis, included "thresholding" (Vissers, de Vries et al. 2003), hidden Markov models (Sebat, Lakshmi et al. 2004), hierarchical clustering using genomic position (Wang, et al, Biostatistics 6:45-58, 2005) and, most recently, a technique known as maximum-a-posteriori or "MAP" (Daruwala, et al., Proc. Natl. Acac. Sci. USA 101 : 16292-7, 2004). Although these methods have been developed for the detection of copy number variations rather than methylation differences, the general problems are similar, and the methods are readily adaptable to the type of data that our arrays will generate. Once individual data sets have been analyzed for the presence of reliable clusters of differential signal, comparisons between data sets aimed at discriminating aneuploid from euploid can be performed. In general, there are a large variety of methods for assessing similarities between different microarray data sets that are well known to those of skill in the art.

[0058] All references referred to herein are incorporated in their entirety. EXAMPLES

[0059] Example 1 : Linker-adapter PCR to amplify from plasma DNA

[0060] Linker mediated PCR was used to amplify DNA from the plasma of pregnant women. In one approach, a standard protocol (Johnson, K.L., et ah, Clin. Chem. 50:516-21 (2004)) was used to purify DNA from a 10 ml sample of anti-coagulated whole blood (maternal plasma). The samples were centrifuged twice to remove cells. The resulting plasma was passed over a DNA binding membrane to purify the DNA. In another approach, DNA was prepared from blood samples with a Flexi-Gene® DNA Kit (Qiagen), and TB samples were prepared with a DNeasy® Tissue Kit (Qiagen).

[0061] Purified DNA was digested with HpyCh4-IV (sensitive to CpG methylation, cuts at ACGT leaving 5'-CG overhang,). Linkers were annealed and ligated to the digested DNA, and PCR was performed using the top strand of the linker pair following a published protocol (Guillaud-Bataille, M., et ah, Nucleic Acids. Res. 32:el 12 (2004)). The linkers were slightly modified so that they created a Mlu I site when ligated to DNA digested with HpyCh4-IV. The linkers were as follows:

CTAGGAGCTGGCAGATCGTACATTGACG (SEQ ID NO: l)

GCATGTAACTGCGC (SEQ ID NO:2)

[0062] Example 2: Amplification with linker-adapter is specific for unmethylated (i.e. HpyCh4-IV digested) DNA.

[0063] Linker mediated amplification of the digested DNA results in a heterogeneous mixture of products of various sizes. To prove that the amplification was specific and linker mediated, PCR products amplified using the linker adapter were cloned using a standard TA cloning protocol. Ten random colonies were picked and sequenced, and in 9 of 10 cases, the sequence showed that the linker adapter was ligated to a bona- fide HpyCh4-IV site at each end.

[0064] It is preferred that maternal blood collections do not involve formaldehyde. When blood is collected in the presence of formaldehyde, laddering is observed in the linker- mediated PCR products. [0065] Example 3 Demonstration of methylation specific amplification of trophoblast/fetal DNA using Acll

[0066] Amplified representations from trophoblast/fetal and whole-blood DNA samples were prepared using Acll. Trophoblast/fetal DNA samples were obtained from electively terminated first trimester pregnancies between 56 and 80 days gestation, and all whole-blood DNAs were prepared from normal adult volunteers.

[0067] All amplifications were performed according to a published protocol. See Guillaud-Bataille, M., et al., Nucleic Acids. Res. 32:el 12 (2004). Briefly, 0.5 ug of genomic DNA was digested with excess Acll in the recommended buffer. 25 ng of this was used to ligate to the linker/adapter pair. Following ligation, 2.5 ng of ligated DNA was used as template for PCR. After 14 cycles, 1/10^Λ volume of the product was used as template for a second round of PCR for 10 further cycles using the same primer. At this point, the products were displayed on a minigel. Consistent with the prediction of differential methylation, PCR products from trophoblast/fetal DNA consistently yielded more robust and differently appearing PCR products than did whole-blood DNA.

[0068] Fragments running between -500 and 1,000 bp were excised from the gel, digested with Mlul to remove the linker/adapter and ligated to a Mlul digested cloning vector. The linker/adapter was designed so that ligation to an Acll overhang results in the creation of a Mlul site. These ligations were transformed into bacteria to yield mini-libraries of amplified Acll fragments from both trophoblast/fetal and whole-blood starting DNAs. At the point of cloning, trophoblast/fetal representations consistently yielded at least twice as many colonies, such that the best trophoblast/fetal mini-library contained about 8,000 recombinants in comparison with about 3,000 for the best whole-blood library.

[0069] Thirty- five random colonies from a trophoblast/fetal library were picked and their inserts sequenced. Analysis with the UCSC browser showed that all but four sequences corresponded to predicted Acll fragments less than 1 kb long, indicating that the digestion, linker ligation and amplification steps had all occurred as predicted. It should be noted that the cloning procedure strongly selects against unintended amplification products since the Mlul site is only created when the linker is ligated to an Acll overhang.

[0070] In contrast, when a TA cloning procedure was used to clone PCR products (i.e., no Mlul digestion of PCR products and cloning vector), cloning efficiency was poor and a high percentage of clones reflected non-specific amplification products. Thus, it was concluded that a significant percentage of the DNA mass resulting from linker-mediated amplification is non-specific.

[0071] Example 4: Isothermal amplification

[0072] Aneuploidy detection requires detection of small amounts of hypomethylated fetal DNA in a mixed source. To overcome contamination of the linker-mediated PCR by non-specific amplification products a method of removing the non-specific amplification products was devised. Biotinylated primers were used in the linker mediated PCR amplification, and the PCR products were immobilized on streptavidin coated paramagnetic beads (Promega). The beads were then treated with Mlu I to release the legitimate PCR products. This procedure reduced the proportion of non-specific amplification products, since only PCR products resulting from linker ligation to an HpyCh4IV site and legitimate amplification would contain the requisite Mlu I site and be cleavable from the paramagnetic beads. The procedure also removes c template. Once separated from template and nonspecific PCR products, the legitimate PCR products could be reamplified to produce quantities sufficient for microarray analysis.

[0073] Isothermal multiple strand displacement (MSD) was used for the second round of amplification. The procedure involves the use of Phi29 DNA polymerase and provides a large degree of amplification, introduces little bias, and allows the use of random primers. Commercial kits are available and may be used (e.g., GenomiPhi, GE Lifesciences). To increase the efficiency the MSD amplification, the PCR products, which had digested Mlu I sites at both ends, were ligated together using T4 DNA ligase to produce higher molecular weight DNAs. While isothermal amplification is often biased towards central portions of linear starting materials, such bias is reduced or eliminated when the Mlu I digested products are ligated together before isothermal amplification. To increase labeling and hybridization efficiency, the isothermal amplification products may then be digested with Mlu I or otherwise fragmented (e.g., mechanical shearing). Alternatively, formation of circular ligation products can be promoted by reducing the concentration of the PCR product in the ligation reaction. Circularized products that result can be amplified by isothermal rolling circle amplification using the same enzyme and random primers.

[0074] Example 5 : DNA sources [0075] Trophoblast/Fetal Samples

[0076] First trimester trophoblast/fetal DNA is preferred because 1) the differences in methylation between trophoblast/fetal DNA and other DNA are more pronounced in early gestation; and 2) a first trimester diagnostic method is desirable. Similarly, representations amplified from trophoblast/fetal derived from pregnancies of 56-84 days are used for microarray hybridizations. These samples may be collected from electively terminated pregnancies. DNA is prepared by routine proteinase-K digestion followed by

phenol/chloroform extraction.

[0077] Non-Trophoblast/Fetal Samples

[0078] 10 randomly chosen female samples are pooled rather than attempting to choose appropriate individual whole-blood DNA samples. By pooling peripheral whole blood derived DNA, a single representation with an average methylation profile is produced.

[0079] Example 6: Microarray analysis for large-scale identification of

trophoblast/fetal-specific amplicons

[0080] Comparative hybridization to custom-made oligonucleotide microarrays is now a routine, commercially available technology that has been extensively used to assess genomic copy number differences. The same technology provides an ideal method for the large-scale identification of trophoblast/fetal specific amplicons. To achieve this goal, methylation-sensitive representations prepared separately from trophoblast/fetal and whole- blood DNA are labeled with different fluorochromes and comparatively hybridized to arrays of oligonucleotides that correspond to predicted restriction fragments for a given

methylation-sensitive enzyme. As opposed to array hybridization for copy number changes, where differences in hybridization level are extremely subtle, those oligonucleotides (array addresses) that hybridize primarily or exclusively to the trophoblast/fetal probe are identified, reflecting little or no digestion of corresponding restriction sites in DNA derived from blood. By performing such microarray analyses using probes made from multiple different trophoblast/fetal samples, those amplicons that consistently show highly differential amplification are identified and used to provide a catalogue of a large number of

trophoblast/fetal-specific amplicons located on target chromosomes.

[0081 ] Choice of restriction enzyme [0082] For the purpose of future prenatal diagnosis, several hundred trophoblast/fetal specific amplicons per chromosome for the target chromosomes, 13, 18, 21, X, and Y are obtained, and, because of the low average molecular weight of plasma derived DNA, the focus is on short segments. Enzymes such as Ac II result in too few fragments for this purpose, and therefore, a more frequently cutting enzyme for microarray analysis is used. The enzyme HpyCh4-IV is ideal for producing representations for microarray experiments. This enzyme cleaves a recognition sequence (which is ACGT) having either A or T at positions other than the central CpG, and has the benefit of being commercially available. In a genome with balanced proportions of A, C, G and T, there should be 16 fold more sites for HpyCh4-IV than for Acll, and this, in turn, would predict -2400 fragments between 100 and 1500 bp long for chromosome number 21. In fact, the true number of HpyCh4-IV fragments of size 100-1500 predicted for chromosome 21 is 17,152, reflecting the extremely uneven distribution of CpG dinucleotides with respect to AT rich sequence. If one makes the assumption that 80% of sites are blocked by methylation in trophoblast/fetal DNA, one can guesstimate that the true number of chromosome 21 fragments in the target size range is 2- 3000. If 15% are trophoblast/fetal specific, then 300-450 such amplicons are predicted.

[0083] Array Construction

[0084] Current technology allows the production of arrays containing -380,000 different oligos, enough to allow the assessment of over half of all HpyCh4-IV fragments in the entire genome in a single experiment. However, to perform this type of analysis on 10 sample pairs would require a minimum of 20 such arrays and would therefore be excessively expensive. As a cost saving alternative, an array format in which 4 identical arrays is provided, each consisting of -98,000 oligos each, are synthesized on the same "chip". A single "chip" of this type allows 4 hybridizations, which is sufficient for 2, color-reversed, duplicate hybridizations. 98,000 oligos provides sufficient space to query -12,000 fragments on each of the 4 relevant chromosomes (13, 18, 21 and X) with each oligo in duplicate. 12,000 is sufficient to represent the majority of 100-1500 bp fragments located on chromosome 21, and this, in turn, is expected to yield several hundred trophoblast/fetal- specific amplicons per chromosome. Because all Y segments are fetal-specific, only 1000 Y segments are represented in the arrays.

[0085] Oligonucleotides [0086] A database containing the sequence of all -17,000 predicted HpyCh4-IV fragments on the 21, 18, 13, X and Y chromosome between 100 and 1,500 bp in length are prepared. These files are then used for probe design and array synthesis. Because of the low molecular weight of plasma DNA, the maximum possible number of short fragments will be represented in arrays. Since about 50% of fragments less than 400 bp will not have suitable sequence for oligonucleotide design, this will leave about 2,500 to be represented in the array. All arrays also contain a series of negative control oligonucleotides.

[0087] Probe Synthesis

[0088] The amplification protocol described above is used to prepare methylation- sensitive representations of trophoblast/fetal and non trophoblast/fetal DNAs. 0.5 ug of each genomic DNA is digested with excess HpyCh4-IV. 25 ng of this digest is ligated to the linker pair and 1/10th of the ligation is used to perform PCR for 12 cycles. In the above examples using Acll digests, legitimate ligation of the linker to the fragment end produced a Mlul site (ACGCGT) and the same result is obtained when using HpyCh4-IV which cleaves after the A to leave CGT. After 12 cycles of PCR, the resulting products are digested with Mlul and circularized as above. Following ligation, remaining linear DNA is digested with nuclease Bal-31, and after buffer exchange with a Sephadex G50 column, isothermal rolling- circle amplification is performed using a commercially available kit (Amersham Bioscience). At this point, the DNA is checked on a minigel to determine whether appropriate products are present. The DNA yield using this protocol is routinely between 3 and 5 ug, but because only a portion of the circularized PCR product is used for amplification, it can easily be scaled-up for larger quantities. After determining quantity by fiuorometry and quality by running Mlul digested products on a minigel, DNA is supplied to an array manufacturer, such as

NimbleGen, for probe labeling and array hybridization.

[0089] Interpretation of microarray data

[0090] Processing of raw data is an important first step. For each array address the signal intensity (with respect to control oligos) is assessed. Spots that prove unreliable are excluded from analysis. For each array address with an adequate signal, the ratio of intensity of the two signals (Cy3 and Cy5) is determined. Because log transformed ratios have better statistical properties than simple ratios, all will be log (base 2) transformed. Array data is normalized by subtracting the median log₂ ratio for an entire array from each individual value of the array. Since each oligo is present in duplicate, the normalized ratios of duplicate addresses are averaged, and these means are averaged with the corresponding color-reversed mean ratio of the same duplicate address. Thus, the final value for each segment is based on four hybridizations and their corresponding log₂ mean ratios. This analysis is easily accomplished with existing software packages.

[0091] Locating those amplicons that are present in trophoblast/fetal representations but are absent or nearly absent in whole-blood representations is quite different than in the typical genomic comparison experiments where one is looking for subtle differences in hybridization ratios in genomically contiguous array addresses. Data from Lucito et al., Genome Res. 13;2291-305 (2003) provides an example of how the data will likely appear. See Figure 8. These authors performed comparative hybridizations to glass slide arrays of 10,000 oligonucleotides that corresponded to Bglll fragments. One hybridization probe consisted of a "complete" Bglll representation of genomic DNA and the other consisted of a similar representation except that the DNA was also digested with Hindlll, largely eliminating all fragments with an internal Hindlll site. This creates a situation similar to the present invention, where one representation contains elements that are essentially missing from the other representation. As is evident the figure, the logio mean-ratio signals vary from 0 to well over 1, reflecting a > 10 fold difference in intensity for many segments. The results for the present invention arrays will be similar to these, but, because the probe amplification method creates much less non-specific amplification than that used by these authors, it is likely that a higher percentage of addresses with logio mean ratios greater than 1 will be seen.

[0092] Those addresses with a 10 fold or greater mean-ratio are considered to be "trophoblast/fetal-specific." Clearly, those addresses with the highest mean ratios are the most desirable. The analysis of each hybridization yields a list of probe addresses with signals that meet this criterion, and a pair- wise comparison of the 10 planned hybridizations yields a final list of those addresses that are consistent among the samples, providing the desired catalogue of trophoblast/fetal specific HpyCh4-IV amplicons for the five relevant chromosomes.

[0093] Example 7: Detection of Aneuploidy

[0094] Samples of peripheral blood (PB) were obtained from healthy, nonpregnant women between the ages of 18 and 35 years. Trophoblast (TB) samples were obtained from women undergoing elective termination of pregnancy between 10 and 13 gestational weeks. TB samples with chromosome abnormalities were obtained from pregnancies (11-13 weeks gestational age) in which the diagnosis had been established by prior chorionic villus sampling.

[0095] Methylation sensitive representations were prepared from mixtures using the protocol described above. In particular, DNA was first digested with the methylation- sensitive restriction enzyme, HpyCh4IV (New England Biolabs). After digestion, linker/adapters were ligated, and the PCR was performed with a linker primer. The linker (CTAGGAGCTGGCAGATCGTACATTGACG) (SEQ ID NO: l) was designed so that when it ligated to the overhang created by HpyCh4IV digestion, it created a site for the relatively rare- cutting restriction enzyme, Mlul (New England Biolabs). After linker ligation, the PCR was performed for 18 cycles. PCR products were then bound to streptavidin-coated paramagnetic beads (Promega), and the bound DNA was released from the beads by Mlul digestion. The resulting DNA fragments were self-ligated by the addition of T4 DNA ligase (New England Biolabs) and then amplified with a commercial multiple strand displacement (MSD) amplification kit (illustra GenomiPhi V2 DNA Amplification Kit; GE Healthcare Life Sciences) according to the manufacturer's instructions. In each case, the total amount of starting DNA was 10 ng, with 1 ng being derived from TB. (Fig. 1).

[0096] Each mixture containing trisomic TB DNA was then compared to a mixture containing euploid TB DNA by hybridizing to a microarray such as described above. In particular, the microarray consisted of 60mer oligonucleotides corresponding to restriction fragments greater than 100 bp and less than 500 bp in size. Each restriction fragment was represented by a single oligonucleotide on the microarray. No effort was made to target genes or GC-rich sequence, nor to avoid regions rich in repetitive elements. The approximate number of features assigned to each chromosome was approximately 15,000. The array design also included approximately 10,000 random oligonucleotides and approximately 10,000 oligonucleotides that corresponded to predicted HpyCh4IV fragments from the Escherichia coli genome. DNA labeling and array hybridizations were performed by Roche NimbleGen according to their standard protocols.

[0097] For this analysis, a standard qspline normalization procedure was used. The signal associated with each chromosome was summarized by summing the number of array addresses either above or below a cutoff M value and taking the ratio of the two sums. These chromosome-specific ratios were then compared to each other using a standard one-sample t test. For detection of aneuploidy, the ratio obtained from the chromosome with aneuploidy (18 or 21) was compared with the distribution of ratios obtained from all other chromosomes (except the X chromosome) by computing a T score with 20 degrees of freedom. The T score was calculated as follows: T = (ratio - Xm)/SD, where "ratio" is the ratio associated with a given chromosome and Xm is the mean for the other chromosomes. The 1 -sided P value associated with the T score represents the probability of observing the ratio when aneuploidy is not present. Analysis was performed with the statistical program R (available at www.bioconductor.org).

[0098] To validate the method of methylation-sensitive differential amplification, a microarray comparison of amplified PB DNA and first-trimester TB DNA was performed using DNA samples consisting of 1 ng genomic DNA from either first-trimester TB (11 weeks gestation) or from a PB sample of a healthy reproductive-aged woman. Each DNA sample was spiked with 2-3 pg of E. coli DNA, an amount calculated to provide the approximate molar equivalent of the human genomic DNA (200 genomic copies). Both DNA samples were prepared and amplified as described and were subsequently used to hybridize to the custom-made microarray. The hybridization was performed twice, with dye reversal.

[0099] Fig. 2 shows an "M-A" plot in which the y axis depicts the log₂ intensity ratio of each array address (M) and the x axis represents the log₂ mean signal intensity for each address (A). In this plot, points with M values >0 indicate array addresses where the TB signal intensity was greater than the PB signal intensity. Array addresses with M values >2 and <-2 are depicted in yellow; the narrow rectangle of red dots indicates array addresses with A values of 12.0 -12.2. Inspection of Fig. 2 indicated considerably more points for M values >2 than for M values <-2, indicating overall relative hypomethylation of TB.

[0100] Table 1 summarizes the global comparison of TB and PB signals and shows that, depending on the threshold M value, the proportion of array addresses showing a higher signal in TB is about 2-fold greater than in PB DNA. All array loci with a low signal, defined as A values <9.5, as well as the sex chromosomes were excluded from this analysis. Thus, the microarray data confirmed that TB DNA globally is relatively hypomethylated.

[0101] The E. coli spike-in DNA demonstrates that the apparent differential amplification is not artifactual. Data points in Fig 2 from E. coli spike-in DNA were tightly clustered about y = 0. This indicates that amplification of this entirely unmethylated DNA was very similar in the 2 probes, even though the A value for the E. coli loci was actually lower than that for the human data. This result provides indirect evidence that the

comparatively wide spread of the ratios observed in the TB/PB comparison is most likely due to differences in methylation between the 2 samples.

[0102] Artificial mixtures of trophoblast (TB) and peripheral blood (PB) DNA, intended to simulate a mixed sample from the plasma of a pregnant woman were used. DNA from three trisomic first trimester TB specimens (one with trisomy 21 (Fig. 3) and 2 with trisomy 18 (Fig. 4)) were each mixed with DNA from normal female PB in a 1 :9 ratio.

Similarly, for each of these three DNA mixtures a second mixture was prepared using first trimester TB DNA from a chromosomally normal pregnancy of opposite sex and female PB DNA in a 1 :9 ratio. Thus, in both mixtures, the DNA content was 90% from PB and 10% from TB.

[0103] Using this method, it was possible to detect the chromosome with known trisomy with a high degree of confidence. In practice, the best discrimination occurred when the analysis was based on approximately 10% of the data with the highest or lowest signal ratios. (Figs. 3, 4, black columns). These results show that aneuploidy can still be confidently detected, despite the use of a very small and highly contaminated sample.

[0104] To the extent that methylation differences between TB and PB are similar from sample to sample, it is possible to enhance the detection of aneuploidy in mixed samples by considering only those array addresses that consistently show stronger amplification in TB than PB. Three separate comparisons of TB and PB (each with color reversal) were performed and the results were combined by qspline normalizing across the datasets and then taking the color-reversed average of the ratios for each array address. This provided a simple metric to express the degree to which a given array address was "trophoblast specific." Next, several different methods for using this information to enhance aneuploidy in the 9: 1 mixture data sets were empirically tested. By restricting the analysis to those array loci with average TB:PB signal ratio of 1 (reflecting a 2 fold higher signal intensity from TB), the ability to detect aneuploidy was improved, as evidenced by a consistently improved statistical certainty that the trisomic chromosome was different from the others.

[0105] It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, kit, reagent, or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.

[0106] It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims.

[0107] All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0108] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

[0109] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0110] The term "or combinations thereof as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CAB ABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

[0111] As used herein, words of approximation such as, without limitation, "about", "substantial" or "substantially" refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of

approximation such as "about" may vary from the stated value by at least ±1, 2, 3, 4, 5, 6, 7, 10, 12 or 15%.

[0112] All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Claims

We claim:

1. A method for making a methylation-sensitive representation of DNA from a patient sample comprising:

a) digesting the mixed DNA sample with a methylation sensitive enzyme;

b) ligating the digested DNA with a linker

c) subjecting the ligated DNA to linker-mediated PCR amplification to obtain PCR products;

d) separating the PCR products from the linker, the template and primer DNA;

e) ligating the separated PCR products to form high molecular weight ligation products; and

f) subjecting the high molecular weight ligation products to isothermal amplification to produce a methylation-sensitive representation from the sample DNA.

2. The method of claim 1, wherein the patient sample contains fetal DNA and maternal DNA.

3. The method of claim 1, wherein the mixed patient sample is plasma or serum.

4. The method of claim 1, wherein the methylation sensitive enzyme is

HpyChIV-4, Clal, Acll or BstBI.

5. The method of claim 1, wherein the methylation sensitive enzyme is

HpyChIV-4.

6. The method of claim 1 , wherein the high molecular weight products average at least 1 kb.

7. The method of claim 1 , wherein the high molecular weight products average at least 5 kb.

8. The method of claim 1 , wherein the high molecular weight products average at least 10 kb.

9. The method of claim 1 , wherein the high molecular weight products average at least 20 kb.

10. The method of claim 1, wherein the linker-mediated PCR amplification is performed for about 5 to about 20 cycles.

11. The method of claim 1 , wherein the linker-mediated PCR amplification is performed for about 10 to about 18 cycles.

12. The method of claim 1 , wherein the linker mediated PCR amplification is performed for 10 cycles or 11 cycles or 12 cycles.

13. The method of claim 1 , wherein the PCR amplification is performed with biotinylated primers, and the PCR products are separated using a biotin binding protein linked to a solid support.

14. The method of claim 13, wherein the biotin binding protein is streptavidin.

15. The method of claim 13, wherein the support is selected from the group consisting of agarose, sepharose, and magnetic beads.

16. A method of identifying a hypomethylated fetal DNA- specific amplicon comprising,

a) separately preparing methylation-sensitive representations from fetal DNA and whole-blood DNA by:

i) digesting the DNA with a methylation sensitive enzyme,

ii) ligating the digested DNA with a linker,

iii) subjecting the ligated DNA to linker-mediated PCR amplification to obtain PCR products,

iv) separating the PCR products from the linker, the template and primer DNA;

v) ligating the separated PCR products to form high molecular weight ligation products; and

vi) subjecting the ligation products to isothermal amplification to produce a methylation-sensitive representation from the DNA.

b) labeling the fetal DNA representation and the whole blood-DNA representation to produce labeled fetal DNA probes and labeled whole-blood DNA probes;

c) hybridizing the labeled DNA probes to two identical arrays of oligonucleotides, wherein said arrays of nucleotides correspond to predicted restriction fragments for a given methylation-sensitive enzyme;

d) comparing the two arrays with each other to locate an oligonucleotide that hybridizes more strongly to a fetal DNA probe than to a whole-blood DNA probe; and e) identifying the hybridized oligonucleotide from step d as a hypomethylated fetal DNA-specific amplicon.

17. The method of claim 16 wherein the fetal DNA probe and the whole-blood DNA probe are labeled with two different labels and wherein the hybridization of labeled probes is to one array.

18. The method of claim 16 wherein the fetal DNA is obtained from first trimester pregnancies.

19. The method of claim 18 wherein the fetal DNA is obtained from pregnancies of about 56-84 days.

20. A library of fetal-specific amplicons produced by the method of claim 16.

21. An array comprising the library of the fetal-specific amplicons of claim 20.

22. A method for determining whether the copy number for a predetermined locus of fetal DNA in a test sample which comprises a mixture of fetal and maternal DNA is either reduced or increased as compared to a normal copy number at the predetermined locus, comprising

a) selectively amplifying the predetermined locus of fetal DNA in the test sample by preparing a methylation-sensitive representation using the method of claim 1 , b) comparing the amount of the amplified DNA in step a) with the amount of amplified DNA from a normal sample prepared by the same method; and

c) correlating a reduced amount of amplified DNA in the test sample to a reduced copy number or an increased amount of amplified DNA in the test sample to an increased copy number.

wherein said control sample has a normal copy number at the predetermined locus of fetal DNA;

23. The method of claim 22, wherein the comparison includes normalization of the amplified DNA from the predetermined locus to DNA amplified from a control locus present at the same copy number in the test sample and the control sample.

24. The method of claim 22, wherein the amplified test DNA and the amplified normal DNA are labeled and hybridized to one or more oligonucleotide arrays.

25. The method of claim 22, wherein the amplified test DNA and the amplified normal DNA are labeled with different tags and hybridized to one oligonucleotide array.

26. A method of making a microarray for detecting hypomethylated fetal DNA in a sample of mixed fetal DNA and maternal DNA comprising:

a) identifying a hypomethylated fetal DNA-specific amplicon according to claim 16;

b) selecting an oligonucleotide that hybridizes to the hypomethylated fetal DNA-specific amplicon; and

c) preparing a microarray comprising the selected oligonucleotide.

27. The method of claim 26, wherein the microarray further comprises one or more oligonucleotides that hybridize to amplicons that are not hypomethylated in fetal DNA.

28. The method of claim 26, wherein the microarray comprises oligonucleotides that hybridize to amplicons from one or more chromosomes selected from human

chromosomes 13, 18, and 21.

29. A microarray made by the method of any one of claims 26 to 28.