WO2011079272A1

WO2011079272A1 - Compounds for modulating the switch between replication and transcription of orthomyxovirus viral genomes and methods of use thereof

Info

Publication number: WO2011079272A1
Application number: PCT/US2010/062020
Authority: WO
Inventors: Benjamin R. Tenoever
Original assignee: Mount Sinai School Of Medicine Of New York University
Priority date: 2009-12-23
Filing date: 2010-12-23
Publication date: 2011-06-30

Abstract

Orthomyxovirus small viral RNAs (svRNAs), which regulate the switch between transcription and replication of the Orthomyxovirus genomes, compounds that modulate the expression or activity of svRNAs, and compositions comprising such compounds are disclosed. Also described are methods for treating an Orthomyxovirus, such as an influenza virus, infection or disease or symptom associated therewith, comprising administering to a subject a compound that modulates the expression or activity of svRNAs. Also described are methods for using compounds that modulate the expression or activity of svRNAs to generate attenuated Orthomyxoviruses, such as influenza viruses. Further, described are non-human transgenic animals comprising a nucleic acid compound that modulates the expression or activity of svRNAs stably integrated into the genome of the non-human animals.

Description

COMPOUNDS FOR MODULATING THE SWITCH BETWEEN REPLICATION AND TRANSCRIPTION OF ORTHOMYXOVIRUS VIRAL GENOMES AND METHODS OF USE THEREOF

[0001] This application claims priority to U.S. provisional application No.

61/327,384, filed April 23, 2010, and U.S. provisional application No. 61/289,912, filed December 23, 2009, each of which is incorporated herein by reference in its entirety.

INTRODUCTION

[0002] Described herein are Orthomyxovirus small viral RNAs (svRNAs), which regulate the switch between transcription and replication of the Orthomyxovirus genomes. Described herein are compounds that modulate the expression or activity of svRNAs, and compositions comprising such compounds. Also described herein are methods for treating an Orthomyxovirus, such as an influenza virus, infection or disease or symptom associated therewith, comprising administering to a subject a compound that modulates the expression or activity of svRNAs. Also described herein are methods for using compounds that modulate the expression or activity of svRNAs to generate attenuated Orthomyxoviruses, such as influenza viruses. Further, described herein are non-human transgenic animals comprising a nucleic acid compound that modulates the expression or activity of svRNAs stably integrated into the genome of the non-human animals.

2.BACKGROUND

[0003] Orthomyxoviruses are a family of negative-sense, single-stranded RNA viruses that includes five genera: Influenzavirus A, Influenzavirus B, Influenzavirus C, Isavirus and Thogotovirus. The first three genera contain viruses that cause influenza in vertebrates, including avian species (chickens, ducks, etc.) and humans, pigs, and other mammals. Isaviruses infect salmon (see, e.g., Falk et al. 1997, "Characterization of infectious salmon anemia virus, an orthomyxo-like virus isolated from Atlantic salmon {Salmo salar L.)," J Virology 71 : 9016-9023). Thogotoviruses infect vertebrates as well as invertebrates such as mosquitoes and sea lice. Orthomyxoviruses pose a significant problem to the health of humans, wild and farmed bird and fish populations, and livestock. See, e.g., Knipe & Howley et al. eds., 2007, Chapters 47 and 48,

"Orthomyxoviridae," IN Fields Virology, Philadelphia, PA: Lippincott Williams & Wilkins 2007); Falk et al.; and Raynard et al. 2001, "Infectious salmon anaemia virus in wild fish from Scotland," Dis. Aquat. Org. 46:93-100. [0004] Influenza A virus is a seasonal pathogen responsible for significant morbidity and mortality worldwide (Fields et al, 2007). Most antiviral drugs directed against influenza A virus focus on virus entry, fusion, or egress, and viruses are able to rapidly alter their genetic composition to develop resistance to such drugs. Moreover, most drugs that can treat one strain of influenza A are less effective against other strains, and are not effective against influenza types B or C.

[0005] Currently there are only four U.S. Food and Drug Administration (FDA)- approved drugs available for the treatment of influenza, amantadine, rimantadine, oseltamivir, and zanamivir (DeClercq, 2006). The adamantanes (amantadine and rimantadine) block the M2 ion channel of the virus and prevent the release of the viral genome into the host cell (Pinto and Lamb, 1995; Wharton et al., 1994). These drugs are effective if used prophylactically and if administered within 48 hours of infection but are not effective against influenza B viruses. However, the development of widespread resistance has precluded the use of adamantanes in recent influenza seasons (Bright et al., 2006) and isolates of the H5N1 influenza virus have been shown to be resistant to these drugs due to mutations in M2 (Cheung et al., 2006).

[0006] The preferred treatment for influenza virus infection is now the use of the neuraminidase (NA) inhibitors, oseltamivir and zanamivir (Garman and Laver, 2004). By targeting NA, these compounds prevent the release of the virus from the infected cell and halt the spread of the virus. As part of its pandemic preparedness plan, the World Health Organization (WHO) has advised that supplies of the NA inhibitors be stockpiled, but it is always advantageous to have at least two antiviral drugs (aimed at different targets) available due to the possible emergence of resistant virus strains. In fact the 2007-2008 influenza season in the Northern hemisphere has shown a marked increase in the number of H1N1 isolates that are resistant to oseltamivir (World Health Organization, 2008) and concerns have also been raised regarding oseltamivir-resistant H5N1 influenza viruses isolated from patients in Southeast Asia (Le et al., 2005). There is now widespread resistance to both of these drug classes (Layne et al., 2009).

[0007] Vaccination is one means of preventing infection or at least minimizing the severity of disease. Based on knowledge of the current circulating influenza virus strains, the WHO makes an annual decision as to which virus strains should be included in the influenza vaccine for the following season. Manufacturers therefore have a relatively short time period in which to generate new vaccine stocks and this, combined with the increase in demand from the population, sometimes leads to shortages. Vaccine viruses are currently grown in embryonated chicken eggs that generally support high levels of virus growth; however the use of eggs has certain limitations. Vaccine production cannot easily be scaled up at short notice, as would be required during a pandemic, due to the reliance on a continuous supply of embryonated eggs.

Furthermore, if the pandemic virus is of avian origin it may be lethal in eggs, as occurred during the preparation of an H5N1 vaccine candidate (Takada et al., 1999). An avian virus would likely also affect the poultry industry and the egg supply may dry up completely. In an effort to avoid these problems, vaccine manufacturers are now establishing tissue culture systems for the growth of influenza virus vaccines (Oxford et al., 2005; Romanova et al., 2004; Tree et al., 2001). The major disadvantage is that wild type human influenza virus strains often do not show optimal growth properties in this culture system, resulting in lower vaccine yields.

[0008] Thus, there is an urgent need for the development of new strategies to control Orthomyxoviruses in humans, livestock, and the wild, including antiviral drugs, and also for the improvement of vaccine production, particularly in preparation for future influenza epidemics or pandemics.

2.1 Influenza virus genome replication and transcription

[0009] Influenza A virus is encoded by eight individual single-stranded segments of RNA with negative polarity that localize to the nucleus upon viral entry (Fields et al, 2007). Each of the eight RNA segments is encapsidated by the nucleoprotein (NP) and associates with the RNA-dependent RNA polymerase (RdRp, composed of PA, PBl, and PB2) to form a viral ribonucleoprotein complex (vRNP), the machinery responsible for both transcription and replication (See Figure 5A) (Krug 1981). During

transcription, PBl functions as the classic polymerase responsible for transcribing the viral RNA (vRNA) (Krug 1981). Transcription by PBl is dependent on the functions of PB2 and PA; PB2 binds to the 5 ' cap of cellular mRNAs while PA cleaves the bound mRNA, together generating short capped primers for viral transcription (Fields et al., 2007; Dias et al., 2009; Yuan et al, 2009). During replication, like transcription, PBl maintains canonical polymerase activity; however, the roles of PB2, PA, or any other viral components have remained elusive. While RdRp activity is known to be essential for both transcription and replication, the mechanism by which replication occurs, and how the virus switches from transcription to replication, is largely unknown. [0010] The RNA promoter for the influenza virus RdRp consists of 13 conserved nucleotides at the 5' end and 12 conserved nucleotides at the 3' end of the vRNA

(Robertson 1979; Hsu et al, 1987). These non-coding regions (NCRs), along with additional segment- specific bases, form a double stranded panhandle/corkscrew structure recognized by RdRp (Desselberger et al, 1980; Brownlee et al, 2002). Upon nuclear import of vRNPs, primary transcription is initiated. The RdRp associates with the secondary structure of the NCRs and initiates transcription beginning at the first 3' cytosine. The PB2 component of the RdRp usurps host mRNAs and PA cleaves the message approximately 10-13 bases downstream of the 5' cap; this fragment is then used by PB1 to synthesize viral mRNA (Dias et al, 2009; Fechter et al, 2003; Guilligay et al, 2008; Li et al, 2001; Plotch et al, 1981; Shi et al, 1995). The RdRp, loaded with the 5 ' capped host primer, associates with the secondary structure of the NCRs and initiates host primer-dependent transcription beginning at the first 3 ' cytosine (Plotch et al, 1981). Subsequent elongation of the transcript, like initiation, is dependent on a stable association with the 5' vRNA end (Honda et al., 1987). As the RdRp reaches the 5' end of the looped fragment, its association with the 3' NCR is believed to impose a steric hindrance on the polymerase as it transcribes a uracil-rich region (Poon et al., 1998; Hay et al, 1977). This restrictive mobility results in stuttering of the polymerase, generation of a polyA tail, and the production of mRNA (Krug 1981; Robertson et al., 1981). Taken together, the cap-snatching ability of PA and PB2 and polymerase function of PB1 encompass the transcriptase activity of the virus.

[0011] Accumulation of viral mRNA, and subsequent protein production, must be followed by a switch to viral genomic replication (i.e., replicase activity) for the assembly of progeny virions (see Figure 5A). However, as mRNA transcripts are incomplete copies of the vRNA, they cannot be used as substrates for genomic synthesis (Fields et al, 2007). As a result, the virus must prioritize its replicative cycle to bias mRNA synthesis early in infection while switching to the production of vRNA when new virions are to be assembled (Shapiro & Krug, 1988). In contrast to transcription, generation of cRNA and vRNA occurs in a primer-independent manner (Shapiro & Krug, 1988) and the resulting cRNA is a complete copy of the vRNA including NCRs with exposed 5' triphosphates (Young & Content 1971). In order for the RdRp to extend to the 5 ' vRNA NCR, the secondary structure of the viral segment must release the steric hindrance utilized during transcription (i.e., transcriptase activity), and thus prevent stuttering and polyadenylation. This suggests that a linear viral segment is more amenable to cRNA/vRNA synthesis whereas a circular viral segment, mediated by the panhandle/corkscrew structure, is required for transcription. This model is supported by data demonstrating that vRNPs are predominantly circular at 4 hours post infection (hpi) but transition to a linear form by 8.5 hpi, at a time when replication is prevalent (Hsu et al, 1987). This model has been challenged, however, by studies demonstrating the requirement for the RdRp to interact with the 5 ' end in order to initiate RNA synthesis at the 3' end (Brownlee & Sharps 2002; Poon et al, 1998; Fodor et al, 1994). The requirement for 3 ' and 5 ' NCR association throughout the viral life cycle has led to alternative virus replication models that include: cRNA stability, the intracellular levels of nucleotides, and the soluble fractions of NP and/or the RdRp as contributing factors of this critical step in the viral life cycle (Shapiro & Krug 1988; Vreede et al, 2008; Vreede et al, 2004; Jorba et al, 2009). While each of these studies provides a molecular basis for how this switch might be controlled, the apparent conundrum of genomic linearity and NCR association has not been resolved. In order to fulfill genome end association while permitting complete RNA synthesis, the virus must in some way provide for a double stranded motif to reconstitute the promoter. As current models fail to reconcile these constraints, the true underlying mechanism for the switch from transcriptase to replicase activity remains elusive.

3. SUMMARY

[0012] This application is based, in part, on the discovery of small viral RNAs (svRNAs) produced by influenza virus and the inhibition or reduction in viral titers when the small viral RNA is targeted. One basis for this application is the discovery that, without being bound by theory, svRNAs expressed by influenza viruses are involved in regulating viral replication by, e.g., regulating the switch from transcription to replication of the viral genome. Without being bound by any theory, compounds that modulate the expression or activity of such small viral RNAs can modulate the switch between transcription and replication of the viral genome and, thus, can modulate the production of viral particles. In one aspect, compounds that modulate the switch between transcription and replication of the Orthomyxovirus viral genome may be used as antivirals. In other aspects, compounds that modulate the switch between

transcription and replication of the Orthomyxovirus viral genome can be used in the production of attenuated Orthomyxoviruses, and for example have utility in the manufacture of vaccines. In certain aspects, compounds that modulate the switch between transcription and replication of the Orthomyxovirus viral genome can be used to selectively modulate the production of one or more Orthomyxovirus genome segments or mRNA transcripts and, in turn, can selectively modulate the production of one or more Orthomyxovirus proteins.

[0013] In one aspect, described herein are Orthomyxovirus svRNAs. In specific embodiments, the svRNA is a single stranded RNA identical to the 5 ' end of the viral genomic RNA (vRNA) and complementary to the 3 ' end of the complementary viral RNA genome (cRNA). In one embodiment, an svRNA is generated from the 5' end(s) of Orthomyxovirus genomic RNA (alternatively referred to herein as "vRNA") by RNA- dependent RNA polymerase (RdRp) cleavage. In one embodiment, an svRNA is generated from the 3 ' end(s) of the Orthomyxovirus genomic cRNA by RdRp machinery. In one embodiment, the svRNA interacts with the 3 ' end of the vRNA. In another embodiment, the svRNA interacts with the 3 ' end of the cRNA. In some embodiments, the svRNA interacts with the 3' ends of both Orthomyxovirus vRNA and cRNA.

[0014] In some embodiments, the Orthomyxovirus svRNA is a Thogotovirus svRNA, such as, e.g., an svRNA of a Thogoto virus, Dhori virus, Batken virus,

Quaranfil virus, Johnston Atoll virus or Lake Chad virus. In one embodiment, a consensus svRNA for Thogoto viruses comprises the nucleobase sequence 5'- AGAGAUAUCAAAGCAGUUUUU-3 ' .

[0015] In certain embodiments, the Orthomyxovirus svRNA is an Isavirus svRNA, such as an svRNA of an infectious salmon anemia virus. In one embodiment, a consensus svRNA for Isaviruses, such as infectious salmon anemia viruses, comprises the nucleobase sequence

5 ' -UUAAAC ACC AUAUUCAUCC AUCAGGUCUUCUUUUU-3 ' .

[0016] In a specific embodiment, the Orthomyxovirus svRNA is an influenza virus svRNA. Sections 5.1, 6 and 7 below describe influenza virus svRNAs. Figure 1C provides an exemplary consensus influenza A svRNA nucleobase sequence. In a specific embodiment, the influenza virus svRNA is an influenza A virus svRNA. In some embodiments, the influenza virus svRNA is a segment-specific svRNA with one of the sequences listed in Table 4 below. In one embodiment, a consensus svRNA for all 8 influenza A viral genome segments comprises the nucleobase sequence 5'- AGUAGAAACAAGG-X14-X15-X16-UUUUU-X22-X23-X24-X25-X26-X27-X28-3', wherein Xs denote segment specific bases, and X23- 28 are either segment specific bases or are absent. In some such embodiments:

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X₂₂ is U, C, or G;

X₂3 is U or C or A or is absent;

X₂4 is U, C, A, G, or is absent;

X₂5 is U, C, A, G, or is absent;

X₂6 is U or A or is absent;

X₂7 is U or C or is absent; and

X₂₈ is U, C, A, G, or is absent.

[0017] In some embodiments, the influenza virus svRNA is an influenza B virus svRNA. In one embodiment, a consensus svRNA for all 8 influenza B viral genome segments comprises the nucleobase sequence 5'-

AGUAG(AAJ)AACAA(G/C)(A/G)(G/C)Xi₅(A/C)UUUUU-X₂i-X₂₂-X₂₃-X₂4-X₂5-X₂6- X₂₇-3', wherein Xs denote segment specific bases, and X₂₂-X₂₇ are either segment specific bases or are absent. In some such embodiments:

Xis is U, C, A, or G;

X21 is U, C, A, or G;

X₂₂ is U, C, A, G or is absent;

X₂₃ is U, C, A, G or is absent;

X₂4 is U, C, A, G or is absent;

X₂5 is U, C, A, G or is absent;

X₂₆ is U, C, A, G or is absent; and

X₂₇ is U, C, A, G or is absent.

[0018] In some embodiments, the influenza virus svRNA is an influenza C virus svRNA. In one embodiment, a consensus svRNA for all 7 influenza C viral genome segments comprises the nucleobase sequence 5'-AGCA(A/G)UAGCAAGG-Xi4-Xi₅- Xi6-UUUUU-X₂₂-X₂₃-X₂4-X₂5-X₂6-X₂7-X₂8-3', wherein Xs denote segment specific bases, and X₂₂-X₂g are either segment specific bases or are absent. In some such embodiments:

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X22 is U, C, A, G or is absent;

X23 is U, C, A, G or is absent;

X24 is U, C, A, G or is absent;

X25 is U, C, A, G or is absent;

X26 is U, C, A, G or is absent;

X27 is U, C, A, G or is absent; and

X₂8 is U, C, A, G or is absent.

[0019] In one embodiment, a consensus svR A for influenza A virus, influenza B virus and/or influenza C virus comprises the nucleobase sequence 5'-AG(U/C)AG-X6-A- X8-CAAG-Xi3-Xi4-Xi5-Xi6-UUUUU-3', wherein Xs denote bases that may vary among segments of the influenza virus and/or the strain, type, or subtype of the influenza virus. In some such embodiments:

X₆ is U, C, A, or G;

X₈ is U, C, A, or G;

Xi4 is U, C, A, or G;

Xi5 is U, C, A, or G; and

Xie is U, C, A, or G.

[0020] In another aspect, described herein are compounds that modulate the expression or activity of svRNAs produced by Orthomyxoviruses. In certain

embodiments, described herein are compounds that increase vRNA levels and decrease viral mRNA levels. In some embodiments, such compounds increase the expression or activity of svRNAs. An example of such a compound is an svRNA mimetic, such as a synthetic svRNA described in Section 5.2 below.

[0021] For example, in some embodiments, a nucleic acid compound that mimics or increases Thogotovirus svRNA expression or activity comprises the nucleobase sequence 5'-AGAGAUAUCAAAGCAGUUUUU-3'.

[0022] In certain embodiments, a nucleic acid compound that mimics or increases Isavirus, such as infectious salmon anemia virus, svRNA expression or activity comprises the nucleobase sequence

5 ' -UUAAAC ACC AUAUUCAUCC AUCAGGUCUUCUUUUU-3 ' .

[0023] In some embodiments, a nucleic acid compound that mimics or increases influenza A virus svRNA expression or activity comprises the consensus nucleobase sequence 5*-AGUAGAAACAAGG-Xi4-Xi5-Xi6-UUUUU-X₂2-X23-X24-X25-X26-X27- X₂8-3', wherein Xs denote segment specific bases, and X23-X28 are either segment specific bases or are absent. In some such embodiments,

Xi₄ is U, C, A, or G;

Xis is U, C, A, or G;

Xi₆ is U, C, A, or G;

X₂₂ is U, C, or G;

X23 is U or C or A or is absent;

X24 is U, C, A, G, or is absent;

X25 is U, C, A, G, or is absent;

X26 is U or A or is absent;

X27 is U or C or is absent; and

X28 is U, C, A, G or is absent.

[0024] In some embodiments, the nucleic acid compound mimics or increases influenza B virus svRNA expression or activity. In one embodiment, the nucleic acid compound that mimics or increases influenza B svRNA expression or activity comprises the consensus nucleobase sequence 5'- AGUAG(A/T)AACAAG-Xi₃-Xi₄-Xi₅-UUUUU- X21-X22-X23-X24-X25-X26-X27-3', wherein Xs denote segment specific bases, and X21-X27 are either segment specific bases or are absent. In some such embodiments,

Xis is U, C, A, or G;

Xi₄ is U, C, A, or G;

Xis is U, C, A, or G;

X₂₁ is U or C or A or is absent;

X₂₂ is U or C or A or is absent;

X₂₃ is U or C or A or is absent;

X24 is U or C or A or is absent;

X25 is U or C or A or is absent;

X26 is U or C or A or is absent; and

X27 is U or C or A or is absent.

[0025] In another embodiment, the nucleic acid compound mimics or increases influenza C virus svRNA expression or activity. In one embodiment, the nucleic acid compound that mimics or increases influenza C svRNA expression or activity comprises the consensus nucleobase sequence 5'-AGCAGUAGCAAGG-Xi₄-Xi₅-Xi₆-UUUUU- X22-X23-X24-X25-X26-X27-X28-3', wherein Xs denote segment specific bases, and X22-X28 are either segment specific bases or are absent. In some such embodiments,

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X22 is U or C or A or is absent;

X23 is U or C or A or is absent;

X24 is U or C or A or is absent;

X25 is U or C or A or is absent;

X26 is U or C or A or is absent;

X27 is U or C or A or is absent; and

X₂8 is U or C or A or is absent.

[0026] In some embodiments, the nucleic acid compound that mimics or increases svRNA expression or activity is a pan-specific nucleic acid compound (i.e., it is not specific to a particular genome segment, or is not specific to a particular type, subtype, or strain of Orthomyxovirus). In some embodiments, the nucleic acid compound that mimics or increases svRNA expression or activity recognizes a particular

Orthomyxovirus genome segment. In other embodiments, the nucleic acid compound that mimics or increases svRNA expression or activity recognizes each genome segment of a particular Orthomyxovirus equally. In some embodiments, the pan-specific nucleic acid compounds comprise a heterogeneous population of oligonucleotides that share complementarity at conserved positions but randomly incorporate nucleotides at the non-conserved positions. For example, in one embodiment, the pan- specific nucleic acid compound comprises the nucleobase sequence 5'-

AGUAGAAACAAGG NNUUUUU-3 ' , wherein the three "N" positions randomly incorporate A,T,C, or U. In one embodiment, the pan-specific nucleic acid compound is a synthetic svRNA comprising the nucleobase sequence 5'- AGUAGAAACAAGGGUGUUUUUUUGUCAC-3'. In some embodiments, the synthetic svRNA is encoded by a DNA nucleobase sequence comprising 5'- AGTAGAAAC AAGGGTGTTTTTTTGTC AC-3 ' , which may be single or double stranded. In some embodiments, the pan-specific nucleic acid compound is a synthetic svRNA that mimics the activity of svRNAs of influenza A virus, influenza B virus and/or influenza C virus. In one embodiment, a nucleic acid compound that mimics or increases influenza A virus, influenza B virus and/or influenza C virus svRNA expression or activity comprises the consensus nucleobase sequence 5'-AG(U/C)AG-X6- A-X8-CAAG-Xi3-Xi4-Xi5-Xi6-UUUUU-3', wherein Xs may denote bases that may vary among segments of the influenza virus and/or the strain, type, or subtype of the influenza virus. In an exemplary embodiment, the synthetic svRNA that mimics the activity of svRNAs of influenza A virus, influenza B virus and/or influenza C virus comprises the nucleobase sequence 5'- AGUAGUAUCAAGUUUUUUUUU -3'.

[0027] In another aspect, described herein are compounds that decrease vRNA levels and increase viral mRNA levels. In some embodiments, such compounds decrease the expression or activity of svRNAs. An example of such a compound is an anti-svRNA compound (e.g., an antisense compound), such as described in Section 5.2 below. In certain embodiments, as used herein, an anti-svRNA compound comprises a nucleic acid sequence that can bind to and inhibit the action of endogenous svRNA. In some embodiments, the anti-svRNA is generated within a cell. In some embodiments, the anti-svRNA compound is not specific to a particular genome segment, or is not specific to a particular type, subtype, or strain of Orthomyxovirus, or both. In some

embodiments, the anti-svRNA compound is specific to a particular genome segment. In some embodiments, the anti-svRNA compound is specific to a particular type, subtype, or strain of Orthomyxovirus. In some embodiments, the anti-svRNA compound is specific to a particular segment of a particular strain, type, or subtype of

Orthomyxovirus. For example, in some embodiments, the anti-svRNA compound is an influenza A segment-specific locked nucleic acid (LNA) anti-svRNA (see, e.g., Section 5.2.2).

[0028] In certain embodiments, the anti-svRNA Compound is a Thogotovirus anti- svRNA. In one embodiment, the Thogotovirus anti-svRNA has a nucleobase sequence comprising or consisting of 5'- AAAAACUGCUUUGAUAUCUCU-3'.

[0029] In certain embodiments, the anti-svRNA Compound is an Isavirus, e.g., infectious salmon anemia virus, anti-svRNA. In one embodiment, the Isavirus anti- svRNA has a nucleobase sequence comprising or consisting of 5'- AAAAAGAAGACCUGAUGGAUGAAU-3 ' .

[0030] In some embodiments, the anti-svRNA compound reduces or inhibits the expression or activity of svRNAs from influenza A virus, influenza B virus and/or influenza C virus. In one embodiment, an anti-svRNA compound (e.g., an LNA anti- svRNA compound) that reduces or inhibits the expression or activity of svRNAs from influenza A virus, influenza B virus and/or influenza C virus comprises the nucleobase sequence 5'- AAAAAUUUCCUUGUUUCUUCU -3'.

[0031] In some embodiments, the compounds described herein may modulate the expression or activity of svRNAs from more than one Orthomyxovirus type, subtype, or strain. For example, the compound may modulate the expression or activity of svRNAs from one or more Thogotoviruses (e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus or Lake Chad virus), one or more Isaviruses (e.g., infectious salmon anemia virus) and/or one or more influenza viruses (e.g., influenza A virus, influenza B virus or influenza C virus). In some embodiments, the compound may modulate the expression or activity of svRNAs from more than one influenza virus type, subtype, or strain.

[0032] In another aspect, described herein are compositions comprising one or more compounds that modulate the expression or activity of svRNAs (see, e.g., the foregoing compounds and Section 5.2 for exemplary compounds) and which can be used in any of the methods described herein. In a specific embodiment, such compositions comprise an amount of a compound described herein that is effective to modulate Orthomyxovirus, e.g., influenza virus or Isavirus (e.g., infectious salmon anemia virus), replication. In one embodiment, a composition described herein may comprise an amount of a compound described herein that is effective to reduce or inhibit Orthomyxovirus, e.g., influenza virus or Isavirus (e.g., infectious salmon anemia virus), replication. Such compositions may be pharmaceutical compositions, which may additionally comprise one or more pharmaceutically acceptable carriers known in the art or described herein and, in certain embodiments, one or more additional active agents known in the art or described herein. In some embodiments, a pharmaceutical composition may comprise an amount of a compound described herein that is effective to treat an Orthomyxovirus, e.g., influenza virus or Isavirus (e.g., infectious salmon anemia virus), infection. In some embodiments, the pharmaceutical composition may comprise an amount of a compound described herein that is effective to prevent or treat a symptom or disease associated with an Orthomyxovirus, e.g., influenza virus or Isavirus (e.g., infectious salmon anemia virus), infection, in accordance with the methods described herein.

[0033] In another aspect, described herein are methods for regulating the life cycle of an Orthomyxovirus, such as, e.g., an influenza virus or an Isavirus (e.g., infectious salmon anemia virus) comprising contacting a substrate with a compound that modulates the activity or expression of svRNAs prior to, concurrently with or subsequent to infecting the substrate with the Orthomyxovirus. In some embodiments, the substrate is contacted with the compound and then infected with an Orthomyxovirus. In some embodiments, the substrate is infected with the Orthomyxovirus and then contacted with the compound. In some embodiments, the substrate is contacted with the compound and concurrently infected with the Orthomyxovirus. Contact of the substrate with the compound can be accomplished by exposing the substrate to the compound, for example, by delivering the compound into the substrate or by inducing the substrate to express the compound.

[0034] In one embodiment, described herein is a method for regulating the life cycle of an influenza virus comprising contacting a substrate with a compound that modulates the activity or expression of svRNAs, and infecting the substrate with the influenza virus. In another embodiment, described herein is a method for regulating the life cycle of an influenza virus, comprising contacting a substrate infected with an influenza virus with a compound that modulates the activity or expression of svRNAs. In another embodiment, described herein is a method for regulating the life cycle of an influenza virus, comprising contacting a substrate with a compound that modulates the activity or expression of svRNAs and concurrently infecting the substrate with an influenza virus. The influenza virus can be any type, strain or subtype of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus.

[0035] In a specific embodiment, a compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svRNA described in Section 5.2 below. In another embodiment, a compound that decreases the activity or expression of svRNAs is an anti-svRNA compound, for example, a locked nucleic acid (LNA) anti-svRNA described in Section 5.2 below.

[0036] In another aspect, described herein are methods for increasing vRNA levels and decreasing viral mRNA levels of an Orthomyxovirus, e.g. , influenza virus or Isavirus (e.g., infectious salmon anemia virus), comprising contacting a substrate with a compound that increases the activity or expression of svRNAs prior to, concurrently with, or subsequent to infecting the substrate with the Orthomyxovirus. In some embodiments, the substrate is contacted with the compound and then infected with an Orthomyxovirus. In some embodiments, the substrate is infected with the

Orthomyxovirus and then contacted with the compound. In some embodiments, the substrate is contacted with the compound and concurrently infected with the

Orthomyxovirus. Contact of the substrate with the compound could be accomplished by exposing the substrate to the compound, for example, by delivering the compound into the substrate or by inducing the substrate to express the compound. An example of a compound that increases the activity or expression of svRNAs is an svR A mimetic, such as a synthetic svRNA described in Section 5.2 below.

[0037] In one embodiment, described herein is a method for increasing vRNA levels and decreasing viral mRNA levels of an influenza virus, comprising contacting a substrate with a compound that increases the activity or expression of svRNAs and infecting the substrate with the influenza virus. In another embodiment, described herein is a method for increasing vRNA levels and decreasing viral mRNA levels of an influenza virus, comprising contacting a substrate infected with an influenza virus with a compound that increases the activity or expression of svRNAs. The influenza virus can be any strain, type or subtype of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus.

[0038] In another aspect, described herein are methods for decreasing vRNA levels and increasing viral mRNA levels of an Orthomyxovirus, e.g., influenza virus or Isavirus (e.g., infectious salmon anemia virus), comprising contacting a substrate with a compound that decreases the activity or expression of svRNAs prior to, concurrently with, or subsequent to infecting the substrate with the Orthomyxovirus. In some embodiments, the substrate is contacted with the compound and then infected with an Orthomyxovirus. In some embodiments, the substrate is infected with the

Orthomyxovirus. Contact of the substrate with the compound could be accomplished by exposing the substrate to the compound, for example, by delivering the compound into the substrate or by inducing the substrate to express the compound. An example of a compound that decreases the activity or expression of svRNAs is an anti-svRNA compound, such as described in Section 5.2 below. In a specific embodiment, the anti- svRNA compound is an LNA anti-svRNA described in Section 5.2 below.

[0039] In one embodiment, described herein is a method for decreasing vRNA levels and increasing viral mRNA levels of an influenza virus, comprising contacting a substrate with a compound that decreases the activity or expression of svRNAs, and infecting the substrate with an influenza virus. In another embodiment, described herein is a method for decreasing vRNA levels and increasing viral mRNA levels of an influenza virus, comprising contacting a substrate infected with an influenza virus with a compound that decreases the activity or expression of svRNAs. The influenza virus can be any strain or subtype of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus.

[0040] In another aspect, described herein are methods for inhibiting or reducing Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising contacting a compound that modulates the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce Orthomyxovirus replication prior to, concurrently with, or subsequent to infecting the substrate with the Orthomyxovirus. In one embodiment, described herein is a method for inhibiting or reducing Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising contacting a compound that increases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce Orthomyxovirus replication, and infecting the substrate with the

Orthomyxovirus. In one embodiment, described herein is a method for inhibiting or reducing Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising contacting a compound that increases the expression or activity of svRNAs with a substrate infected with an Orthomyxovirus in an amount effective to inhibit or reduce Orthomyxovirus replication. In a specific embodiment, described herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a compound that increases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce influenza virus replication, and infecting the substrate with an influenza virus. In another embodiment, described herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a compound that increases the expression or activity of svRNAs with a substrate infected with an influenza virus in an amount effective to inhibit or reduce influenza virus replication. The influenza virus can be any strain, type or subtype of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svRNA, such as described in Section 5.2 below.

[0041] In another embodiment, described herein is a method for inhibiting or reducing Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising contacting a compound that decreases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce Orthomyxovirus replication, and then infecting the substrate with the Orthomyxovirus. In another embodiment, described herein is a method for inhibiting or reducing Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising contacting a compound that decreases the expression or activity of svR As with a substrate infected with an Orthomyxovirus in an amount effective to inhibit or reduce Orthomyxovirus replication. In a specific embodiment, described herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a compound that decreases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce influenza virus replication, and then infecting the substrate with the influenza virus. In another specific embodiment, described herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a compound that decreases the expression or activity of svRNAs with a substrate infected with an influenza virus in an amount effective to inhibit or reduce influenza virus replication. The influenza virus can be any type, strain or subtype of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a compound that decreases the activity or expression of svRNAs is an anti-svRNA compound, such as described in Section 5.2 below. In a specific embodiment, the anti-svRNA compound is an LNA anti-svRNA described in Section 5.2 below.

[0042] In another aspect, described herein are methods for treating an

Orthomyxovirus infection, comprising administering to a subject an effective amount of a compound (or pharmaceutical composition thereof) that modulates the expression or activity of svRNAs. In one embodiment, described herein is a method for treating an Orthomyxovirus infection, comprising administering to a subject an effective amount of a compound that increases the expression or activity of svRNAs. In a specific embodiment, described herein is a method for treating an influenza virus infection, comprising administering to a subject an effective amount of a compound that increases the expression or activity of svRNAs. The influenza virus can be any strain, type or subtype of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svRNA described in Section 5.2 below. In a specific embodiment, described herein is a method for treating an influenza A virus infection, comprising administering to a subject an effective amount of a synthetic svRNA described in Section 5.2 below. In another embodiment, described herein is a method for treating an influenza B virus infection, comprising administering to a subject an effective amount of a synthetic svRNA described in Section 5.2 below. In another embodiment, described herein is a method for treating an influenza C virus infection, comprising administering to a subject an effective amount of a synthetic svRNA described in Section 5.2 below.

[0043] In one embodiment, described herein is a method for treating an

Orthomyxovirus infection, comprising administering to a subject an effective amount of a compound that decreases the expression or activity of svRNAs. In a specific embodiment, described herein is a method for treating an influenza virus infection, comprising administering to a subject an effective amount of a compound that decreases the expression or activity of svRNAs. The influenza virus can be any strain, type or subtype of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a compound that decreases the activity or expression of svRNAs is an anti-svRNA compound, such as described in Section 5.2 below. In a specific embodiment, described herein is a method for treating an influenza A virus infection, comprising administering to a subject an effective amount of an LNA anti- svRNA described in Section 5.2 below. In a specific embodiment, described herein is a method for treating an influenza B virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA described in Section 5.2 below. In another specific embodiment, described herein is a method for treating an influenza C virus infection, comprising administering to a subject an effective amount of an LNA anti- svRNA described in Section 5.2 below.

[0044] In another aspect, described herein are methods for preventing or treating a symptom or disease associated with an Orthomyxovirus, e.g. , influenza virus or Isavirus {e.g., infectious salmon anemia virus), infection, comprising administering to a subject an effective amount of a compound that modulates the expression or activity of svRNAs. In one embodiment, described herein is a method for preventing or treating a symptom or disease associated with an Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), infection, comprising administering to a subject an effective amount of a compound that increases the expression or activity of svRNAs. In a specific embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza virus infection, comprising

administering to a subject an effective amount of a compound that increases the expression or activity of svRNAs. The influenza virus can be any strain, type or subtype of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus. An example of a compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svR A described in Section 5. 2 below. In a specific embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza A virus infection, comprising administering to a subject an effective amount of a synthetic svRNA described in Section 5.2 below. In another embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza B virus infection, comprising administering to a subject an effective amount of a synthetic svRNA described in Section 5.2 below. In another embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza C virus infection, comprising administering to a subject an effective amount of a synthetic svRNA described in Section 5.2 below.

[0045] In one embodiment, described herein is a method for preventing or treating a symptom or disease associated with an Orthomyxovirus, e.g. , influenza virus or Isavirus {e.g., infectious salmon anemia virus), infection, comprising administering to a subject an effective amount of a compound that decreases the expression or activity of svRNAs. In a specific embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza virus infection, comprising

administering to a subject an effective amount of a compound that decreases the expression or activity of svRNAs. The influenza virus can be any strain, type or subtype of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus. An example of a compound that decreases the activity or expression of svRNAs is an anti-svRNA compound, such as described in Section 5.2 below. In a specific embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza A virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA described in Section 5.2 below. In a specific embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza B virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA described in Section 5.2 below. In another specific embodiment, described herein is a method for preventing or treating a symptom or disease associated with an influenza C virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA described in Section 5.2 below.

[0046] In certain of the above embodiments, the subject is a mammal. In certain embodiments, the mammalian subject is a human. In certain embodiments, the subject is a non-human mammal. In certain embodiments, the mammalian subject is a pig. In certain embodiments, the mammalian subject is a horse. In certain embodiments, the subject is a fish. In certain embodiments, the subject is an avian (chicken, duck, etc.).

[0047] In another aspect, described herein is a method for inhibiting or reducing Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising engineering a substrate so that its genome encodes a compound that, upon expression, modulates the expression or activity of svR As in an amount effective to inhibit or reduce Orthomyxovirus replication. In one embodiment, described herein is a method for inhibiting or reducing Orthomyxovirus, e.g. , influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising engineering a substrate so that its genome encodes a compound {e.g. , an svR A mimetic) that, upon expression, increases the expression or activity of svRNAs in an amount effective to inhibit or reduce Orthomyxovirus replication. In another embodiment, described herein is a method for inhibiting or reducing Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), replication, comprising engineering a substrate so that its genome encodes a compound {e.g. , an anti-svR A) that, upon expression, decreases the expression or activity of svRNAs in an amount effective to inhibit or reduce Orthomyxovirus replication. In some of the foregoing embodiments, the compound encoded by the genome is stably integrated into the genome.

[0048] In certain embodiments, the substrate is a cell. In certain embodiments, the substrate is a zygote. In certain embodiments, the substrate is an embryonic stem cell or embryonic germ cell. In certain embodiments, the substrate is an egg, such as a fish egg or an avian egg. In certain embodiments, the substrate is a blastodisc or blastocyst. In certain embodiments, the substrate is a somatic cell {e.g., a fibroblast). In certain embodiments, the substrate is an animal, such as, e.g., a fish {e.g., salmon), avian (chicken, duck, etc.), or mammal {e.g., mouse, pig, horse, human, etc.). In certain embodiments, the substrate is a transgenic animal. In certain embodiments, the transgenic animal is a non-human animal.

[0049] In another aspect, described herein are methods for preventing or treating a symptom or disease associated with an Orthomyxovirus, e.g. , influenza virus or Isavirus {e.g., infectious salmon anemia virus), infection, comprising engineering a substrate so that its genome encodes a compound that, upon expression, modulates the expression or activity of svRNAs in an amount effective to prevent or treat the symptom or disease associated with Orthomyxovirus infection. In one embodiment, described herein is a method for preventing or treating a symptom or disease associated with an

Orthomyxovirus, e.g., influenza virus or Isavirus {e.g., infectious salmon anemia virus), infection, comprising engineering a substrate so that its genome encodes a compound {e.g. , an svR A mimetic) that, upon expression, increases the expression or activity of svRNAs in an amount effective to prevent or treat the symptom or disease associated with Orthomyxovirus infection. In another embodiment, described herein is a method for preventing or treating a symptom or disease associated with an Orthomyxovirus, e.g. , influenza virus or Isavirus {e.g., infectious salmon anemia virus), infection, comprising engineering a substrate so that its genome encodes a compound {e.g., an anti-svR A) that, upon expression, decreases the expression or activity of svRNAs in an amount effective to prevent or treat the symptom or disease associated with Orthomyxovirus infection. In some of the foregoing embodiments, the compound encoded by the genome is stably integrated into the genome.

[0050] In certain embodiments, the substrate is a cell. In certain embodiments, the substrate is a zygote. In certain embodiments, the substrate is an embryonic stem cell or embryonic germ cell. In certain embodiments, the substrate is an egg, such as a fish egg or an avian egg. In certain embodiments, the substrate is a blastodisc or blastocyst. In certain embodiments, the substrate is a somatic cell {e.g., a fibroblast). In certain embodiments, the substrate is a transgenic animal, such as, e.g., a transgenic fish {e.g., salmon), avian (chicken, duck, etc.), or mammal {e.g., mouse, pig, horse, human, etc.).

[0051] In another aspect, described herein are methods of using compounds that modulate the expression or activity of Orthomyxovirus svRNAs for producing attenuated Orthomyxoviruses. In some embodiment, described herein are methods for producing an attenuated Orthomyxovirus comprising contacting a compound that decreases the expression or activity of Orthomyxovirus svRNAs with a substrate prior to, concurrently with, or subsequent to infecting the substrate with the Orthomyxovirus, and collecting the replication-deficient progeny viruses. In some embodiments, the substrate is contacted with the compound that decreases the expression or activity of Orthomyxovirus svRNAs and then infected with an Orthomyxovirus. In other embodiments, the substrate is infected with the Orthomyxovirus and then contacted with the compound. In some embodiments, the substrate is contacted with the compound and concurrently infected with the Orthomyxovirus.

[0052] In another aspect, described herein are uses of compounds that modulate the expression or activity of Orthomyxovirus svRNAs in the production Orthomyxoviruses for use as either live viral vaccines or inactivated viral vaccines. In some embodiments, described herein are methods for the manufacture of an Orthomyxovirus vaccine, comprising contacting a compound that decreases or inhibits the expression or activity of svR As with a substrate prior to, concurrently with, or subsequent to infection with the virus under conditions that permit production of replication-deficient virus, and purifying the replication-deficient virus. In some embodiments, the substrate is contacted with the compound and then infected with an Orthomyxovirus. In some embodiments, the substrate is infected with the Orthomyxovirus and then contacted with the compound. In some embodiments, the substrate is contacted with the compound and concurrently infected with the Orthomyxovirus. In another aspect, described herein are vaccine formulations comprising viruses, in particular, attenuated viruses, wherein the viruses have been grown or manufactured in accordance with a foregoing methods of attenuated Orthomyxovirus production. Also described herein are therapies in which a subject is administered an Orthomyxovirus vaccine, described herein or known in the art, in combination with a compound that modulates the expression or activity of Orthomyxovirus svRNAs, such an a compound that reduces or inhibits the expression or activity of Orthomyxovirus svRNAs, such as described in Section 5.2 below.

[0053] In certain of the above embodiments, the Orthomyxovirus is a Thogotovirus, such as, e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus or Lake Chad virus. In certain of the above embodiments, the Orthomyxovirus is an Isavirus, such as infectious salmon anemia virus. In certain of the above

embodiments, the Orthomyxovirus is influenza virus. In some embodiments, the influenza virus is an influenza A virus. In some embodiments, the influenza virus is an influenza B virus. In some embodiments, the influenza virus is an influenza C virus. In accordance with certain embodiments described herein, the influenza virus may be any type, subtype, or strain of influenza virus described herein (see, e.g., Section 5.1 below) or known in the art.

[0054] In another aspect, described herein are methods for selectively modulating production of specific Orthomyxovirus genome segments or viral mRNA transcripts, which in turn can selectively modulate the production of specific Orthomyxovirus proteins. In a specific embodiment, described herein are methods for selectively modulating production of specific influenza virus genome segments or viral mRNA transcripts, which in turn can selectively modulate the production of specific

Orthomyxovirus proteins. In certain embodiments, a compound that increases a specific segment's vRNA levels and decreases that segment's viral mRNA levels is used. In some embodiments, such a compound increases the expression or activity of a specific svRNA. An example of such a compound is an svRNA mimetic, e.g. , a synthetic svRNA, specific to a particular genome segment, such as described in Section 5.2. In certain embodiments, a compound that decreases a specific segment's vRNA levels and increases that segment's viral mRNA levels is used. In some embodiments, such a compound decreases the expression or activity of a specific svRNA. For example, in some embodiments, the compound decreases the expression or activity of an svRNA specific for influenza virus NA. In other embodiments, the compound decreases the expression or activity of an svRNA specific for another influenza virus genome segment. An example of such a compound is an anti-svRNA compound, such as an LNA anti- svRNA, specific to a particular genome segment, such described in Section 5.2 (see, e.g., Table 1). In certain embodiments, a combination of compounds is used to achieve the effect of modulating the expression or activity of one or more segment-specific svRNAs.

3.1 Terms

[0055] As used herein, the term "about" or "approximately" when used in

conjunction with a number refers to any number within 1, 5 or 10% of the referenced number.

[0056] As used herein, the terms "anti-svRNA" and "anti-svRNA compound" each refer to a compound that is capable of reducing or inhibiting the expression or activity of svRNAs. In some embodiments, the anti-svRNA or anti-svRNA compound inhibits or reduces the interaction between an Orthomyxovirus svRNA and the polymerase (for example, the interaction of an influenza virus svRNA and the polymerase subunits PA, PB1 and PB2), as measured using techniques known in the art (e.g.,

immunoprecipitation, Western blotting, optionally in combination with Northern blotting; Northwestern blotting; RNA dependent RNA polymerase activity, e.g. , measured using a Luciferase reporter; etc.). In some embodiments, the anti-svRNA or anti-svRNA compound binds to a target nucleic acid, such as svRNA, cRNA, or viral genomic RNA, or a portion thereof. In some embodiments, the anti-svRNA is a compound that binds to an svRNA. In some embodiments, the anti-svRNA or anti- svRNA compound is a nucleic acid compound. In some embodiments, the compound is capable of hybridizing to a target nucleic acid, through hydrogen bonding. In some embodiments, the compound is capable of covalently binding to a target nucleic acid. In some embodiments, the anti-svRNA compound is an LNA or peptide nucleic acid ("PNA") anti-svRNA. In some embodiments, the anti-svRNA compound is an antisense compound.

[0057] As used herein, the term "target nucleic acid" refers to a nucleic acid that comprises, or consists of, an svRNA sequence or the complement thereof. For example, the target nucleic acid can be svRNA, cRNA, or viral genomic RNA, or a portion thereof. In a specific embodiment, the target nucleic acid is an svRNA.

[0058] As used herein, the term "antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to the target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

[0059] As used herein, the term "Compound" or "Compounds" refer to an agent that modulates the expression and/or activity of svRNAs. Examples of such compounds are described herein. See, in particular, Section 5.2 and Examples 1 and 2.

[0060] As used herein, the term "effective amount" in the context of administering a therapy to a subject refers to the amount of a therapy that has a prophylactic and/or therapeutic effect(s). In certain embodiments, an "effective amount" in the context of administration of a therapy to a subject refers to the amount of a therapy which is sufficient to achieve one, two, three, four, or more of the following effects: (i) reduce or ameliorate the severity of a viral infection or a symptom or disease associated therewith;

(ii) reduce the duration of a viral infection or a symptom or disease associated therewith;

(iii) reduce or inhibit the progression of a viral infection or a symptom or disease associated therewith; (iv) cause regression of a viral infection or a symptom or disease associated therewith; (v) prevent the development or onset of a symptom or disease associated with a viral infection; (vi) reduce or prevent the recurrence of a viral infection or a symptom or disease associated therewith; (vii) reduce or prevent the spread of a virus from one cell to another cell, one tissue to another tissue, or one organ to another organ; (ix) reduce or prevent the spread of a virus from one subject to another subject; (x) reduce or prevent organ failure associated with a viral infection; (xi) reduce hospitalization of a subject; (xii) reduce hospitalization length; (xiii) increase the survival of a subject with a viral infection or a symptom or disease associated therewith; (xiv) increase the period of disease-free and/or symptom- free survival of a subject affected by or at risk for a viral infection; (xv) eliminate a virus infection or symptom or disease associated therewith; (xvi) inhibit or reduce virus replication; (xvii) inhibit or reduce the entry of a virus into a host cell(s); (xviii) inhibit or reduce replication of the viral genome; (xix) inhibit or reduce synthesis of viral proteins; (xx) inhibit or reduce assembly of viral particles; (xxi) inhibit or reduce release of viral particles from a host cell(s); (xxii) reduce viral titer; (xxiii) enhance or improve the prophylactic or therapeutic effect(s) of another therapy; (xxiv) reduce the number of symptoms associated with the Orthomyxovirus infection; and/or (xxv) improve the general quality of life of the subject as assessed by, e.g., questionnaire. In some embodiments, the "effective amount" of a therapy has a beneficial effect but does not cure a viral infection or disease associated therewith. In certain embodiments, the "effective amount" of a therapy may encompass the administration of multiple doses if a therapy at a certain frequency to achieve an amount of the therapy that has a prophylactic and/or therapeutic effect. In other situations, the "effective amount" of a therapy may encompass the administration of a single dose of a therapy at a certain amount. See Section 5.7.4, infra, for non-limiting examples of dosages and dosing regimens to achieve an effective amount.

[0061] In certain embodiments, the term "effective amount," in the context of contacting a compound with a virus substrate {e.g., cell, egg, animal, human, etc.) for reducing virus replication, refers to the amount of compound that reduces viral replication by at least 1.5 fold, 2, fold, 3, fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 100 fold, 500 fold, or 1000 fold relative to virus replication in the absence of compound or the presence of a negative control. In a specific embodiment, the compound reduces virus replication by at least 2 log relative to virus replication in the absence of compound or the presence of a negative control. In certain embodiments, the compound reduces virus replication by 1.5 to 3 fold, 2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 fold, 25 to 50 fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 fold, 500 to 1000 fold, or 10 to 1000 fold. In a specific

embodiment, the compound reduces virus replication by approximately 2 logs or more, approximately 3 logs or more, approximately 4 logs or more, approximately 5 logs or more, or 2 to 10 logs or 2 to 5 logs relative to virus replication in the absence of compound or the presence of a negative control.

[0062] In some embodiments, as used herein, a compound that modulates, increases, or decreases the "expression or activity" of a viral svR A affects the expression of the svRNA, the activity of the svRNA, or both. In a specific embodiment, a compound that modulates, increases, or decreases the "expression or activity" of a viral svRNA affects the activity of the svRNA. In some embodiments, a compound that modulates, increases, or decreases the "expression or activity" of a viral svRNA affects the activity of the viral svRNA but not the expression of the svRNA.

[0063] As used herein, the terms "hybridize," "hybridizes," and "hybridization" refer to the annealing of complementary nucleic acid molecules. In some embodiments, a nucleic acid molecule hybridizes across an entire svRNA sequence or the complement thereof, or across a portion of the svRNA sequence or its complement. In certain embodiments, the terms "hybridize," "hybridizes," and "hybridization" as used herein refer to the binding of two or more nucleic acid sequences that are at least 60% (e.g. , 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 99.5%) complementary to each other. In certain embodiments, the hybridization is under high stringency conditions. In certain embodiments the hybridization is under moderate (i.e., medium) stringency conditions. In certain embodiments the hybridization is under low stringency conditions. In some embodiments, two nucleic acids hybridize to one another if they are not fully

complementary, for example, they hybridize under low- to medium-stringency conditions. Those of skill in the art will understand that low, medium and high stringency conditions are contingent upon multiple factors all of which interact and are also dependent upon the specific properties of the nucleic acids involved. In certain embodiments, a nucleic acid hybridizes to its complement only under high stringency conditions. For example, typically, high stringency conditions may include temperatures within 5°C melting temperature of the nucleic acid(s), a low salt concentration (e.g., less than 250 mM), and a high co-solvent concentration (e.g., 1-20% of co-solvent, e.g., DMSO). Low stringency conditions, on the other hand, may include temperatures greater than 10°C below the melting temperature of the nucleic acid(s), a high salt concentration (e.g., greater than 1000 mM) and the absence of co-solvents. Nucleic acid hybridization techniques and conditions are known in the art and have been described, e.g., in Sambrook et al. Molecular Cloning A Laboratory Manual, 2nd Ed. Cold Spring Lab. Press, December 1989; U.S. Pat. Nos. 4,563,419 and 4,851,330, and in Dunn et al, 1978, Cell 12: 23-26, among many other publications. Various modifications to the hybridization reactions are known in the art.

[0064] As used herein, the term "in combination," in the context of contacting two or more compounds or compositions to a substrate, or administering two or more compounds or compositions to a subject, or administering two or more therapies to a subject, refers to the use of more than one compound, composition, or therapy. In some embodiments, the two compounds may be formulated together in a single composition. The use of the term "in combination" does not restrict the order in which the

compounds, compositions or therapies are administered. A first compound, composition or therapy can be contacted or administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the contacting with or administration of a second compound, composition or therapy. In certain embodiments, the use of more than one compound, composition, or therapy is referred to herein as "combination therapy."

[0065] As used herein, the term "infection" means the invasion by, multiplication and/or presence of a virus in a cell, tissue, or subject. In one embodiment, an infection is an "active" infection, i.e., one in which the virus is replicating in a cell, tissue, subject or other substrate. Such an infection may be characterized by the spread of the virus to other cells, tissues, organs, and/or subjects from the cells, tissues, organs, and/or subjects initially infected by the virus. An infection may also be a latent infection, i.e., one in which the virus is not replicating.

[0066] As used herein, the term "locked nucleic acid" or "LNA" refers to an oligonucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. In some embodiments, the modification results in a more stable binding of the nucleotide to its complement.

[0067] As used herein, the numeric term "log" refers to logio.

[0068] As used herein, the phrase "multiplicity of infection" or "MOI" is the average number of virus per infected cell. The MOI is determined by dividing the number of virus added (ml added x PFU) by the number of cells added (ml added x cells/ml).

[0069] As used herein, the term "nucleic acid" refers to deoxyribonucleotides, deoxyribonucleic acids, ribonucleotides, and ribonucleic acids, and oligomeric and polymeric forms thereof, and analogs thereof, and includes either single- or double- stranded forms. Nucleic acids include naturally occurring nucleic acids, such as deoxyribonucleic acid ("DNA") and ribonucleic acid ("RNA") as well as nucleic acid analogs. Nucleic acid analogs include those which contain non-naturally occurring bases, nucleotides that engage in linkages with other nucleotides other than the naturally occurring phosphodiester bond or which contain bases attached through linkages other than phosphodiester bonds. Thus, nucleic acid analogs include, for example and without limitation, locked-nucleic acids (LNAs), peptide-nucleic acids (PNAs), morpholino nucleic acids, glycolnucleic acid (GNA), threose nucleic acid (TNA), phosphorothioates, phosphorodithioates, phosphorotriesters, phosphoramidates, boranophosphates, methylphosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and the like. In certain embodiments, as used herein, the term "nucleic acid" refers to a molecule composed of monomeric nucleotides.

[0070] As used herein, the term "nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein, the term "nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification. For example, the nucleobase sequence can be a sequence of RNA bases (cytosine, guanine, adenine, uracil, abbreviated as C, G, A, U, respectively) or DNA bases (cytosine, guanine, adenine, thymine, abbreviated as C, G, A, T, respectively). In one embodiment, a nucleobase is an analog of C, G, A, U, or T. As used herein, the term "nucleoside" means a nucleobase linked to a sugar. As used herein, the term "nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0071] As used herein, the term "oligomeric compound" or "polymeric compound," in the context of nucleic acid compounds, means a polymer of linked monomeric subunits that is capable of hybridizing to a region of a nucleic acid molecule. In some embodiments, as used herein, the term "oligonucleoside" means an oligomeric compound in which the internucleoside linkages do not contain a phosphorus atom or in which the linkages do not contain a phosphate group. As used herein, the term "oligo" or "oligonucleotide" means a polymer of linked nucleotides each of which can be modified or unmodified independent one from another.

[0072] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of a compound prepared from a pharmaceutically acceptable acid or base including, but not limited to an inorganic acid, an inorganic base, an organic acid, or an organic base.

Suitable pharmaceutically acceptable base addition salts of the compounds include, but are not limited to metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from lysine, Ν,Ν'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. Suitable acids include, but are not limited to, inorganic and organic acids such as acetic, alginic, anthranilic,

benzenesulfonic, benzoic, camphorsulfonic, citric, ethenesulfonic, formic, fumaric, furoic, galacturonic, gluconic, glucuronic, glutamic, glycolic, hydrobromic,

hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phenylacetic, phosphoric, propionic, salicylic, stearic, succinic, sulfanilic, sulfuric, tartaric, and p-toluenesulfonic acid. Specific acids include hydrochloric, hydrobromic, phosphoric, sulfuric, and methanesulfonic acid. In one embodiment, the pharmaceutically acceptable salt is a hydrochloride or a mesylate salt. Others are well-known in the art. See for example, Remington's Pharmaceutical Sciences, 18th eds., Mack Publishing, Easton PA (1990) or Remington: The Science and Practice of Pharmacy, 19th eds., Mack Publishing, Easton PA (1995).

[0073] As used herein, the term "purified," in the context of a compound that is chemically synthesized, refers to a compound that is substantially free of chemical precursors or other chemicals when chemically synthesized. In a specific embodiment, the compound is 60%, e.g., 65%, 70%, 75%, 80%, 85%, 90%, or 99% free of other, different compounds as assessed by known techniques, including, e.g., nuclear magnetic resonance spectroscopy, infrared spectroscopy, mass spectrometry, GC-MS, MALDI- TOF, liquid chromatography, gas chromatography electrophoresis.

[0074] As used herein, the terms "purified" and "isolated," when used in the context of a compound (including nucleic acid compounds or proteinaceous agents) that is obtained from a natural source, e.g., cells or viruses, refer to a compound which is substantially free of contaminating materials from the natural source, e.g., soil particles, minerals, chemicals from the environment, and/or cellular or viral materials from the natural source, such as but not limited to cell debris, cell wall materials, membranes, organelles, the bulk of the nucleic acids, carbohydrates, proteins, and/or lipids present in cells or a virus. In some embodiments, the "purified" or "isolated" compound is substantially free of compounds {e.g. , nucleic acids) that are associated with it in its natural source. The phrase "substantially free of natural source materials" refers to preparations of a compound that has been separated from the material {e.g., cellular components of the cells) from which it is isolated. Thus, a compound that is isolated includes preparations of a compound having less than about 30%>, 20%>, 10%>, 5%, 2%, or 1% (by dry weight) of cellular materials and/or contaminating materials, as assessed by known techniques, such as, e.g., nuclear magnetic resonance spectroscopy, infrared spectroscopy, mass spectrometry, GC-MS, MALDI-TOF, liquid chromatography, gas chromatography electrophoresis.

[0075] In some embodiments, as used herein, the terms "purified" or "isolated," in the context of nucleic acid (for example, an RNA, DNA, oligonucleotide, antisense compound, siR A, miRNA, shRNA, svRNA, svRNA mimetic (e.g., a synthetic svRNA) such as described herein, an anti-svRNA compound such as described herein (e.g. , an LNA or PNA anti-svRNA)), or a vector construct for producing or delivering such a nucleic acid (including, for example, a viral vector or plasmid vector), refer to nucleic acid that is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors when chemically synthesized. In certain embodiments, an "isolated" nucleic acid is a nucleic acid that has been recombinantly expressed in a heterologous cell. In some embodiments, an

"isolated" nucleic acid refers to a nucleic acid molecule that is separated from other nucleic acid present in the natural source of the nucleic acid molecule. In other words, the isolated nucleic acid molecule can comprise heterologous nucleic acid that are not associated with the nucleic acid molecule in nature.

[0076] As used herein, the term "isolated," in the context of viruses, refers to a virus that is derived from a single parental virus or a single viral clone. In some

embodiments, a "viral clone" is a viral population with 98% or more sequence identity at the genomic level. A virus can be isolated using routine methods known to one of skill in the art including, but not limited to, those based on plaque purification, limiting dilution, or rescue of virus from plasmid DNA (e.g., using reverse genetics). As used herein, the term "purified" in the context of viruses refers to a virus which is

substantially free of cellular material and culture media from the cell or tissue source from which the virus is derived. The language "substantially free of cellular material" includes preparations of virus in which the virus is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, virus that is substantially free of cellular material includes preparations of virus having less than about 30%), 20%), 10%>, or 5% (by dry weight) of cellular protein. The virus is also substantially free of culture medium, i.e., culture medium represents less than about 20%o, 10%), or 5%o of the volume of the virus preparation. A virus can be purified using routine methods known to one of skill in the art including, but not limited to,

chromatography and centrifugation. [0077] As used herein, the terms "replication," "viral replication" and "virus replication" in the context of a virus refer to one or more, or all, of the stages of a viral life cycle that result in infection with and/or propagation of virus. The steps of a viral life cycle include, but are not limited to, virus attachment to the host cell surface, penetration or entry of the host cell (e.g., through receptor mediated endocytosis or membrane fusion), uncoating (the process whereby the viral capsid is removed and degraded by viral enzymes or host enzymes thus releasing viral genomic nucleic acid), synthesis of viral messenger RNA (mR A), synthesis of viral proteins, post- translational modification of viral proteins, trafficking of viral components to the host cell nucleus, assembly of viral ribonucleoprotein complexes for genome replication, synthesis of vR A and viral genome replication, assembly of virus particles, and release from the host cell by lysis or budding and acquisition of a phospholipid envelope which contains embedded viral glycoproteins. In some embodiments, where it is specified or clear from the context, the terms "replication," "viral replication" and "virus replication" refer to the replication of the viral genome. In other embodiments, where it is specified or clear from the context, the terms "replication," "viral replication" and "virus replication" refer to viral particle production. In some embodiments, the term "viral particle production" refers to the production of infectious, replication competent viruses. In other embodiments, the term "viral particle production" refers to the production of infectious, replication-defective viruses. In other embodiments, the term "viral particle production" refers to the production of viral particles that are defective for infectivity and replication.

[0078] As used herein, the term "single-stranded" in the context of a nucleic acid means a nucleic acid that is not hybridized to a complementary strand.

[0079] As used herein, the terms "small molecule" and "small molecular weight compound," and analogous terms include, but are not limited to, peptides,

peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, oligonucleotides, oligonucleotide analogs, nucleotides, nucleotide analogs, and other organic and inorganic compounds (i.e., including heteroorganic and

organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, organic or inorganic compounds having a molecular weight less than about 100 grams per mole, as well as solvates, hydrates, prodrugs, stereoisomers and pharmaceutically acceptable salts thereof. In one embodiment, the small molecule is an organic compound other than a peptide, peptidomimetic, amino acid, amino acid analog, or nucleic acid (including analogs thereof).

[0080] As used herein, the terms "subject" or "patient" are used interchangeably. As used herein, the term "subject" refers to an animal (e.g., insect, fish, avian, reptile, mammal). In some embodiments, the subject is an avian (e.g., chicken, duck, etc.). In some embodiment, the subject is a fish (e.g., salmon). In some embodiments, the mammal is a non-primate (e.g., camel, donkey, zebra, cow, pig, horse, goat, sheep, seal, cat, dog, rat, mouse). In some embodiments, the mammal is a primate (e.g., a monkey, chimpanzee, human). In some embodiments, the primate is a human. In certain embodiments, the animal is a human. In certain embodiments, the animal is a non- human animal.

[0081] As used herein, the term "premature human infant" refers to a human infant born at less than 37 weeks of gestational age.

[0082] As used herein, the term "human infant" refers to a newborn to 1 year old year human.

[0083] As used herein, the term "human child" refers to a human that is 1 year to 18 years old.

[0084] As used herein, the term "human adult" refers to a human that is 18 years or older.

[0085] As used herein, the term "elderly human" refers to a human 65 years or older.

[0086] As used herein, the terms "svR A" and "small viral R A" refer to an Orthomyxovirus svRNA described in Section 5.1.

[0087] As used herein, the term "synergistic," in the context of the effect of therapies, refers to a combination of therapies that is more effective than the additive effect of any two or more single therapies. In a specific embodiment, a synergistic effect of a combination of therapies permits the use of lower dosages of one or more therapies and/or less frequent administration of said therapies to a subject with a viral infection or a disease or symptom associated therewith. In certain embodiments, the ability to utilize lower dosages of therapies (e.g., the compounds described herein, compositions comprising the compounds described herein, or other therapies) and/or to administer said therapies less frequently reduces the toxicity associated with the administration of said therapies to a subject without reducing the efficacy of said therapies in the prevention or treatment of a viral infection or a disease or symptom associated therewith. In some embodiments, a synergistic effect results in improved efficacy of therapies (e.g. , the compounds described herein, compositions comprising the compounds described herein, or other therapies) in the prevention or treatment of a viral infection or a disease or symptom associated therewith. In some embodiments, a synergistic effect of a combination of therapies (e.g., the compounds described herein, compositions comprising the compounds described herein, or other therapies) avoids or reduces adverse or unwanted side effects associated with the use of any single therapy.

[0088] As used herein, the terms "therapies" and "therapy" can refer to any protocol(s), method(s), compound(s), composition(s), formulation(s), inhibitor(s), and/or agent(s) that can be used in the prevention and/or treatment of a viral infection or a symptom or disease associated therewith. In certain embodiments, the terms "therapies" and "therapy" refer to biological therapy, supportive therapy, and/or other therapies useful in prevention and/or treatment of a viral infection or a symptom or disease associated therewith known to one of skill in the art. In certain embodiments, the therapy comprises administration of a compound described herein. In other

embodiments, the therapy comprises a compound not described herein.

[0089] In one embodiment, the term "vRNA" as used herein refers to a complete genome segment. In one embodiment, the term "vRNA" as used herein refers to a portion of a genome segment. In one embodiment, the term "vRNA" as used herein refers to a complete copy of a genome segment. In other embodiments, the term

"vRNA" as used herein refers to an incomplete copy of a genome segment.

4.BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figures 1A-1C. Identification of influenza A virus-derived small RNAs. Figure 1A: A549 cells were mock treated or infected with influenza A/PR/8/34 H1N1 virus at a multiplicity of infection (MOI) of one. 12 hours post-infection (hpi), total RNA was resolved on an SDS-PAGE gel and RNA <40 nucleotides in length were isolated and sequenced using SOLiD based technology. Each of the eight segments (and corresponding accession numbers) and their open reading frames are shown. Above each cartoon is a histogram depicting peaks of total reads captured per segment (labeled as n=total reads). Figure IB: Total reads and percentage of reads for influenza A virus specific and 5 ' vRNA specific (svRNA) captured sequences per segment. Figure 1C: Consensus sequence for the 5 ' vRNA product found for each of the eight segments. [0091] Figures 2A-2D. Influenza A svRNA is an RdRp-dependent influenza A virus-specific small RNA. Figure 2A: Northern blot analysis for A549 cells mock treated or infected with influenza A/PR/8/34 virus (MOI 1). Total RNA harvested at 4, 8, 12, 24, and 36 hpi. Extracts resolved by denaturing gel electrophoresis and hybridized with a radiolabeled pan-specific svRNA probe. U6 used as loading control. Figure 2B: Northern blot analysis of mock, A/PR/8/34, Indiana Vesicular Stomatitis virus (VSV) or interferon β (IFN-I) treated A549 cells processed as in Figure 2A. Figure 2C: Northern blot analysis of HEK293 cells mock transfected, transfected with all eight bidirectional influenza A virus encoding plasmids, or transfected with only seven of the eight bidirectional plasmids. Numbers above each lane indicate missing segment. Total RNA harvested 24hpt, resolved by denaturing gel electrophoresis, and subsequently hybridized with a radio-labeled pan-specific svRNA probe. U6 provided as loading control. Figure 2D: Northern blot analysis of MDCK cells mock treated or infected with: influenza A/PR/8/34 (H1N1), influenza AVN/1203/04 (H5N1), or influenza A/Wyoming/03 (H3N2) for 24 hpi (MOI=l). Total RNA processed as in

Figure 2A.

[0092] Figures 3A-3F. svRNA is non-immunostimulatory and biases viral genome replication. Figure 3 A: Northern blot analysis of HEK293 cells mock transfected, transfected with a T7 transcribed scrambled (Scrmbl) RNA, or transfected with a T7 transcribed svRNA. Figure 3B: Immunoblots of IRF3 and beta-actin for A549 cells, A549 cells mock transfected, A549 cells infected with Indiana VSV, or A549 cells transfected with polylC, T7 transcribed scrambled RNA, or T7 transcribed svRNA 6 hrs post treatment. Figure 3C: QRT-PCR for RNA extracts from Figure 2C along with total RNA from HEK293 cells mock treated, infected with influenza

A/PR/8/34, VSV Indiana, NDV La Sato, or treated with IFN β for 12 hrs. QRT-PCR was performed for human IRF7 and tubulin mRNA. Data are represented as an average fold induction of hIRF7 above baseline tubulin values for each sample. Error bars indicate standard deviation of fold change. Figure 3D: Luciferase activity for HEK293 cells transfected with RdRp expression plasmids as well as an RdRp dependent firefly Luciferase, and constitutive Renilla luciferase, in the absence or presence of scrambled RNA or increasing amounts of synthetic svRNA. Protein was harvested 24 hours post- transfection (hpt) and assayed for both Luciferase and Renilla activity. Values presented are the average of three replicates per condition, normalized to control Renilla expression per sample, and taken as a percentage of the positive control. Error bars indicate standard deviation; p-values calculated using a two-tailed student's t-test with significance determined as a value below 0.05. Figure 3E: QRT-PCR for NEP mRNA and segment 8 RNA from HEK293 cells transfected with scrambled RNA or synthetic svRNA and subsequently infected with influenza A/PR/8/34 at an MOI of 0.1 for 16 hours. Values presented are normalized to tubulin for each sample, and taken as a percentage of the control scrambled RNA sample. Error bars reflect standard deviation of fold change. Figure 3F: Northern analysis of HEK293 cells transfected with RdRp expression plasmids with or without accessory proteins (NP or NS1) in the presence or absence of segment 4 or 8 vRNA. Total RNA was extracted 24 hpt and analyzed as in Figure 2C. U6 provided as a loading control.

[0093] Figures 4A-4D. Anti-svRNAs are segment-specific and inhibits viral replication. Figure 4A: Left panel: immunoblots of HA, NP, NS1, and beta-actin for HEK293 cells mock transfected, transfected with scrambled RNA or anti-svRNA and subsequently infected with influenza A/PR/8/34 at an MOI of 0.1 for the indicated times. Right panel: immunoblots of HA, NP, NS1, and beta-actin for MDCK cells mock infected or infected for 24 hrs with the indicated supernatants from left panel. Figure 4B: Immunoblots of HA, NP, and beta-actin for HEK293 cells mock transfected, transfected with scrambled RNA or anti-svRNA and subsequently infected with influenza A/PR/8/34 at an MOI of 0.1 for 48 hrs. Figure 4C: Viral titers for

supernatants harvested at the indicated times for samples in Figure 4B. Figure 4D: Model of svRNA in the switch from viral RNA transcription to viral genome replication during influenza virus infection: (1) RdRp binds panhandle/corkscrew structure; (2) RdRp generates mRNA from vRNA (start codon underlined); (3) RdRp generates polyA tail on uracil tract as a result of steric hindrance; (4) svRNA serves as 5 ' surrogate for panhandle structure or RdRp engagement; and (5) RdRp transcribes cRNA from vRNA.

[0094] Figures 5A-5B. Identification of Influenza A Virus-Derived Small RNAs. Figure 5A: Schematic representation of influenza A virus segment structure and RNA synthesis. Cartoon depicts viral Ribonucleoprotein complex (vRNP) bound by the RNA-dependent RNA Polymerase (RdRp) components PB2, PB1, and PA. Negative sense viral genomic RNA (vRNA), containing conserved non-coding regions (NCRs), is first transcribed to make an incomplete mRNA containing the 5' cap and 10-13 nucleotides of a host mRNA. After sufficient primary transcription, full-length complimentary RNA (cRNA) is synthesized, followed by full-length vRNA for viral packaging. Figure 5B: A549 cells were mock treated or infected with influenza A/PR/8/34 H1N1 virus at a multiplicity of infection (MOI) of 1. 12hpi, total RNA was resolved on an SDS-PAGE gel and RNA <40 nucleotides in length was isolated and sequenced using SOLiD based technology. Each of the eight segments (and

corresponding accession numbers) and their open reading frames are shown. Above each cartoon is a histogram depicting peaks of total reads captured per segment (labeled as n=total reads).

[0095] Figures 6A-6B. Figure 6A: miRNA expression profiling in acquired SOLiD sequencing data from mock treated or A/PR/8/34 infected A549 cells represented in Fig. 5B. miRNA expression values plotted as a percentage of total reads per sample as compared to mock treated. Specific miRNAs indicated demonstrated regulation due to virus infection. Lower limit of Northern detection depicts the range of detection of miRNA expression by Northern blot analysis. Figure 6B: Northern blot analysis of identified regulated miRNAs for mock, A/PR 8/34, Indiana Vesicular Stomatitis virus (VSV) or interferon β (IFN-I) treated A549s; total RNA harvested 36hpi and resolved by denaturing gel electrophoresis. U6 used as loading control.

[0096] Figures 7A-7F. Characterization of Influenza A Virus-Derived Small RNA Production. Figure 7A: Northern blot analysis of A549s mock treated or infected with influenza A/PR 8/34 virus at an MOI of 1. Total RNA harvested at 4, 8, 12, 24, and 36hpi. Extracts resolved by denaturing gel electrophoresis and hybridized with a radiolabeled pan-specific svRNA probe. U6 used as loading control. Figure 7B: Western blot analysis from duplicate samples as described in Figure 7A. Figure 7C: qPCR analysis of NS genomic RNA from samples processed in Figure 7A. Error bars reflect standard deviation of fold change. Figure 7D: Northern blot analysis of mock, A/PR 8/34, Indiana Vesicular Stomatitis virus (VSV) or interferon β (IFN-I) treated A549s processed as in Figure 7A. Figure 7E: Northern blot analysis of isolated allantoic membrane from embryonated chicken eggs mock treated or infected with A/PR 8/34 (H1N1), A/Panama/2007/99 (H3N2), or A/Vietnam/ 1203/04 (H5N1) and processed as in Figure 7A. Figure 7F: qRT-PCR for M mRNA of isolated allantoic membrane from embryonated chicken eggs mock treated or infected with A/PR 8/34 (H1N1), A/Panama/2007/99 (H3N2), or A/Vietnam/ 1203/04 (H5N1) represented in Figure 7E. Values presented are normalized to Rpsl 1 for each sample, and taken as a percentage of the mock infected sample. Error bars reflect standard deviation of fold change. Figure 7G: Northern blot analysis of human fibroblasts (Human, HEK293), isolated allantoic membrane from embryonated chicken eggs (Chicken), murine fibroblasts (Mouse, wt MEF), and Madin-Darby Canine Kidney fibroblasts (Canine, MDCK) mock treated or infected with A/PR/8/34 and processed as in Figure 7A. U6 used as a loading control for all Northerns.

[0097] Figures 8A-9E. svRNA is an RdRp-Dependent Influenza A Virus small RNA. Figure 8A: Schematic representation of bi-directional influenza A virus segment- specific plasmids. Positive sense mRNA is synthesized from an RNA

Polymerase II (Pol. II) promoter, while negative sense vRNA is synthesized from an RNA Polymerase I (Pol. I) promoter. Influenza A virus segment numbers and corresponding proteins listed below the schematic. Figure 8B: Northern blot analysis of fibroblasts mock transfected, transfected with all eight bi-directional influenza A virus encoding plasmids, or transfected with only seven of the eight bi-directional plasmids. Numbers above each lane indicate missing segment. Total RNA was harvested 24hpt, resolved by denaturing gel electrophoresis, and hybridized with a radiolabeled pan-specific svRNA probe. U6 used as loading control. Figure 8C:

Quantitative RT-PCR of NP mRNA from samples represented in Figure 8B. Numbers below each bar indicate missing segment. Values presented are normalized to tubulin for each sample, and represented as fold induction over mock transfected sample. Error bars reflect standard deviation of fold change. Figure 8D: qRT-PCR for M mRNA of HEK293s mock transfected, transfected with all eight bidirectional influenza A virus encoding plasmids, or transfected with only seven of the eight bidirectional plasmids as represented in Figure 8B. Numbers below each bar indicate missing segment. Values presented are normalized to tubulin for each sample, and represented as fold induction over mock transfected sample. Error bars reflect standard deviation of fold change. Figure 8E: qRT-PCR for PB2 mRNA for samples in Figure 8B.

[0098] Figure 9. Molecular interactions of svRNA. Top two frames: Northern blots as in Figure 8B with additional expression of either NEP/NS2 or NS 1. Bottom frames: Western blot of total protein extract depicted in top frames.

[0099] Figures lOA-lOC. svRNA Does Not Induce The Cell's Intrinsic Antiviral Defenses. Figure 10A: Northern blot analysis of HEK293 s mock transfected, transfected with a T7 transcribed scrambled (Scrmbl) RNA, or transfected with a T7 transcribed svRNA. Figure 10B: Immunoblots of IRF3 and beta-Actin for A549s, A549s mock transfected, A549s infected with Indiana VSV, or A549s transfected with polylC, T7 transcribed scrambled RNA, or T7 transcribed svRNA 6 hrs post treatment. Figure IOC: Luciferase activity for HEK293s transfected with RdRp expression plasmids as well as an RdRp dependent firefly Luciferase, and constitutive Renilla luciferase, in the absence or presence of scrambled RNA or increasing amounts of synthetic svRNA. Protein was harvested 24hpt and assayed for both Luciferase and Renilla activity. Values presented are the average of three replicates per condition, normalized to control Renilla expression per sample, and taken as a percentage of the positive control. Error bars indicate standard deviation; p-values calculated using a two- tailed student's t-test with significance determined as a value below 0.05.

[00100] Figures 11A-11F. Anti-svRNA Inhibits Viral Replication in a Segment- Specific Manner. Figure 11 A: Primer extension analysis of fibroblasts transfected with scrambled LNA or anti-HA, and subsequently infected with A/PR8/34. 5S rRNA used as a loading control (hpi: hours post infection). Figure 11B: Western blot analysis of HA, NP, NS1 , and beta-Actin for HEK293 fibroblasts mock transfected, transfected with scrambled LNA or anti-svRNA LNA specific to HA and subsequently infected with influenza A/PR/8/34 at an MOI of 0.1 for the indicated times (hpi: hours post infection). Figure 11C: Western blot analysis of HA, NP, NS 1 , and beta-Actin for MDCKs mock infected or infected for 24 hrs with the indicated supernatants from

Figure 11B. Figure 11D: Primer extension analysis of fibroblasts transfected with scrambled LNA or anti-HA,-NS, or -NA, and subsequently infected with A/PR8/34. 5S rRNA used as a loading control. Figure HE: Immunoblots of HA, NP, and beta-Actin for HEK293 fibroblasts mock transfected, transfected with scrambled LNA or LNA anti- svRNA specific for HA and subsequently infected with influenza A/PR/8/34 at an MOI of 0.1 for 48 hrs. Figure 11F: Viral titers for supernatants harvested at the indicated times for samples in Figure HE.

[00101] Figures 12A-12C. Generation of intron-based svRNA antagonists.

Figure 12A: Schematic of two-exon based cDNA in which the intron encodes three copies of an anti-svRNA (reverse complement of svRNA) plus additional nucleotides encoding transcription factor binding sites. The exons represent a split cDNA encoding a red fluorescent protein (RFP). Upon synthesis of cDNA, the intron is free to bind to target nucleic acid (e.g., svRNA) by competitive hybridization. Figure 12B: Northern blot probed for anti-svRNA encoded by the intron and U6 RNA. Extracts are derived from fibroblasts transfected with vector alone or a plasmid encoding the anti-svRNA as an intron as depicted in Figure 12A. Figure 12C: Primer extension assay from fibroblasts transfected with vector alone (vec), vector containing a scrambled intron (Scbl), or vector containing an intron encoding three repeats of an anti-svRNA directed to influenza virus HA. Lanes 1-4 represent primer extension on HA transcripts of positive polarity (cRNA and mRNA), lanes 5-8 depict primer extension on transcripts from HA of negative polarity (vRNA), and lanes 9-12 depict primer extension of 5S rRNA as a loading control.

5.DETAILED DESCRIPTION OF THE INVENTION

5.1 Orthomyxovirus svRNAs

[00102] In one aspect, described herein are Orthomyxovirus svRNAs. Small viral RNAs are generated from the 5' ends of viral genomic RNA (vRNA) segments by RNA- dependent RNA polymerase (RdRp) machinery. Thus, Orthomyxovirus svRNA sequences are the complement of the viral genomic RNA that they are generated from. In general, svRNAs are generated from the 5' terminal base of a vRNA and extend approximately 1 to 7 bases beyond the uracil (polyU) tract, terminating 21-27 nucleotides from the terminal base of a given viral segment. In some embodiments, an Orthomyxovirus svRNA extends no more than 3, 4, 5, 6, 7, 8, 9, or 10 bases beyond the polyU tract. In certain embodiments, the svRNA contains a 5' triphosphate.

[00103] In specific embodiments, the Orthomyxovirus svRNA is a single stranded RNA identical to the 5 ' end of the viral genomic RNA (vRNA) and complementary to the 3' end of the complementary viral RNA genome (cRNA). In one embodiment, an svRNA is generated from the 5 ' end(s) of Orthomyxovirus genomic RNA (alternatively referred to herein as "vRNA") by RNA-dependent RNA polymerase (RdRp) cleavage. In one embodiment, an svRNA is generated from the 3 ' end(s) of the Orthomyxovirus genomic cRNA by RdRp machinery. In one embodiment, the svRNA interacts with the 3 ' end of the vRNA. In another embodiment, the svRNA interacts with the 3 ' end of the cRNA. In some embodiments, the svRNA interacts with the 3' ends of both

Orthomyxovirus vRNA and cRNA. In some embodiments, the Orthomyxovirus svRNA increases vRNA production.

[00104] Orthomyxovirus svRNAs may range in length from 12 to 30 nucleotides in length, for example, 12 to 15, 15 to 20, 20 to 25, 22 to 27, or 22 to 25, or 25 to 30 nucleotides in length. In some embodiments, an svRNA is 20 to 30 nucleotides in length. In some embodiments, an svRNA is 22 to 28 nucleotides in length. In some embodiments, an svRNA is 22 to 27 nucleotides in length. In some embodiments, an svRNA is 22 to 25 nucleotides in length. In some embodiments, two or more Orthomyxovirus svRNAs are at least 40% identical, 50%> identical, 55% identical, 60%> identical, 65% identical, 70% identical, 75% identical or 80% or more identical. In other embodiments, two or more Orthomyxovirus svRNAs are at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% or more identical. In a specific embodiment, there is a unique svRNA for each segment of a particular Orthomyxovirus.

[00105] In some embodiments, the Orthomyxovirus svRNA is a Thogoto virus svRNA, such as, e.g., an svRNA of a Thogoto virus, Dhori virus, Batken virus,

[00106] In certain embodiments, the Orthomyxovirus svRNA is an Isavirus svRNA, such as an svRNA of an infectious salmon anemia virus. In one embodiment, a consensus svRNA for Isaviruses comprises the nucleobase sequence 5'- UUAAACACC AUAUUC AUCCAUCAGGUCUUCUUUUU-3 ' .

[00107] In some embodiments, the Orthomyxovirus svRNA is an influenza virus svRNA. In particular embodiments, an influenza virus svRNA ranges from 20 nucleotides to 30 nucleotides in length, for example 22 to 28 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, nucleotides in length. In some

embodiments, an influenza virus svRNA ranges from 20 nucleotides to 27 nucleotides in length, from 22 nucleotides to 27 nucleotides in length, from 22 nucleotides to 25 nucleotides in length, or from 22 nucleotides to 28 nucleotides in length. In some embodiments, an influenza virus svRNA is 25 nucleotides in length. In some embodiments, an influenza virus svRNA is 27 nucleotides in length. In some embodiments, two or more influenza virus svRNAs are at least 40% identical, 50% identical, 55% identical, 60%> identical, 65 % identical, 70%> identical, 75% identical or 80% or more identical. In other embodiments, two or more influenza virus svRNAs are at least 85% identical, at least 90% identical, at least 95% identical, at least 98% identical, or at least 99% or more identical. In a specific embodiment, the svRNAs are influenza strain specific. In some embodiments, influenza svRNAs are identical except that they have one two four unique bases that are strain specific. In a specific embodiment, there is a unique svRNA for each segment of a particular influenza virus.

[00108] In a specific embodiment, the influenza virus svRNA is an influenza A svRNA. In some embodiments, an influenza A svRNA ranges from 20 nucleotides to 30 nucleotides. In some embodiments, an influenza A svR A ranges from 22 nucleotides to 28 nucleotides, for example, 22, 24, 26 or 28 nucleotides, or 25 or 27 nucleotides, in length. In some embodiments, nucleobases 1-13 are universal for influenza A virus. In some embodiments, the svRNAs have segment specificity beyond the first 13 nucleobases. In a specific embodiment, there is a unique svRNA for each of the 8 segments of influenza A, wherein the svRNAs may differ from one another at positions 14-16 and beyond the 21^st position. The examples in Sections 6 and 7 below describe exemplary Orthomyxovirus svRNAs from influenza A virus, and Figure 1C provides exemplary consensus influenza A svRNA sequences. Specifically, in one embodiment, a consensus svRNA nucleobase sequence for all 8 influenza A viral genome segments comprises or consists of the nucleobase sequence 5'-AGUAGAAACAAGG-Xi4-Xi5- X16-UUUUU-X22- 23-X24-X25-X26-X27-X28-3', wherein Xs denote segment specific bases, and X23-X28 are either segment specific bases or are absent.

[00109] In some embodiments, an influenza A svRNA comprises or consists of the nucleobase sequence 5*-AGUAGAAACAAGG-Xi4-Xi5-Xi6-UUUUU-X₂2-X23-X24-X25- X26-X27-X28-3', wherein:

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X₂₂ is U, C, or G;

X23 is U or C or A or is absent;

X24 is U, C, A, G, or is absent;

X25 is U, C, A, G, or is absent;

X26 is U or A or is absent;

X27 is U or C or is absent; and

X28 is G or U or is absent.

[00110] In some embodiments, the nucleobase in the "X" position is the nucleobase present at the corresponding position of the complement of the 5 ' end of a particular influenza A virus genome segment. By way of non-limiting example, one exemplary influenza A svRNA comprises or consists of the nucleobase sequence

AGUAG A AAC AAGGUACUUUUUUGG AC AG . Another exemplary influenza A svRNA comprises or consists of the nucleobase sequence

AGUAGAAACAAGGCACUUUUUCGG. [00111] In some embodiments, the influenza virus svRNA is an influenza B svRNA. In some embodiments, an influenza B svRNA ranges from 20 nucleotides to 28 nucleotides, for example, 21 nucleotides, or 22 nucleotides, or 25 nucleotides, or 27 nucleotides, in length. In a specific embodiment, there is a unique svRNA for each of the segments of influenza B, wherein the svR As may differ from one another at positions 13-15 and beyond the 20th position. In some embodiments, the influenza B svRNAs may additionally differ from one another at position 6.

[00112] In one embodiment, a consensus nucleobase svRNA sequence for all 8 influenza B viral genome segments comprises or consists of the sequence 5'- AGUAG(AAJ)AACAAG-Xi3-Xi4-Xi5-UUUUU-X₂i-X22-X23-X24-X25-X26-X27-3^*, wherein Xs denote segment specific bases, and X22-X27 are either segment specific bases or are absent. In some such embodiments:

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X21 is U, C, A, or G;

X22 is U, C, A, G or is absent;

X23 is U, C, A, G or is absent;

X24 is U, C, A, G or is absent;

X25 is U, C, A, G or is absent;

X₂6 is U, C, A, G or is absent; and

X27 is U, C, A, G or is absent.

[00113] In one embodiment, a consensus nucleobase svRNA sequence for all 8 influenza B viral genome segments comprises or consists of the sequence 5'-

AGUAG(AAJ)AACAA(G/C)(A/G)(G/C)Xi₅(A/C)UUUUU-X₂2-X23-X24-X25-X26-X27- X₂8-3', wherein Xs denote segment specific bases, and X22-X28 are either segment specific bases or are absent. In some embodiments, the nucleobase in the "X" position is the nucleobase present at the corresponding position of the complement of the 5 ' end of a particular influenza B virus genome segment.

[00114] In another embodiment, the influenza virus svRNA is an influenza C svRNA. In some embodiments, an influenza C svRNA ranges from 22 nucleotides to 28 nucleotides, for example, 22, 24, 26 or 28 nucleotides, in length. In a specific embodiment, there is a unique svRNA for each of the segments of influenza C, wherein the svR As may differ from one another at positions 14-16 and beyond the 21st position.

[00115] In one embodiment, the consensus svR A nucleobase sequence for all 7 influenza C viral genome segments comprises or consists of the sequence 5'- AGCAGUAGCAAGG-X14-X15-X16-UUUUU-X22-X23-X24-X25-X26-X27-X28-3^*, wherein Xs denote segment specific bases, and X22-X28 are either segment specific bases or are absent. In one embodiment, the consensus svRNA nucleobase sequence for all 7 influenza C viral genome segments comprises or consists of the sequence 5'-

AGCA(A/G)UAGCAAGG-Xl4-Xl5-Xl6-UUUUU-X₂2-X23-X24-X25-X26-X27-X28-3^*, wherein Xs denote segment specific bases, and X22-X28 are either segment specific bases or are absent. In some such embodiments:

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X22 is U, C, A, G or is absent;

X23 is U, C, A, G or is absent;

X24 is U, C, A, G or is absent;

X25 is U, C, A, G or is absent;

X26 is U, C, A, G or is absent;

X27 is U, C, A, G or is absent; and

X₂8 is U, C, A, G or is absent.

[00116] In some embodiments, the nucleobase in the "X" position is the nucleobase present at the corresponding position of the complement of the 5 ' end of a particular influenza C virus genome segment.

[00117] In one embodiment, a consensus svRNA nucleobase sequence for influenza A, influenza B and influenza C virus comprises or consists of the sequence 5'- AG(U/C)AG-X₆-A-X8-CAAG-Xi3-Xi4-Xi5-Xi6-UUUUU-3^*, wherein Xs denote strain, type, subtype or segment-specific bases. In some embodiments, the nucleobase in the "X" position is chosen based on the nucleobase present at the corresponding position of the complement of the 5' end of a particular influenza A, influenza B, or influenza C virus genome segment.

[00118] In some embodiments, an Orthomyxovirus svRNA described herein is encoded by R A. In some embodiments, an Orthomyxovirus svRNA described herein is encoded by DNA. In some embodiments, the DNA is single stranded. In some embodiments, the DNA is double stranded.

[00119] In some embodiments, an Orthomyxovirus svRNA is involved in or required for replication of a single type, subtype or strain of Orthomyxovirus, or may be unique to a particular segment of an Orthomyxovirus. In other embodiments, an

Orthomyxovirus svRNA is involved in or required for replication of more than one type, subtype or strain of Orthomyxovirus. Exemplary Orthomyxoviruses include influenza viruses (e.g., influenza A virus, influenza B virus, influenza C virus), Thogotoviruses (e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus, Lake Chad virus) and Isaviruses (e.g., infectious salmon anemia virus). In a particular embodiment, the svRNA is involved in or required for replication of one type, subtype or strain of influenza. In another embodiment, the svRNA is involved in or required for replication of more than one type, subtype or strain of influenza. For example, the svRNA may be involved in or required for replication of influenza A virus, influenza B virus, and/or influenza C virus. Without being bound by any theory, svRNAs regulate the switch between transcription and replication. In some embodiments, the svRNAs increase vRNA production.

[00120] In some embodiments, the svRNA is involved in or required for replication of an H5N1 , an HlNl and/or an H3N2 influenza A virus. In certain embodiments, the svRNA(s) is from one or more of the following, non-limiting, influenza A virus subtypes: influenza A subtype HI 0N4, subtype H10N5, subtype HI 0N7, subtype H10N8, subtype H10N9, subtype HI 1N1 , subtype HI 1N13, subtype HI 1N2, subtype HI 1N4, subtype HI 1N6, subtype HI 1N8, subtype HI 1N9, subtype H12N1 , subtype H12N4, subtype H12N5, subtype H12N8, subtype H13N2, subtype H13N3, subtype H13N6, subtype H13N7, subtype H14N5, subtype H14N6, subtype H15N8, subtype H15N9, subtype H16N3, subtype HlNl , subtype H1N2, subtype H1N3, subtype H1N6, subtype H1N9, subtype H2N1 , subtype H2N2, subtype H2N3, subtype H2N5, subtype H2N7, subtype H2N8, subtype H2N9, subtype H3N1 , subtype H3N2, subtype H3N3, subtype H3N4, subtype H3N5, subtype H3N6, subtype H3N8, subtype H3N9, subtype H4N1 , subtype H4N2, subtype H4N3, subtype H4N4, subtype H4N5, subtype H4N6, subtype H4N8, subtype H4N9, subtype H5N1 , subtype H5N2, subtype H5N3, subtype H5N4, subtype H5N6, subtype H5N7, subtype H5N8, subtype H5N9, subtype H6N1 , subtype H6N2, subtype H6N3, subtype H6N4, subtype H6N5, subtype H6N6, subtype H6N7, subtype H6N8, subtype H6N9, subtype H7N1 , subtype H7N2, subtype H7N3, subtype H7N4, subtype H7N5, subtype H7N7, subtype H7N8, subtype H7N9, subtype H8N4, subtype H8N5, subtype H9N1, subtype H9N2, subtype H9N3, subtype H9N5, subtype H9N6, subtype H9N7, subtype H9N8, and subtype H9N9.

[00121] In certain embodiments, the svRNA(s) is from one or more of the following, non-limiting, influenza A virus strains: A/sw/Iowa/ 15/30 (HlNl); AWSN/33 (HlNl); A/eq/Prague/1/56 (H7N7); A/PR/8/34; A/mallard/Potsdam/ 178-4/83 (H2N2); Aherring gull/DE/712/88 (H16N3); Asw/Hong Kong/168/1993 (HlNl);

A/mallard/Alberta/211/98 (HlNl); Ashorebird/Delaware/168/06 (H16N3);

Asw/Netherlands/25/80 (HlNl); Asw/Germany/2/81 (HlNl); Asw/Hannover/1/81 (HlNl); Asw/Potsdam/1/81 (HlNl); Asw/Potsdam/ 15/81 (HlNl);

Asw/Potsdam/268/81 (HlNl); Asw/Finistere/2899/82 (HlNl); Asw/Potsdam/35/82 (H3N2); A/sw/Cote d'Armor/3633/84 (H3N2); A/sw/Gent/1/84 (H3N2);

Asw/Netherlands/12/85 (HlNl); Asw/Karrenzien/2/87 (H3N2);

Asw/Schwerin 103/89 (HlNl); Aturkey/Germany/3/91 (HlNl);

A/sw/Germany/8533/91 (HlNl); Asw/Belgium/220/92 (H3N2); Asw/Gent/V230/92 (HlNl); Asw/Leipzig/145/92 (H3N2); A/sw/Re220/92hp (H3N2);

Asw/Bakum/909/93 (H3N2); Asw/Schleswig-Holstein/1/93 (HlNl);

Asw/Scotland/419440/94 (H1N2); A/sw/Bakum/5/95 (HlNl); Asw/Best/5C/96 (HlNl); Asw/England/17394/96 (H1N2); Asw/Jena/5/96 (H3N2);

Asw/Oedenrode/7C/96 (H3N2); Asw/Lohne/1/97 (H3N2); Asw/Cote d^*Armor/790/97 (H1N2); Asw/Bakum/1362/98 (H3N2); A/sw/Italy/1521/98 (H1N2); Asw/Italy/1553- 2/98 (H3N2); Asw/Italy/1566/98 (HlNl); Asw/Italy/ 1589/98 (HlNl);

A/sw/Bakum/8602/99 (H3N2); A/sw/Cotes d'Armor/604/99 (H1N2); A/sw/Cote d^*Armor/1482/99 (HlNl); Asw/Gent/7625/99 (H1N2); A/Hong Kong/1774/99 (H3N2); Asw/Hong Kong/5190/99 (H3N2); Asw/Hong Kong/5200/99 (H3N2); Asw/Hong Kong/5212/99 (H3N2); Asw/Ille et Villaine/ 1455/99 (HlNl); Asw/Italy/1654- 1/99 (H1N2); Asw/Italy/2034/99 (HlNl); Asw/Italy/2064/99 (H1N2);

Asw/Berlin 1578/00 (H3N2); Asw/Bakum/1832/00 (H1N2); Asw/Bakum/1833/00 (H1N2); A/sw/Cote d'Armor/800/00 (H1N2); Asw/Hong Kong/7982/00 (H3N2);

Asw/Italy/1081/00 (H1N2); Asw/Belzig/2/01 (HlNl); Asw/Belzig/54/01 (H3N2); Asw/Hong Kong/9296/01 (H3N2); Asw/Hong Kong/9745/01 (H3N2);

Asw/Spain/33601/01 (H3N2); Asw/Hong Kong/1144/02 (H3N2); Asw/Hong

Kong/1197/02 (H3N2); Asw/Spain/39139/02 (H3N2); Asw/Spain42386/02 (H3N2); A/Switzerland/8808/2002 (HlNl); Asw/Bakum/1769/03 (H3N2); A/sw/Bissendorf/IDT 1864/03 (H3N2); A/sw/Ehren/IDT2570/03 (H1N2);

A/sw/Gescher/IDT2702/03 (H1N2); A/sw/Haselunne/2617/03hp (HlNl);

A/sw/Loningen/IDT2530/03 (H1N2); A/sw/IVD/IDT2674/03 (H1N2);

A/sw/Nordkirchen/IDT 1993/03 (H3N2); A/sw/Nordwalde/IDT2197/03 (H1N2);

A/sw/Norden/IDT2308/03 (H1N2); A/sw/Spain/50047/03 (HlNl);

A/sw/Spain/51915/03 (HlNl); A/sw/Vechta/2623/03 (HlNl);

A/sw/Visbek/IDT2869/03 (H1N2); A/sw/Waltersdorf/IDT2527/03 (H1N2);

A/sw/Damme/IDT2890/04 (H3N2); A/sw/Geldern/IDT2888/04 (HlNl);

A/sw/Granstedt/IDT3475/04 (H1N2); A/sw/Greven/IDT2889/04 (HlNl);

A/sw/Gudensberg/IDT2930/04 (H1N2); A sw/Gudensberg/IDT2931/04 (H1N2);

A/sw/Lohne/IDT3357/04 (H3N2); A/sw/Nortrup/IDT3685/04 (H1N2);

A/sw/Seesen/IDT3055/04 (H3N2); A/sw/Spain/53207/04 (HlNl); A/sw/Spain/54008/04 (H3N2); A/sw/Stolzenau/IDT3296/04 (H1N2); A/sw/Wedel/IDT2965/04 (HlNl);

A/sw/Bad Griesbach/IDT4191/05 (H3N2); A/sw/Cloppenburg/IDT4777/05 (H1N2); A/sw/D6tlingen/IDT3780/05 (H1N2); A/sw/D6tlingen/IDT4735/05 (H1N2);

A/sw/Egglham/IDT5250/05 (H3N2); A/sw/Harkenblek IDT4097/05 (H3N2);

A/sw/Hertzen/IDT4317/05 (H3N2); A/sw/Krogel/IDT4192/05 (HlNl);

A/sw/Laer/IDT3893/05 (HlNl); A/sw/Laer/IDT4126/05 (H3N2);

A/sw/Merzen/IDT41 14/05 (H3N2); A/sw/Muesleringen-S./IDT4263/05 (H3N2);

A/sw/Osterhofen/IDT4004/05 (H3N2); A/sw/Sprenge/IDT3805/05 (H1N2);

A/sw/Stadtlohn/IDT3853/05 (H1N2); A/sw/Voglarn/IDT4096/05 (HlNl);

A/sw/Wohlerst/IDT4093/05 (HlNl); A/sw/Bad Griesbach/IDT5604/06 (HlNl);

A/sw/Herzlake/IDT5335/06 (H3N2); A/sw/Herzlake/IDT5336/06 (H3N2);

A/sw/Herzlake/IDT5337/06 (H3N2); and A/wild boar/Germany/Rl 69/2006 (H3N2).

[00122] In certain embodiments, the svRNA(s) is from one or more of the following, non-limiting, influenza A virus strains: A/Toronto/3141/2009 (HlNl);

A/Regensburg/D6/2009 (HlNl); A/Bayern 62/2009 (HlNl); A/Bayern/62/2009 (HlNl); A/Bradenburg/19/2009 (HlNl ); A/Bradenburg/20/2009 (HlNl ); A/Distrito Federal/2611/2009 (HlNl); A/Mato Grosso/2329/2009 (HlNl); A/Sao

Paulo/1454/2009 (HlNl); A/Sao Paulo/2233/2009 (HlNl); A/Stockholm/37/2009 (HlNl); A/Stockholm/41/2009 (HlNl); A Stockholm/45/2009 (HlNl);

A/swine/Alberta/OTH-33-1/2009 (HlNl); A/swine/Alberta/OTH-33- 14/2009 (HlNl); A/swine/Alberta/OTH-33-2/2009 (HlNl); A/swine/Alberta/OTH-33 -21/2009 (HlNl); A/swine/Alberta/OTH-33-22/2009 (HlNl); A/swine/Alberta/OTH-33 -23/2009 (HlNl); A/swine/Alberta/OTH-33-24/2009 (HlNl); A/swine/Alberta/OTH-33 -25/2009 (HlNl); A/swine/Alberta/OTH-33-3/2009 (HlNl); A/swine/Alberta/OTH-33 -7/2009 (HlNl); A/Beijing/502/2009 (HlNl); A/Firenze/ 10/2009 (HlNl); A/Hong Kong/2369/2009 (HlNl); A/Italy/85/2009 (HlNl); A/Santo Domingo/572N/2009 (HlNl);

A/Catalonia/385/2009 (HlNl); A/Catalonia/386/2009 (HlNl); A/Catalonia/387/2009 (HlNl); A/Catalonia/390/2009 (HlNl); A/Catalonia/394/2009 (HlNl);

A/Catalonia/397/2009 (HlNl); A/Catalonia/398/2009 (HlNl); A/Catalonia/399/2009 (HlNl); A/Sao Paulo/2303/2009 (HlNl); A/Akita/ 1/2009 (HlNl); A/Castro/JXP/2009 (HlNl); A/Fukushima/1/2009 (HlNl); A/Israel/276/2009 (HlNl); A/Israel/277/2009 (HlNl); A/Israel/70/2009 (HlNl); A/Iwate/ 1/2009 (HlNl); A/Iwate/2/2009 (HlNl); A/Kagoshima/1/2009 (HlNl); A/Osaka/180/2009 (HlNl); A/Puerto Montt/Bio87/2009 (HI Nl); A/Sao Paulo/2303/2009 (HlNl); A/Sapporo/1/2009 (HlNl);

A/Stockholm/30/2009 (HlNl); A/Stockholm/31/2009 (HlNl); A/Stockholm/32/2009 (HlNl); A/Stockholm/33/2009 (HlNl); A/Stockholm/34/2009 (HlNl);

A/Stockholm/35/2009 (HlNl); A/Stockholm/36/2009 (HlNl); A/Stockholm/38/2009 (HlNl); A/Stockholm/39/2009 (HlNl); A/Stockholm/40/2009 (HlNl;)

A/Stockholm/42/2009 (HlNl); A/Stockholm/43/2009 (HlNl); A/Stockholm/44/2009 (HlNl); A/Utsunomiya/2/2009 (HlNl); A/WRAIR/0573N/2009 (HlNl); and

A/Zhejiang/DTID-Z JU01 /2009 (H IN 1 ) .

[00123] In certain embodiments, the svRNA(s) is from one or more of the following, non-limiting, influenza B virus strains: strain Aichi/5/88, strain Akita/27/2001, strain Akita/5/2001, strain Alaska/16/2000, strain Alaska/ 1777/2005, strain

Argentina/69/2001, strain Arizona/ 146/2005, strain Arizona/148/2005, strain

Bangkok/ 163/90, strain Bangkok/34/99, strain Bangkok/460/03, strain Bangkok/54/99, strain Barcelona/215/03, strain Beijing/15/84, strain Beijing/184/93, strain

Beijing/243/97, strain Beijing/43/75, strain Beijing/5/76, strain Beijing/76/98, strain Belgium/WV 106/2002, strain Belgium/WV 107/2002, strain Belgium/WV 109/2002, strain Belgium/WV 114/2002, strain Belgium/WV 122/2002, strain Bonn/43, strain Brazil/952/2001, strain Bucharest/795/03, strain Buenos Aires/161/00), strain Buenos Aires/9/95, strain Buenos Aires/SW16/97, strain Buenos Aires/VL518/99, strain Canada/464/2001, strain Canada/464/2002, strain Chaco/366/00, strain Chaco/Rl 13/00, strain Cheju/303/03, strain Chiba/447/98, strain Chongqing/3/2000, strain clinical isolate SA1 Thailand/2002, strain clinical isolate SA10 Thailand/2002, strain clinical isolate SA100 Philippines/2002, strain clinical isolate SA101 Philippines/2002, strain clinical isolate SA110 Philippines/2002), strain clinical isolate SA112 Philippines/2002, strain clinical isolate SA113 Philippines/2002, strain clinical isolate SA114 Philippines/2002, strain clinical isolate SA2 Thailand/2002, strain clinical isolate SA20 Thailand/2002, strain clinical isolate SA38 Philippines/2002, strain clinical isolate SA39 Thailand/2002, strain clinical isolate SA99 Philippines/2002, strain CNIC/27/2001, strain

Colorado/2597/2004, strain Cordoba/VA418/99, strain Czechoslovakia/16/89, strain Czechoslovakia/69/90, strain Daeku/10/97, strain Daeku/45/97, strain Daeku/47/97, strain Daeku/9/97, strain B/Du/4/78, strain B/Durban/39/98, strain Durban/43/98, strain Durban/44/98, strain B/Durban 52/98, strain Durban/55/98, strain Durban/56/98, strain England/1716/2005, strain England/2054/2005) , strain England/23/04, strain

Finland/154/2002, strain Finland/159/2002, strain Finland/160/2002, strain

Finland/161/2002, strain Finland/ 162/03, strain Finland/162/2002, strain Finland/ 162/91, strain Finland/ 164/2003, strain Finland/ 172/91, strain Finland/ 173/2003, strain

Finland/ 176/2003, strain Finland/ 184/91, strain Finland/ 188/2003, strain

Finland/ 190/2003, strain Finland/220/2003, strain Finland/WV5/2002, strain

Fujian/36/82, strain Geneva/5079/03, strain Genoa/11/02, strain Genoa/2/02, strain Genoa/21/02, strain Genova/54/02, strain Genova/55/02, strain Guangdong/05/94, strain Guangdong/08/93, strain Guangdong/5/94, strain Guangdong/55/89, strain

Guangdong/8/93, strain Guangzhou/7/97, strain Guangzhou/86/92, strain

Guangzhou/87/92, strain Gyeonggi/592/2005, strain Hannover/2/90, strain

Harbin/07/94, strain Hawaii/ 10/2001, strain Hawaii/1990/2004, strain Hawaii/38/2001, strain Hawaii/9/2001, strain Hebei/19/94, strain Hebei/3/94), strain Henan/22/97, strain Hiroshima/23/2001, strain Hong Kong/110/99, strain Hong Kong/1115/2002, strain Hong Kong/112/2001, strain Hong Kong/ 123/2001, strain Hong Kong/1351/2002, strain Hong Kong/1434/2002, strain Hong Kong/147/99, strain Hong Kong/156/99, strain Hong Kong/157/99, strain Hong Kong/22/2001, strain Hong Kong/22/89, strain Hong Kong/336/2001, strain Hong Kong/666/2001, strain Hong Kong/9/89, strain

Houston/1/91, strain Houston/1/96, strain Houston/2/96, strain Hunan/4/72, strain Ibaraki/2/85, strain ncheon/297/2005, strain India/3/89, strain India/77276/2001, strain Israel/95/03, strain Israel/WV 187/2002, strain Japan/ 1224/2005, strain Jiangsu/ 10/03, strain Johannesburg/1/99, strain Johannesburg/96/01, strain Kadoma/1076/99, strain Kadoma/122/99, strain Kagoshima/15/94, strain Kansas/22992/99, strain

Khazkov/224/91, strain Kobe/1/2002, strain, strain Kouchi/193/99, strain Lazio/1/02, strain Lee/40, strain Leningrad/129/91, strain Lissabon/2/90) , strain Los Angeles/1/02, strain Lusaka/270/99, strain Lyon/1271/96, strain Malaysia/83077/2001, strain

Maputo/1/99, strain Mar del Plata/595/99, strain Maryland/ 1/01, strain Memphis/1/01, strain Memphis/ 12/97-MA, strain Michigan/22572/99, strain Mie/1/93, strain

Milano/1/01, strain Minsk/318/90, strain Moscow/3/03, strain Nagoya/20/99, strain Nanchang/1/00, strain Nashville/ 107/93, strain Nashville/45/91, strain Nebraska/2/01, strain Netherland/801/90, strain Netherlands/429/98, strain New York/1/2002, strain NIB/48/90, strain Ningxia/45/83, strain Norway/1/84, strain Oman/ 16299/2001, strain Osaka/1059/97, strain Osaka/983/97-V2, strain Oslo/1329/2002, strain Oslo/1846/2002, strain Panama/45/90, strain Paris/329/90, strain Parma/23/02, strain Perth/211/2001, strain Peru/1364/2004, strain Philippines/5072/2001, strain Pusan/270/99, strain Quebec/173/98, strain Quebec/465/98, strain Quebec/7/01, strain Roma/1/03, strain Saga/S172/99, strain Seoul/13/95, strain Seoul/37/91, strain Shangdong/7/97, strain Shanghai/361/2002) , strain Shiga/T30/98, strain Sichuan/379/99, strain

Singapore/222/79, strain Spain/WV27/2002, strain Stockholm/10/90, strain

Switzerland/5441/90, strain Taiwan/0409/00, strain Taiwan/0722/02, strain

Taiwan/97271/2001, strain Tehran/80/02, strain Tokyo/6/98, strain Trieste/28/02, strain Ulan Ude/4/02, strain United Kingdom/34304/99, strain USSR/100/83, strain

Victoria/103/89, strain Vienna/1/99, strain Wuhan/356/2000, strain WV194/2002, strain Xuanwu/23/82, strain Yamagata/1311/2003, strain Yamagata/K500/2001, strain Alaska/12/96, strain GA/86, strain NAGASAKI/ 1/87, strain Tokyo/942/96, and strain Rochester/02/2001.

[00124] In certain embodiments, the svRNA(s) is from one or more of the following, non-limiting, influenza C virus strains: from strain Aichi/1/81, strain Ann Arbor/1/50, strain Aomori/74, strain California/78, strain England/83, strain Greece/79, strain Hiroshima/246/2000, strain Hiroshima/252/2000, strain Hyogo/1/83, strain

Johannesburg/66, strain Kanagawa/1/76, strain Kyoto/1/79, strain Mississippi/80, strain Miyagi/1/97, strain Miyagi/5/2000, strain Miyagi/9/96, strain Nara/2/85, strain

NewJersey/76, strain pig/Beijing/115/81, strain Saitama/3/2000), strain Shizuoka/79, strain Yamagata/2/98, strain Yamagata/6/2000, strain Yamagata/9/96, strain

BERLIN/1/85, strain ENGLAND/892/8, strain GREAT LAKES/1167/54, strain JJ/50, strain PIG/BEIJING/10/81, strain PIG/BEIJING/439/82), strain TAYLOR/1233/47, and strain C/Y AMAGATA/10/81. [00125] Nucleotide sequences (for example, sequences of genome segments) from the foregoing influenza virus strains can be obtained by accession number from sequence databases such as NCBI Genbank.

5.2 Compounds that Modulate Orthomyxovirus svRNAs

[00126] Described herein are compounds that modulate the expression or activity of svRNAs produced by Orthomyxoviruses; such compounds may be referred to herein as "Compounds." The Compounds may be used to regulate the Orthomyxovirus life cycle, for example, to reduce or inhibit Orthomyxovirus replication. In certain embodiments, the Compounds increase viral genomic RNA (vRNA) levels and decrease viral mRNA levels. An example of such a Compound is an svRNA mimetic (e.g., a synthetic svRNA), such as described in Section 5.2.1 and in the examples in Sections 6 and 7 below. In some embodiments, the Compounds decrease vRNA levels and increase viral mRNA levels. An example of such a Compound is an anti-svRNA Compound, such as an LNA anti-svRNA described Section 5.2.1 and in the examples in Sections 6 and 7 below.

[00127] In some embodiments, and in accordance with the methods described herein, the Compound modulates the Orthomyxovirus life cycle. In some embodiments, the Compound modulates Orthomyxovirus replication. In some embodiments, a Compound modulates Orthomyxovirus particle production. In some embodiments, a Compound modulates Orthomyxovirus genome transcription (i.e., the production of viral mRNA). In some embodiments, a Compound modulates Orthomyxovirus genome replication (i.e., the production of vRNA). In some embodiments, a Compound modulates

Orthomyxovirus genome transcription but does not modulate Orthomyxovirus genome replication. In some embodiments, the Compound modulates Orthomyxovirus genome replication but does not modulate Orthomyxovirus genome transcription. In some embodiments, a Compound or a combination of Compounds modulates Orthomyxovirus genome transcription and/or Orthomyxovirus genome replication but does not significantly affect viral entry, uncoating, and/or nuclear import.

[00128] The effect of a Compound on the Orthomyxovirus life cycle may be assayed using techniques known to one of skill in the art and described herein (see, e.g., Section 5.3). For example, viral RNA transcription and replication may be measured by measuring the transcription and replication, respectively, of a reporter gene, using, e.g. , the assays disclosed herein (see, e.g., the examples in Sections 6 and 7). For example, in one embodiment, influenza virus genome transcription and replication can be measured using a reporter gene (e.g., firefly luciferase (Luc), chloramphenicol acetyl transferase (CAT), or green fluorescent protein (GFP)) cloned in the negative sense and flanked by influenza genome segment-specific non-coding regions (NCRs). Expression of NCR- flanked Luc, CAT, or GFP may be under the control of T7 polymerase or RNA polymerase I (Poll) to generate an RNA that contains neither a 5' cap nor a poly A tail. Cotransfection of a reporter plasmid with RNA polymerase II dependent vectors that express influenza NP, PBl, PB2, and PA induces RNA-dependent RNA polymerase (RdRp)-dependent expression of the Luc, CAT, or GFP -based vRNA. As RNA polymerase I production of vRNA will also serve as a template for cRNA and the subsequent induction of RdRp-dependent vRNA, this assay can distinguish both viral genome transcription (level of activity based on Poll driven vRNA) and transcription plus viral genome replication (levels of activity based on Poll and RdRp driven vRNA). Levels of activity can be quantified as Luc or CAT activity or GFP fluorescence in the presence of all required RdRp components over the activity obtained in the absence of NP, PBl, PB2, and/or PA. To control for cell viability, techniques known to one of skill in the art and described herein can be performed. For example, to determine the total number of viable cells, reagents such as CellTiter-Glo™ can be used, which produces a luminescent signal that is proportional to the intracellular ATP levels. Values for viral polymerase output can be divided by cell viability standards to determine viral induction as compared to vehicle treated (such as, e.g., DMSO) controls. Z scores can be calculated to adapt the assay for high throughput screening, where the z-score is the induction score minus the mean value of the screen divided by the standard deviation of the screen.

[00129] In some of the foregoing embodiments, the Compound does not have an inhibitory effect, or has only an insignificant effect, on the overall host cell transcription and replication machinery as compared to the effect on viral genome transcription and replication, as monitored by assays such as, e.g., the expression of reporter genes (see, e.g., Sections 6 and 7 below). In some embodiments, a reporter assay using two different reporters is used to distinguish between effects on host cell transcription and replication and viral genome transcription and replication.

[00130] In certain embodiments, a Compound, alone or in combination with another therapy, alters the kinetics of the viral cycle, e.g. , the rate of viral genome replication is altered, and/or the rate of viral mRNA production is altered. In some embodiments, the kinetic effect of a Compound is measured by adding the Compound to a cell or other viral substrate at different times ( e.g., before, concurrently with, or after) relative to infection with a virus.

[00131] Exemplary Orthomyxoviruses whose replication can be modulated by the Compounds include: influenza viruses (influenza A virus, influenza B virus, influenza C virus), Thogotoviruses (e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus, Lake Chad virus) and Isaviruses (e.g., infectious salmon anemia virus). The Compounds may modulate the replication of more than one type, subtype, or strain of Orthomyxovirus. In a particular embodiment, a Compound modulates the replication of more than one type, subtype, or strain of influenza virus. For example, the Compound may modulate the replication of influenza A virus, influenza B virus, and/or influenza C virus, such as the influenza viruses described in Section 5.1 supra. In specific embodiments, the Compound modulates the replication of an H5N1, an H1N1, or an H3N2 influenza A virus.

[00132] In certain embodiments, the Compounds provided herein are not toxic to human host cells. In certain embodiments, the Compounds provided herein are not toxic to other host cells, such as fish (e.g. salmon), avians (e.g., ducks, chickens, etc.), or livestock (e.g., pigs or horses). In some embodiments, a Compound reduces or inhibits Orthomyxovirus replication and induces a general antiviral state, for example, it induces an interferon response, as measured using any assay known in the art or described herein (see, e.g., Sections 6 and 7). In some embodiments, a Compound is designed so that its structure (e.g., presence of secondary structure, such as double-stranded secondary structure, or presence of a 5 ' triphosphate) favors the induction of an interferon response. In other embodiments, a Compound does not significantly trigger a non- Orthomyxovirus-specific antiviral state, e.g., an interferon response. For example, in some embodiments, a Compound does not induce a non-specific antiviral state, for example, it does not significantly induce an interferon response, using any assay known in the art or described herein (see, e.g., Sections 6 and 7). In some embodiments, a Compound is designed to have a structure (e.g., short length and/or lack of double- stranded secondary structure, or lack of a 5 ' triphosphate) that is unlikely to induce an interferon response.

[00133] Any compound described herein, known in the art, or to be discovered (e.g., using the methods described in Section 5.3 below) that modulates the expression and/or activity of an Orthomyxovirus svR A may be used in the compositions and in accordance with the methods described herein. The Compounds include compounds of any structure described herein or incorporated by reference herein, and solvates, hydrates, prodrugs, stereoisomers and pharmaceutically acceptable salts thereof. Such compounds include, but are not limited to, nucleic acid molecules including, but not limited to, double-stranded or single-stranded DNA, double-stranded or single-stranded RNA, anti-svRNA compounds (e.g., LNA, PNA, antisense), RNA interference (RNAi) compounds (e.g. , small interfering RNA (siRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), etc.), intron sequences (see, e.g., the example of Section 8 infra), triple helix nucleic acid molecules and aptamers; carbohydrates; proteinaceous molecules, including, but not limited to, peptides (including dimers and multimers of such peptides), polypeptides, proteins, including post-translationally modified proteins, conjugates, antibodies or antibody fragments (including intrabodies), etc.; small molecules, including inorganic or organic compounds; and lipids. In certain

embodiments, a Compound interferes or disrupts the interaction between an

Orthomyxovirus RNA-dependent RNA polymerase (RdRp) and an svRNA. In one embodiment, a Compound is purified. In another embodiment, a Compound is isolated.

5.2.1 Nucleic Acid Compounds

[00134] In some embodiments, the Compound is a nucleic acid compound. A nucleic acid Compound for use in the embodiments described herein may be any nucleic acid compound known in the art or described herein that is able to modulate the expression and/or activity of an Orthomyxovirus svRNA. In particular embodiments, a nucleic acid Compound is designed based on a known sequence of an Orthomyxovirus, for example, as provided in Genbank. In exemplary embodiments, a nucleic acid Compound is designed based on the sequence of an influenza virus described in Section 5.1 supra, using methods provided herein and known in the art. In certain embodiments, a nucleic acid Compound is encoded by RNA. In some embodiments, a nucleic acid Compound is encoded by DNA. In certain embodiments, the nucleic acid Compounds contain a 5' triphosphate. In certain embodiments, the nucleic acid Compounds have chemically modified subunits, which may optionally be arranged in patterns, or motifs, to confer to the Compounds properties such as enhanced activity, increased binding affinity for a target nucleic acid (e.g., svRNA, vRNA or cRNA, or a portion thereof), or resistance to degradation by in vivo nucleases. For example, chimeric nucleic acid compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for a target nucleic acid (e.g., svRNA, vRNA or cRNA or a portion thereof), or increased activity. In some embodiments, the nucleic acid Compound is encompassed within a compound (e.g., is part of a larger nucleic acid) that facilitates its introduction into cells, for example, is part of a plasmid. In some embodiments, the nucleic acid Compound is encompassed within a vector (e.g., a viral vector) that facilitates its introduction into cells.

Targeting of Nucleic Acid Compounds

[00135] It is understood that the sequences described in Sections 5.2.1.2 and 5.2.1.3 infra are independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, a nucleic acid Compound defined by a sequence or its target (e.g. , svRNA, vRNA or cRNA, or a portion thereof) sequence may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. The sequences of targets for the nucleic acid Compounds (e.g., Orthomyxovirus genome segments, or an Orthomyxovirus svRNA, vRNA or cRNA, or a portion thereof) - and on which nucleic acid Compound sequences may be based - can be obtained by accession number from sequence databases such as NCBI Genbank.

[00136] Targeting of a nucleic acid Compound includes determination of at least one target sequence - e.g., svRNA, vRNA or cRNA, or a portion thereof - that the

Compound mimics or to which the Compound may hybridize, such that a desired effect occurs. For example, in certain embodiments, the desired effect is a reduction in svRNA levels in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain embodiments, the desired effect is a reduction in svRNA activity in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain

embodiments, the desired effect is a reduction of vRNA or one or more other phenotypic changes associated with reducing or inhibiting the expression or activity of an svRNA in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In some embodiments, the desired effect is an increase in viral mRNA or an increase in viral proteins in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain embodiments, the reduction or increase is 50% or greater, 60% or greater, 70% or greater, 75% or greater, 80%> or greater, 85% or greater, 90% or greater, 95% or greater, 97% or greater, 98% or greater, 99% or greater or 100% or greater in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain

embodiments, the reduction or increase is 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, 90%-95% or 95%- 100% in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound.

[00137] In other embodiments, the desired effect is an increase in svRNA levels in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain embodiments, the desired effect is an increase in svRNA activity in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain embodiments, the desired effect is an increase of vR A or other phenotypic change associated with reducing or inhibiting the expression or activity of an svRNA in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain embodiments, the desired effect is a decrease in viral mR A or a decrease in viral proteins in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain

embodiments, the increase or reduction is 50% or greater, 60% or greater, 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, 97%) or greater, 98% or greater, 99% or greater or 100%) or greater in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound. In certain

embodiments, the increase or reductions is 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, 90%-95% or 95%- 100% in a substrate contacted with an Orthomyxovirus in the presence of Compound relative to the substrate contacted with an Orthomyxovirus in the absence of Compound.

[00138] The determination of suitable sequences for the nucleic acid Compounds may include a comparison of the sequence to other sequences throughout the virus or host genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of Compound sequences that may affect (for example, hybridize to in a non-specific manner) sequences other than the selected target nucleic acid (e.g., svR A, vR A or cRNA). In one embodiment, the Compound interferes with the interaction of an Orthomyxovirus RNA-dependent RNA polymerase (RdRp) with svRNA. In one embodiment, the Compound interferes with the interaction of an influenza virus RNA- dependent RNA polymerase (RdRp) with svRNA.

Hybridization

[00139] In certain embodiments, hybridization occurs between a nucleic acid Compound described herein (e.g., an anti-svRNA Compound described in Section 5.2.1.3) and an svRNA or a portion thereof. In certain embodiments, hybridization occurs between a nucleic acid Compound described herein (e.g. , an anti-svRNA

Compound described in Section 5.2.1.3) and a viral cRNA or a portion thereof. In certain embodiments, hybridization occurs between a nucleic acid Compound described herein (e.g., an anti-svRNA Compound described in Section 5.2.1.3) and a vRNA or a portion thereof. In certain embodiments, hybridization occurs between a nucleic acid Compound described herein (e.g., an svRNA mimetic) and the complement of an svRNA, vRNA or cRNA, or a portion thereof. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules. Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized. Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid (e.g., svRNA, vRNA or cRNA, or a portion thereof) are well known in the art. In certain embodiments, a nucleic acid Compound provided herein is specifically hybridizable with a target nucleic acid (e.g., svRNA, vRNA or cRNA, or a portion thereof).

[00140] In some embodiments, the target nucleic acid (e.g., svRNA, vRNA or cRNA, or a portion thereof) sequence comprises additional nucleic acids that the nucleic acid Compound does not hybridize to. In other embodiments, the target nucleic acid sequence (e.g. , svRNA, vRNA or cRNA, or a portion thereof) does not comprise additional nucleic acids that the nucleic acid Compound does not hybridize to.

[00141] In certain embodiments, a nucleic acid Compound hybridizes to its complementary (target, e.g., svRNA, vRNA or cRNA, or a portion thereof) nucleic acid sequence under high stringency, intermediate (i.e., medium or moderate) or low stringency hybridization conditions, wherein the choice of hybridization conditions used determines the degree of stringency of hybridization. Optimal hybridization conditions will depend on the length and type (e.g. , RNA, or DNA, modified or unmodified) of Compound and nucleic acid to which the Compound hybridizes. Those of skill in the art will appreciate that as nucleic acid Compounds become shorter, it may become necessary to adjust their length to achieve a relatively uniform melting temperature for satisfactory hybridization results.

[00142] In certain embodiments, the hybridization is under high stringency conditions. In certain embodiments the hybridization is under moderate (i.e., medium) stringency conditions. In certain embodiments the hybridization is under low stringency conditions. In some embodiments, two nucleic acids hybridize to one another if they are not fully complementary, for example, they hybridize under low- to medium- stringency conditions. Those of skill in the art will understand that low, medium and high stringency conditions are contingent upon multiple factors all of which interact and are also dependent upon the specific properties of the nucleic acids involved. In certain embodiments, a nucleic acid hybridizes to its complement only under high stringency conditions. For example, typically, high stringency conditions may include temperatures within 5°C melting temperature of the nucleic acid(s), a low salt concentration (e.g., less than 250 mM), and a high co-solvent concentration (e.g., 1-20% of co-solvent, e.g., DMSO). Low stringency conditions, on the other hand, may include temperatures greater than 10°C below the melting temperature of the nucleic acid(s), a high salt concentration (e.g., greater than 1000 mM) and the absence of co-solvents. Examples of high stringency conditions include: low salt concentration (e.g., 1-250 mM Na+), high temperature relative to the melting temperature of the probe(s) (e.g., from 5°C below the melting temperature to 5°C above the melting temperature), high pH (e.g., greater than pH 10), the presence of co-solvents (e.g., 1-20% DMSO or glycerol). Nucleic acid hybridization techniques and conditions are known in the art and have been described, e.g., in Sambrook et al. Molecular Cloning A Laboratory Manual, 2nd Ed. Cold Spring Lab. Press, December 1989; U.S. Pat. Nos. 4,563,419 and 4,851,330, and in Dunn et al, 1978, Cell 12: 23-26, among many other publications. Various modifications to the hybridization reactions are known in the art. For example, general parameters for stringent hybridization conditions for nucleic acids are described in Sambrook et al., MOLECULAR CLONING - A LABORATORY MANUAL (2ND ED.), Vols. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989), and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, vol. 2, Current Protocols Publishing, New York (1994).

[00143] In some embodiments, a Compound hybridizes under moderate or high stringency conditions to an svRNA and only under low stringency conditions to a vRNA or cRNA or portion thereof. In some embodiments, hybridization primarily occurs between a Compound and svRNA, with low or insignificant amounts of Compound hybridizing to vRNA. In some embodiments, a Compound hybridizes under high stringency conditions to an svRNA, and under such conditions does not hybridize to a vRNA or cRNA or portion thereof. In some embodiments, a Compound hybridizes under moderate stringency conditions to an svRNA, and under such conditions does not hybridize to a vRNA or cRNA or portion thereof.

[00144] A Compound used in accordance with the embodiments described herein may include one or more nucleic acid sequences in addition to the nucleic acid sequence of the target (e.g. , svRNA, vRNA or cRNA, or a portion thereof) that do not hybridize to the target nucleic acid sequence. An additional nucleic acid sequence may comprise any nucleic acid sequence, so long as it does not hybridize to the target nucleic acid sequence. In some embodiments, the additional nucleic acid sequence does not hybridize, or is poorly hybridizable, to a nucleic acid sequence present in the host cell or elsewhere in the viral genome. In exemplary embodiments, an additional nucleic acid sequence might be a 5' sequence recognized by a RNA polymerase (e.g., RNA Pol I, RNA Pol II, or RNA Pol III) or that enhances initiation or elongation by an RNA polymerase (e.g., a T7 promoter). More than one additional nucleic acid sequence may be included if the first sequence is incorporated into, for example, a self-hybridizing moiety (i.e., a Compound having distinct nucleobase regions capable of hybridizing to each other in the absence of a complementary target nucleic acid sequence under the conditions of the hybridization). In certain embodiments, self-hybridizing moieties comprise one or more detectable labels. In specific embodiments, self-hybridizing moieties comprise a fluorescent moiety and a quencher moiety.

[00145] The nucleic acid Compounds used in accordance with these embodiments may hybridize to their complementary nucleic acid sequences with varying degrees of specificity. In certain embodiments, a nucleic acid Compound used in accordance with these embodiments hybridizes across the full length or a portion of a target nucleic acid (e.g., svRNA, vRNA or cRNA). In certain embodiments, the Compounds hybridize with nucleic acid sequences that are 100% complementary to that of the Compound. In other embodiments, the Compounds hybridize with nucleic acid sequences that are greater than 90% complementary to that of the Compound. In other embodiments, the Compounds hybridize with nucleic acid sequence that are greater than 85%

complementary to that of the Compound. In other embodiments, the Compounds hybridize with nucleic acid sequences that are greater than 80% complementary to that of the Compound. In other embodiments, the Compounds hybridize with nucleic acid sequences that are greater than 75% complementary to that of the Compound. In other embodiments, the Compounds hybridize with nucleic acid sequences that are greater than 70% complementary to that of the Compound. In other embodiments, the

Compounds hybridize with nucleic acid sequences that are greater than 60%> complementary to that of the Compound. In certain embodiments, the Compounds hybridize with nucleic acid sequences that are 60 % to 100%, 70% to 100%), 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, or 95% to 100% complementary to that of the Compound.

Complementarity

[00146] A nucleic acid Compound (e.g., an anti-svR A Compound described in Section 5.2.1.3) and a target nucleic acid (e.g., svR A) are complementary to each other when a sufficient number of nucleobases of the Compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of the expression or activity of an svRNA). Non- complementary nucleobases between a nucleic acid Compound and a target nucleic acid may be tolerated provided that the Compound remains able to specifically hybridize to a target nucleic acid. Moreover, a Compound may hybridize over one or more portions of a target nucleic acid such that intervening or adjacent portions are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure). In certain embodiments, the Compounds provided herein are at least 70%>, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% complementary to a target nucleic acid. Percent complementarity of a Compound with a target nucleic acid can be determined using routine methods, e.g., using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol, 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[00147] In certain embodiments, a nucleic acid Compound provided herein is fully complementary (i.e., 100% complementary) to a target nucleic acid. For example, in some embodiments, an anti-svRNA Compound may be fully complementary to its target svRNA or to a defined portion thereof. As used herein, "fully complementary" means each nucleobase of a nucleic acid Compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid.

[00148] In some embodiments, the location of a non-complementary nucleobase may be at the 5 ' end or 3 ' end of the Compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the Compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In certain embodiments, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide Compound. In certain embodiments, nucleic acid Compounds up to 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2 or no more than 1 non-complementary nucleobase(s) relative to a target (e.g., svRNA) nucleic acid. In certain embodiments, Compounds up to 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2 or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid.

[00149] The Compounds provided herein also include those which are

complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of the nucleic acid Compound. In certain embodiments, the Compounds are complementary to at least an 8 nucleobase portion of a target (e.g., svRNA). In certain embodiments, the Compounds are complementary to at least a 12 nucleobase portion of a target. In certain embodiments, the Compounds are complementary to at least a 15 nucleobase portion of a target. Also contemplated are nucleic acid Compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target (e.g., svRNA), or a range defined by any two of these values.

[00150] In certain embodiments, the Compounds provided herein include those comprising a portion which consists of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 contiguous nucleobases of a nucleobase sequence set forth herein, or incorporated by reference herein. In certain embodiments, the

Compounds are complementary to an equal-length portion of the nucleobase sequence. In certain embodiments, the Compounds are at least 75%, 80%, 85%, 90%, 95%, or 100%) (fully) complementary to the nucleobase sequence.

Identity

[00151] The nucleic acid Compounds provided herein may also have a defined percent identity to a particular nucleotide sequence {e.g., an svR A). As used herein, a nucleic acid Compound is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, an R A which contains uracil in place of thymine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymine pair with adenine. Shortened and lengthened versions of the Compounds described herein as well as Compounds having non-identical bases relative to the Compounds provided herein also are contemplated. The non- identical bases may be adjacent to each other or dispersed throughout the Compound. Percent identity of a Compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

[00152] In certain embodiments, a Compound is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the Compounds or nucleobase sequences thereof, or a portion thereof, disclosed herein. In certain embodiments, a Compound is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%o, 99%) or 100% identical to one or more of the svR As or nucleobase sequences thereof, or a portion thereof, disclosed herein.

Modifications

[00153] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar.

Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[00154] Modifications to the nucleic acid Compounds described herein encompass substitutions or changes to internucleobase linkages, internucleoside linkages, sugar moieties, or nucleobases. Modified nucleic acid Compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased activity. Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated oligonucleotide Compound for its target nucleic acid. Consequently, comparable results can often be obtained with shorter Compounds (e.g., anti-svR A Compounds) that have such chemically modified nucleosides.

Modified Nucleobase Linkages or Modified Internucleoside Linkages

[00155] In naturally occurring nucleic acids, nucleobases are attached to a sugar moiety (forming a nucleoside), which are in turn linked via phosphodiester linkages. Nucleic acid Compounds having one or more modified, i.e., non-naturally occurring, linkages between nucleobases are often selected over nucleic acid Compounds having naturally occurring linkages between nucleobases linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, increased activity, or increased stability in the presence of nucleases. In one embodiment, a nucleic acid Compound described herein has one or more modified linkages between nucleobases. In one such embodiment, the nucleic acid Compound comprises one or more nucleobases linked via a peptide moiety instead of the naturally- occurring sugar-phosphodiester linkage. In certain embodiments, the nucleic acid Compound comprises one or more peptide nucleic acids ("PNA," also referred to herein as a "peptide nucleic acid compound" or "PNA compound"). See, e.g., Science

254: 1497 ^'. In some embodiments, the PNA nucleic acid Compound is linked to a compound that facilitates its entry into cells.

[00156] The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Nucleic acid Compounds having one or more modified, i.e., non-naturally occurring, internucleoside linkages are often selected over nucleic acid Compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, increased activity, or increased stability in the presence of nucleases.

[00157] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates.

Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

[00158] In certain embodiments, the nucleic acid Compounds described herein comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain

embodiments, each internucleoside linkage of a Compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

[00159] In some embodiments, the nucleic acid Compounds can optionally contain one or more nucleotides having modified sugar moieties.

[00160] Sugar modifications may impart nuclease stability, binding affinity or some other beneficial biological property to the Compounds. The furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to: addition of a substituent group, particularly at the 2' position; bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA); and substitution of an atom or group such as -S-, -N(R)- or -C(Ri)(R₂) for the ring oxygen at the 4'-position. Modified sugars include, but are not limited to: substituted sugars, especially 2'-substituted sugars having a 2^*-F, 2^*-OCH₂ (2'-OMe) or a 2^*-0(CH₂)₂-OCH₃ (2'-0-methoxyethyl or 2'-MOE) substituent group; and bicyclic modified sugars (BNAs), having a 4'-(CH₂)_n-0-2' bridge, where n=l or n=22, including a-L-Methyleneoxy (4'-CH2-0-2') BNA, β-D- Methyleneoxy (4'-CH2-0-2') BNA and Ethyleneoxy (4'-(CH2)2-0-2') BNA. Bicyclic modified sugars also include (6 'S)-6 'methyl BNA, Aminooxy (4'-CH2-0-N(R)-2') BNA, Oxyamino (4'-CH2-N(R)-0-2') BNA wherein, R is, independently, H, a protecting group, or CI -CI 2 alkyl. The substituent at the 2' position can also be selected from alyl, amino, azido, thio, O-allyl, O-CI-CIO alkyl, OCF3, 0(CH2)2SCH3,

0(CH2)2-0-N(Rm)(Rn), and 0-CH2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted CI -CIO alkyl. Methods for the preparations of modified sugars are well known to those skilled in the art.

[00161] In some embodiments of nucleic acid Compounds that have modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained.

[00162] In certain embodiments, the nucleic acid Compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-0-methoxy ethyl/phosphorothioate (2'-MOE). In certain embodiments, the 2'-MOE modified nucleotides are arranged in a gapmer motif. In certain embodiments, the Compound is 2-hydroxymethylated.

[00163] In certain embodiments, the nucleic acid Compounds comprise an

oligonucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon (e.g., referred to herein as LNA). In some embodiments, this modification results in a more stable binding of the nucleotide to its complement. In some embodiments, the LNA nucleic acid Compound is linked to a compound that facilitates its entry into cells.

Modified Nucleobases

[00164] Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to the nucleic acid Compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). For example, in some embodiments, certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense Compound or other anti-svRNA Compound for a target nucleic acid {e.g., svRNA). For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (see, e.g., Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

[00165] Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (- C≡C-CH₃) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8- thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7- methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3- deazaadenine.

[00166] Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of nucleic acid Compounds (e.g., antisense compounds or other anti-svR A compounds) include 5 -substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2

aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

[00167] In certain embodiments, nucleic acid Compounds targeted to a nucleic acid comprise one or more modified nucleobases. In certain embodiments, gap-widened oligonucleotide Compounds (e.g. , antisense oligonucleotides) targeted to a nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5- methylcytosine.

Conjugated Nucleic Acid Compounds

[00168] The nucleic acid Compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting nucleic acid Compound. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

[00169] Nucleic acid Compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of the nucleic acid Compound to enhance properties such as, for example, stability against nucleases.

Included in stabilizing groups are cap structures. These terminal modifications protect the Compound, for example, those Compounds with terminal nucleic acid(s), from exonuclease degradation, and can help in delivery or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Additional 3' and 5 '-stabilizing groups that can be used to cap one or both ends of a nucleic acid Compound to impart stability against nucleases include those described in International Patent Application Publication No. WO

03/004602, published January 16, 2003. Antisense Compounds

[00170] In certain embodiments, a nucleic acid Compound provided herein is an antisense compound {e.g., an antisense oligonucleotide). In some embodiments, the antisense Compound has a sequence that is optimized for use as an antisense compound, according to methods known in the art. As used herein, the term "antisense" refers to a nucleic acid that is the complement of a target nucleic acid.

[00171] In certain embodiments, an antisense Compound provided herein has chemically modified subunits arranged in patterns, or motifs, to confer to the antisense Compound properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid {e.g., svR A, cR A or vR A, or portion thereof), or resistance to degradation by in vivo nucleases. For example, chimeric antisense Compounds {e.g., antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits) typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, or increased inhibitory activity.

[00172] In accordance with the embodiments described herein, antisense Compounds having a gapmer motif are considered chimeric antisense Compounds. As used herein, the term "gapmer" means an antisense compound in which an internal position having a plurality of nucleotides that supports R aseH cleavage is positioned between external regions having one or more nucleotides that are chemically distinct from the nucleosides of the internal region. A "gap segment" means the plurality of nucleotides that make up the internal region of a gapmer. In certain embodiments, the antisense Compound as a "wingmer" motif, having a wing-gap or gap-wing configuration, i.e., an X-Y or Y-Z configuration as described above for the gapmer configuration. Thus, wingmer configurations for use herein include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10 or 8-2. A "wing segment" means the external region of a gapmer. In certain embodiments, an antisense Compound targeted to a nucleic acid has a gap-widened motif. As used herein, the term "gap-widened" means an antisense compound has a gap segment of 12 or more contiguous 2'- deoxyribonucleotides positioned between and immediately adjacent to 5' and 3' wing segments having from one to six nucleotides having modified sugar moieties.

[00173] In certain embodiments, the antisense Compound comprises one or more chemically modified nucleosides. In certain embodiments, the chemical modification comprises a 2'-sugar modification. In certain embodiments, the chemical modification comprises a 2'-MOE sugar modification. In certain embodiments, the chemical modification is 2'hydroxymethylation.

5.2.1.1 Synthesis and Delivery of Nucleic Acid

Compounds

[00174] Methods for preparing nucleic acid Compounds for use in accordance with the embodiments described herein are known in the art and include, e.g., chemical synthesis, methods of in vitro synthesis, and methods of effecting expression within a cell using an expression vector (see, e.g. Takashi Morita, et al: Tanpakushitu Kakusan Kouso (Proteins, Nucleic Acids and Enzymes) Vol. 47 No. 14 p 1939-1945 (2002); Asako Sugimoto, Kagaku to Seibutsu (Chemistry and Biology) Vol. 40 No. 11 : p 713- 718 (2002); Makoto Miyagishi, et al.: Jikken Igaku (Experimental Medicine) Vol. 20 No. 18 p 2667-2672 (2002); Kazunori Taira, et al: RNAi Jikken Protocol, Yodosha (2003)).

[00175] In chemical synthesis, nucleic acid is prepared in single or double stranded form. In in vitro synthesis, a double stranded nucleic acid may be expressed by association with, e.g., a T7 promoter and T7 RNA polymerase. An oligonucleotide comprising a sequence corresponding to 19-29 bases or more of the target nucleic acid (e.g., svRNA, cRNA or vRNA) is ligated downstream of the binding site of T7 RNA polymerase, and sense RNA and antisense strand RNA are synthesized by in vitro transcription, and they are annealed in vitro. Exemplary means of facilitating introduction of nucleic acids into a cell or other substrate include insertion of the nucleic acid into a plasmid vector, conjugation to lipids, conjugation to cholesterol, etc. The nucleic acid can be introduced into a cell or other substrate by, e.g., microinjection or transfection (by, e.g., electroporation or using lipid-based transfection methods, such as, e.g., lipofection methods using FuGENE6 (Roche), LIPOFECTIN® (Invitrogen, Carlsbad, CA), or Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions) or using other methods known in the art. In another embodiment, the nucleic acid can be inserted into a viral vector (e.g. , a retrovirus vector, or a DNA virus vector such as, e.g., an adenovirus vector or an adeno-associated virus vector) for infection of a cell or other substrate for subsequent transfer into a subject, or for direct infection of a subject.

[00176] Intracellular expression of nucleic acid Compounds can be effected using expression vectors known in the art, for example, by infection of a substrate (cell, egg, zygote, etc.) with a viral vector, or transfection (e.g., by electroporation or other methods known in the art or described here) or microinjection of the substrate with a DNA plasmid. For example, a sense strand and an antisense strand may be simultaneously expressed from both ends by two kinds of promoters, from separate transcription units, or by expressing appropriate precursors. In certain embodiments, the intracellular expression of the nucleic acid Compound is regulated by an inducible promoter, constitutive promoter, tissue-specific promoter, etc.

[00177] In some embodiments, intracellular expression of a nucleic acid Compound is effected via an expression vector designed to facilitate genomic integration of the sequence encoding the nucleic acid Compound. Generally, any predetermined endogenous DNA sequence can be altered by homologous recombination (which includes gene conversion) with an exogenous transgene (or complementary pair of transgenes) that has at least one sequence of homology which substantially corresponds to or is substantially complementary to a predetermined endogenous DNA target sequence and which is introduced with a recombinase {e.g. , recA) into a substrate having the predetermined endogenous DNA sequence. The transgene polynucleotide (or complementary polynucleotide pair) has a portion having a sequence that is not present in the preselected endogenous targeted sequence(s) {i.e., a nonhomologous portion) which comprises a sequence encoding the nucleic acid Compound (or its reverse complement) or 1, 2, 3, 4, 5, 10, 20, 50, 100, 200, or more copies thereof, spanning up to about several kilobases (2 to 10 or more) or more of nonhomologous sequence.

Generally, such nonhomologous portions are flanked on each side by sequences of homology, although a single flanking sequence of homology may be used.

Nonhomologous portions flanked by the sequence(s) of homology can be used to make insertions, deletions, or substitutions into a predetermined endogenous targeted DNA sequence, so that the resultant recombined sequence {i.e., a targeted recombinant endogenous sequence) incorporates the sequence information of the nonhomologous portion of the transgene polynucleotide(s). In another embodiment, the transgene encoding the nucleic acid Compound is permitted to randomly integrate into the genome. Methods known in the art may be used to assess expression and functionality of the transgenic nucleic acid Compound, such as Northern blot, PCR, ability to modulate Orthomyxovirus replication, or antiviral activity, etc. , such as described in Section 5.3 infra, and toxicity, such as described in Section 5.3.3 infra.

[00178] In some such embodiments, the sequence encoding a nucleic acid Compound is targeted for insertion into the 5' untranslated region of a cellular gene, for example, a housekeeping gene or other gene that is highly expressed. In some such embodiments, the sequence encoding a nucleic acid Compound is targeted for insertion into the 3 ' untranslated region of a cellular gene, for example, a housekeeping gene or other gene that is highly expressed. In some such embodiments, the sequence encoding the nucleic acid Compound is targeted for insertion into the noncoding region of a gene the expression of which is controlled by RNA Pol I or RNA Pol III gene.

[00179] In another such embodiment, the sequence encoding a nucleic acid

Compound is inserted as an intron between two exons of a transgene, which can be integrated into the genome of a substrate. In some embodiments, the exons encode a detectable marker interrupted by the intron, such that upon splicing of the intron, a cDNA encoding the marker is expressed. Detectable markers for use in such

embodiments are known in the art, for example, green fluorescent protein, red fluorescent protein, etc. The sequence encoding the nucleic acid Compound may be inserted into any part of an intron as long as it does not disrupt the splice donor or splice acceptor site. In a particular embodiment, the nucleic acid Compound inserted into an intron is an anti-svRNA Compound. See, for example, the example of Section 8; such an intron can be inserted into the transgene construct described in, e.g. , Yaskowiak et al. 2006, "Characterization and multi-generational stability of the growth hormone transgene (EO-l ) responsible for enhanced growth rates in Atlantic Salmon,"

Transgenic Research 15:465-480, which is incorporated herein by reference in its entirety. Transgenic animals and methods for their generation using such constructs are described in Section 5.8 infra.

[00180] For further information on how to design, generate, administer and deliver nucleic acid Compounds for use in the embodiments described herein, see, for example, Liu Y, Braasch D A, Nulf C J, Corey D R. Efficient and isoform-selective inhibition of cellular gene expression by peptide nucleic acids Biochemistry, 2004 February 24; 43(7): 1921-7; Lanford et al, 2010, "Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection," Science 327: 198-201; Nulf et al, 2004, Nucleic Acids Research 32:3792; US Patent Application Publication No. 2010- 0004320; PCT publications WO 2004/015107 (Atugen); WO 02/44321 (Tuschl et al); and WO 02/094250 (Cureon); Shen et al (FEBS letters 539: 111-114 (2003)); Xia et al, Nature Biotechnology 20: 1006-1010 (2002); Reich et al, Molecular Vision 9: 210-216 (2003); Sorensen et al. (J. Mol. Biol. 327: 761-766 (2003); Lewis et al, Nature Genetics 32: 107-108 (2002); Simeoni et al, Nucleic Acids Research 31, 11 : 2717-2724 (2003); Tolentino et al, Retina 24(1) February 2004 pp 132-138; U.S. Patent Nos. 5,486,603, 5,859,221, 5,898,031, 5,976,567, 6,107,094, 6,153,737, 6,476,205, 6,506,559,

6,815,432, 6,858,225, 7,056,704, 7,078,196, 7,199,281, 7,432,250, and 7,626,015; and U.S. Patent Application Publication Nos. 20090306356, Publication No. 20090306194, and 20090312531 , each of which are incorporated herein by reference in their entirety and the disclosures of which may be adapted to design, generate, administer and deliver nucleic acid Compounds and compositions comprising them in accordance with the present embodiments.

5.2.1.2 Nucleic Acid Compounds that Mimic or Increase svRNA Expression or Activity

[00181] In some embodiments, the nucleic acid Compounds provided herein mimic the activity of an svRNA. In some embodiments, the nucleic acid Compound increases the expression of an svRNA. In some embodiments, the nucleic acid Compound increases the expression of vRNA. In some embodiments, the nucleic acid Compound increases the activity of an svRNA. In some embodiments, the nucleic acid Compound is an svRNA mimetic, such as, e.g., a synthetic svRNA described herein. The svRNA mimetic could be antisense to the complement of an svRNA or cRNA, or could be complementary to the portion of the vRNA that the svRNA is derived from. In some embodiments, the svRNA mimetic hybridizes to the complement of an svRNA or cRNA, or hybridizes to the portion of the vRNA that the svRNA is derived from.

[00182] Nucleic acid Compounds that mimic or increase svRNA expression or activity may range in length from 12 to 30 nucleotides in length, for example, 12 to 15, 15 to 20, 20 to 25, or 22 to 25, or 22 to 27, or 25 to 30 nucleotides in length. In some embodiments, the nucleic acid Compound is 20 to 30 nucleotides in length. In some embodiments, the nucleic acid Compound is 22 to 38 nucleotides in length. For example, the nucleic acid Compound may be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and for example, 22 or 26 or 28, or 25 or 27, nucleotides in length. In some

embodiments, the nucleic acid Compound sequence is identical or nearly identical to an svRNA sequence described in Section 5.1 supra. In some embodiments, the nucleic acid Compound is an svRNA mimetic, i.e., is a synthetic version of an svRNA described in Section 5.1 supra. In some embodiments, the sequence of the Compound is at least 40% identical, 50% identical, 55% identical, 60% identical, 65% identical, 70% identical, 75% identical or 80% or more identical to the sequence of an svRNA or cRNA, or a portion thereof, or to the complement of a vRNA, or a portion thereof. In some embodiments, the sequence of the Compound is at least 80% identical, 85% identical, 90%> identical, 95% identical, 98% identical, or 99% or more identical to the sequence of an svRNA or cRNA, or a portion thereof, or to the complement of a vRNA, or a portion thereof.

[00183] In some embodiments, the sequence of the nucleic acid Compound comprises other nucleobases in addition to the sequence encoding the svRNA mimetic. In some such embodiments, the nucleic acid Compound comprises 1, 2, 3, 4, 5, 10, 20, 50, 75, 100, 150, 200, 300, 400, 500, 1000 or more additional nucleobases in addition to the sequence encoding the svRNA mimetic. For example, in some embodiments, the nucleic acid Compound comprises a sequence encoding one or more detectable markers (e.g. , green or red fluorescent proteins) or elements that regulate the expression of the svRNA mimetic, such as, e.g., an inducible promoter, constitutive promoter, tissue- specific promoter, etc.

[00184] In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity is specific for a particular Orthomyxovirus genome segment. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity is not specific for a particular Orthomyxovirus genome segment, but rather broadly mimics or increases the expression or activity of svRNAs of the Orthomyxovirus. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity mimics or increases the expression or activity of an svRNA for a single segment of a particular Orthomyxovirus. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity mimics or increases the expression or activity of svRNAs for two, three, four, five, six or more genome segments of a particular Orthomyxovirus, or two or more types, subtypes, or strains of Orthomyxovirus. In some embodiments, the nucleic acid Compound mimics or increases the expression or activity of svRNAs of one type, subtype, or strain of Orthomyxovirus. In some embodiments, the nucleic acid Compound mimics or increases the expression or activity of svRNAs of more than one type, subtype, or strain of Orthomyxovirus. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity mimics or increases the expression or activity of svRNAs of two, three, four or more types, subtypes, or strains of Orthomyxovirus.

[00185] In certain embodiments, a nucleic acid Compound that mimics or increases Thogotovirus svRNA expression or activity has a consensus nucleobase sequence comprising or consisting of 5'-AGAGAUAUCAAAGCAGUUUUU-3'. [00186] In certain embodiments, a nucleic acid Compound that mimics or increases Isavirus svR A expression or activity has a consensus nucleobase sequence comprising or consisting of 5'-UUAAACACCAUAUUCAUCCAUCAGGUCUUCUUUUU-3'.

[00187] In certain embodiments, the nucleic acid Compound mimics or increases the expression or activity of svRNAs of influenza A virus, influenza B virus and/or influenza C virus. In some embodiments, a Compound that mimics the expression or activity of svRNAs from one type of influenza differs in sequence from a Compound that mimics the expression or activity of svRNAs from another type of influenza by one two four bases. In some embodiments, the nucleic acid Compound mimics or increases the expression or activity of an svRNA from one or more of the influenza viruses described in Section 5.1 supra. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity is not specific for a particular influenza virus genome segment, but rather broadly mimics or increases the expression or activity of svRNAs of the influenza virus. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity mimics or increases the expression or activity of an svRNA for a single segment of a particular influenza virus. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity mimics or increases the expression or activity of svRNAs for two, three, four, five, six or more genome segments of a particular influenza virus, or two or more types, subtypes, or strains of influenza virus. In some embodiments, the nucleic acid Compound mimics or increases the expression or activity of svRNAs of one type, subtype, or strain of influenza virus. In some embodiments, the nucleic acid Compound mimics or increases the expression or activity of svRNAs of more than one type, subtype, or strain of influenza virus. In some embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity mimics or increases the expression or activity of svRNAs of two, three, four or more types, subtypes, or strains of influenza virus.

[00188] In certain embodiments, the nucleic acid Compound mimics or increases influenza A svRNA expression or activity. In some embodiments, the nucleic acid Compound that mimics or increases influenza A svRNA expression or activity ranges from 20 nucleotides to 30 nucleotides, e.g., 22 to 25 nucleotides, or 22 to 27 nucleotides, or 22 nucleotides to 28 nucleotides, for example, 22, 24, 26 or 28 nucleotides, or 25 or 27 nucleotides, in length. In a specific embodiment, the nucleic acid Compound that mimics or increases influenza A svRNA expression or activity uniquely mimics an svRNA for a particular genome segment of influenza A. In another embodiment, the nucleic acid Compound that mimics or increases influenza A svRNA expression or activity is not specific for a particular influenza A genome segment. In one

embodiment, the nucleic acid Compound that mimics or increases influenza A svRNA expression or activity has a consensus nucleobase sequence comprising or consisting of

5^*-AGUAGAAACAAGG-Xl4-Xl5-Xl6-UUUUU-X22-X23-X24-X25-X26-X27-X28-3^*, wherein Xs denote segment specific bases, and X23-X28 are either segment specific bases or are absent. In some embodiments,

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X₂₂ is U, C, or G;

X23 is U or C or A or is absent;

X24 is U, C, A, G, or is absent;

X25 is U, C, A, G, or is absent;

X₂6 is U or A or is absent;

X27 is U or C or is absent; and

X28 is G or U or is absent.

[00189] In some embodiments, the nucleobase in the "X" position is chosen based on the nucleobase present at the corresponding position of the complement of the 5 ' end of a particular influenza A virus genome segment. By way of non-limiting example, one exemplary nucleic acid Compound that mimics or increases influenza A svRNA expression or activity has a nucleobase sequence comprising or consisting of

AGUAG A AAC AAGGUACUUUUUUGG AC AG . Another exemplary nucleic acid Compound that mimics or increases influenza A svRNA expression or activity has a nucleobase sequence comprising or consisting of

AGUAGAAACAAGGCACUUUUUCGG. In some embodiments, a nucleic acid Compound is an influenza A svRNA mimetic that has a nucleobase sequence comprising or consisting of the sequence in Table 4 below, or a portion thereof.

[00190] In another embodiment, the nucleic acid Compound mimics or increases influenza B svRNA expression or activity. In some embodiments, the nucleic acid Compound that mimics or increases influenza B svRNA expression or activity ranges from 20 nucleotides to 30 nucleotides, or 20 nucleotides to 28 nucleotides, or 22 to 25, or 22 to 27 nucleotides, for example, 21 nucleotides, or 25 nucleotides, or 27 nucleotides, or 28 nucleotides, in length. In a specific embodiment, the nucleic acid Compound that mimics or increases influenza B svRNA expression or activity uniquely mimics an svRNA for a particular genome segment of influenza B. In another embodiment, the nucleic acid Compound that mimics or increases influenza B svRNA expression or activity is not specific for a particular influenza B genome segment. In one embodiment, the nucleic acid Compound that mimics or increases influenza B svRNA expression or activity has a consensus nucleobase sequence comprising or consisting of 5*- AGUAG(A/T)AACAAG-Xi₃-Xi4-Xi5-UUUUU-X₂i-X22-X23-X24-X25- X26-X27-3', wherein Xs denote segment specific bases, and X21-X27 are either segment specific bases or are absent. In some such embodiments,

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X21 is U or C or A or is absent;

X22 is U or C or A or is absent;

X₂₃ is U or C or A or is absent;

X24 is U or C or A or is absent;

X25 is U or C or A or is absent;

X26 is U or C or A or is absent; and

X27 is U or C or A or is absent.

[00191] In one embodiment, the nucleic acid Compound that mimics or increases influenza B svRNA expression or activity has a consensus nucleobase sequence comprising or consisting of 5'-

AGUAG(AAJ)AACAA(G/C)(A/G)(G/C)Xi₅(A/C)UUUUU-X₂2-X23-X24-X25-X26-X27- X₂8-3', wherein Xs denote segment specific bases, and X22-X28 are either segment specific bases or are absent. In some embodiments, the nucleobase in the "X" position is chosen based on the nucleobase present at the corresponding position of the complement of the 5 ' end of a particular influenza B virus genome segment.

[00192] In another embodiment, the nucleic acid Compound mimics or increases influenza C svRNA expression or activity. In some embodiments, the nucleic acid Compound that mimics or increases influenza C svRNA expression or activity ranges from 20 to 30 nucleotides, for example, 22 nucleotides to 25 nucleotides, 22 nucleotides to 27 nucleotides, or 22 nucleotides to 28 nucleotides, for example, 22, 24, 26 or 28 nucleotides, or 25 or 27 nucleotides, in length. In a specific embodiment, the nucleic acid Compound that mimics or increases influenza C svRNA expression or activity uniquely mimics an svRNA for a particular genome segment of influenza C. In another embodiment, the nucleic acid Compound that mimics or increases influenza C svRNA expression or activity is not specific for a particular influenza C genome segment. In one embodiment, the nucleic acid Compound that mimics or increases influenza C svRNA expression or activity has a consensus nucleobase sequence comprising or consisting of 5^*-AGCAGUAGCAAGG-Xi4-Xi5-Xi6-UUUUU-X₂2-X23-X24-X25-X26-X27- X₂8-3', wherein Xs denote segment specific bases, and X23-X28 are either segment specific bases or are absent. In one embodiment, the nucleic acid Compound that mimics or increases influenza C svRNA expression or activity has a consensus nucleobase sequence comprising or consisting of 5'-AGCA(A/G)UAGCAAGG-Xi4-Xi5- X16-UUUUU-X22-X23-X24-X25-X26-X27-X28-3', wherein Xs denote segment specific bases, and X22-X28 are either segment specific bases or are absent. In some such embodiments,

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

X22 is U or C or A or is absent;

X23 is U or C or A or is absent;

X24 is U or C or A or is absent;

X25 is U or C or A or is absent;

X26 is U or C or A or is absent;

X27 is U or C or A or is absent; and

X28 is U or C or A or is absent.

[00193] In some embodiments, the nucleobase in the "X" position is chosen based on the nucleobase present at the corresponding position of the complement of the 5 ' end of a particular influenza C virus genome segment.

[00194] In some embodiments, a nucleic acid Compound that mimics or increases svRNA expression or activity is a pan-specific nucleic acid Compound (i.e., it is not specific to a particular genome segment, or is not specific to a particular type, subtype, or strain of Orthomyxovirus). In some embodiments, the nucleic acid compound that mimics or increases svRNA expression or activity recognizes a particular

Orthomyxovirus genome segment. In other embodiments, the nucleic acid Compound that mimics or increases svRNA expression or activity recognizes each genome segment of a particular Orthomyxovirus equally. In one embodiment, a pan-specific nucleic acid Compound targets each of the eight influenza A virus genome segments. In one embodiment, a pan-specific nucleic acid Compound mimics each of the eight influenza A virus svRNAs. In one embodiment, a pan- specific nucleic acid Compound targets each of the eight influenza B virus genome segments. In one embodiment, a pan- specific nucleic acid Compound mimics each of the eight influenza B virus svRNAs. In one embodiment, a pan-specific nucleic acid Compound targets each of the seven influenza C virus genome segments. In one embodiment, a pan- specific nucleic acid Compound mimics each of the seven influenza C virus svRNAs. For example, this may be accomplished by randomly inserting A/C/G or U at each of the variable nucleobase positions (i.e., the Xs in the foregoing paragraphs), resulting in a probe that is a heterogeneous population of every possible combination.

[00195] In one embodiment, the pan-specific nucleic acid Compound is a synthetic svRNA with a nucleobase sequence comprising or consisting of 5'- AGUAGAAACAAGGGUGUUUUUUUGUCAC-3'. In some embodiments, the synthetic svRNA sequence is encoded by a DNA sequence comprising or consisting of AGTAGAAAC AAGGGTGTTTTTTTGTC AC-3 ' , which may be single or double stranded.

[00196] In another embodiment, the pan-specific nucleic acid Compound is a synthetic svRNA that mimics the activity of svRNAs of influenza A virus, influenza B virus and/or influenza C virus. In one embodiment, a nucleic acid Compound that mimics or increases influenza A virus, influenza B virus and/or influenza C virus svRNA expression or activity has a consensus nucleobase sequence comprising or consisting of 5^*-AG(U/C)AG-X6-A-X8-CAAG-Xi3-Xi4-Xi5-Xi6-UUUUU-3^*, wherein Xs may denote strain, type, subtype or segment- specific bases. In an exemplary

embodiment, a synthetic svRNA Compound that mimics the activity of svRNAs of influenza A virus, influenza B virus and/or influenza C virus has a nucleobase sequence comprising or consisting of 5 ' - AGUAGUAUC AAGUUUUUUUUU -3 ' . Such

Compounds could be used to increase influenza virus genome replication and decrease influenza virus genome transcription in accordance with the methods described herein.

[00197] In some of the foregoing embodiments, the nucleic acid Compound comprises or consists of a nucleobase sequence that terminates 4, or 5, or 6, or 7, or 8, or 9, or 10 bases beyond the polyU tract of the corresponding viral genome segment, terminating 21-27 nucleotides from the terminal base of that particular given viral genome segment. In some embodiments, the nucleic acid Compound comprises a nucleobase sequence that is a minor modification of one of the foregoing nucleobase sequences (i.e., differing by 4, or 3, or 2, or 1 bases). In some of the foregoing embodiments, the nucleic acid Compound that mimics or increases the expression or activity of an Orthomyxovirus svRNA is an LNA or a PNA compound.

[00198] In some embodiments, a nucleic acid Compound described herein is encoded by R A. In some embodiments, a nucleic acid Compound described herein is encoded by DNA. In some embodiments, the DNA is single stranded. In some embodiments, the DNA is double stranded.

5.2.1.3 Nucleic Acid Compounds that Reduce or Inhibit svRNA Expression or Activity

[00199] In some embodiments, provided herein are nucleic acid Compounds that reduce or inhibit the expression of an Orthomyxovirus svRNA. In some embodiments, provided herein are nucleic acid Compounds that reduce or inhibit the activity of an Orthomyxovirus svRNA. The nucleic acid Compounds that reduce or inhibit expression or activity of Orthomyxovirus svRNAs could be antisense to an svRNA or partially antisense (i.e., wherein 1, 2, 3, 4, 5, or more nucleobases do not perfectly base-pair with the Orthomyxovirus svRNA) to an svRNA, or antisense or partially antisense to the portion of a cRNA corresponding to the genome segment from which the svRNA is derived. Such compounds are referred to collectively herein as "anti-svRNA" or "anti- svRNA compounds."

[00200] In certain embodiments, an anti-svRNA Compound is targeted to a nucleic acid sequence (e.g., svRNA or the cRNA corresponding to the genome segment from which the svRNA is derived) that is 12 to 30 nucleotides in length. The anti-svRNA Compounds may range in length from 12 to 30 linked subunits (e.g., nucleotides, nucleosides or nucleobases), for example, 12 to 15, 15 to 20, 20 to 25, 22 to 25, 22 to 27, 22 to 28, or 25 to 30 linked subunits in length. For example, the anti-svRNA Compound may be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 linked subunits in length. In certain embodiments, the anti-svRNA Compound is 8 to 80, 12 to 50, 15 to 30, 20 to 30, 18 to 24, 19 to 22, or 20 linked subunits in length. In certain embodiments, the anti-svRNA Compounds are 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In certain embodiments, the linked subunits are linked nucleobases, nucleosides, or nucleotides. Anti-svR A Compounds may also be shortened or lengthened, or have mismatches introduced, without eliminating their activity.

[00201] In some embodiments, the anti-svR A Compound is identical to part or all of the complement of an Orthomyxovirus svRNA, or to part or all of the complement of the 5 ' end of an Orthomyxovirus cRNA, so that it hybridizes to the svRNA or cRNA under conditions described herein or known in the art. In some embodiments, the anti- svRNA Compound is at least 40% identical, 50%> identical, 55% identical, 60%> identical, 65% identical, 70% identical, 75% identical or 80% or more identical to the complement of an Orthomyxovirus svRNA or to the 5 ' end of an Orthomyxovirus cRNA. In some embodiments, the anti-svRNA Compound is at least 80% identical, 85%o identical, 90%> identical, 95% identical, 98%> identical, or 99% or more identical to the complement of an Orthomyxovirus svRNA or to the 5 ' end of an Orthomyxovirus cRNA In some embodiments, the anti-svRNA Compound hybridizes to an

Orthomyxovirus svRNA described in Section 5.1 supra.

[00202] In certain embodiments, an anti-svRNA Compound has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, comprises the reverse complement of the target segment or portion of a target nucleic acid (e.g. , svRNA or cRNA) to which it is targeted. In certain embodiments, an anti-svRNA Compound has a nucleobase sequence that, when written in the 5 ' to 3 ' direction, comprises the reverse complement of the svRNA, or portion thereof, to which it is targeted.

[00203] Anti-svRNA Compounds provided herein include, but are not limited to, oligomeric compounds, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, LNA compounds, and PNA

compounds. In some embodiments, an anti-svRNA Compound is an LNA compound. In some embodiments, an anti-svRNA Compound is a PNA compound.

[00204] In some embodiments, the sequence of an anti-svRNA nucleic acid

Compound comprises other nucleobases in addition to the Orthomyxovirus sequence to which it is targeted. In some such embodiments, the anti-svRNA nucleic acid

Compound comprises 1, 2, 3, 4, 5, 10, 20, 50, 75, 100, 150, 200, 300, 400, 500, 1000 or more additional nucleobases in addition to the Orthomyxovirus sequence to which it is targeted. For example, in some embodiments, the anti-svRNA nucleic acid Compound comprises a sequence encoding one or more detectable markers (e.g., a green or red fluorescent protein) or elements that regulate its expression, such as, e.g., an inducible promoter, constitutive promoter, tissue-specific promoter, etc.

[00205] In some embodiments, the anti-svRNA Compound is specific for a particular Orthomyxovirus genome segment. In some embodiments, the anti-svRNA Compound is not specific for a particular Orthomyxovirus genome segment, but rather broadly reduces or inhibits the expression or activity of svRNAs of the Orthomyxovirus. In some embodiments, the anti-svRNA Compound is specific for a single segment of a particular Orthomyxovirus. In some embodiments, the anti-svRNA Compound is specific for svRNAs for two, three, four, five, six or more genome segments of a particular Orthomyxovirus, or two or more types, subtypes, or strains of

Orthomyxovirus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity svRNAs of one type, subtype, or strain of Orthomyxovirus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNAs of more than one type, subtype, or strain of Orthomyxovirus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNAs from two, three, four or more types, subtypes, or strains of

Orthomyxovirus .

[00206] In certain embodiments, the anti-svRNA Compound is a Thogotovirus anti- svRNA. In one embodiment, the Thogotovirus anti-svRNA has a nucleobase sequence comprising or consisting of 5'- AAAAACUGCUUUGAUAUCUCU-3'.

[00207] In certain embodiments, the anti-svRNA Compound is an Isavirus, e.g., infections salmon anemia virus, anti-svRNA. In one embodiment, the Isavirus anti- svRNA has a nucleobase sequence comprising or consisting of 5'- AAAAAGAAGACCUGAUGGAUGAAU-3 ' .

[00208] In certain embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNAs of influenza A virus, influenza B virus and/or influenza C virus. In some embodiments, the anti-svRNA Compound that reduces or inhibits the expression or activity of svRNAs from one type of influenza differs in sequence from an anti-svRNA Compound that reduces or inhibits the expression or activity of svRNAs from another type of influenza by one two four bases. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNA from one or more of the influenza viruses described in Section 5.1 supra. In some embodiments, the anti-svRNA Compound is not specific for a particular influenza virus genome segment, but rather broadly reduces or inhibits the expression or activity of svRNAs of the influenza virus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of an svR A for a single segment of a particular influenza virus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNAs for two, three, four, five, six or more genome segments of a particular influenza virus, or two or more types, subtypes, or strains of influenza virus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNAs of one type, subtype, or strain of influenza virus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNAs of more than one type, subtype, or strain of influenza virus. In some embodiments, the anti-svRNA Compound reduces or inhibits the expression or activity of svRNAs of two, three, four or more types, subtypes, or strains of influenza virus.

[00209] In one embodiment, the anti-svRNA Compound is an influenza A segment- specific anti-svRNA, such as, for example, an LNA anti-svRNA. For example, the influenza A segment-specific anti-svRNA may have a nucleobase sequence comprising or consisting of a sequence provided in Table 1 below, or a portion thereof. For example, in accordance with the embodiments described herein, an anti-svRNA

Compound specific for the influenza A genome segment that encodes HA (segment 4) (also referred to herein as "anti-HA") may have the nucleobase sequence

GAGGAAAAAAACACCCUUGUUUCUACU. In one embodiment, a consensus influenza A anti-svRNA Compound has the nucleobase sequence comprising or consisting of 5'-AAAAANNNCCUUGUUUCUACU-3', wherein "N" denotes a segment-specific nucleobase, as exemplified in Table 1.

Table 1.

[00210] In some embodiments, an influenza A virus anti-svR A has a nucleobase sequence comprising or consisting of 5'- AAAAANNNCCUUGUUUCUACU-3', or a portion thereof, wherein N denotes any base. In some embodiments, an influenza C virus anti-svRNA has a nucleobase sequence comprising or consisting of 5 '

AAAAANNNCCUUGCUACUGCU-3, or a portion thereof, wherein N denotes any base. In some embodiments, an influenza B virus anti-svRNA has a nucleobase sequence comprising or consisting of 5'-AAAAANNNCUUGUUUCUACU-3', wherein N denotes any base. In some embodiments, an anti-svRNA Compound reduces or inhibits the expression or activity of svR As from influenza A virus, influenza B virus and/or influenza C virus.

[00211] In some embodiments, an anti-svRNA Compound that inhibits the expression or activity of an svRNAs from one type of influenza differs in sequence from an anti-svRNA Compound that inhibits the expression or activity of an svR A from another type of influenza by one two four bases. In certain embodiments, the anti- svRNA Compound reduces or inhibits the expression or activity of an influenza virus described in Section 5.1 supra.

[00212] In an exemplary embodiment, an anti-svRNA Compound {e.g., an LNA anti- svRNA) that reduces or inhibits the expression or activity of svRNAs from influenza A virus, influenza B virus and/or influenza C virus has a nucleobase sequence comprising or consisting of 5 '-AAAAAUUUCCUUGUUUCUUCU-3 ' . In another embodiment, an anti-svRNA Compound {e.g. , an LNA anti-svRNA) that reduces or inhibits the expression or activity of svRNAs from influenza A virus, influenza B virus and/or influenza C virus has a nucleobase sequence comprising or consisting of 5'- AAAAAUUUCCUUGUUUCUUCU-3', with small variations {e.g., variations in length and/or variations at one two four positions). In some embodiments, the single nucleotide polymorphisms between influenza A , B and C virus strains do not significantly affect the overall binding capacity of such broad-acting anti-svRNA Compounds, as measured using an assay and standards described herein or known in the art. Such anti-svRNA Compounds - or their complements - may also be used to reduce or inhibit the synthesis of Orthomyxovirus cRNA or vRNA in accordance with the methods described herein.

[00213] In some embodiments, the anti-svRNA or anti-svRNA Compound inhibits or reduces the interaction between an Orthomyxovirus svRNA and the polymerase (for example, the interaction of an influenza virus svRNA and the polymerase subunits PA, PB1 and PB2), as measured using techniques known in the art (e.g., immunoprecipitation, Western blotting, Northern blotting, or Northwestern blotting, etc.).

[00214] In some embodiments, the anti-svRNA Compound described herein is encoded by RNA. In some embodiments, the anti-svRNA Compound described herein is encoded by DNA. In some embodiments, the anti-svRNA Compound is single- stranded. In some embodiments, the anti-svRNA Compound is double-stranded. In some embodiments, an anti-svRNA Compound comprises a sequence in which strain and segment-specific bases are replaced with uracils to induce broader binding capacity to both guanine and adenine.

5.2.2 Additional Compounds

[00215] In addition to the Compounds provided above, any compound or library of compounds from any source can be tested for modulation of svRNA expression and/or activity, for the desired effect(s) of modulation of Orthomyxovirus replication, utility as antiviral agents, or for increasing Orthomyxovirus production, by targeting one or more of the Orthomyxovirus svRNAs described herein. Such compounds include, but are not limited to, proteins, polypeptides, peptides, nucleic acids, including dominant negative mutants, ribozyme or triple helix molecules, antibodies (including antibodies for intracellular use, referred to herein as intrabodies), small organic molecules, or inorganic molecules. In a specific embodiment, an antibody is used, for example, an intrabody. In other embodiments, small molecular weight compounds are used. In certain preferred embodiments, the compound is in a form so that it can be delivered into a human host cell, e.g., in vivo.

[00216] In some embodiments, such compounds are identified by screening for their ability to modulate svRNA expression and/or activity or to modulate Orthomyxovirus replication, and can then be tested for their efficacy as antiviral agents or for use in Orthomyxovirus production using the assays described in the Section 5.3 below.

5.3 Biological Assays

5.3.1 Cellular Assays for Assessing the Effect of a Compound on svRNA Expression

[00217] The following methods and the methods described in the examples of Sections 6 and 7 (e.g., primer extension, minigenome reporter assays using luciferase, Western blot, plaque assay, viral growth curves) may be used for assaying the effect of a compound on Orthomyxovirus svRNA expression, for contacting viral substrates with such compounds, and/or for screening for compounds that have an effect on

Orthomyxovirus svRNA expression or activity. With respect to delivering and testing the activity of nucleic acid compounds, see also Section 5.2.1 above and the references cited therein.

[00218] In one embodiment, the effect of a compound on the expression of

Orthomyxovirus svRNAs is measured using the deep sequencing methods, Northern blot analysis with Orthomyxovirus svRNA-specific probes (e.g. , probes that hybridize to the 5 ' ends of Orthomyxovirus vRNAs or probes that hybridize to Orthomyxovirus svRNAs), or screening assays described in Sections 6 and 7, infra.

[00219] The effect of a compound on the expression of Orthomyxovirus svRNAs can be tested in vitro using a variety of substrates (e.g., cell types or eggs). Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to an avian cell or cell line (e.g., chicken cell or cell line, etc.), fish cell or cell line (e.g., a salmon red blood cell), pig cell or cell line (such as, e.g., PK(D1) cells, PK(15) cells, PK13 cells, SJPL cells, NSK cells, LLC-PKl cells, LLC-PKl A cells, ESK-4 cells, ST cells, PT-K75 cells, or PK-2a/CL 13 cells, etc.), fibroblast cell, Vera cell, MDCK cell, MBCK cell, human respiratory epithelial cell (e.g., A549 cells) or other cell of the respiratory tract, HEK 293 cell, calf kidney cell or mink lung cell. In certain embodiments, the substrate is an embryonated egg. In certain embodiments, the substrate is biologically relevant to Orthomyxovirus, e.g., influenza virus, infection.

[00220] For the cellular assays described herein, compounds may be delivered into substrates, e.g., cells, by routine methods. In addition to the methods described and incorporated by reference in Section 5.2.1 supra, with regard to nucleic acid compounds, for example, cells may be contacted with a compound when the cells reach

approximately 60-80% confluency in culture. Commonly used methods to introduce nucleic acids into cultured cells includes lipid-based transfection methods, e.g. , using the cationic reagent LIPOFECTIN® (Invitrogen, Carlsbad, CA) or Lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions or using methods known in the art or described herein (see, e.g., Sections 6 and 7). Cells are typically harvested 16-24 hours after contact with the nucleic acid, at which time the levels of expression or activity of target (e.g. , svRNA) nucleic acids are measured by methods known in the art or described herein.

[00221] The concentration of compounds used varies depending on the compound and the substrate to which it is contacted. Methods to determine the optimal

concentration for a particular compound and substrate are known in the art. For example, a nucleic acid compound (e.g. , a synthetic svRNA or anti-svRNA compound described in Section 5.2) may be used at concentrations ranging from 1 nM to 500 nM. In some embodiments, a nucleic acid compound (e.g., a synthetic svRNA or anti-svRNA compound described in Section 5.2) is used at a concentration ranging from 1 nM to 10 nM, 10 nM to 50 nM, 50 nM to 100 nM, 100 nM to 250 nM, or 250 nM to 500 nM.

[00222] Methods of RNA isolation and analysis for use in determining the effect of a compound on svRNA expression are known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols. In some embodiments, the deep sequencing methods described in Sections 6 or 7 are used to isolate and analyze the expression of svRNAs.

[00223] The ability of a compound to modulate Orthomyxovirus svRNA expression can be assayed in a variety of ways known in the art. For example, svRNA levels can be quantified by, e.g., the deep sequencing methods described in Sections 6 or 7 below, or by routine methods such as of Northern blot analysis (see also Sections 6 and 7), competitive polymerase chain reaction (PCR), or quantitative (e.g., real-time) PCR. RNA analysis can be performed on a selected nucleic acid population, for example, total cellular and/or viral RNA, RNAs with a certain size cut-off, etc.

[00224] In one embodiment, a decrease in svRNA expression is measured by: (a) contacting a compound or a member of a library of compounds with a substrate (e.g., a cell or egg) before (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more before), concurrently and/or subsequent to (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more after) infection with the Orthomyxovirus; and (b) detecting svRNA expression using a probe specific for the svRNA, wherein the compound or member of a library of compounds is considered to decrease svRNA expression if the amount of svRNA in a substrate (e.g., a cell or egg) contacted with the compound or member of a library of compounds is decreased compared to the amount of svRNA detected in a substrate (e.g. , a cell or egg) contacted with a negative control or not contacted with the compound or member of a library of compounds. In some embodiments, svRNA expression is detected using a probe specific for a particular svRNA. In some embodiments, svRNA expression is detected using a probe that is pan-specific for svRNAs for an

Orthomyxovirus. In some embodiments, svRNA expression is detected using a probe that hybridizes to the 5 ' end of a specific Orthomyxovirus vRNA. In some

embodiments, svRNA expression is detected using a probe that is pan-specific for the 5 ' ends of Orthomyxovirus vRNAs. In some embodiments, the probe is used in a Northern blot assay to detect svRNA expression. In some embodiments, the probe is considered to detect svRNA expression if it specifically detects small RNAs, for example, less than 40, or 30 to 40, or 20 to 30 nucleobases in length.

[00225] In one embodiment, a decrease in svRNA expression is measured by: (a) contacting a compound or a member of a library of compounds with a substrate (e.g., a cell or egg) before (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more before), concurrently and/or subsequent to (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more after) infection with the Orthomyxovirus; and (b) using deep sequencing to measure the amount of svRNA, wherein the compound or member of a library of compounds is considered to decrease svRNA expression if the amount of svRNA in a substrate (e.g., a cell or egg) contacted with the compound or member of a library of compounds is decreased compared to the amount of svRNA detected in a substrate (e.g. , a cell) contacted with a negative control or not contacted with the compound or member of a library of compounds.

[00226] In one embodiment, an increase in svRNA expression is measured by: (a) contacting a compound or a member of a library of compounds with a substrate (e.g., a cell or egg) before (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more before), concurrently and/or subsequent to (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more after) infection with the Orthomyxovirus; and (b) detecting svRNA expression using a probe specific for the svRNA, wherein the compound or member of a library of compounds is considered to increase svRNA expression if the amount of svRNA in a substrate (e.g., a cell or egg) contacted with the compound or member of a library of compounds is increased compared to the amount of svRNA detected in a substrate (e.g., a cell or egg) contacted with a negative control or not contacted with the compound or member of a library of compounds. In some embodiments, svRNA expression is detected using a probe specific for a particular svRNA. In some embodiments, svRNA expression is detected using a probe that is pan-specific for svRNAs for an

[00227] In one embodiment, an increase in svRNA expression is measured by: (a) contacting a compound or a member of a library of compounds with a substrate (e.g., a cell or egg) before (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more before), concurrently and/or subsequent to (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more after) infection with the Orthomyxovirus; and (b) using deep sequencing to measure the amount of svRNA, wherein the compound or member of a library of compounds is considered to increase svRNA expression if the amount of svRNA in a substrate (e.g., a cell or egg) contacted with the compound or member of a library of compounds is increased compared to the amount of svRNA detected in a substrate (e.g., a cell) contacted with a negative control or not contacted with the compound or member of a library of compounds.

[00228] In some of the foregoing embodiments, the effect on svRNA expression is measured 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 18 hours, 24 hours, 32 hours, 36 hours, 40 hours, 48 hours, 72 hours, or 96 hours after contacting the compound with the substrate. In some of the foregoing embodiments, the effect on svRNA expression is measured 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 18 hours, 24 hours, 32 hours, 36 hours, 40 hours, 48 hours, 72 hours, or 96 hours after the substrate with the virus.

[00229] In some embodiments of the assays for testing the effect of a compound on the expression of svRNAs described herein, the svRNAs may introduced to the substrate (e.g., cells) by infection with an Orthomyxovirus, e.g., an influenza virus. In some embodiments, the svRNAs are introduced to cells by recombinant methods. For example, in some embodiments, the svRNA is generated from an Orthomyxovirus, e.g., an influenza virus, by reverse genetics techniques for Orthomyxovirus production known in the art. See, e.g., U.S. Patent No. 5,166,057 issued November 24, 1992; in

U.S. Patent No. 5,854,037 issued December 29, 1998; in European Patent Publication

EP 0702085A1, published February 20, 1996; in U.S. Patent Application Serial No.

09/152,845; in International Patent Publications PCT WO 97/12032 published April 3,

1997; WO 96/34625 published November 7, 1996; in European Patent Publication EP

A780475; WO 99/02657 published January 21, 1999; WO 98/53078 published

November 26, 1998; WO 98/02530 published January 22, 1998; WO 99/15672 published April 1, 1999; WO 98/13501 published April 2, 1998; WO 97/06270 published February 20, 1997; and EPO 780 475A1 published June 25, 1997, each of which is incorporated by reference herein in its entirety. In some embodiments, the svRNA introduced into the substrate {e.g. , cells) is encompassed within a vector, such as another virus or a plasmid, and may optionally be part of a reporter construct that permits identification or quantification of the svRNA. In some embodiments, the svRNAs are chemically synthesized and introduced into the substrate {e.g., cells) using nucleic acid delivery methods known in the art or described herein.

[00230] The effect of a compound or library of compounds on svRNA expression can be measured for any Orthomyxovirus that has or is suspected of having svRNAs. In some embodiments, the Orthomyxovirus is a Thogotovirus, such as, e.g., Thogoto virus,

Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus or Lake Chad virus. In certain embodiments, the Orthomyxovirus is an Isavirus, such as infectious salmon anemia virus. In certain embodiments, the Orthomyxovirus is an influenza virus, such as influenza A virus, influenza B virus or influenza C virus.

5.3.2 Cellular Assays for Assessing the Effect of a Compound on svRNA Activity

[00231] The following methods may be used for assaying the effect of the

Compounds described in Section 5.2 supra on the activity of Orthomyxovirus svRNAs and/or for screening for additional compounds that have an effect on Orthomyxovirus svRNA activity. One way of assaying the effect of a compound on Orthomyxovirus svRNA activity is by measuring the effect of the compound on Orthomyxovirus replication in accordance with the methods described in this section or in Sections 6 and 7. This section also provides methods for contacting viral substrates {e.g., cells) with compounds {e.g., the Compounds described in Section 5.2) that modulate the expression or activity of Orthomyxovirus svRNAs. [00232] A compound described in Section 5.2 supra may be assessed for its ability to modulate Orthomyxovirus replication. In some embodiments, the effect on

Orthomyxovirus replication is assessed by measuring the effect on Orthomyxovirus genome replication, or replication of a reporter based on the Orthomyxovirus genome. In some embodiments, the effect on Orthomyxovirus replication is assessed by measuring the effect on replication of a particular Orthomyxovirus genome segment, or replication of a reporter based on the particular Orthomyxovirus genome segment. In some such embodiments, Orthomyxovirus nucleic acids, e.g., vR As, may be isolated and analyzed in accordance with the methods described in Section 5.3.1 supra. In some embodiments, the effect on Orthomyxovirus replication is assessed by measuring the effect on Orthomyxovirus particle production.

[00233] In one embodiment, the ability of a compound {e.g., a Compound described in Section 5.2) to modulate {e.g., increase or decrease) Orthomyxovirus replication is measured using an assay described in Sections 6 or 7, infra. In some embodiments, modulation of Orthomyxovirus replication is screened for using a library of compounds. The effect of a compound or library of compounds on Orthomyxovirus replication can be measured for any Orthomyxovirus that has or is suspected of having svR As. In some embodiments, the Orthomyxovirus is a Thogotovirus, such as, e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus or Lake Chad virus. In certain embodiments, the Orthomyxovirus is an Isavirus, such as infectious salmon anemia virus. In certain embodiments, the Orthomyxovirus is an influenza virus, such as influenza A virus, influenza B virus or influenza C virus.

[00234] In particular embodiments, the effect of a compound on the replication of an influenza virus is determined. In some embodiments, the influenza virus is influenza A virus. In some embodiments, the virus is influenza B virus. In some embodiments, the virus is influenza C virus. In some embodiments, the effect of a compound on the replication of a currently circulating influenza virus is determined. In some

embodiments, the effect of a compound on replication of H1N1 influenza virus is determined. In some embodiments, the effect of a compound on replication of H5N1 influenza virus is determined. In some embodiments, the effect of a compound on replication of H3N2 influenza virus is determined. In some embodiments, the effect of a compound on replication of an influenza virus described in Section 5.1 supra is determined. [00235] In some embodiments, the effect of a compound on replication of an attenuated Orthomyxovirus is determined. In some embodiments, the effect of a compound on the replication of a naturally occurring strain, variant or mutant of an Orthomyxovirus, a mutagenized Orthomyxovirus, a reassortant Orthomyxovirus and/or a genetically engineered Orthomyxovirus can be assessed. In a specific embodiment, the effect of a compound on the replication of a vaccine strain of an Orthomyxovirus is determined. In some such embodiments, the Orthomyxovirus is an influenza virus.

[00236] The effect of a compound on Orthomyxovirus replication can be assessed by any assay known in the art or described herein. Such assays may involve: (a) contacting a compound or a member of a library of compounds with a substrate (e.g., a cell) before (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more before), concurrently and/or subsequent to (e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more after) infection with an Orthomyxovirus; and (b) measuring Orthomyxovirus replication.

[00237] In the assays described herein, the cells can be infected at different MOIs and the effect of a compound on Orthomyxovirus replication can be assessed. For example, the MOI may be 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 2.5, or 5. The effect of different concentrations of a compound on Orthomyxovirus replication can also be assessed.

[00238] In the assays described herein, the cells or another substrate that contains cells (e.g., embryonated eggs) used in the assay should be susceptible to infection by the Orthomyxovirus. The cells may be primary cells or established cell lines. For example, the following cells may be used in assays for Orthomyxovirus replication: chicken cells (e.g., primary chick embryo cells or chick kidney cells) or other avian cells, fish cells (such as, e.g., salmon red blood cells), pig cells or a pig cell line (such as, e.g., PK(D1) cells, PK(15) cells, PK13 cells, SJPL cells, NSK cells, LLC-PK1 cells, LLC-PK1A cells, ESK-4 cells, ST cells, PT-K75 cells, or PK-2a/CL 13 cells, etc.), Vera cells, MDCK cells, MBCK cells, human respiratory epithelial cells (e.g., A549 cells) or other respiratory tract cells, such as, e.g., human tracheobronchial epithelial (HTBE; primary lung cells) cells, fibroblast cells, HEK 293 T cells, MEFs, Huh 7.5 cells, Detroit cells, calf kidney cells, or mink lung cells. In one embodiment, the cell or cell line is biologically relevant to Orthomyxovirus infection.

[00239] In the assays described herein, Orthomyxovirus replication can be measured at different times post-infection. For example, Orthomyxovirus replication may be measured 6 hours, 12 hours, 16 hours, 24 hours, 48 hours or 72 hours post-infection. Any method known in the art can be used measure virus replication. For example, Orthomyxovirus replication may be assessed by measuring viral titer (as determined, e.g., by plaque formation) or viral genome replication {i.e., the production of vR A, as determined, e.g., by RT-PCR or Northern blot analysis). In another embodiment, Orthomyxovirus replication is assessed by measuring the production of viral proteins (as determined, e.g., by Western blot analysis, ELISA or flow cytometry). In another embodiment, Orthomyxovirus replication is assessed by measuring the production of viral nucleic acids {e.g., vRNA; as determined, e.g., by RT-PCR or Northern blot analysis) using techniques known to one of skill in the art. Standard assays for influenza virus replication have been described, See, e.g., Sidwell et al, Antiviral Research, 2000, 48: 1-16. See Section 5.3.2 below for more details of techniques for measuring viral replication.

[00240] In some embodiments of the assays described herein, Orthomyxovirus replication is measured using a virus engineered to contain a reporter, such as a green fluorescent protein (GFP) reporter, luciferase reporter (as described in Sections 5.2, 6 or 7 infra), or other reporter known in the art. In some embodiments, the reporter is or is based on an Orthomyxovirus genome segment, which permits determination of the replication of that particular segment. For examples of reporter assays that may be used, see, e.g., U.S. Patent Nos. 6,544,785 and 6,649,372; Muramoto et al, 2006, J Virol 80:2318-2325; and Liang et al, 2005, J Virol 79: 10348-10355; the contents of each of which is incorporated herein in its entirety. In some embodiments, Orthomyxovirus replication is measured using the nucleic acid detection methods described in Section 5.3.1 supra, for example, Northern blot analysis to measure replication of a particular genome segment.

[00241] In the assays described herein, a compound or member of a library of compounds is considered to modulate Orthomyxovirus replication if the replication of the Orthomyxovirus is altered in a substrate {e.g., a cell) contacted with a compound or library of compounds relative to the replication of the Orthomyxovirus in a substrate contacted with a negative control {e.g., PBS or saline).

[00242] In one embodiment, a decrease in Orthomyxovirus replication is measured by: (a) contacting a compound or a member of a library of compounds with a cell before {e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more before), concurrently and/or subsequent to {e.g., 15 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours or more after) infection with the Orthomyxovirus; and (b) measuring Orthomyxovirus replication.

[00243] In one embodiment, a decrease in Orthomyxovirus replication is assessed as a decrease in viral titer (as determined, e.g., by plaque formation). In another

embodiment, a decrease in Orthomyxovirus replication is assessed as a decrease in Orthomyxovirus genome replication (i.e., production of vRNA, as determined, e.g., by RT-PCR or Northern blot analysis) using techniques known to one of skill in the art or described herein. In another embodiment, a decrease in Orthomyxovirus replication is assessed as a decrease in the production of viral proteins (as determined, e.g., by

Western blot analysis, ELISA or flow cytometry). In another embodiment, a decrease in Orthomyxovirus replication is assessed as a decrease in the production of viral nucleic acids (e.g., viral mRNA or vRNA; as determined, e.g., by RT-PCR or Northern blot analysis) using techniques known to one of skill in the art or described herein. In some embodiments, a compound or member of a library of compounds is considered to decrease Orthomyxovirus replication if the replication of the Orthomyxovirus is decreased in a cell contacted with a compound or library of compounds relative to the replication of the Orthomyxovirus in a cell contacted with a negative control (e.g., PBS or saline).

[00244] In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces the Orthomyxovirus replication by at least 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 100 fold, 500 fold, or 1000 fold relative to Orthomyxovirus replication in the absence of compound or the presence of a negative control. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces the Orthomyxovirus replication by 1.5 to 3 fold,

2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 fold, 25 to 50 fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 fold, 500 to 1000 fold, or 10 to 1000 fold. In some embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces the virus replication by approximately 2 logs or more, approximately 3 logs or more, approximately 4 logs or more, approximately 5 logs or more, or 2 to 10 logs or 2 to 5 logs relative to

Orthomyxovirus replication in the absence of compound or the presence of a negative control. [00245] In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it results in 1.5 fold or more, 2 fold or more, 3 fold or more, 4 fold or more, 5 fold or more, 6 fold or more, 7 fold or more, 8 fold or more, 9 fold or more, 10 fold or more, 15 fold or more, 20 fold or more, 25 fold or more, 30 fold or more, 35 fold or more, 40 fold or more, 45 fold or more, 50 fold or more, 60 fold or more, 70 fold or more, 80 fold or more, 90 fold or more, or 100 fold or more reduction of viral yield per round of Orthomyxovirus replication. In certain embodiments, a compound results in about a 2 fold or more reduction of viral yield per round of Orthomyxovirus replication. In a specific embodiment, a compound results in about a 10 fold or more reduction of viral yield per round of Orthomyxovirus replication.

[00246] In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces viral titer by 50% or more, by 55% or more, by 60%) or more, by 65%> or more, by 70%> or more, by 75% or more, by 80%> or more, by 85% or more, by 90% or more, or by 95% or more. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces viral titer by at least 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 4.5 logs, 5 logs or more relative to Orthomyxovirus compared to the viral titer obtained in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art.

[00247] In specific embodiments, a compound is considered to reduce or inhibit influenza virus replication if it reduces influenza virus replication by at least 2 wells of hemagglutinin (HA) in a hemagglutination assay (see Section 5.3.2.7 below), which equals approximately a 75% reduction in viral titer.

[00248] In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus genome replication (or replication of a particular Orthomyxovirus genome segment) by about at least 1.5 fold, 2, fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 75 fold, 100 fold, 500 fold, or 1000 fold Orthomyxovirus genome replication (or replication of a particular Orthomyxovirus genome segment) in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art. In certain

embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus genome replication (or replication of a particular

Orthomyxovirus genome segment) by about 1.5 to 3 fold, 2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 fold, 25 to 50 fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 fold, 500 to 1000 fold, or 10 to 1000 fold relative to Orthomyxovirus genome replication (or replication of a particular Orthomyxovirus genome segment) in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus genome replication (or replication of a particular Orthomyxovirus genome segment) by at least 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 4.5 logs, 5 logs or more relative to Orthomyxovirus genome replication (or replication of a particular Orthomyxovirus genome segment) in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art.

[00249] In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus mR A levels by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 75 fold, 100 fold, 500 fold, or 1000 fold relative to Orthomyxovirus mRNA levels in the absence of a compound or relative to a negative control in an assay described herein or others known in the art. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus mRNA levels by at least 1.5 to 3 fold, 2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 fold, 25 to 50 fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 fold, 500 to 1000 fold, or 10 to 1000 fold relative to Orthomyxovirus mRNA levels in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus mRNA levels approximately 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 4.5 logs, 5 logs relative to Orthomyxovirus mRNA levels in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art.

[00250] In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces the synthesis of Orthomyxovirus proteins by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 75 fold, 100 fold, 500 fold, or 1000 fold relative to the synthesis of Orthomyxovirus proteins in the absence of a compound or relative to a negative control in an assay described herein or others known in the art. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces the synthesis of Orthomyxovirus proteins at least 1.5 to 3 fold, 2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 fold, 25 to 50 fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 fold, 500 to 1000 fold, or 10 to 1000 fold relative to the synthesis of Orthomyxovirus proteins in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces the synthesis of Orthomyxovirus proteins approximately 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 4.5 logs, 5 logs relative to the synthesis of Orthomyxovirus proteins in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art.

[00251] In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus vR A levels by at least 1.5 fold, 2, fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold, 20 fold, 25 fold, 30 fold, 35 fold, 40 fold, 45 fold, 50 fold, 75 fold, 100 fold, 500 fold, or 1000 fold relative to Orthomyxovirus vRNA levels in the absence of a compound or relative to a negative control in an assay described herein or others known in the art. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus vRNA levels by at least 1.5 to 3 fold, 2 to 4 fold, 3 to 5 fold, 4 to 8 fold, 6 to 9 fold, 8 to 10 fold, 2 to 10 fold, 5 to 20 fold, 10 to 40 fold, 10 to 50 fold, 25 to 50 fold, 50 to 100 fold, 75 to 100 fold, 100 to 500 fold, 500 to 1000 fold, or 10 to 1000 fold relative to Orthomyxovirus vRNA levels in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art. In certain embodiments, a compound is considered to reduce or inhibit Orthomyxovirus replication if it reduces Orthomyxovirus vRNA levels approximately 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 4.5 logs, 5 logs relative to Orthomyxovirus vRNA levels in the absence of a compound or relative to a negative control in an assay described herein or others known to one of skill in the art.

5.3.2.1 Viral Titer Assay

[00252] In this non-limiting example, a monolayer of the target mammalian cell line is infected with different amounts (e.g., multiplicity of 3 plaque forming units (pfu) or 5 pfu) of virus and subsequently cultured in the presence or absence of various dilutions of compounds (e.g., 0.1 μ§/ηι1, 1 μ§/ι 1, 5 μ^ιηΐ, or 10 μ§/ηι1). Infected cultures are harvested 48 hours or 72 hours post infection and titered by standard plaque assays known in the art on the appropriate target cell line (e.g., Vero cells).

5.3.2.2 Flow Cytometry Assay

[00253] Flow cytometry can be utilized to detect expression of virus antigens in infected target cells cultured in the presence or absence of compounds (See, e.g. , McSharry et al., Clinical Microbiology Rev., 1994, 7:576-604). Non-limiting examples of viral antigens that can be detected on cell surfaces by flow cytometry include, but are not limited to HA of influenza. In other embodiments, intracellular viral antigens or viral nucleic acid can be detected by flow cytometry with techniques known in the art.

5.3.2.3 Viral Cytopathic Effect (CPE) Assay

[00254] CPE is the morphological changes that cultured cells undergo upon being infected by most viruses. These morphological changes can be observed easily in unfixed, unstained cells by microscopy. Forms of CPE, which can vary depending on the virus, include, but are not limited to, rounding of the cells, appearance of inclusion bodies in the nucleus and/or cytoplasm of infected cells, and formation of syncytia, or polykaryocytes (large cytoplasmic masses that contain many nuclei).

[00255] The CPE assay can provide a measure of the effect of a compound on virus replication. In a non-limiting example of such an assay, compounds are serially diluted (e.g. 1000, 500, 100, 50, 10, 1 μg/ml) and added to 3 wells containing a cell monolayer (e.g., mammalian cells at 80-100% confluent) of a 96-well plate. Within 5 minutes, viruses are added and the plate sealed, incubated at 37°C for the standard time period required to induce near-maximal viral CPE (e.g., approximately 48 to 120 hours, depending on the virus and multiplicity of infection). When assaying a compound for its potential activity, CPE is read microscopically after a known positive control drug (an antiviral) is evaluated in parallel with compounds in each test. A non-limiting example of a positive control for influenza is ribavirin or an anti-svRNA compound described in Section 5.2. The data is expressed as 50% effective concentrations or approximated virus-inhibitory concentration, 50% endpoint (EC50) and cell-inhibitory concentration, 50%) endpoint (IC₅₀). General selectivity index ("SI") is calculated as the IC50 divided by the EC50. These values can be calculated using any method known in the art, e.g., the computer software program MacSynergy II by M.N. Prichard, K.R. Asaltine, and C. Shipman, Jr., University of Michigan, Ann Arbor, Michigan.

[00256] In one embodiment, a compound that reduces or inhibits Orthomyxovirus replication has an SI of greater than 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24, 25, 30, 35, 39, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1,000, or 10,000. In some embodiments, a compound has an SI of greater than 10. In a specific embodiment, compounds with an SI of greater than 10 are further assessed in other in vitro and in vivo assays described herein or others known in the art to characterize safety and efficacy.

5.3.2.4 Neutral Red (NR) Dye Uptake Assay

[00257] The NR Dye Uptake assay can be used to validate the CPE inhibition assay (See Section 5.3.2.3). In a non-limiting example of such an assay, the same 96-well microplates used for the CPE inhibition assay can be used. Neutral red is added to the medium, and cells not damaged by virus take up a greater amount of dye. The percentage of uptake indicating viable cells is read on a microplate autoreader at dual wavelengths of 405 and 540 nm, with the difference taken to eliminate background. {See McManus et al., Appl. Environment. Microbiol. 31 :35-38, 1976). An ECso is determined for samples with infected cells and contacted with compounds, and an IC₅₀ is determined for samples with uninfected cells contacted with compounds.

5.3.2.5 Virus Yield Assay

[00258] Lysed cells and supernatants from infected cultures such as those in the CPE inhibition assay {See Section 5.3.2.3) can be used to assay for virus yield (production of viral particles after the primary infection). In a non- limiting example, these supernatants are serially diluted and added onto monolayers of susceptible cells {e.g., Vera cells). Development of CPE in these cells is an indication of the presence of infectious viruses in the supernatant.

5.3.2.6 Plaque Assay

[00259] In a non-limiting example of a plaque assay, the virus is diluted into various concentrations and added to each well containing a monolayer of the target cells in triplicate. The plates are then incubated for a period of time to achieve effective infection of the control sample {e.g., 1 hour with shaking every fifteen minutes). After the incubation period, an equal amount of 1% agarose is added to an equal volume of each compound dilution prepared in 2x concentration. In certain embodiments, final compound concentrations between 0.03 μg/ml to 100 μg/ml can be tested with a final agarose overlay concentration of 0.5%. The drug agarose mixture is applied to each well in 2 ml volume and the plates are incubated for three days, after which the cells are stained with a 1.5% solution of neutral red. At the end of the 4-6 hour incubation period, the neutral red solution is aspirated, and plaques counted using a

stereomicroscope. Alternatively, a final agarose concentration of 0.4% can be used. In other embodiments, the plates are incubated for more than three days with additional overlays being applied on day four and on day 8 when appropriate. In another embodiment, the overlay medium is liquid rather than semi-solid.

5.3.2.7 Influenza Hemagglutination assays

[00260] In a non-limiting example of a hemagglutination assay to measure replication of influenza virus, cells are contacted with a compound and are concurrently or subsequently infected with the influenza virus {e.g., an influenza virus at an MOI of 1) and incubated under conditions to permit virus replication {e.g., 20-24 hours). The compounds are in some embodiments preferably present throughout the course of infection. Viral replication and release of viral particles is then determined by hemagglutination assays using 0.5%> chicken red blood cells. In some embodiments, a compound is considered to reduce or inhibit influenza virus replication if it reduces influenza virus replication by at least 2 wells of HA, which equals approximately a 75% reduction in viral titer. In specific embodiments, a compound reduces influenza virus titer in this assay by 50%> or more, by 55% or more, by 60% or more, by 65 % or more, by 70%) or more, by 75% or more, by 80%> or more, by 85% or more, by 90% or more, or by 95% or more.

5.3.3 Cytotoxicity Assays

[00261] In some embodiments, compounds differentially affect the viability of an uninfected substrate {e.g., cells) and a substrate {e.g., cells) infected with virus. The differential effect of a compound on the viability of virally infected and uninfected cells may be assessed using techniques known to one of skill in the art or described herein. In certain embodiments, compounds are more toxic to cells infected with a virus than uninfected cells. In specific embodiments, compounds preferentially affect the viability of cells infected with a virus. In certain embodiments, the compounds are not so cytotoxic that they are unsafe for administration to an animal or human subject. [00262] Many assays well-known in the art can be used to assess viability of cells (infected or uninfected) or cell lines following exposure to a compound and, thus, determine the cytotoxicity of the compound. For example, cell proliferation can be assayed by measuring Bromodeoxyuridine (BrdU) incorporation (See, e.g., Hoshino et al., 1986, Int. J. Cancer 38, 369; Campana et al, 1988, J. Immunol. Meth. 107:79), (3H) thymidine incorporation (See, e.g., Chen, J., 1996, Oncogene 13: 1395-403; Jeoung, J., 1995, J. Biol. Chem. 270: 18367 73), by direct cell count, or by detecting changes in transcription, translation or activity of known genes such as proto-oncogenes (e.g., fos, myc) or cell cycle markers (Rb, cdc2, cyclin A, Dl, D2, D3, E, etc). The levels of such protein and mRNA and activity can be determined by any method well known in the art. For example, protein can be quantitated by known immunodiagnostic methods such as ELISA, Western blotting or immunoprecipitation using antibodies, including

commercially available antibodies. mRNA can be quantitated using methods that are well known and routine in the art, for example, using northern analysis, RNase protection, or polymerase chain reaction in connection with reverse transcription. Cell viability can be assessed by using trypan-blue staining or other cell death or viability markers known in the art. In a specific embodiment, the level of cellular ATP is measured to determined cell viability.

[00263] In specific embodiments, cell viability is measured in three-day and seven- day periods using an assay standard in the art, such as the CellTiter-Glo Assay Kit (Promega) which measures levels of intracellular ATP. A reduction in cellular ATP is indicative of a cytotoxic effect. In another specific embodiment, cell viability can be measured in the neutral red uptake assay. In other embodiments, visual observation for morphological changes may include enlargement, granularity, cells with ragged edges, a filmy appearance, rounding, detachment from the surface of the well, or other changes. These changes are given a designation of T (100% toxic), PVH (partially toxic-very heavy-80%), PH (partially toxic-heavy-60%), P (partially toxic-40%), Ps (partially toxic-slight-20%), or 0 (no toxicity-0%), conforming to the degree of cytotoxicity seen. A 50% cell inhibitory (cytotoxic) concentration (IC₅₀) is determined by regression analysis of these data.

[00264] In a specific embodiment, the cells used in the cytotoxicity assay are animal cells, including primary cells and cell lines. In some embodiments, the cells are human cells. In some embodiments, the cells are avian cells (e.g., chicken cells). In some embodiments, the cells are pig cells (such as, e.g., PK(D1) cells, PK(15) cells, PK13 cells, SJPL cells, NSK cells, LLC-PK1 cells, LLC-PK1 A cells, ESK-4 cells, ST cells, PT-K75 cells, or PK-2a/CL 13 cells, etc.). In some embodiments, the cells are fish cells (such as, e.g., salmon red blood cells). In certain embodiments, cytotoxicity is assessed in one or more of the following cell lines: U937, a human monocyte cell line; primary peripheral blood mononuclear cells (PBMC); Huh7, a human hepatoblastoma cell line; 293T, a human embryonic kidney cell line; or THP-1, monocytic cells. In certain embodiments, cytotoxicity is assessed in one or more of the following cell lines:

MDCK, MBCK, MEF, Vera, A549, Huh 7.5, Detroit, or human tracheobronchial epithelial (HTBE) cells.

[00265] Compounds can be tested for in vivo toxicity in animal models. For example, animal models, described herein (see, e.g., Section 5.3.4 and the examples in Sections 6 and 7) and/or others known in the art, used to test the activities of compounds can also be used to determine the in vivo toxicity of these compounds. For example, animals are administered a range of concentrations of compounds. Subsequently, the animals are monitored over time for lethality, weight loss or failure to gain weight, and/or levels of serum markers that may be indicative of tissue damage {e.g. , creatine phosphokinase level as an indicator of general tissue damage, level of glutamic oxalic acid transaminase or pyruvic acid transaminase as indicators for possible liver damage). These in vivo assays may also be adapted to test the toxicity of various administration mode and/or regimen in addition to dosages.

[00266] The toxicity and/or efficacy of a compound in accordance with the embodiments described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. A compound identified in accordance with the embodiments described herein that exhibits large therapeutic indices is in certain embodiments preferred. While a compound identified in accordance with the embodiments described herein that exhibits toxic side effects may be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[00267] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage of a compound identified in accordance with the embodiments described herein for use in humans. In certain embodiments, the dosage of such agents lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any agent used in the methods and compositions described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high-performance liquid chromatography. Additional information concerning dosage determination is provided in Section 5.7.4, infra.

5.3.3.1 Apoptosis Assay

[00268] Any technique known to one of skill in the art can be used to determine whether a compound has an apoptotic effect. For example, a fluorescence-based assay for caspase-3 activity can be used to detect whether a compound has a pro- or anti- apoptotic effect. In one example of such an assays, cells are seeded into 60 mm tissue culture treated dishes at 1.5xl0⁶ cells per dish and allowed to incubate for 24 hours. After incubation, the medium is aspirated and the cells are washed with PBS. Fresh DMEM post-infection medium was added, containing compounds at the same concentrations as has been used for the viral infections. As a positive control for the induction of apoptosis, cells are treated with any known inducer of apoptosis, for example, staurosporin at a concentration of 5 μΜ. Cells are incubated for 6 hours.

Subsequently, they are harvested, washed twice with PBS, lysed and incubated with the colorimetric substrate for an additional hour, at which time fluorescence is measured. An increase in fluorescence relative to a negative control or cells not treated with the compound indicates that the compound is pro-apoptotic.

5.3.4 Animal Model Studies

[00269] In some embodiments, Compounds and compositions for the inhibition or reduction of Orthomyxovirus, e.g., influenza virus, replication are preferably assayed in vivo for the desired therapeutic or prophylactic activity prior to use in humans. For example, in vivo assays can be used to determine whether it is preferable to administer a Compound and/or another therapeutic agent. For example, to assess the prophylactic use of a Compound (e.g., to prevent a viral infection or a disease or symptom associated therewith), the Compound can be administered before the animal is infected with the virus. Alternatively, or in addition, a Compound can be administered to the animal at the same time that the animal is infected with the virus. To assess the therapeutic use of a Compound (e.g., to treat a viral infection or to prevent or treat a symptom or disease associated therewith), in one embodiment, the Compound is administered after a viral infection in the animal. In another embodiment, a Compound is administered to the animal at the same time that the animal is infected. In another embodiment, a

Compound is administered to the animal before the animal is infected. In a specific embodiment, the Compound is administered to the animal more than one time.

[00270] Compounds can be tested for antiviral activity against virus in animal model systems including, but are not limited to, insects, fish, rats, mice, chicken, cows, seals, non-human primates (e.g., monkeys, chimpanzees), pigs, goats, sheep, dogs, rabbits, guinea pigs, etc. In a specific embodiment, Compounds are tested in a mouse model system. Such model systems are widely used and well-known to the skilled artisan. Non-limiting examples of animal models for influenza virus are provided in Section 5.3.4.1 below.

[00271] Compounds can also be tested for replication enhancing activity in animal model systems including, but not limited to, insects, fish, rats, mice, chicken, cows, non- human primates (e.g., monkeys, chimpanzees), pigs, goats, sheep, dogs, rabbits, seals, guinea pigs, etc. In a specific embodiment, Compounds are tested in a mouse model system. Such model systems are widely used and well-known to the skilled artisan. Non-limiting examples of animal models for influenza virus are provided in Section 5.3.4.1 below.

[00272] In some embodiments, animals are infected with virus and concurrently or subsequently treated with a Compound or placebo. Alternatively, animals can be treated with a Compound or placebo and subsequently infected with virus. Samples obtained from these animals (e.g. , serum, urine, sputum or other cells from the respiratory tract, semen, saliva, plasma, red blood cells, or tissue sample) can be tested for the presence of the Compound and/or viral replication via well known methods in the art, e.g., those that measure altered viral titers (as determined, e.g., by plaque formation), the production of viral proteins (as determined, e.g., by Western blot, ELISA, or flow cytometry analysis) or the presence or production of viral nucleic acids (as determined, e.g., by RT-PCR or Northern blot analysis). For quantification of virus in tissue samples, tissue samples are homogenized in phosphate-buffered saline (PBS), and dilutions of clarified homogenates are adsorbed for 1 hour at 37°C onto monolayers of cells (e.g., Vero, CEF or MDCK cells). In other assays, histopathologic evaluations are performed after infection, for example, evaluations of the organ(s) the virus is known to target for infection. Virus immunohistochemistry can be performed using a virus-specific monoclonal antibody.

[00273] The effect of a Compound on the virulence of a virus can also be determined using in vivo assays in which the titer of the virus in an infected subject administered a Compound, the length of survival of an infected subject administered a Compound, the immune response in an infected subject administered a Compound, the number, duration and/or severity of the symptoms in an infected subject administered a Compound, and/or the time period before onset of one or more symptoms in an infected subject

administered a Compound is assessed. Techniques known to one of skill in the art can be used to measure such effects.

5.3.4.1 Influenza Virus Animal Models

[00274] Animal models, such as ferret, mouse, guinea pig, and chicken, developed for testing antiviral agents against influenza virus have been described, See, e.g., Sidwell et al, Antiviral Res., 2000, 48: 1-16; Lowen A.C. et al. PNAS, 2006, 103: 9988-92; and McCauley et al., Antiviral Res., 1995, 27: 179-186. For mouse models of influenza, non-limiting examples of parameters that can be used to assay antiviral activity of Compounds administered to the influenza-infected mice include pneumonia-associated death, serum a 1 -acid glycoprotein increase, animal weight, lung virus assayed by hemagglutinin, lung virus assayed by plaque assays, and histopathological change in the lung. Statistical analysis is carried out to calculate significance (e.g., a P value of 0.05 or less).

[00275] Nasal turbinates and trachea may be examined for epithelial changes and subepithelial inflammation. The lungs may be examined for bronchiolar epithelial changes and peribronchiolar inflammation in large, medium, and small or terminal bronchioles. The alveoli are also evaluated for inflammatory changes. The medium bronchioles are graded on a scale of 0 to 3+ as follows: 0 (normal: lined by medium to tall columnar epithelial cells with ciliated apical borders and basal pseudostratified nuclei; minimal inflammation); 1+ (epithelial layer columnar and even in outline with only slightly increased proliferation; cilia still visible on many cells); 2+ (prominent changes in the epithelial layer ranging from attenuation to marked proliferation; cells disorganized and layer outline irregular at the luminal border); 3+ (epithelial layer markedly disrupted and disorganized with necrotic cells visible in the lumen; some bronchioles attenuated and others in marked reactive proliferation).

[00276] The trachea is graded on a scale of 0 to 2.5+ as follows: 0 (normal: Lined by medium to tall columnar epithelial cells with ciliated apical border, nuclei basal and pseudostratified. Cytoplasm evident between apical border and nucleus. Occasional small focus with squamous cells); 1+ (focal squamous metaplasia of the epithelial layer); 2+ (diffuse squamous metaplasia of much of the epithelial layer, cilia may be evident focally); 2.5+ (diffuse squamous metaplasia with very few cilia evident).

[00277] Virus immunohistochemistry is performed using a viral-specific monoclonal antibody (e.g. NP-, N- or HN-specific monoclonal antibodies). Staining is graded 0 to 3+ as follows: 0 (no infected cells); 0.5+ (few infected cells); 1+ (few infected cells, as widely separated individual cells); 1.5+ (few infected cells, as widely separated singles and in small clusters); 2+ (moderate numbers of infected cells, usually affecting clusters of adjacent cells in portions of the epithelial layer lining bronchioles, or in small sublobular foci in alveoli); 3+ (numerous infected cells, affecting most of the epithelial layer in bronchioles, or widespread in large sublobular foci in alveoli).

5.3.5 Assays in Humans

[00278] In one embodiment, a Compound that is a candidate for use in human subjects is assessed in human subjects at risk for or suffering from an Orthomyxovirus infection. In one embodiment, a Compound that is a candidate for use in human subjects is assessed human subjects at risk for or suffering from an influenza infection. In accordance with these embodiments, a candidate Compound or a control compound is administered to the human subject, and the effect of a test Compound on viral replication is determined by, e.g., analyzing the level of the virus or viral nucleic acids in a biological sample (e.g., serum or plasma). A candidate Compound that reduces or inhibits virus replication can be identified by comparing the level of virus replication in a subject or group of subjects treated with a control compound to that in a subject or group of subjects treated with the candidate Compound. Alternatively, a decrease in viral replication can be detected by comparing the level of virus replication in a subject or group of subjects before and after the administration of a candidate Compound.

Techniques known to those of skill in the art can be used to obtain the biological sample and analyze the mRNA or protein expression. [00279] In another embodiment, the effect of a candidate Compound on the severity of one or more symptoms or diseases associated with an Orthomyxovirus, e.g., influenza virus, infection is assessed in a subject having or at risk for an Orthomyxovirus, e.g., influenza virus, infection. In accordance with this embodiment, a candidate Compound or a control compound is administered to a human subject at risk for or suffering from an Orthomyxovirus, e.g. , influenza virus, infection and the effect of the candidate Compound on one or more symptoms or disease associated with the virus infection is determined. A candidate Compound that reduces one or more symptoms or diseases can be identified by comparing the subjects treated with a control compound to the subjects treated with the candidate Compound. Techniques known to physicians familiar with infectious diseases can be used to determine whether a candidate Compound reduces one or more symptoms or diseases associated with the an Orthomyxovirus, e.g. , influenza virus, virus infection.

[00280] The foregoing assays can be adapted to assess the efficacy of candidate Compounds in other subjects, such as other mammals {e.g., pigs, horses), avians {e.g., ducks and other birds), and fish {e.g., salmon), including Compounds introduced into the subjects by transgenic gene technology, as described in Section 5.8 infra.

5.4 Compositions

[00281] Provided herein are compositions comprising one or more of the Compounds described in Section 5.2 supra. In some embodiments, the composition comprises an amount of Compound in a dose effective to modulate Orthomyxovirus, e.g., influenza virus, svR A expression or activity, according to an assay described herein (see, e.g., Section 5.3 supra and the examples of Sections 6 and 7) or known in the art. In some embodiments, the composition comprises an amount of Compound in a dose effective to reduce or inhibit the expression or activity of an Orthomyxovirus, e.g., influenza virus, svRNA. In some embodiments, the composition comprises an amount of Compound in a dose effective to increase the expression or activity of an Orthomyxovirus, e.g. , influenza virus, svRNA.

[00282] In some embodiments, the composition comprises an amount of Compound in a dose effective to modulate Orthomyxovirus, e.g., influenza virus, replication, according to an assay described herein (see, e.g., Section 5.3 supra and the examples of Sections 6 and 7) or known in the art. In some embodiments, the composition comprises an amount of Compound in a dose effective to reduce or inhibit Orthomyxovirus, e.g., influenza virus, replication. In some embodiments, the composition comprises an amount of Compound in a dose effective to increase Orthomyxovirus, e.g., influenza virus, replication.

[00283] In certain embodiments, the compositions, including the pharmaceutical compositions, provided herein contain the Compound in an amount that is not significantly toxic to the cell, tissue, or subject for which it is intended. Methods of testing toxicity include any method known in the art, for example, as described in Sections 5.3.3 supra and Sections 6 and 7 infra.

[00284] The compositions provided herein may be pharmaceutical compositions, and may additionally comprise a pharmaceutically acceptable carrier known in the art or described herein and/or one or more additional active agents known in the art or described herein. Such additional active agents include, for example, one or more Compounds described in Section 5.2; an additional antiviral agent; an antibiotic; an immunomodulatory agent; or an agent used in the treatment or prophylaxis of one or more pulmonary diseases (see, e.g., Section 5.7.1) or other diseases associated with Orthomyxovirus infection described herein or known in the art. In some embodiments, a pharmaceutical composition described herein is administered before, concurrently with, or after another pharmaceutical composition or therapy described herein or known in the art.

[00285] In some embodiments, provided herein are pharmaceutical compositions comprising an effective amount of a Compound and a pharmaceutically acceptable carrier, excipient, or diluent. In a specific embodiment, the pharmaceutical composition comprises one or more compounds that reduce or inhibit Orthomyxovirus, e.g., influenza virus, infection or replication described herein (e.g., a Compound described in Section 5.2 supra). In some embodiments, the pharmaceutical composition is in an amount effective to treat an Orthomyxovirus, e.g. , influenza virus, infection. In some

embodiments, the pharmaceutical composition is in an amount effective to prevent, treat a symptom or disease associated with an Orthomyxovirus, e.g., influenza virus, infection.

[00286] The pharmaceutical compositions provided herein are suitable for veterinary and/or human administration. Pharmaceutical compositions provided herein can be in any form that allows for the composition to be administered to a subject. In a specific embodiment and in this context, the term "pharmaceutically acceptable carrier, excipient or diluent" means a carrier, excipient or diluent approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and

incomplete)), excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a specific carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.

[00287] Typical compositions and dosage forms comprise one or more excipients. Suitable excipients are well-known to those skilled in the art of pharmacy, and non limiting examples of suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.

Whether a particular excipient is suitable for incorporation into a pharmaceutical composition or dosage form depends on a variety of factors well known in the art including, but not limited to, the way in which the dosage form will be administered to a patient and the specific active ingredients in the dosage form. The composition or single unit dosage form, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

[00288] Lactose free compositions can comprise excipients that are well known in the art and are listed, for example, in the U.S. Pharmacopeia (USP) SP (XXI)/NF (XVI). In general, lactose free compositions comprise an active ingredient, a binder/filler, and a lubricant in pharmaceutically compatible and pharmaceutically acceptable amounts. Specific lactose free dosage forms comprise a Compound, microcrystalline cellulose, pre gelatinized starch, and magnesium stearate.

[00289] Further provided herein are anhydrous pharmaceutical compositions and dosage forms comprising one or more Compounds, since water can facilitate the degradation of some compounds. For example, the addition of water (e.g., 5%) is widely accepted in the pharmaceutical arts as a means of simulating long term storage in order to determine characteristics such as shelf life or the stability of formulations over time. See, e.g., Jens T. Carstensen, Drug Stability: Principles & Practice, 2d. Ed., Marcel Dekker, NY, NY, 1995, pp. 379 80. In effect, water and heat accelerate the decomposition of some compounds. Thus, the effect of water on a formulation can be of great significance since moisture and/or humidity are commonly encountered during manufacture, handling, packaging, storage, shipment, and use of formulations.

[00290] Further provided herein are compositions and dosage forms that comprise one or more agents that reduce the rate by which a compound will decompose. Such agents, which are referred to herein as "stabilizers," include, but are not limited to, antioxidants such as ascorbic acid, pH buffers, or salt buffers.

[00291] The compositions and single unit dosage forms can take the form of solutions, suspensions, emulsions, gels, lotions, or creams, tablets, pills, capsules, powders, sustained-release formulations and the like. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Such compositions and dosage forms will contain an effective amount of a Compound, e.g. , in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration. In a specific embodiment, the compositions or single unit dosage forms are sterile and in suitable form for administration to a subject, for example, an animal subject. In some embodiments, the subject is a mammalian subject. In some embodiments, the subject is a human.

[00292] Compositions provided herein are formulated to be compatible with the intended route of administration. Examples of routes of administration include, but are not limited to, topical, parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), intranasal, transdermal (topical), transmucosal, intra-synovial and rectal administration. In a specific embodiment, the composition is formulated in accordance with routine procedures as a composition adapted for topical, intravenous, pulmonary, subcutaneous, intramuscular, oral, intranasal or topical administration to human beings. In a specific embodiment, a composition is formulated in accordance with routine procedures for subcutaneous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Examples of dosage forms include, but are not limited to: tablets; caplets; capsules, such as soft elastic gelatin capsules; cachets; troches; lozenges; dispersions; suppositories; ointments; cataplasms (poultices); pastes; powders; dressings; creams or lotions; plasters; solutions; patches; aerosols (e.g., nasal sprays or inhalers); gels; liquid dosage forms suitable for oral or mucosal administration to a patient, including suspensions (e.g., aqueous or non aqueous liquid suspensions, oil in water emulsions, or a water in oil liquid emulsions), solutions, and elixirs; liquid dosage forms suitable for parenteral administration to a patient; and sterile solids (e.g. , crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient.

[00293] The composition, shape, and type of dosage forms will typically vary depending on their use.

[00294] Generally, the ingredients of compositions provided herein are supplied either separately or mixed together in unit dosage form, for example, as a dry

lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[00295] Examples of fillers suitable for use in the pharmaceutical compositions and dosage forms provided herein include, but are not limited to, talc, calcium carbonate (e.g., granules or powder), microcrystalline cellulose, powdered cellulose, dextrates, kaolin, mannitol, silicic acid, sorbitol, starch, pre gelatinized starch, and mixtures thereof. The binder or filler in pharmaceutical compositions provided herein is typically present in from about 50 to about 99 weight percent of the pharmaceutical composition or dosage form.

[00296] Disintegrants are used in the compositions provided herein to provide solid forms (e.g. , tablets) that disintegrate when exposed to an aqueous environment. Tablets that contain too much disintegrant may disintegrate in storage, while those that contain too little may not disintegrate at a desired rate or under the desired conditions. Thus, a sufficient amount of disintegrant that is neither too much nor too little to detrimentally alter the release of the active ingredients should be used to form solid oral dosage forms provided herein. The amount of disintegrant used varies based upon the type of formulation, and is readily discernible to those of ordinary skill in the art. Typical pharmaceutical compositions comprise from about 0.5 to about 15 weight percent of disintegrant, specifically from about 1 to about 5 weight percent of disintegrant.

[00297] Disintegrants that can be used in pharmaceutical compositions and dosage forms provided herein include, but are not limited to, agar, alginic acid, calcium carbonate, microcrystalline cellulose, croscarmellose sodium, crospovidone, polacrilin potassium, sodium starch glycolate, potato or tapioca starch, pre gelatinized starch, other starches, clays, other algins, other celluloses, gums, and mixtures thereof.

[00298] Lubricants that can be used in pharmaceutical compositions and dosage forms provided herein include, but are not limited to, calcium stearate, magnesium stearate, mineral oil, light mineral oil, glycerin, sorbitol, mannitol, polyethylene glycol, other glycols, stearic acid, sodium lauryl sulfate, talc, hydrogenated vegetable oil (e.g., peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil), zinc stearate, ethyl oleate, ethyl laureate, agar, and mixtures thereof. Additional lubricants include, for example, a syloid silica gel (AEROSIL 200, manufactured by W.R. Grace Co. of Baltimore, MD), a coagulated aerosol of synthetic silica (marketed by Degussa Co. of Piano, TX), CAB O SIL (a pyrogenic silicon dioxide product sold by Cabot Co. of Boston, MA), and mixtures thereof. If used at all, lubricants are typically used in an amount of less than about 1 weight percent of the pharmaceutical

compositions or dosage forms into which they are incorporated.

[00299] A Compound can be administered by controlled release means or by delivery devices that are well known to those of ordinary skill in the art. Examples include, but are not limited to, those described in U.S. Patent Nos. : 3,845,770; 3,916,899; 3,536,809; 3,598,123; and 4,008,719, 5,674,533, 5,059,595, 5,591 ,767, 5, 120,548, 5,073,543, 5,639,476, 5,354,556, and 5,733,566, each of which is incorporated herein by reference. Such dosage forms can be used to provide slow or controlled release of one or more active ingredients using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings,

microparticles, liposomes, microspheres, or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled release formulations known to those of ordinary skill in the art, including those described herein, can be readily selected for use with the active ingredients of the compositions described herein. The embodiments described herein thus encompass single unit dosage forms suitable for oral administration such as, but not limited to, tablets, capsules, gelcaps, and caplets that are adapted for controlled release. [00300] All controlled release pharmaceutical products have a common goal of improving drug therapy over that achieved by their noncontrolled counterparts. Ideally, the use of an optimally designed controlled release preparation in medical treatment is characterized by a minimum of drug substance being employed to cure or control the condition in a minimum amount of time. Advantages of controlled release formulations include extended activity of the drug, reduced dosage frequency, and increased patient compliance. In addition, controlled release formulations can be used to affect the time of onset of action or other characteristics, such as blood levels of the drug, and can thus affect the occurrence of side (e.g., adverse) effects.

[00301] Most controlled release formulations are designed to initially release an amount of drug (active ingredient) that promptly produces the desired therapeutic effect, and gradually and continually release of other amounts of drug to maintain this level of therapeutic or prophylactic effect over an extended period of time. In order to maintain this constant level of drug in the body, the drug must be released from the dosage form at a rate that will replace the amount of drug being metabolized and excreted from the body. Controlled release of an active ingredient can be stimulated by various conditions including, but not limited to, pH, temperature, enzymes, water, or other physiological conditions or agents.

[00302] Parenteral dosage forms can be administered to patients by various routes including, but not limited to, subcutaneous, intravenous (including bolus injection), intramuscular, and intraarterial. Because their administration typically bypasses patients' natural defenses against contaminants, parenteral dosage forms are preferably sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions.

[00303] Suitable vehicles that can be used to provide parenteral dosage forms provided herein are well known to those skilled in the art. Examples include, but are not limited to: Water for Injection USP; aqueous vehicles such as, but not limited to, Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, and Lactated Ringer's Injection; water miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and polypropylene glycol; and non aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate. [00304] Agents that increase the solubility of one or more of the Compounds provided herein can also be incorporated into the parenteral dosage forms provided herein.

[00305] Transdermal, topical, and mucosal dosage forms provided herein include, but are not limited to, ophthalmic solutions, sprays, aerosols, creams, lotions, ointments, gels, solutions, emulsions, suspensions, or other forms known to one of skill in the art. See, e.g., Remington's Pharmaceutical Sciences, 16th and 18th eds., Mack Publishing, Easton PA (1980 & 1990); and Introduction to Pharmaceutical Dosage Forms, 4th ed., Lea & Febiger, Philadelphia (1985). Dosage forms suitable for treating mucosal tissues within the oral cavity can be formulated as mouthwashes or as oral gels. Further, transdermal dosage forms include "reservoir type" or "matrix type" patches, which can be applied to the skin and worn for a specific period of time to permit the penetration of a desired amount of active ingredients.

[00306] Suitable excipients (e.g., carriers and diluents) and other materials that can be used to provide transdermal, topical, and mucosal dosage forms provided herein are well known to those skilled in the pharmaceutical arts, and depend on the particular tissue to which a given pharmaceutical composition or dosage form will be applied. With that fact in mind, typical excipients include, but are not limited to, water, acetone, ethanol, ethylene glycol, propylene glycol, butane 1,3 diol, isopropyl myristate, isopropyl palmitate, mineral oil, and mixtures thereof to form lotions, tinctures, creams, emulsions, gels or ointments, which are non toxic and pharmaceutically acceptable. Moisturizers or humectants can also be added to pharmaceutical compositions and dosage forms if desired. Examples of such additional ingredients are well known in the art. See, e.g. , Remington's Pharmaceutical Sciences, 16th and 18th eds., Mack Publishing, Easton PA (1980 & 1990).

[00307] Depending on the specific tissue to be treated, additional components may be used prior to, in conjunction with, or subsequent to administration of a Compound. For example, penetration enhancers can be used to assist in delivering the active ingredients to the tissue. Suitable penetration enhancers include, but are not limited to: acetone; various alcohols such as ethanol, oleyl, and tetrahydrofuryl; alkyl sulfoxides such as dimethyl sulfoxide; dimethyl acetamide; dimethyl formamide; polyethylene glycol; pyrrolidones such as polyvinylpyrrolidone; Kollidon grades (Povidone, Polyvidone); urea; and various water soluble or insoluble sugar esters such as Tween 80 (polysorbate 80) and Span 60 (sorbitan monostearate). [00308] The H of a pharmaceutical composition or dosage form, or of the tissue to which the pharmaceutical composition or dosage form is applied, may also be adjusted to improve delivery of one or more Compounds. Similarly, the polarity of a solvent carrier, its ionic strength, or tonicity can be adjusted to improve delivery. Agents such as stearates can also be added to pharmaceutical compositions or dosage forms to advantageously alter the hydrophilicity or lipophilicity of one or more Compounds so as to improve delivery. In this regard, stearates can serve as a lipid vehicle for the formulation, as an emulsifying agent or surfactant, and as a delivery enhancing or penetration enhancing agent. Different salts, hydrates or solvates of the Compounds can be used to further adjust the properties of the resulting composition.

[00309] In certain specific embodiments, the compositions are in oral, injectable, or transdermal dosage forms. In one specific embodiment, the compositions are in oral dosage forms. In one specific embodiment, the compositions are in intranasal dosage forms. In another specific embodiment, the compositions are in the form of injectable dosage forms. In one specific embodiment, the compositions are in topical dosage forms. In another specific embodiment, the compositions are in the form of transdermal dosage forms.

[00310] In certain embodiments, it is beneficial to deliver a Compound for inhibition or reduction of influenza virus replication to a lung or other epithelial tissue of an individual infected with, or at risk for infection with, an influenza virus.

5.4.1 Compositions Comprising Nucleic Acid Compounds

[00311] With regard to nucleic acid Compounds, such as svRNA mimetics (e.g., synthetic svRNAs described in Section 5.2) and anti-svRNA Compounds (e.g., LNA svRNAs or other nucleic acid anti-svRNAs described in Section 5.2), administration may be carried out by known methods, wherein the nucleic acid is introduced into a desired target cell in vitro or in vivo. Commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, electroporation or other means of transfection, microinjection, and viral methods, e.g., using viral vectors or viral-like particles

(Graham, F. L. and van der Eb, A. J. (1973) Virol. 52, 456; McCutchan, J. H. and Pagano, J. S. (1968), J. Natl. Cancer Inst. 41, 351; Chu, G. et al (1987), Nucl. Acids Res. 15, 1311; Fraley, R. et al. (1980), J. Biol. Chem. 255, 10431; Capecchi, M. R. (1980), Cell 22, 479, each of which is incorporated herein by reference in its entirety). See also the formulation and delivery methods described and incorporated by reference in Section 5.2.1 supra.

[00312] In some embodiments, the nucleic acid Compounds may be in the form of a pro-drug. Nucleic acids are by virtue negatively charged ions. Due to the lipophilic nature of cell membranes, the cellular uptake of nucleic acids is reduced compared to neutral or lipophilic equivalents. This polarity "hindrance" can be avoided by using the pro-drug approach (see e.g. Crooke, R. M. (1998) in Crooke, S. T. Antisense research and Application. Springer- Verlag, Berlin, Germany, vol. 131, pp. 103-140).

[00313] Delivery of nucleic acid Compounds into cells may be enhanced through the use of liposomes, particularly cationic liposomes (see, e.g., Feigner, P. L. et al. (1987), Proc. Natl. Acad. Sci USA 84, 7413, which is incorporated herein by reference in its entirety). Commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin2000 (Life Technologies). Delivery of compositions comprising the Compounds may also be enhanced by carrier-mediated delivery including, but not limited to, cyclodextrins, porphyrin derivatives, branched chain dendrimers,

polyethylen-imine polymers, nanoparticles and microspheres (Dass C R. J Pharm

Pharmacol 2002; 54(l):3-27). Delivery of nucleic acid Compounds may be enhanced by chemically linking the nucleic acid Compound to one or more additional non-ligand moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties, such as a cholesterol moiety (Letsinger et al, Proc. Natl. Acad. Sci. USA, 1989, 86, 6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053), a thioether, e.g., hexyl-5-tritylthiol (Manoharan et al, Ann. N.Y. Acad. Sci., 1992, 660, 306;

Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765), a thiocholesterol

(Oberhauser et al, Nucl. Acids Res., 1992, 20, 533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al, EMBO J., 1991, 10, 111; Kabanov et al, FEBS Lett., 1990, 259, 327; Svinarchuk et al, Biochimie, 1993, 75, 49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3- H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl. Acids Res., 1990, 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14, 969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229), or an octadecylamine or hexylamino-carbonyl- oxycholesterol moiety (Crooke et al, J. Pharmacol. Exp. Ther., 1996, 277, 923). See also Section 5.2.1 supra.

5.5 Methods for Modulating the Orthomyxovirus Life Cycle and/or Viral RNA Levels

[00314] Provided herein are methods for regulating the life cycle of an

Orthomyxovirus, comprising contacting a substrate with a Compound, such as described in Section 5.2, prior to, concurrently with, or subsequent to infecting the substrate with the Orthomyxovirus. In some embodiments, the substrate is contacted with the

Compound and then infected with an Orthomyxovirus. In some embodiments, the substrate is infected with the Orthomyxovirus and then contacted with the Compound. In some embodiments, the substrate is contacted with the Compound and concurrently infected with the Orthomyxovirus. Contact of the substrate with the Compound could be accomplished by exposing the substrate to the Compound, for example, by delivering the Compound into the substrate or by inducing the substrate to express the Compound. In some embodiments, the substrate is contacted with a DNA that encodes the

Compound. In some embodiments, the substrate is contacted with an RNA that encodes the Compound.

[00315] The Orthomyxovirus, or svRNA therefrom, to be targeted in accordance with these embodiments include: an influenza virus {e.g., influenza A virus, influenza B virus, influenza C virus, such as an influenza virus described in Section 5.1), a

Thogotovirus (e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus, Lake Chad virus) or an Isavirus (e.g., infectious salmon anemia virus).

[00316] In one embodiment, provided herein is a method for regulating the life cycle of an influenza virus, comprising contacting a substrate with a Compound, such as described in Section 5.2, prior to, concurrently with, or subsequent to infecting the substrate with an influenza virus. In some embodiments, the substrate is contacted with the Compound and then infected with an influenza virus. In some embodiments, the substrate is infected with the influenza virus and then contacted with the Compound. In some embodiments, the substrate is contacted with the Compound and concurrently infected with the influenza virus. Contact of the substrate with the Compound could be accomplished by exposing the substrate to the Compound, for example, by delivering the Compound into the substrate or by inducing the substrate to express the Compound.

[00317] The influenza virus can be any type, subtype, or strain of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus. In a specific embodiment, a Compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svRNA, such as described in Section 5.2. In another embodiment, a Compound that decreases the activity or expression of svRNAs is an anti-svRNA Compound, for example, an LNA anti-svRNA described in Section 5.2.

[00318] In another aspect, provided herein are methods for increasing vRNA levels and decreasing viral mRNA levels of an Orthomyxovirus, comprising contacting a substrate with a Compound, such as described in Section 5.2, that increases the activity or expression of svRNAs, prior to, concurrently with, or subsequent to infecting the substrate with an Orthomyxovirus. In one embodiment, provided herein is a method for increasing vRNA levels and decreasing viral mRNA levels of an influenza virus, comprising contacting a substrate with a Compound that increases the activity or expression of svRNAs, and infecting the substrate with an influenza virus. In another embodiment, provided herein is a method for increasing vRNA levels and decreasing viral mRNA levels of an influenza virus, comprising contacting a substrate infected with an influenza virus with a Compound that increases the activity or expression of svRNAs. The influenza virus can be any strain, type or subtype of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus. An example of a Compound that increases the activity or expression of svRNAs is an svRNA mimetic (e.g., a synthetic svRNA), such as described in Section 5.2. In a specific embodiment, provided herein is a method for increasing vRNA levels and decreasing viral mRNA levels of influenza A virus, comprising contacting a synthetic svRNA described in Section 5.2 with a substrate and infecting the substrate with an influenza A virus. In another embodiment, provided herein is a method for increasing vRNA levels and decreasing viral mRNA levels of influenza B virus, comprising contacting a synthetic svRNA described in Section 5.2 with a substrate and infecting the substrate with an influenza B virus. In another specific embodiment, provided herein is a method for increasing vRNA levels and decreasing viral mRNA levels of influenza C virus, comprising contacting a synthetic svRNA described in Section 5.2 with a substrate and infecting the substrate with an influenza C virus.

[00319] In another aspect, provided herein are methods for decreasing vRNA levels and increasing viral mRNA levels of an Orthomyxovirus, comprising contacting a substrate with a Compound, such as described in Section 5.2, that decreases the activity or expression of svRNAs, prior to, concurrently with, or subsequent to infecting the substrate with an Orthomyxovirus. In one embodiment, provided herein is a method for decreasing vRNA levels and increasing viral mR A levels of an influenza virus, comprising contacting a substrate with a Compound that decreases the activity or expression of svR As, and infecting the substrate with an influenza virus. In one embodiment, provided herein is a method for decreasing vRNA levels and increasing viral mRNA levels of an influenza virus, comprising contacting a substrate with a Compound that decreases the activity or expression of svRNAs, and infecting the substrate with an influenza virus.

[00320] In one embodiment, provided herein is a method for decreasing vRNA levels and increasing viral mRNA levels of an influenza virus, comprising contacting a substrate with a Compound, such as described in Section 5.2, that decreases the activity or expression of svRNAs prior to, concurrently with, or subsequent to infecting the substrate with the influenza virus. In one embodiment, provided herein is a method for decreasing vRNA levels and increasing viral mRNA levels of an influenza virus, comprising contacting a substrate with a Compound that decreases the activity or expression of svRNAs, and infecting the substrate with an influenza virus. The influenza virus can be any type, subtype, or strain of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a Compound that decreases the activity or expression of svRNAs is an anti-svRNA Compound, such as described in Section 5.2. In a specific embodiment, provided herein is a method for decreasing vRNA levels and increasing viral mRNA levels of influenza A virus, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate and infecting the substrate with an influenza A virus. In another embodiment, provided herein is a method for decreasing vRNA levels and increasing viral mRNA levels of influenza B virus, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate and infecting the substrate with an influenza B virus. In another embodiment, provided herein is a method for decreasing vRNA levels and increasing viral mRNA levels of influenza C virus, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate and infecting the substrate with an influenza C virus.

[00321] In some embodiments, the substrate is contacted with the Compound and then infected with an Orthomyxovirus, e.g., an influenza virus. In some embodiments, the substrate is infected with the Orthomyxovirus (e.g. , an influenza virus) and then contacted with the Compound. In some embodiments, the substrate is contacted with the Compound and concurrently infected with the Orthomyxovirus, e.g., an influenza virus. Contact of the substrate with the Compound could be accomplished by exposing the substrate to the Compound, for example, by delivering the Compound into the substrate or by inducing the substrate to express the Compound. In some embodiments, the substrate is a cell. In some embodiments, the substrate is an embryonated egg. In some embodiments, the substrate is an animal. In other embodiments, the substrate is not an animal. In some embodiments, the substrate is a human. In other embodiments, the substrate is not a human.

5.6 Methods for Inhibiting or Reducing Orthomyxovirus Replication

[00322] Provided herein are methods for inhibiting or reducing Orthomyxovirus replication, comprising contacting a Compound, such as described in Section 5.2, with a substrate in an amount effective to inhibit or reduce Orthomyxovirus replication, prior to, concurrently with, or subsequent to, infecting the substrate with the Orthomyxovirus. In some embodiments, the substrate is contacted with a DNA that encodes the

[00323] Non-limiting examples of Orthomyxoviruses to be targeted in accordance with these methods include: influenza viruses (e.g., influenza A virus, influenza B virus, influenza C virus, such as described in Section 5.1), Thogoto viruses (e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus, Lake Chad virus) or Isaviruses (e.g., infectious salmon anemia virus).

[00324] In one embodiment, provided herein is a method for inhibiting or reducing Orthomyxovirus replication, comprising contacting a Compound, such as described in Section 5.2, that increases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce Orthomyxovirus replication, and infecting the substrate with an Orthomyxovirus. In another embodiment, provided herein is a method for inhibiting or reducing Orthomyxovirus replication, comprising contacting a

Compound, such as described in Section 5.2, that increases the expression or activity of svRNAs with a substrate infected with an Orthomyxovirus in an amount effective to inhibit or reduce Orthomyxovirus replication. In a specific embodiment, provided herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a Compound, such as described in Section 5.2, that increases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce influenza virus replication, and infecting the substrate with an influenza virus. In a specific embodiment, provided herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a Compound, such as described in Section 5.2, that increases the expression or activity of svRNAs with a substrate infected with an influenza virus in an amount effective to inhibit or reduce influenza virus replication. The influenza virus can be any type, subtype, or strain of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a

Compound that increases the activity or expression of svRNAs is an svRNA mimetic (e.g., a synthetic svRNA), such as described in Section 5.2. In a specific embodiment, provided herein is a method for inhibiting or reducing influenza A replication, comprising contacting a synthetic svRNA described in Section 5.2 with a substrate in an amount effective to inhibit or reduce influenza A virus replication and infecting the substrate with an influenza A virus. In another embodiment, provided herein is a method for inhibiting or reducing influenza B virus replication, comprising contacting a synthetic svRNA described in Section 5.2 with a substrate in an amount effective to inhibit or reduce influenza B virus replication and infecting the substrate with an influenza B virus. In another embodiment, provided herein is a method for inhibiting or reducing influenza C virus replication, comprising contacting a synthetic svRNA described in Section 5.2 with a substrate in an amount effective to inhibit or reduce influenza C virus replication and infecting the substrate with an influenza C virus.

[00325] In another embodiment, provided herein is a method for inhibiting or reducing Orthomyxovirus replication, comprising contacting a Compound, such as described in Section 5.2, that decreases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce Orthomyxovirus replication prior to, concurrently with, or subsequent to infecting the substrate with an Orthomyxovirus. In a specific embodiment, provided herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a Compound that decreases the expression or activity of svRNAs with a substrate in an amount effective to inhibit or reduce influenza virus replication, and infecting the substrate with an influenza virus. In a specific embodiment, provided herein is a method for inhibiting or reducing influenza virus replication, comprising contacting a Compound that decreases the expression or activity of svRNAs with a substrate infected with an influenza virus in an amount effective to inhibit or reduce influenza virus replication. The influenza virus can be any type, subtype, or strain of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a Compound that decreases the activity or expression of svR As is an anti-svR A Compound, such as described in Section 5.2.

[00326] In a specific embodiment, provided herein is a method for inhibiting or reducing influenza A virus replication, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate in an amount effective to inhibit or reduce influenza A virus replication, and infecting the substrate with an influenza A virus. In another embodiment, provided herein is a method for inhibiting or reducing influenza B virus replication, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate in an amount effective to inhibit or reduce influenza B virus replication, and infecting the substrate with an influenza B virus. In another embodiment, provided herein is a method for inhibiting or reducing influenza C virus replication, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate in an amount effective to inhibit or reduce influenza C virus replication, and infecting the substrate with an influenza C virus.

[00327] In some embodiments, provided herein are methods of reducing or inhibiting Orthomyxovirus replication, comprising contacting a substrate with a Compound, or composition comprising the Compound, in an amount sufficient to reduce or inhibit replication of the Orthomyxovirus, prior to, concurrently with, or subsequent to infecting the substrate with an Orthomyxovirus. In one embodiment, provided herein are methods for reducing or inhibiting Orthomyxovirus replication, comprising: (a) contacting a substrate with a Compound described herein, or composition comprising the Compound, in an amount sufficient to reduce or inhibit replication of the virus; and (b) infecting the substrate with the virus. Also provided herein are methods of reducing or inhibiting Orthomyxovirus replication, comprising contacting a substrate infected with an

Orthomyxovirus with a Compound, or composition comprising the Compound, that modulates the expression or activity of an svRNA, in an amount sufficient to reduce or inhibit replication of the virus. In one embodiment, a method for reducing or inhibiting replication of the virus comprises: (a) infecting a substrate with the virus; and (b) contacting the substrate with such a Compound or composition in an amount sufficient to reduce or inhibit replication of the virus. In some embodiments, a Compound or composition comprising the Compound is considered to reduce or inhibit

Orthomyxovirus replication if it reduces the amount of Orthomyxovirus replication as measured compared to a control, such as, for example, Orthomyxovirus replication in the absence of the Compound or composition, or Orthomyxovirus replication in the presence of a negative control. In some embodiments, the Compound or composition is contacted to a substrate at risk for an Orthomyxovirus infection.

[00328] In certain embodiments, the substrate is contacted with the Compound and then infected with the Orthomyxovirus. In some embodiments, the substrate is infected with the Orthomyxovirus and then contacted with the Compound. In some

embodiments, the substrate is contacted with the Compound and concurrently infected with the Orthomyxovirus. In certain embodiments, the substrate is contacted with an Orthomyxovirus concurrently with the Compound, or within, for example, 5 seconds, 15 seconds, 30 seconds, 1 minute, 5 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 6 hours, 12 hours, 16 hours or 24 hours, of each other. Contact of the substrate with the Compound could be accomplished by exposing the substrate to the Compound, for example, by delivering the Compound into the cell or by inducing/engineering the cell to express the Compound.

[00329] In certain of the foregoing embodiments, the substrate is a cell. In certain embodiments, the substrate is a zygote. In certain embodiments, the substrate is an embryonic stem cell or embryonic germ cell. In certain embodiments, the substrate is an egg, such as a fish egg or an avian egg. In certain embodiments, the substrate is a blastodisc or blastocyst. In certain embodiments, the substrate is a somatic cell (e.g. , a fibroblast). In some embodiments, the substrate is an embryonated egg. In some embodiments, the substrate is an animal. In certain embodiments, the substrate is a non- human animal, such as, e.g., a fish (e.g., salmon), avian (chicken, duck, etc.), or mammal (e.g., mouse, pig, horse, etc.). In other embodiments, the substrate is not an animal. In some embodiments, the substrate is a human. In other embodiments, the substrate is not a human.

[00330] In accordance with the foregoing embodiments, Orthomyxovirus replication may be assessed by measuring viral titer (as determined, e.g., by plaque formation) or viral genome replication (i.e., the production of vR A, as determined, e.g., by RT-PCR or Northern blot analysis), using the assays described in Sections 5.3, 6 and 7 herein or known in the art.

5.7 Prophylactic and Therapeutic Uses

[00331] Provided herein are methods for treating an Orthomyxovirus infection, comprising administering to a subject an effective amount of a Compound, such as described in Section 5.2 supra. In some embodiments, a DNA that encodes the Compound is administered to a subject. In some embodiments, an RNA that encodes the Compound is administered to a subject.

[00332] In one embodiment, provided herein is a method for treating an

Orthomyxovirus infection, comprising administering to a subject an effective amount of a Compound that increases the expression or activity of svRNAs. In a specific embodiment, provided herein is a method for treating an influenza virus infection, comprising administering to a subject an effective amount of a Compound that increases the expression or activity of svRNAs. The influenza virus can be any type, subtype, or strain of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a Compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svRNA described in Section 5.2 supra.

[00333] In a specific embodiment, provided herein is a method for treating an influenza A virus infection, comprising administering to a subject an effective amount of an svRNA mimetic, such as a synthetic svRNA, described in Sections 5.2, 6 and 7 herein. In another specific embodiment, provided herein is a method for treating an influenza B virus infection, comprising administering to a subject an effective amount of an svRNA mimetic, such as a synthetic svRNA, described in Section 5.2. In another specific embodiment, provided herein is a method for treating an influenza C virus infection, comprising administering to a subject an effective amount of an svRNA mimetic, such as a synthetic svRNA, described in Section 5.2.

[00334] In one embodiment, provided herein is a method for treating an

Orthomyxovirus infection, comprising administering to a subject an effective amount of a Compound that decreases the expression or activity of svRNAs. In a specific embodiment, provided herein is a method for treating an influenza virus infection, comprising administering to a subject an effective amount of a Compound that decreases the expression or activity of svRNAs. The influenza virus can be any type, subtype or strain of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus. An example of a Compound that decreases the activity or expression of svRNAs is an anti-svRNA Compound described in Section 5.2.

[00335] In a specific embodiment, described herein is a method for treating an influenza A virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA described in Sections 5.2 and 6 herein. In another specific embodiment, described herein is a method for treating an influenza B virus infection, comprising administering to a subject an effective amount of an LNA anti-svR A described in Section 5.2. In a specific embodiment, described herein is a method for treating an influenza C virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA described in Section 5.2.

[00336] In another embodiment, provided herein are methods for preventing or treating a symptom or disease associated with an Orthomyxovirus infection, comprising administering to a subject an effective amount of a Compound, such as described in Section 5.2 supra. In one embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an Orthomyxovirus infection, comprising administering to a subject an effective amount of a Compound that increases the expression or activity of svRNAs. In a specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an Isavirus {e.g., infectious salmon anemia virus) infection, comprising administering to a subject, such as a fish {e.g., salmon) an effective amount of a Compound that increases the expression or activity of svRNAs. An example of a Compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svRNA, described in Section 5.2 supra. In another specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza virus infection, comprising administering to a subject an effective amount of a Compound that increases the expression or activity of svRNAs. The influenza virus can be any type, subtype, or strain of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus. An example of a Compound that increases the activity or expression of svRNAs is an svRNA mimetic, such as a synthetic svRNA, described in Section 5.2 supra.

[00337] In a specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza A virus infection, comprising administering to a subject an effective amount of an svRNA mimetic, such as a synthetic svRNA, such as described in Sections 5.2, 6 and 7. In another specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza B virus infection, comprising administering to a subject an effective amount of an svRNA mimetic, such as a synthetic svRNA, such as described in Section 5.2. In another specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza C virus infection, comprising administering to a subject an effective amount of an svRNA mimetic, such as a synthetic svRNA, such as described in Section 5.2. [00338] In one embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an Orthomyxovirus infection, comprising administering to a subject an effective amount of a Compound that decreases the expression or activity of svRNAs. In a specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an Isavirus (e.g., infectious salmon anemia virus) infection, comprising administering to a subject, such as a fish (e.g., salmon) an effective amount of a Compound that decreases the expression or activity of svRNAs. In another specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza virus infection, comprising administering to a subject an effective amount of a Compound that decreases the expression or activity of svRNAs. The influenza virus can be any type, strain, or subtype of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus. An example of a Compound that decreases the activity or expression of svRNAs is an anti-svRNA Compound, such as described in Section 5.2 supra.

[00339] In a specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza A virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA, such as described in Sections 5.2, 6 and 7. In another specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza B virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA, such as described in Section 5.2. In another specific embodiment, provided herein is a method for preventing or treating a symptom or disease associated with an influenza C virus infection, comprising administering to a subject an effective amount of an LNA anti-svRNA, such as described in Section 5.2.

[00340] In specific embodiments, the methods for preventing a symptom or disease associated with an Orthomyxovirus infection described herein result in one or more of the following effects: (i) the inhibition of the development or onset of a symptom or disease associated with an Orthomyxovirus infection; (ii) the inhibition of the recurrence of a symptom or disease associated with an Orthomyxovirus infection; and/or (iii) delaying or forestalling the onset of a symptom or disease associated with an

Orthomyxovirus infection.

[00341] In specific embodiments, the methods of treating an Orthomyxovirus infection or a symptom or disease associated therewith described herein result in one, two, three, four, five or more of the following effects: (i) the reduction or amelioration of the severity of a viral infection and/or a symptom or disease associated therewith; (ii) the reduction in the duration of a viral infection and/or a symptom or disease associated therewith; (iii) the regression of a viral infection and/or a symptom or disease associated therewith; (iv) the prevention or delay in development or onset of a viral infection or a symptom or disease associated therewith; (v) the reduction or prevention of recurrence of a viral infection or a symptom or disease associated therewith; (vi) an increase in survival (e.g., lifespan) of a subject with a viral infection or a symptom or disease associated therewith; (vii) an increase the period of disease-free and/or symptom-free survival of a subject affected by or at risk for a viral infection or disease or symptom associated therewith; (viii) the reduction of the titer of a virus; (ix) the reduction in organ failure associated with a viral infection or a disease associated therewith; (x) the reduction in hospitalization of a subject; (xi) the reduction in hospitalization length; (xii) the increase in the survival of a subject; (xiii) the elimination of a virus infection or a symptom or disease associated therewith; (xiv) the reduction or inhibition of the progression of a viral infection and/or a symptom or disease associated therewith; (xv) the enhancement or improvement the therapeutic effect of another therapy or treatment; (xvi) the reduction or prevention of the spread of a virus from a cell, tissue, organ or subject to another cell, tissue, organ or subject; (xvii) the inhibition or reduction in the entry of a virus into a host cell; (xviii) the inhibition or reduction in the replication of the viral genome; (xix) the inhibition or reduction in the synthesis of viral proteins; (xx) the inhibition or reduction in viral assembly; (xxi) the inhibition or reduction in the release of viral particles from a host cell; (xxii) the reduction in hospitalization rate; (xxiii) prevention or reduction of organ failure associated with the virus infection or a symptom or disease associated therewith; (xxiv) elimination or curing of the viral infection or a symptom or disease associated therewith; (xxv) a reduction in the number of symptoms associated with the Orthomyxovirus infection; and/or (xxvi) an improvement in the general quality of life as assessed by, e.g., questionnaire. In some embodiments, the method of treating does not cure a disease caused by or associated with the

Orthomyxovirus, but prevents progression or worsening of the disease. In specific embodiments, the foregoing results relate to methods of treating an Isavirus (e.g. , infectious salmon anemia virus) infection or a symptom or disease associated therewith. In specific embodiments, the foregoing results relate to methods of treating an influenza virus infection or a symptom or disease associated therewith. [00342] Symptoms associated with influenza virus infection include, but are not limited to, body aches (especially joints and throat), fever, nausea, headaches, irritated eyes, fatigue, sore throat, reddened eyes or skin, and abdominal pain. In specific embodiments, the methods for treating an influenza virus infection or disease or symptom associated therewith provided herein reduce or eliminate one, two, or more of the following: body aches (especially joints and throat), fever, nausea, headaches, irritated eyes, fatigue, sore throat, reddened eyes or skin, and abdominal pain.

[00343] In some embodiments, a foregoing method for treating an Orthomyxovirus infection comprises administering to a subject in need thereof a pharmaceutical composition comprising a Compound in an amount sufficient to reduce the

Orthomyxovirus virus infection.

[00344] In some embodiments, a foregoing method of preventing and/or treating a symptom or disease associated with an Orthomyxovirus infection comprises

administering to a subject in need thereof a pharmaceutical composition comprising a Compound in an amount sufficient to reduce the symptom or disease associated with the Orthomyxovirus infection. In some embodiments, the subject is infected with an Orthomyxovirus. In some embodiments, the subject is at risk for infection with an Orthomyxovirus .

[00345] In some embodiments, a foregoing method of preventing a symptom or disease associated with an Orthomyxovirus infection comprises administering to a subject in need thereof a pharmaceutical composition comprising a Compound in an amount sufficient to prevent or reduce the symptom or disease associated with the Orthomyxovirus infection. In some embodiments, the subject is infected with an Orthomyxovirus. In some embodiments, the subject is at risk for infection with an Orthomyxovirus .

[00346] In certain embodiments of the aforementioned methods, the Compounds, compositions, and pharmaceutical compositions are used in an amount that is not significantly toxic to the cell, tissue, or subject for which it is intended. Methods of testing toxicity include any method known in the art, for example, as described in Section 5.3 (e.g., Section 5.3.3). The aforementioned methods may optionally comprise use of the Compound in combination with one or more additional therapies, e.g., active agents. Such additional active agents include, for example, one or more additional antiviral agents, e.g., a second compound that modulates the expression or activity of svRNAs; an antibiotic; an immunomodulatory agent; or an agent used in the treatment or prophylaxis of Orthomyxovirus infections or related symptoms or diseases described herein or known in the art.

[00347] A Compound or a composition described herein may be used as any line of therapy (e.g., a first, second, third, fourth or fifth line therapy) for an Orthomyxovirus infection.

[00348] Compounds for use in the foregoing methods include, by non-limiting example, (i) an svRNA mimetic, such as a synthetic svR A described in Section 5.2 supra; (ii) an anti-svR A Compound, such as an LNA anti-svR A described in Section 5.2 supra; or (iii) any other Compound described herein, known in the art, or to be discovered that modulates the expression or activity of an Orthomyxovirus svRNA.

[00349] Non-limiting examples of Orthomyxovirus infections or diseases associated therewith that may be prevented and/or treated in accordance with the foregoing methods include: influenza virus (e.g., influenza A virus, influenza B virus, influenza C virus), Thogotoviruses (e.g., Thogoto virus, Dhori virus, Batken virus, Quaranfil virus, Johnston Atoll virus, Lake Chad virus) or Isaviruses (e.g., infectious salmon anemia virus). In a specific embodiment, the Orthomyxovirus is an Isavirus (e.g., infectious salmon anemia virus). In another specific embodiment, the Orthomyxovirus is influenza virus. In one specific embodiment, the influenza virus in an influenza A virus. In one specific embodiment, the influenza virus in an influenza B virus. In one specific embodiment, the influenza virus in an influenza C virus. In one embodiment, the influenza A virus is an H5N1 isolate. In another embodiment, the influenza A virus is an HlNl isolate. In another embodiment, the influenza A virus is an H3N2 isolate. The foregoing methods may be used to target any influenza virus described in Section 5.1 supra, or a disease or symptom associated therewith. In some embodiments, the virus is a naturally occurring strain, variant or mutant of an Orthomyxovirus, a reassortant virus and/or a genetically engineered virus.

[00350] In some embodiments, a Compound described herein is the only active ingredient administered to prevent and/or treat the Orthomyxovirus infection or disease or symptom associated therewith. In other embodiments, more than one such

Compound, or the Compound together with another active agent or therapy, is administered in order to achieve a synergistic effect. In one embodiment, a Compound is administered together with an Orthomyxovirus vaccine, either known in the art or produced in accordance with the methods described in Section 5.9 below. Non-limiting examples of influenza virus vaccines include Fluarix® (Glaxo SmithKline), FluMist® (Medlmmune Vaccines), Fluvirin® (Chiron Corporation), Flulaval®

(Glaxo SmithKline), Afluria® (CSL Biotherapies Inc.), Agriflu® (Novartis)or Fluzone®

(Aventis Pasteur).

[00351] In a specific embodiment, a Compound is administered together with an influenza virus vaccine, either known in the art or produced in accordance with the methods described in Section 5.9. In one embodiment, an svRNA mimetic, such as described in Section 5.2, is administered with an attenuated live virus vaccine. In one embodiment, an anti-svR A Compound, such as described in Section 5.2, is

administered with an attenuated live virus vaccine. In certain embodiments, the anti- svRNA Compound is directed to a virus genome segment that is not required for packaging of the virus. In certain embodiments, the anti-svRNA Compound is directed to the PB1, PB2 or NA genome segments.

[00352] In some embodiments, the Compound used in accordance with the foregoing methods specifically interferes with the replication of an Isavirus (e.g. , an infectious salmon anemia virus). In some embodiments, the Compound used in accordance with the foregoing methods specifically interferes with the replication of an influenza virus. In other embodiments, the Compound interferes with the replication of an influenza virus and one or more other Orthomyxoviruses, e.g., more than one type of influenza virus. In some embodiments, the Compound interferes with the replication of one type, subtype or strain of influenza virus more than another. For example, the Compound may reduce the replication of an influenza A virus more than it reduces the replication of an influenza B virus, and vice versa.

[00353] The choice of Compounds to be used depends on a number of factors, including but not limited to the type of viral infection, the species, health and/or age of the subject, and toxicity or side effects.

[00354] The embodiments described herein also encompass methods for preventing and/or treating an Orthomyxovirus, e.g., an influenza virus or Isavirus (e.g., infectious salmon anemia virus), infection or disease or symptom associated therewith for which no antiviral therapy is available. The embodiments described herein also encompass methods for preventing, and/or treating an Orthomyxovirus virus infection or disease or symptom associated therewith as an alternative to other conventional therapies. In certain embodiments, the subject to be treated is too young or too old to be given a conventional therapy. In some embodiments, the subject to be treated is severely ill. In some embodiments, the subject to be treated is unresponsive, or poorly responsive, to one or more previous antiviral therapies. In some embodiments, the subject cannot be vaccinated against the particular Orthomyxovirus with which the subject is at risk of infection.

[00355] Also provided herein are methods of treating an Orthomyxovirus, e.g., an influenza virus, infection, said methods comprising administering to a subject in need thereof one or more of the Compounds described herein and one or more other therapies {e.g., with prophylactic or therapeutic agents). Also provided herein are methods of preventing or treating a disease associated with an Orthomyxovirus, e.g., an influenza virus or Isavirus {e.g., infectious salmon anemia virus), infection, said methods comprising administering to a subject in need thereof one or more of the Compounds described herein and one or more other therapies {e.g., with prophylactic or therapeutic agents). In a specific embodiment, the other therapies are currently being used, have been used or are known to be useful in the prevention and/or treatment of a viral infection or disease or symptom associated therewith. Non-limiting examples of such therapies are provided below. In a specific embodiment, one or more Compounds described herein are administered to a subject in combination with one or more therapies. In another embodiment, one or more Compounds described herein are administered to a subject in combination with a supportive therapy, a pain relief therapy, or another therapy that does not have antiviral activity. In some embodiments, the therapy is a treatment for pulmonary disease, for example, a disease associated with smoking, asthma, emphysema, allergies, bronchitis, cystic fibrosis, pulmonary fibrosis, or another disease that increases susceptibility to, for example, an influenza virus infection.

[00356] The combination therapies can be administered sequentially or concurrently. In one embodiment, the combination therapies comprise a Compound {e.g. , described in Section 5.2 herein) and at least one other therapy that has the same mechanism of action. In another embodiment, the combination therapy comprises a Compound {e.g. , described in Section 5.2 herein) and at least one other therapy that has a different mechanism of action than the Compound.

[00357] In a specific embodiment, the combination therapies improve the

prophylactic and/or therapeutic effect of a Compound {e.g., described in Section 5.2 herein) by functioning together with the Compound to have an additive or synergistic effect. In another embodiment, the combination therapies reduce the side effects associated with each therapy taken alone. [00358] The prophylactic or therapeutic agents of the combination therapies can be administered to a subject in the same pharmaceutical composition. Alternatively, the prophylactic or therapeutic agents of the combination therapies can be administered concurrently to a subject in separate pharmaceutical compositions. The prophylactic or therapeutic agents may be administered to a subject by the same or different routes of administration.

5.7.1 Patient/Subject Population

[00359] In some embodiments, a Compound, a composition comprising the

Compound, or a combination therapy is administered to a subject suffering from an Orthomyxovirus, e.g., an influenza virus, infection. In other embodiments, a

Compound, a composition comprising the Compound, or a combination therapy is administered to a subject predisposed to, at risk for, or susceptible to an

Orthomyxovirus, e.g., an influenza virus, infection. In some embodiments, a

Compound, a composition comprising the Compound, or a combination therapy is administered to a subject that lives in a region where there has been or might be an outbreak with an Orthomyxovirus, e.g., an influenza virus, infection. In some embodiments, the virus infection is an active infection. In some embodiments, the virus infection is chronic. In some of the foregoing embodiments, the Orthomyxovirus is an Isavirus, such as, e.g., infectious salmon anemia virus.

[00360] In certain embodiments, a Compound, a composition comprising the Compound, or a combination therapy is administered to a mammal, e.g. , a human or a non-human mammal (e.g., a pig or horse) which is 0 to 6 months old, 6 to 12 months old, 1 to 5 years old, 5 to 10 years old, 10 to 15 years old, 15 to 20 years old, 20 to 25 years old, 25 to 30 years old, 30 to 35 years old, 35 to 40 years old, 40 to 45 years old, 45 to 50 years old, 50 to 55 years old, 55 to 60 years old, 60 to 65 years old, 65 to 70 years old, 70 to 75 years old, 75 to 80 years old, 80 to 85 years old, 85 to 90 years old, 90 to 95 years old or 95 to 100 years old. In certain embodiments, a Compound, a composition comprising the Compound, or a combination therapy is administered to a human at risk for Orthomyxovirus, e.g., an influenza virus, infection.

[00361] In certain embodiments, a Compound, a composition comprising the Compound, or a combination therapy is administered to a human with an

Orthomyxovirus, e.g., an influenza virus, infection. In certain embodiments, the subject is a human 0 to 6 months old, 6 to 12 months old, 1 to 5 years old, 5 to 10 years old, 5 to 12 years old, 10 to 15 years old, 15 to 20 years old, 13 to 19 years old, 20 to 25 years old, 25 to 30 years old, 20 to 65 years old, 30 to 35 years old, 35 to 40 years old, 40 to 45 years old, 45 to 50 years old, 50 to 55 years old, 55 to 60 years old, 60 to 65 years old, 65 to 70 years old, 70 to 75 years old, 75 to 80 years old, 80 to 85 years old, 85 to 90 years old, 90 to 95 years old or 95 to 100 years old. In some embodiments, a Compound, a composition comprising the Compound, or a combination therapy is administered to a human infant. In some embodiments, a Compound, a composition comprising the Compound, or a combination therapy is administered to a premature human infant. In other embodiments, a Compound, a composition comprising the Compound, or a combination therapy is administered to a human child. In other embodiments, a Compound, a composition comprising the Compound, or a combination therapy is administered to a human adult. In yet other embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to an elderly human.

[00362] In certain embodiments, a Compound, a composition comprising the

Compound or a combination therapy is administered to a pet, e.g., a dog or cat. In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a farm animal or livestock, e.g. , fish (such as, e.g., salmon including, e.g., Salmo Salar, Salmo trutta and Onchorhyncus ), pig, cow, horse, chicken, etc. In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to an insect, a fish (e.g., salmon), a seal or an avian, e.g. , a duck or chicken.

[00363] In certain embodiments, a Compound, a composition comprising the

Compound or a combination therapy is administered to a subject (e.g., a primate, such as a human, monkey or chimpanzee, or another mammal, such as a pig, cow, horse, sheep, seal, goat, dog, cat or rodent), or an avian (e.g., duck or chicken) or a fish (e.g., salmon) in an immunocompromised state or immunosuppressed state or at risk for becoming immunocompromised or immunosuppressed. In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject receiving or recovering from immunosuppressive therapy. In certain

embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that has or is at risk of getting cancer, AIDS, another viral infection, or a bacterial infection. In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that is, will or has undergone surgery, chemotherapy and/or radiation therapy. In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that has, will have or had a tissue transplant. In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that smokes, has asthma, emphysema, allergies, bronchitis, cystic fibrosis, pulmonary fibrosis, or another disease that makes the subject susceptible to an influenza virus infection or infection with another Orthomyxovirus.

[00364] In some embodiments, a Compound, a composition comprising the

Compound or a combination therapy is administered to a subject that lives or works at a nursing home, a group home (i.e., a home for 10 or more subjects), or a prison. In some embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that attends or works at a school (e.g., elementary school, middle school, junior high school, high school or university) or daycare. In some embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that works in the healthcare area, such as a doctor or a nurse, or in a hospital. In some embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that lives or works at or near a farm, or is in contact with or might come into contact with livestock or other animals that may be infected with an Orthomyxovirus. In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that is pregnant or plans on becoming pregnant. In certain embodiments, a Compound, a composition comprising the

Compound or a combination therapy is administered to a subject that has given birth 1, 2, 3, 4, 5, 6, 7, or 8 weeks ago.

[00365] In certain embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject that is too young or too old to be given a conventional therapy. In some embodiments, the subject to be treated is severely ill. In some embodiments, the subject to be treated is unresponsive, or poorly responsive, to one or more previous antiviral therapies.

[00366] In some embodiments, a patient is administered a Compound, a composition comprising the Compound or a combination therapy before any adverse effects or intolerance to therapies other than the Compound develops. In some embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to refractory patients. In a certain embodiment, a refractory patient is a patient refractory to a standard antiviral therapy. In certain embodiments, a patient with a viral infection is refractory to a therapy when the infection has not significantly been eradicated and/or the symptoms have not been significantly alleviated. The

determination of whether a patient is refractory can be made either in vivo or in vitro by any method known in the art for assaying the effectiveness of a treatment of infections, using art-accepted meanings of "refractory" in such a context. In various embodiments, a patient with a viral infection is refractory when viral replication has not decreased or has increased.

[00367] In some embodiments, a Compound, a composition comprising the

Compound or a combination therapy is administered to a subject {e.g. a human patient or a non-human) to prevent the onset or reoccurrence of an Orthomyxovirus, e.g., an influenza virus or an Isavirus {e.g., infectious salmon anemia virus), infection in a subject {e.g. a human patient or a non-human) at risk of developing such an infection. In some embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject {e.g. a human patient or a non-human) who is susceptible to adverse reactions to conventional therapies. In some embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject {e.g. a human patient or a non-human) who is too young or too old for conventional therapies.

[00368] In some embodiments, a Compound, a composition comprising the

Compound or a combination therapy is administered to a subject {e.g. a human patient or a non-human) who has proven refractory to therapies other than the Compound, but are no longer on these therapies. In certain embodiments, the subjects {e.g. human patients or non-humans) being treated in accordance with the methods described herein are subjects {e.g. human patients or non-humans) already being treated with antibiotics, antivirals, antifungals, or other biological therapy/immunotherapy. Among these subjects {e.g. human patients or a non-humans) are refractory patients, patients who are too young for conventional therapies, patients who are too old for conventional therapies, and patients with reoccurring viral infections despite management or treatment with existing therapies.

[00369] In some embodiments, the subject being administered a Compound, a composition comprising the Compound or a combination therapy has not received a therapy prior to the administration of the Compound or composition or combination therapy. In other embodiments, a Compound, a composition comprising the Compound or a combination therapy is administered to a subject who has received a therapy prior to administration of the Compound, composition or combination therapy. In some embodiments, the subject administered a Compound, a composition comprising the Compound or a combination therapy was refractory to a prior therapy or experienced adverse side effects to the prior therapy or the prior therapy was discontinued due to unacceptable levels of toxicity to the subject.

[00370] In certain of the foregoing embodiments, the subject is administered a DNA encoding the Compound. In certain other embodiments, the subject is administered an R A encoding the Compound.

5.7.2 Mode of Administration

[00371] When administered to a subject (e.g. a human patient or a non-human), a Compound may be administered as a component of a composition that optionally comprises a pharmaceutically acceptable vehicle. In certain embodiments, a DNA encoding the Compound is administered. In certain other embodiments, an RNA encoding the Compound is administered. The Compound or composition thereof can be administered orally, or by any other convenient route, for example, topically, subcutaneously, intravenously, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g. , oral mucosa, rectal, and intestinal mucosa) and may be administered together with another biologically active agent. Administration can be systemic or local. Various delivery systems are known, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, or using gene therapy delivery methods known in the art, and can be used to administer the Compound and

pharmaceutically acceptable salts thereof.

[00372] Methods of administration include but are not limited to parenteral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances,

administration will result in the release of a Compound into the bloodstream.

[00373] In specific embodiments, it may be desirable to administer a Compound described herein locally. This may be achieved, for example, and not by way of limitation, by local infusion, topical application, e.g. , in conjunction with a wound dressing, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.

[00374] Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, a Compound is formulated as a suppository, with traditional binders and vehicles such as triglycerides. In a specific embodiment, a Compound is formulated as an aerosol.

[00375] In specific embodiments, the Compound can be administered topically, ocularly, intranasally or by an inhaler or nebulizer.

[00376] In another embodiment, the Compound is delivered in a vesicle, in particular a liposome (See Langer, 1990, Science 249:1527 1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Bacterial infection, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353 365 (1989); Lopez Berestein, ibid., pp. 317 327). See also Sections 5.2.1 and 5.4.1 supra and the references incorporated therein for more information on methods of formulation and delivery for administration of nucleic acid Compounds in accordance with the embodiments described herein.

[00377] In another embodiment, the Compound is delivered in a controlled release system (See, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115 138 (1984)). Examples of controlled-release systems are discussed in the review by Langer, 1990, Science 249: 1527 1533 may be used. In one embodiment, a pump may be used (See Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al, 1980, Surgery 88:507; Saudek et al, 1989, N. Engl. J. Med. 321 :574). In another embodiment, polymeric materials can be used (See Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; See also Levy et al, 1985, Science 228: 190; During et al., 1989, Ann. Neurol. 25:351; Howard et al, 1989, J. Neurosurg. 71 :105). In a specific embodiment, a controlled-release system comprising the Compound is placed in close proximity to the tissue infected with a virus to be prevented and/or treated. In accordance with this embodiment, the close proximity of the controlled-release system to the infection may result in only a fraction of the dose of the Compound required if it is systemically administered. [00378] In certain embodiments, it may be preferable to administer a Compound described herein via the natural route of infection of the Orthomyxovirus against which the Compound has antiviral activity. For example, it may be desirable to administer the Compound into the lungs by any suitable route to treat or prevent an infection of the respiratory tract by an influenza virus. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent for use as a spray.

5.7.3 Therapies for Use in Combination with the Compounds

[00379] Therapies that can be used in combination with the Compounds for the prevention and/or treatment of Orthomyxovirus, e.g., an influenza virus or an Isavirus (e.g. , infectious salmon anemia virus), infection or a disease or symptom associated therewith include, but are not limited to, small molecules, synthetic drugs, peptides (including cyclic peptides), polypeptides, proteins, nucleic acids (e.g., DNA and RNA nucleotides including, but not limited to, antisense nucleotide sequences, triple helices, R Ai, and nucleotide sequences encoding biologically active proteins, polypeptides or peptides), antibodies (including intrabodies), synthetic or natural inorganic molecules, mimetic agents, and synthetic or natural organic molecules. Specific examples of such agents include, but are not limited to, immunomodulatory agents (e.g., interferon), antiinflammatory agents (e.g., adrenocorticoids, corticosteroids (e.g., beclomethasone, budesonide, fiunisolide, fluticasone, triamcinolone, methylprednisolone, prednisolone, prednisone, hydrocortisone), glucocorticoids, steroids, and non-steroidal antiinflammatory drugs (e.g., aspirin, ibuprofen, diclofenac, and COX-2 inhibitors), pain relievers, leukotreine antagonists (e.g. , montelukast, methyl xanthines, zafirlukast, and zileuton), beta2-agonists (e.g. , albuterol, biterol, fenoterol, isoetharie, metaproterenol, pirbuterol, salbutamol, terbutalin formoterol, salmeterol, and salbutamol terbutaline), anticholinergic agents (e.g., ipratropium bromide and oxitropium bromide),

sulphasalazine, penicillamine, dapsone, antihistamines, anti-malarial agents (e.g., hydroxychloroquine), anti-viral agents (e.g., nucleoside analogs (e.g., zidovudine, acyclovir, gangcyclovir, vidarabine, idoxuridine, trifiuridine, and ribavirin), foscarnet, amantadine, rimantadine, saquinavir, indinavir, ritonavir, and AZT) and antibiotics (e.g. , dactinomycin (formerly actinomycin), bleomycin, erythomycin, penicillin, mithramycin, and anthramycin (AMC)). [00380] Any therapy which is known to be useful, or which has been used or is currently being used for the prevention and/or treatment of an Orthomyxovirus, e.g., an influenza virus or an Isavirus (e.g., infectious salmon anemia virus), infection or symptom or disease associated therewith can be used in combination with the

Compounds described herein in the compositions and methods described herein. See, e.g., Gilman et al, Goodman and Gilman's: The Pharmacological Basis of Therapeutics, 10th ed., McGraw-Hill, New York, 2001; The Merck Manual of Diagnosis and Therapy, Berkow, M.D. et al. (eds.), 17th Ed., Merck Sharp & Dohme Research Laboratories, Rahway, NJ, 199 9; Cecil Textbook of Medicine, 20th Ed., Bennett and Plum (eds.), W.B. Saunders, Philadelphia, 1996, and Physicians' Desk Reference {e.g., 64th ed. 2010) for information regarding therapies {e.g., prophylactic or therapeutic agents) which have been or are currently being used for preventing and/or treating

Orthomyxovirus, e.g., influenza virus, infections or symptoms or diseases associated therewith.

5.7.3.1 Antiviral Agents

[00381] Antiviral agents that can be used in combination with Compounds described herein include, but are not limited to, non-nucleoside reverse transcriptase inhibitors, nucleoside reverse transcriptase inhibitors, protease inhibitors, and fusion inhibitors. In one embodiment, the antiviral agent is selected from the group consisting of amantadine, oseltamivir phosphate, rimantadine, and zanamivir. In another embodiment, the antiviral agent is a non-nucleoside reverse transcriptase inhibitor selected from the group consisting of delavirdine, efavirenz, and nevirapine. In another embodiment, the antiviral agent is a nucleoside reverse transcriptase inhibitor selected from the group consisting of abacavir, didanosine, emtricitabine, emtricitabine, lamivudine, stavudine, tenofovir DF, zalcitabine, and zidovudine. In another embodiment, the antiviral agent is a protease inhibitor selected from the group consisting of amprenavir, atazanavir, fosamprenav, indinavir, lopinavir, nelfmavir, ritonavir, and saquinavir. In another embodiment, the antiviral agent is a fusion inhibitor such as enfuvirtide.

[00382] Additional, non-limiting examples of antiviral agents for use in combination with Compounds described herein include the following: rifampicin, nucleoside reverse transcriptase inhibitors {e.g., AZT, ddl, ddC, 3TC, d4T), non-nucleoside reverse transcriptase inhibitors {e.g., delavirdine efavirenz, nevirapine), protease inhibitors {e.g., aprenavir, indinavir, ritonavir, and saquinavir), idoxuridine, cidofovir, acyclovir, ganciclovir, zanamivir, amantadine, and palivizumab. Other examples of anti-viral agents include but are not limited to acemannan; acyclovir; acyclovir sodium; adefovir; alovudine; alvircept sudotox; amantadine hydrochloride (SYMMETREL(TM));

aranotin; arildone; atevirdine mesylate; avridine; cidofovir; cipamfylline; cytarabine hydrochloride; delavirdine mesylate; desciclovir; didanosine; disoxaril; edoxudine; enviradene; enviroxime; famciclovir; famotine hydrochloride; fiacitabine; fialuridine; fosarilate; foscamet sodium; fosfonet sodium; ganciclovir; ganciclovir sodium;

idoxuridine; kethoxal; lamivudine; lobucavir; memotine hydrochloride; methisazone; nevirapine; oseltamivir phosphate (TAMIFLU(TM)); penciclovir; pirodavir; ribavirin; rimantadine hydrochloride (FLUMADINE(TM)); saquinavir mesylate; somantadine hydrochloride; sorivudine; statolon; stavudine; tilorone hydrochloride; trifluridine;

valacyclovir hydrochloride; vidarabine; vidarabine phosphate; vidarabine sodium phosphate; viroxime; zalcitabine; zanamivir (RELENZA(TM)); zidovudine; and zinviroxime.

5.7.3.2 Antibacterial Agents

[00383] Antibacterial agents, including antibiotics, that can be used in combination with the Compounds described herein include, but are not limited to, aminoglycoside antibiotics, glycopeptides, amphenicol antibiotics, ansamycin antibiotics,

cephalosporins, cephamycins oxazolidinones, penicillins, quinolones, streptogamins, tetracyclins, and analogs thereof. In some embodiments, antibiotics are administered in combination with the Compound to prevent and/or treat a bacterial infection.

[00384] In a specific embodiment, the Compounds described herein are used in combination with protein synthesis inhibitors, including but not limited to, streptomycin, neomycin, erythromycin, carbomycin, and spiramycin.

[00385] In one embodiment, the antibacterial agent is selected from the group consisting of ampicillin, amoxicillin, ciprofloxacin, gentamycin, kanamycin, neomycin, penicillin G, streptomycin, sulfanilamide, and vancomycin. In another embodiment, the antibacterial agent is selected from the group consisting of azithromycin, cefonicid, cefotetan, cephalothin, cephamycin, chlortetracycline, clarithromycin, clindamycin, cycloserine, dalfopristin, doxycycline, erythromycin, linezolid, mupirocin,

oxytetracycline, quinupristin, rifampin, spectinomycin, and trimethoprim.

[00386] Additional, non-limiting examples of antibacterial agents for use in combination with the Compounds described herein include the following: aminoglycoside antibiotics (e.g. , apramycin, arbekacin, bambermycins, butirosin, dibekacin, neomycin, neomycin, undecylenate, netilmicin, paromomycin, ribostamycin, sisomicin, and spectinomycin), amphenicol antibiotics (e.g., azidamfenicol,

chloramphenicol, florfenicol, and thiamphenicol), ansamycin antibiotics (e.g., rifamide and rifampin), carbacephems (e.g., loracarbef), carbapenems (e.g., biapenem and imipenem), cephalosporins (e.g. , cefaclor, cefadroxil, cefamandole, cefatrizine, cefazedone, cefozopran, ΰε ίιηίζοΐε, cefpiramide, and cefpirome), cephamycins (e.g. , cefbuperazone, cefmetazole, and cefminox), folic acid analogs (e.g., trimethoprim), glycopeptides (e.g., vancomycin), lincosamides (e.g., clindamycin, and lincomycin), macro lides (e.g. , azithromycin, carbomycin, clarithomycin, dirithromycin, erythromycin, and erythromycin acistrate), monobactams (e.g. , aztreonam, carumonam, and

tigemonam), nitrofurans (e.g., furaltadone, and furazolium chloride), oxacephems (e.g., flomoxef, and moxalactam), oxazolidinones (e.g., linezolid), penicillins (e.g., amdinocillin, amdinocillin pivoxil, amoxicillin, bacampicillin, benzylpenicillinic acid, benzylpenicillin sodium, epicillin, fenbenicillin, floxacillin, penamccillin, penethamate hydriodide, penicillin o benethamine, penicillin 0, penicillin V, penicillin V benzathine, penicillin V hydrabamine, penimepicycline, and phencihicillin potassium), quinolones and analogs thereof (e.g., cinoxacin, ciprofloxacin, clinafloxacin, flumequine, grepagloxacin, levofloxacin, and moxifloxacin), streptogramins (e.g., quinupristin and dalfopristin), sulfonamides (e.g., acetyl sulfamethoxypyrazine, benzylsulfamide, noprylsulfamide, phthalylsulfacetamide, sulfachrysoidine, and sulfacytine), sulfones (e.g., diathymosulfone, glucosulfone sodium, and solasulfone), and tetracyclines (e.g., apicycline, chlortetracycline, clomocycline, and demeclocycline). Additional examples include cycloserine, mupirocin, tuberin amphomycin, bacitracin, capreomycin, colistin, enduracidin, enviomycin, and 2,4 diaminopyrimidines (e.g., brodimoprim).

5.7.4 Dosages & Frequency of Administration

[00387] The amount of a Compound or a composition thereof that will be effective in the prevention and/or treatment of an Orthomyxovirus, e.g., an influenza virus or an Isavirus (e.g., infectious salmon anemia virus), infection or a disease or symptom associated therewith can be determined by standard clinical techniques. In vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed for a patient will also depend, e.g. , on the route of administration, the type of infection, and the seriousness of the infection, and should be decided according to the judgment of the practitioner and each patient's circumstances.

[00388] Exemplary doses of Compounds or compositions thereof include milligram or microgram amounts per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 5 micrograms per kilogram to about 100 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram). In specific embodiments, a daily dose is at least 50 mg, 75 mg, 100 mg, 150 mg, 250 mg, 500 mg, 750 mg, or at least 1 g.

[00389] In another embodiment, the dosage is a unit dose of 5 mg, 10 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, or 800 mg or more. In another embodiment, the dosage is a unit dose that ranges from about 5 mg to about 100 mg, about 100 mg to about 200 mg, about 150 mg to about 300 mg, about 150 mg to about 400 mg, 250 mg to about 500 mg, about 500 mg to about 800 mg, about 500 mg to about 1000 mg, or about 5 mg to about 1000 mg.

[00390] The formulation of compositions comprising nucleic acid Compounds (such as, e.g., synthetic svRNAs or anti-svR A Compounds described in Section 5.2) and their subsequent administration is within the skill of those in the art. In general, in accordance with the embodiments described herein, a subject is administered a nucleic acid Compound in doses ranging from 0.01 ug to 100 g per kg of body weight depending on the age of the patient and the severity of the condition. Further, the treatment regimen may last for a period of time that will vary depending upon the nature of the particular infection, symptom or disease, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years. Following treatment, the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disease state. The dosage of the Compound may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms or disease associated with the Orthomyxovirus is observed.

[00391] In embodiments in which the nucleic acid Compound is administered in a viral vector, the virus may be administered at a dosage of 10² - 10⁴ pfu, 10³ - 10⁴ pfu, 10⁴ - 10⁶ pfu, or 10⁴ - 5xl0⁶ pfu of virus, and can be administered once. Alternatively, the dosage may comprise 10² - 10⁴ pfu, 10³ - 10⁴ pfu, 10⁴ - 10⁶ pfu, or 10⁴ - 5xl0⁶ pfu of virus, and can be administered twice or three times, with an interval, for example, of 2 to 6 months between doses. Alternatively, the dosage may comprise 10² - 10⁴ pfu, 10³ - 10⁴ pfu, 10⁴ - 10⁶ pfu, or 10⁴ - 5xl 0⁶ pfu of virus, and can be administered as often as needed.

[00392] In another embodiment, a subject is administered one or more doses of a effective amount of a Compound or a composition described herein, wherein the effective amount is not the same for each dose.

[00393] In certain embodiments, a subject is administered a Compound (e.g., described in Section 5.2 herein) or a composition comprising the Compound in an amount effective to inhibit or reduce viral replication by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70% to 75%, at least 75% to 80%, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In some embodiments, a subject is administered the Compound or composition thereof in an amount effective to inhibit or reduce viral replication by at least 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 8 fold, 10 fold, 15 fold, 20 fold, or 2 to 5 fold, 2 to 10 fold, 5 to 10 fold, or 5 to 20 fold relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In other embodiments, a subject is administered the Compound or composition thereof in an amount effective to inhibit or reduce viral replication by 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 5 logs or more relative to a negative control as determined using an assay described herein or others known to one of skill in the art.

[00394] In certain embodiments, a subject is administered a Compound (e.g., described in Section 5.2 herein) or a composition comprising the Compound in an amount effective to inhibit viral genome replication by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70% to 75%, at least 75% to 80%, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In other embodiments, a subject is administered the Compound or a composition thereof in an amount effective to inhibit or reduce viral genome replication by at least 20%> to 25%>, preferably at least 25%> to 30%>, at least 30%> to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70% to 75%), at least 75% to 80%>, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In certain embodiments, a subject is administered the Compound or a composition thereof in an amount effective to inhibit or reduce viral genome replication by at least 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 8 fold, 10 fold, 15 fold, 20 fold, or 2 to 5 fold, 2 to 10 fold, 5 to 10 fold, or 5 to 20 fold relative to a negative control as determined using an assay described herein or other known to one of skill in the art.

[00395] In certain embodiments, a subject is administered a Compound (e.g., described in Section 5.2 herein) or a composition comprising the Compound in an amount effective to inhibit or reduce viral mRNA or protein synthesis by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70% to 75%, at least 75% to 80%, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In other embodiments, a subject is administered the Compound or a composition thereof in an amount effective to inhibit or reduce viral mRNA or protein synthesis by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70%) to 75%, at least 75% to 80%, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In certain embodiments, a subject is administered the Compound or composition thereof in an amount effective to inhibit or reduce mRNA or viral protein synthesis by at least 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 8 fold, 10 fold, 15 fold, 20 fold, or 2 to 5 fold, 2 to 10 fold, 5 to 10 fold, or 5 to 20 fold relative to a negative control as determined using an assay described herein or others known to one of skill in the art.

[00396] In certain embodiments, a subject is administered a Compound (e.g., described in Section 5.2 herein) or a composition comprising the Compound in an amount effective to inhibit or reduce the spread of virus from a cell, tissue, or organ to another cell, tissue or organ by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70%) to 75%, at least 75% to 80%, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In some embodiments, a subject is administered the Compound or composition thereof in an amount effective to inhibit or reduce the spread of virus from a cell, tissue or organ to another cell, tissue or organ by at least 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 8 fold, 10 fold, 15 fold, 20 fold, or 2 to 5 fold, 2 to 10 fold, 5 to 10 fold, or 5 to 20 fold relative to a negative control as determined using an assay described herein or others known to one of skill in the art.

[00397] In certain embodiments, a subject is administered a Compound (e.g., described in Section 5.2 herein) or a composition comprising the Compound in an amount effective to inhibit or reduce viral titer by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70% to 75%, at least 75% to 80%, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In some embodiments, a subject is administered the Compound or composition thereof in an amount effective to inhibit or reduce viral titer by at least 1.5 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 8 fold, 10 fold, 15 fold, 20 fold, or 2 to 5 fold, 2 to 10 fold, 5 to 10 fold, or 5 to 20 fold relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In other embodiments, a subject is administered the Compound or composition thereof in an amount effective to inhibit or reduce viral titer by 1 log, 1.5 logs, 2 logs, 2.5 logs, 3 logs, 3.5 logs, 4 logs, 5 logs or more relative to a negative control as determined using an assay described herein or others known to one of skill in the art.

[00398] In certain embodiments, a subject is administered a Compound (e.g., described in Section 5.2 herein) or a composition comprising the Compound in an amount effective to inhibit or reduce the ability of the virus to spread to other individuals by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70% to 75%, at least 75%) to 80%), or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art. In other embodiments, a subject is administered the Compound or composition thereof in an amount effective to inhibit or reduce the ability of the virus to spread to other cells, tissues or organs in the subject by at least 20% to 25%, preferably at least 25% to 30%, at least 30% to 35%, at least 35% to 40%, at least 40% to 45%, at least 45% to 50%, at least 50% to 55%, at least 55% to 60%, at least 60% to 65%, at least 65% to 70%, at least 70% to 75%, at least 75%) to 80%>, or up to at least 85% relative to a negative control as determined using an assay described herein or others known to one of skill in the art.

[00399] In certain embodiments, a dose of a Compound (e.g., described in Section 5.2 herein) or a composition comprising the Compound is administered to a subject every day, every other day, every couple of days, every third day, once a week, twice a week, three times a week, or once every two weeks. In other embodiments, two, three or four doses of the Compound or composition thereof is administered to a subject every day, every couple of days, every third day, once a week or once every two weeks. In some embodiments, a dose(s) of the Compound or composition thereof is administered for 2 days, 3 days, 5 days, 7 days, 14 days, or 21 days. In certain embodiments, a dose of the Compound or composition thereof is administered for 1 month, 1.5 months, 2 months, 2.5 months, 3 months, 4 months, 5 months, 6 months or more.

[00400] The dosages of therapies that have been or are currently used for the prevention, treatment and/or management of an Orthomyxovirus, e.g., an influenza virus, infection or disease or symptom associated therewith can be determined using references available to a clinician such as, e.g., the Physicians' Desk Reference (64th ed. 2010). In a specific embodiment, dosages lower than those that have been or are currently being used to prevent, treat and/or manage the infection are utilized in combination with one or more Compounds (e.g., described in Section 5.2 herein) or compositions comprising the Compound(s).

[00401] For compounds that modulate the expression or activity of an

Orthomyxovirus svRNA (e.g., a Compound described in Section 5.2 herein), or compositions comprising the Compound(s), which have already been approved for uses other than prevention, treatment or management of Orthomyxovirus, e.g., influenza virus, infections or diseases or symptoms associated therewith, safe ranges of doses can be readily determined using references available to clinicians, such as e.g., the

Physician's Desk Reference (64^th ed. 2010).

[00402] The above-described administration schedules are provided for illustrative purposes only and should not be considered limiting. A person of ordinary skill in the art will readily understand that all doses are within the scope of the embodiments described herein. 5.8 Genomic Expression of Compounds

[00403] The methods described in Sections 5.6 and 5.7 supra may be adapted such that the Compound (in particular, a nucleic acid Compound, such as an svR A mimetic or anti-svR A described in Section 5.2.1 supra) is stably expressed in a substrate or subject. For example, the Compound may be stably integrated into the genome of the substrate or subject. Expression of a nucleic acid Compound from the genome may be accomplished using methods known in the art, as described infra and in Sections 5.2.1.1 and the example of Section 8.

[00404] In some embodiments, transgenic animals are generated that express a nucleic acid Compound from their genomes. Such transgenic animals may have reduced susceptibility to, or be resistant to, infection or disease caused by the Orthomyxovirus targeted by the nucleic acid Compound that is expressed as a transgene. Exemplary transgenic animals include any animal at risk for Orthomyxovirus infection. For example, avian species (chickens, ducks, etc.), and pigs and other mammals are at risk for influenza virus infection. Salmon, including farmed and wild salmon, are at risk for Isavirus {e.g., infectious salmon anemia virus) infection. Thus, in some embodiments, the transgenic animal is a non-human animal. In certain embodiments, the transgenic animal is an avian, such as, e.g., a chicken or duck. In some embodiments, the transgenic animal is a mammal, such as, e.g., a pig. In some embodiments, the transgenic animal is a fish, such as, e.g., salmon. Methods of generating transgenic versions of these animals, including stable transgenic lines, and others are known in the art. See, e.g., Laible, 2009, "Enhancing livestock through genetic engineering: Recent advances and future prospects," Comparative Immunology, Microbiology and Infectious Diseases, 32: 123-13; U.S. Patent No. 7,323,619, issued January 29, 2008, and U.S. Patent No. 7,199,281, issued April 3, 2007, each of which is incorporated by reference herein in its entirety. See, e.g., Matsubara et al. 2010, "A Simple Culture Method of Chicken Blastodermal Cells for Germline Transmission," J Poultry Science, Advance Publication; and Scott et al. 2010, "Applications of Avian Transgenesis," ILAR Journal 51 :353-361, incorporated by reference herein in their entireties, for examples of transgenic chicken generation. See, e.g., Lai et al. 2006, "Generation of cloned transgenic pigs rich in omega-3 fatty acids," Nat. Biotechnology 24:435-436; and Lai et al. 2002, "Production of alpha-l,3-galactosyltransferase knockout pigs by nuclear transfer cloning," Science 295: 1089-1092, incorporated by reference herein in their entireties, for examples transgenic pig generation. See, e.g., Yaskowiak et al. 2006, "Characterization and multi-generational stability of the growth hormone transgene (EO- l ) responsible for enhanced growth rates in Atlantic Salmon," Transgenic Research 15:465-480, incorporated by reference herein in its entirety, for examples of transgenic salmon generation.

[00405] One exemplary methodology for generating transgenic animals involves growing embryonic stem (ES) cells or an ES cell line from a subject (e.g., a non-human mammal such as a pig) on an appropriate fibroblast-feeder layer or in the presence of appropriate growth factor (e.g., leukemia inhibiting factor (LIF)), and transfecting or microinjecting the cells with a nucleic acid Compound. After transfecting or

microinjecting the cells, they are plated onto a feeder layer in appropriate medium and allowed to grow for a period of time. After a sufficient period of time, colonies are picked and analyzed for the occurrence of integration (e.g., by homologous

recombination) of the nucleic acid Compound. Those colonies that are positive may then be used for embryo manipulation and blastocyst injection. Blastocysts are generally obtained from 4 to 6 weeks old superovulated females. The ES cells are trypsinized, and the modified cells are injected into the blastocoel of the blastocyst. After injection, the blastocysts are returned to each uterine horn of pseudopregnant females. Females are then allowed to go to term and the resulting progeny are screened for mutant cells having the nucleic acid Compound. Progeny having the nucleic acid Compound can be readily detected if, e.g., the blastocyst and the ES cells have a different phenotype. Males and females having the nucleic acid Compound can be mated to produce homozygous progeny.

[00406] Another exemplary methodology for generating transgenic animals (e.g., a non-human animal such as a fish, chicken, or pig) involves microinjection or retro viral- mediated gene delivery of the nucleic acid Compound directly into the zygote or blastula. The offspring having the nucleic acid Compound can be mated to produce homozygous progeny.

[00407] Successful generation of a transgenic pig, chicken, salmon, or line thereof, etc., in accordance with the foregoing methods may be measured by methods known in the art, for example, by assessing expression of the transgenic nucleic acid Compound, using Northern blot or PCR, assessing expression or function of a detectable marker (for example, a green or red fluorescent protein) encoded by the nucleic acid Compound transgene, or by determining the Compound's ability to modulate Orthomyxovirus replication or its antiviral activity, such as described in Section 5.3 supra. Methods of determining whether transgenic expression of the Compound is toxic are known in the art, for example, as described in Section 5.3.3 supra. In some embodiments, the transgene remains stably integrated and is expressed over multiple generations.

[00408] Accordingly, provided herein are methods of inhibiting or reducing

Orthomyxovirus replication, comprising engineering a substrate so that its genome encodes a nucleic acid Compound that, upon expression, modulates the expression and/or activity of svRNAs in an amount effective to inhibit or reduce Orthomyxovirus replication. In one embodiment, provided herein is a method for inhibiting or reducing Orthomyxovirus replication, comprising engineering a substrate so that its genome encodes a nucleic acid Compound {e.g. , an svR A mimetic) that, upon expression, increases the expression and/or activity of svRNAs in an amount effective to inhibit or reduce Orthomyxovirus replication. In another embodiment, described herein is a method for inhibiting or reducing Orthomyxovirus replication, comprising engineering a substrate so that its genome encodes a nucleic acid Compound {e.g. , an anti-svRNA) that, upon expression, decreases the expression and/or activity of svRNAs in an amount effective to inhibit or reduce Orthomyxovirus replication.

[00409] In another embodiment, provided herein are methods for preventing or treating a symptom or disease associated with an Orthomyxovirus infection, comprising engineering a substrate so that its genome encodes a nucleic acid Compound that, upon expression, modulates the expression and/or activity of svRNAs in an amount effective to prevent or treat the symptom or disease associated with Orthomyxovirus infection. In one embodiment, described herein is a method for preventing or treating a symptom or disease associated with an Orthomyxovirus infection, comprising engineering a substrate so that its genome encodes a nucleic acid Compound {e.g., an svRNA mimetic described in Section 5.2.1.2 supra) that, upon expression, increases the expression and/or activity of svRNAs in an amount effective to prevent or treat the symptom or disease associated with Orthomyxovirus infection. In one embodiment, described herein is a method for preventing or treating a symptom or disease associated with an Orthomyxovirus infection, comprising engineering a substrate so that its genome encodes a nucleic acid Compound {e.g., an anti-svRNA described in Section 5.2.1.3 supra) that, upon expression, decreases the expression and/or activity of svRNAs in an amount effective to prevent or treat the symptom or disease associated with Orthomyxovirus infection. [00410] In certain of the foregoing embodiments, the Orthomyxovirus is an Isavirus, e.g., an infectious salmon anemia virus. In certain embodiments, the Orthomyxovirus is an influenza virus. In certain embodiments, the influenza virus is an influenza A virus. In certain embodiments, the influenza virus is an influenza B virus. In certain embodiments, the influenza virus is an influenza C virus.

[00411] In certain of the foregoing embodiments, the substrate is a cell. In certain embodiments, the substrate is a zygote. In certain embodiments, the substrate is an embryonic stem cell or embryonic germ cell. In certain embodiments, the substrate is an egg, such as a fish egg or an avian egg. In certain embodiments, the substrate is a blastodisc or blastocyst. In certain embodiments, the substrate is a somatic cell (e.g. , a fibroblast). In certain of the foregoing embodiments, the engineered substrate is a transgenic animal, such as, e.g., a transgenic fish (e.g., salmon), avian (chicken, duck, etc.), or mammal (e.g., non-human mammal (e.g., mouse, pig, horse, etc.) or a human)..

[00412] In certain embodiments, a non-human transgenic animal comprises a nucleic acid Compound (e.g., an anti-svRNA or an svR A mimetic) stably integrated into the genome of the non-human animal. In specific embodiments, the nucleic acid Compound is expressed by the non-human animal. In some embodiments, the expression of the nucleic acid Compound is regulated by, e.g., an inducible promoter, constitutive promoter or tissue-specific promoter. In certain embodiments, the nucleic acid

Compound is only expressed in certain tissues, organs or cells. In some embodiments, the non-human animal is homozygous for the transgene encoding the nucleic acid Compound. In some embodiments, the non-human animal is heterozygous for the transgene encoding the nucleic acid Compound.

[00413] In an exemplary embodiment, a transgenic salmon expressing an anti-svRNA against infectious salmon anemia virus is generated. In certain embodiments, one or more copies (in some embodiments, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more copies) of the anti-svRNA sequence (e.g., 5'-

AAAAAGAAGACCUGAUGGAUGAAU-3 ') may be inserted in by standard recombinant DNA technology into an intron in the growth hormone transgene, EO-l (as described in Yaskowiak et al. 2006). A plasmid DNA construct encoding the modified EO-l transgene may then be transfected into a salmon blastocyst. Upon splicing of the modified EO-l transgene, a lariat is formed that is processed by the cellular miRNA machinery, generating the anti-svRNA Compound. Salmon that are homozygous for stable, high level expression of the transgene may be selected, and used as founders for a stable line of transgenic anti-svRNA expressing salmon. Alternatively, salmon that are heterozygous for stable, high level expression of the transgene may be crossed to generate a founder line of transgenic anti-svRNA expressing salmon.

Standard methods to select fish for breeding based upon a balance of low transgene toxicity and high transgene expression and functionality, as described supra, may be used. The foregoing method, or variants thereof, may be used to generate other transgenic animals in accordance with the methods described herein.

5.9 Methods of Using Compounds In the Production of Attenuated Orthomyxoviruses

[00414] In some embodiments, the Compounds provided in Section 5.2 supra are used for producing attenuated Orthomyxoviruses. In some embodiments, a DNA encoding the Compound is used for producing attenuated Orthomyxoviruses. In other embodiments, an RNA encoding the Compound is used for producing attenuated Orthomyxoviruses. In one embodiment, provided herein is a method for producing an attenuated Orthomyxovirus comprising contacting a Compound described herein with a substrate, infecting the substrate with an Orthomyxovirus, and collecting the replication- deficient progeny viruses. In one embodiment, provided herein is a method for producing an attenuated Orthomyxovirus comprising contacting a Compound with a substrate infected with an Orthomyxovirus and collecting the replication-deficient progeny viruses.

[00415] In one aspect, provided herein is a method for producing an attenuated Orthomyxovirus, comprising contacting a Compound that decreases the expression or activity of svRNAs with a substrate prior to, concurrently with, or subsequent to infecting the substrate with the Orthomyxovirus, and collecting the replication-deficient progeny virus. In some embodiments, the substrate is contacted with the Compound and then infected with an Orthomyxovirus. In other embodiments, the substrate is infected with the Orthomyxovirus and then contacted with the Compound. In some

embodiments, the substrate is contacted with the Compound and concurrently infected with the Orthomyxovirus. Contact of the substrate with the Compound can be accomplished by exposing the substrate to the Compound, for example, by delivering the Compound into the substrate or by inducing the substrate to express the Compound.

[00416] In a specific embodiment, provided herein is a method for producing an attenuated influenza virus, comprising contacting a Compound that decreases the expression or activity of svRNAs with a substrate prior to, concurrently with, or subsequent to infecting the substrate with an influenza virus, and collecting the replication-deficient progeny virus. In one embodiment, provided herein is a method for producing attenuated influenza viruses, comprising contacting a Compound that decreases the expression or activity of svR As with a substrate prior to, concurrently with, or subsequent to infection with an influenza virus, and collecting the replication- deficient progeny virus. The influenza virus can be any strain, type or subtype of influenza virus, for example, an influenza A virus, influenza B virus or influenza C virus.

[00417] In a specific embodiment, provided herein is a method for producing attenuated influenza A viruses, comprising contacting an anti-svRNA Compound (e.g., an LNA anti-svRNA Compound) provided in Section 5.2 with a substrate, infecting the substrate with an influenza A virus and collecting the replication-deficient progeny virus. In another embodiment, provided herein is a method for producing attenuated influenza B viruses, comprising contacting an anti-svRNA Compound (e.g., an LNA anti-svRNA Compound) described in Section 5.2 with a substrate, infecting the substrate with an influenza B virus and collecting the replication-deficient progeny virus. In another embodiment, provided herein is a method for producing influenza C viruses, comprising contacting an anti-svRNA Compound (e.g. , an LNA anti-svRNA

Compound) described in Section 5.2 with a substrate, infecting the substrate with an influenza C virus and collecting the replication-deficient progeny virus.

[00418] In some embodiments, the attenuated influenza virus is produced by contacting a Compound, such as described in Section 5.2, that decreases the expression or activity of an svRNA for a specific influenza virus genome segment. In specific embodiments, the Compound decreases the activity of the svRNA specific for a viral genome segment that is not required for packaging, such as influenza virus NA. In another embodiment, the Compound decreases the expression or activity of an svRNA specific to another genome segment. In one embodiment, the Compound is an anti- svRNA described in Section 5.2.1.3. In one embodiment, the Compound is an anti- svRNA described in Table 1.

[00419] Replication of Orthomyxoviruses, for example, replication of an influenza virus, may be measured using assays known in the art or described herein. For example, replication of influenza viruses may be assayed using the methods described in Section 5.3 supra. [00420] Without being bound by any theory, it is thought that exposure of cells to Compounds (such as described in Section 5.2) may result in the production of attenuated Orthomyxovirus particles because such Compounds may cause segment-specific loss of cRNA and vR A. For influenza virus, for example, all eight segments are required to efficiently to package virions that contain the full complement of genomic segments. Thus, contact of cells with Compounds (such as described in Section 5.2), such as anti- svRNA Compounds, may result in the production of particles that lack one, or more, or any, or all genome segments, and that may comprise only one or more of HA, NA, and M2 proteins. Thus, the Compounds described herein may be used to generate replication-deficient virus-like particles. In some embodiments, such virus-like particles are able to enter cells but undergo limited or no subsequent replication.

[00421] Any substrate that can be used to propagate viruses may be used for producing attenuated Orthomyxoviruses, e.g., influenza viruses, in accordance with the foregoing methods. In some embodiments, a substrate with an improved ability to produce attenuated viruses is chosen. In certain embodiments, the substrate is a cell or cell line, such as, for example, an avian cell, chicken cell, African green monkey kidney cell {e.g., Vero cells), Madin-Darby canine kidney (MDCK) cell, MBCK cell, human respiratory epithelial cell (e.g., A549 cells), human embryonic kidney (HEK) 293 cell, calf kidney cell or mink lung cell. In a particular embodiment, the substrate is Vero cells. In certain embodiments, the substrate is an embryonated egg. In particular embodiments, the embryonated egg is an immature embryonated egg. In some embodiments, the embryonated egg is 6 to 10 days old, or 6 to 9 days old, or 6 to 8 days old, or 6 to 7 days old.

5.9.1 Methods of Vaccine Manufacture

[00422] Provided herein are uses of the Compounds described in Section 5.2 supra in the production Orthomyxoviruses for use as either live viral vaccines or inactivated viral vaccines. The production of a live vaccine may be preferred because multiplication in the host leads to a prolonged stimulus of similar kind and magnitude more similar to that occurring in natural infections, and therefore, confers substantial, long-lasting immunity.

[00423] In one embodiment, provided herein are methods for the manufacture of an Orthomyxovirus vaccine, comprising contacting a Compound that decreases the expression or activity of svRNAs with a substrate prior to, concurrently with, or subsequent to infection with the virus under conditions that permit production of replication-deficient virus, and purifying the replication-deficient virus. In some embodiments, the substrate is contacted with the Compound and then infected with an Orthomyxovirus. In some embodiments, the substrate is infected with the

Orthomyxovirus. Contact of the substrate with the Compound could be accomplished by exposing the substrate to the Compound, for example, by delivering the Compound into the substrate or by inducing the substrate to express the Compound. In some

embodiments, the substrate is a cell. In some embodiments, the substrate is an embryonated egg.

[00424] In some embodiments, provided herein are methods for the manufacture of an attenuated Orthomyxovirus for use as a vaccine, comprising contacting a Compound that decreases the expression or activity of svRNAs with a substrate infected with the virus under conditions that permit the replication of the virus, and purifying the attenuated virus. Also provided herein are methods for the manufacture of an attenuated Orthomyxovirus virus for use as a vaccine, comprising contacting a Compound that decreases the expression or activity of svRNAs with a substrate that permits the replication of the virus, infecting the substrate with the virus, and purifying the virus. An example of a Compound that decreases the activity or expression of svRNAs is an anti-svRNA Compound, such as described in Section 5.2. In a specific embodiment, provided herein is a method for the manufacture of an attenuated influenza A virus for use as a vaccine, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate that permits replication of influenza A virus, infecting the substrate with the influenza A virus, and collecting the virus. In another embodiment, provided herein is a method for the manufacture of an attenuated influenza B virus for use as a vaccine, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate that permits replication of influenza B virus, infecting the substrate with the influenza B virus, and collecting the virus. In another embodiment, provided herein is a method for the manufacture of an attenuated influenza C virus for use as a vaccine, comprising contacting an LNA anti-svRNA described in Section 5.2 with a substrate that permits replication of influenza C virus, infecting the substrate with the influenza C virus, and collecting the virus. In an alternative embodiment, the attenuated influenza A virus or influenza B virus or influenza C virus for use as a vaccine is produced by contacting the LNA anti-svRNA to a substrate infected with the virus, and collecting the virus. [00425] In certain embodiments, provided herein is a method for the manufacture of an attenuated Orthomyxovirus for use in a vaccine, comprising: (a) contacting a Compound that decreases the expression or activity of svRNAs with a substrate; (b) infecting the substrate with an Orthomyxovirus; and (c) purifying the virus from the substrate. In one embodiment, the Orthomyxovirus is attenuated prior to contact with the Compound. In another embodiment, the Orthomyxovirus is an Orthomyxovirus vaccine strain. In another embodiment, described herein is a method for the

manufacture of an inactivated Orthomyxovirus, comprising: (a) contacting a Compound that decreases the expression or activity of svRNAs with a substrate; (b) infecting the substrate with an Orthomyxovirus; (c) purifying the virus from the substrate; and (d) inactivating the virus. An example of a Compound that decreases the activity or expression of svRNAs is an anti-svRNA Compound, such as described in Section 5.2. In a specific embodiment, the Compound is an LNA anti-svRNA described in Section 5.2.

[00426] In certain embodiments, provided herein is a method for the manufacture of an attenuated Orthomyxovirus for use in a vaccine, comprising: (a) contacting a Compound that decreases the expression or activity of svRNAs with a substrate infected with an Orthomyxovirus; and (b) purifying the virus from the substrate. In one embodiment, the Orthomyxovirus is attenuated prior to contact with the Compound. In another embodiment, the Orthomyxovirus is an Orthomyxovirus vaccine strain. In another embodiment, described herein is a method for the manufacture of an inactivated Orthomyxovirus, comprising: (a) contacting a Compound that decreases the expression or activity of svRNAs with a substrate infected with an Orthomyxovirus; (b) purifying the virus from the substrate; and (c) inactivating the virus. An example of a Compound that decreases the activity or expression of svRNAs is an anti-svRNA Compound, such as described in Section 5.2. In a specific embodiment, the Compound is an LNA anti- svRNA described in Section 5.2.

[00427] In certain embodiments, the Orthomyxovirus is influenza virus. The influenza virus can be any type, strain, or subtype of influenza virus, for example, influenza A virus, influenza B virus or influenza C virus. In a specific embodiment, described herein is a method for the manufacture of an influenza A virus vaccine, comprising contacting an anti-svRNA Compound (e.g. , an LNA anti-svRNA

Compound) described in Section 5.2 with a substrate that permits replication of the influenza A virus, infecting the substrate with the influenza A virus vaccine strain and collecting the influenza A virus. In another embodiment, described herein is a method for the manufacture of an influenza B virus vaccine, comprising contacting an anti- svRNA Compound (e.g., an LNA anti-svRNA Compound) described in Section 5.2 with a substrate that permits replication of the influenza B virus, infecting the substrate with the influenza A virus vaccine strain and collecting the influenza B virus. In another embodiment, described herein is a method for the manufacture of an influenza C virus vaccine, comprising contacting an anti-svRNA Compound (e.g., an LNA anti-svRNA Compound) described in Section 5.2 with a substrate that permits replication of the influenza C virus, infecting the substrate with the influenza C virus vaccine strain and collecting the influenza C virus. In an alternative embodiment, the substrate is infected with the virus prior to contact with the anti-svRNA Compound.

[00428] In one embodiment, an attenuated influenza virus for use as a vaccine is produced in the presence of a Compound, such as described in Section 5.2, that decreases the expression or activity of an svRNA for a specific influenza virus genome segment. In specific embodiments, the Compound decreases the activity of the svRNA specific for a viral genome segment that is not required for packaging, such as influenza PB1 , PB2, or NA. For example, in one embodiment, the Compound decreases the expression or activity of an svRNA specific to the NA genome segment. In another embodiment, the Compound decreases the expression or activity of an svRNA specific to the PB1 genome segment. In another embodiment, the Compound decreases the expression or activity of an svRNA specific to the PB2 genome segment. In another embodiment, the Compound decreases the expression or activity of an svRNA specific to the HA genome segment. In one embodiment, the Compound is an anti-svRNA described in Section 5.2.1.3. In one embodiment, the Compound is an anti-svRNA described in Table 1.

[00429] In certain of the aforementioned methods for generating an Orthomyxovirus vaccine or an attenuated Orthomyxoviruses for use as a vaccine, the substrate is a cell or cell line, such as, for example, an avian cell, chicken cell, Vero cell, MDCK cell, MBCK cell, human respiratory epithelial cell (e.g., A549 cells), HEK 293 cell, calf kidney cell or mink lung cell. In one embodiment, the substrate is Vero cells. In certain

embodiments, the substrate is an embryonated egg. In particular embodiments, the embryonated egg is an immature embryonated egg. In some embodiments, the embryonated egg is 6 to 10 days old, or 6 to 9 days old, or 6 to 8 days old, or 6 to 7 days old. In some embodiments, a substrate that permits the growth of attenuated viruses is chosen. In certain of the aforementioned methods, the Orthomyxovirus is attenuated prior to exposure to the Compound. In certain embodiments, the Orthomyxovirus is inactivated subsequent to purification.

[00430] In certain embodiments of the aforementioned methods, the Orthomyxovirus is produced in the presence of a helper virus. In certain embodiments, the

Orthomyxovirus is produced in cells that have been engineered to express or produce one or more proteins that complement the loss of one or more genome segments. In certain embodiments, the substrate in which the Orthomyxovirus is produced is engineered to contain or express one or more Orthomyxovirus vRNAs, cR As, or a portion thereof, which may express one or more Orthomyxovirus mRNAs or protein. In one embodiment, the substrate contains the one or more Orthomyxovirus vRNAs, cRNAs, or a portion thereof on a plasmid. In one embodiment, the substrate contains the one or more Orthomyxovirus vRNAs, cRNAs, or a portion thereof as the result of an infection with another virus. In one embodiment, the one or more Orthomyxovirus vRNAs, cRNAs, or a portion thereof is an influenza virus vRNA, cRNA, or portion thereof. In one embodiment, the influenza virus vRNA, cRNA, or portion thereof encodes influenza NA. In one embodiment, the influenza virus vRNA, cRNA, or portion thereof encodes influenza HA. In one embodiment, the influenza virus vRNA, cRNA, or portion thereof encodes influenza PB1. In one embodiment, the influenza virus vRNA, cRNA, or portion thereof encodes influenza PB2.

5.9.2 Vaccine Formulations

[00431] Also provided herein are vaccine formulations comprising viruses, in particular, attenuated viruses, wherein the viruses have been grown or manufactured in accordance with a foregoing methods of Orthomyxovirus production. The virus used in the vaccine formulation may be selected from naturally occurring mutants or variants, mutagenized viruses or genetically engineered viruses. Attenuated strains of

Orthomyxoviruses for use in methods of vaccine production in accordance with the methods described in Section 5.9.1 supra can also be generated via reassortment techniques, or by using a combination of the reverse genetics approach and reassortment techniques. Naturally occurring variants include viruses isolated from nature as well as spontaneous occurring variants generated during virus propagation. The attenuated virus can itself be used as the active ingredient in the vaccine formulation. Alternatively, the attenuated virus can be used as the vector or "backbone" of recombinantly produced vaccines. To this end, recombinant techniques such as reverse genetics or combinations of reverse genetics and reassortment techniques may be used to engineer mutations or introduce foreign antigens into the attenuated virus used in the vaccine formulation. In this way, vaccines can be designed for immunization against strain variants, or in the alternative, against completely different infectious agents or disease antigens. Virtually any heterologous gene sequence may be constructed into the viruses for use in vaccines. Preferably, epitopes that induce a protective immune response to any of a variety of pathogens, or antigens that bind neutralizing antibodies may be expressed by or as part of the viruses. As such, provided herein are vaccine formulations comprising an attenuated Orthomyxovirus for treating or preventing any infectious disease or a symptom or disease associated therewith.

[00432] In some embodiments, the vaccine formulations provided herein comprise an Orthomyxovirus, wherein the attenuation results, in part, from a mutation in a gene required for efficient replication. Also provided herein are vaccine formulations comprised of an Orthomyxovirus wherein the attenuation results, in part, from a combination of one or more mutations in other viral genes. Vaccine formulations may include genetically engineered Orthomyxoviruses that have mutations in any gene that leads to attenuation and does not impair the ability of the host to launch an immune response against the virus, including but not limited to the influenza mutants with truncated or deleted NS1 genes described in issued patents U.S. Patent No. 6,468,544, issued October 22, 2002, U.S. Patent No. 6,866,853, issued March 15, 2005, and U.S. Patent No. 6,669,943, issued December 30, 2003 and U.S. Patent No. 7,588,768, issued September 15, 2009. The vaccine formulations may also be formulated using natural variants, such as the A/turkey/Ore/71 natural variant of influenza A, or B/201, and B/AWBY-234, which are natural variants of influenza B. Also provided herein are vaccine formulations comprising chimeric viruses.

[00433] In some embodiments, an Orthomyxovirus vaccine strain is further attenuated by production in the presence of a Compound in accordance with the methods described in Section 5.9.1 supra. In some embodiments, an influenza vaccine strain is further attenuated by production in the presence of a Compound in accordance with the methods described in Section 5.9.1 supra.

[00434] Vaccine formulations manufactured using the methods and Compounds described herein may be administered to a subject by a method known to one of skill in the art, including, but are not limited to, intranasal, intratracheal, oral, intradermal, intramuscular, intraperitoneal, intravenous, and subcutaneous routes. It may be preferable to introduce the virus vaccine formulation via the natural route of infection of the pathogen for which the vaccine is designed, or via the natural route of infection of the parental attenuated virus. Where a live influenza virus vaccine preparation is used, it may be preferable to introduce the formulation via the natural route of infection for the virus.

[00435] A vaccine formulation manufactured using the methods and Compounds described herein may comprise 10² - 10⁴ pfu, 10³ - 10⁴ pfu, 10⁴ - 10⁶ pfu, or 10⁴ - 5xl0⁶ pfu of virus, and can be administered once. Alternatively, a vaccine formulation may comprise 10² - 10⁴ pfu, 10³ - 10⁴ pfu, 10⁴ - 10⁶ pfu, or 10⁴ - 5xl0⁶ pfu of virus, and can be administered twice or three times, with an interval, for example, of 2 to 6 months between doses. Alternatively, a vaccine formulation may comprise 10² - 10⁴ pfu, 10³ - 10⁴ pfu, 10⁴ - 10⁶ pfu, or 10⁴ - 5xl0⁶ pfu of virus, and can be administered as often as needed to an animal, for example a mammal. In some embodiments, the mammal is a human. In some embodiments, a vaccine formulation described herein is administered to a patient described in Section 5.7.1 supra.

5.9.3 Combination Therapies of Vaccines and Compounds

[00436] Provided herein are therapies in which a subject is administered an

Orthomyxovirus vaccine, described herein or known in the art, in combination with a Compound described in Section 5.2 herein. In some embodiments, provided herein are therapies in which a subject is administered an influenza virus vaccine, described herein or known in the art, in combination with a Compound described in Section 5.2 herein. In one embodiment, the combination therapy comprises administration of a vaccine and a Compound that increases expression or activity of an svR A, for example, an svR A mimetic, such as a synthetic svRNA described in Section 5.2. In another embodiment, the combination therapy comprises administration of a vaccine and a Compound that decreases expression or activity of an svRNA, for example, an anti-svRNA Compound, such as an LNA anti-svRNA described in Section 5.2. These combination therapies may be administered in accordance with any of the methods described in Section 5.7 supra. Without being bound by any theory, these treatment regimens may have the advantage of increasing viral protein production {e.g., enhancing recognition by the immune system) and/or reducing replication of a vaccine strain in the subject, and may permit administration of a higher than typical dose of a vaccine. In some embodiments, the combination therapy is administered to subjects for whom a particular vaccination regimen is not recommended, for example, the very young (e.g. , patient less than 1 year old), the very old (e.g., patients 65 years old or older), or immunocompromised or immunosuppressed subjects.

5.10 Methods for Regulating Expression of Specific Orthomyxovirus Genome Segments

[00437] Also provided herein are methods for selectively modulating production of specific Orthomyxovirus genome segments or Orthomyxovirus mR A transcripts, which in turn can selectively modulate the production of specific Orthomyxovirus proteins. In specific embodiments, provided herein are methods for selectively modulating production of specific influenza virus genome segments or influenza virus mRNA transcripts, which in turn can selectively modulate the production of specific influenza virus proteins. In certain embodiments, a Compound that increases a specific segment's vRNA levels and decreases that segment's viral mRNA levels is used. In some embodiments, such a Compound increases the expression or activity of a specific svRNA. An example of such a Compound is an svRNA mimetic specific to a particular genome segment, such as a synthetic svRNA described in Section 5.2. In certain embodiments, a Compound that decreases a specific segment's vRNA levels and increases that segment's viral mRNA levels is used. In some embodiments, such a Compound decreases the expression or activity of a specific svRNA. An example of such a Compound is an anti-svRNA Compound that is specific to a particular genome segment, such as an LNA anti-svRNA Compound described in Section 5.2 (see, e.g., Table 1). In certain embodiments, a combination of Compounds is used to achieve the effect of modulating the expression or activity of one or more segment-specific svRNAs. In some embodiments, the Compound is specific for an influenza virus HA svRNA. In some embodiments, the Compound is specific for an influenza virus NA svRNA. In some embodiments, the Compound is specific for an influenza virus PB1 svRNA. In some embodiments, the Compound is specific for an influenza virus PB2 svRNA.

5.11 Use of Compounds in Cell Culture and as Disinfectants

[00438] Also provided herein is the use of Compounds, such as described in Section 5.2 supra, as ingredients in cell culture-related products in which it is desirable to modulate Orthomyxovirus, e.g., influenza virus, replication, for example, to have antiviral activity or to increase virus replication. In one embodiment, one or more of the Compounds described herein are added to cell culture media. In certain embodiments, Compounds that prove too toxic or are not used in subjects are added to cell culture- related products, such as media. Also provided is the use of the Compounds described herein as ingredients in disinfectants and soaps.

5.12 Kits

[00439] Also provided herein are kits that can be used in the foregoing methods. In one embodiment, a kit provided herein comprises a Compound, such as described in

Section 5.2, contained in an appropriate package. In one embodiment, the kit comprises the Compound and an Orthomyxovirus svR A. In one embodiment, the kit comprises the Compound and an influenza virus svRNA. In one embodiments, the kit comprises a library of compounds and an Orthomyxovirus svRNA. In one embodiment, the kit comprises an svRNA mimetic, such as a synthetic svRNA described in Section 5. 2 supra. In one embodiment, the kit comprises an anti-svRNA Compound, such as an

LNA anti-svRNA described in Section 5. 2 supra. In some embodiments, a kit further comprises a negative control and/or a positive control, in an appropriate package(s). In some embodiments, the kit further comprises an Orthomyxovirus, e.g. , an influenza virus (such as, e.g., influenza A virus, influenza B virus, or influenza C virus), and/or constructs for generating the Orthomyxovirus. In certain embodiments, the kit further comprises a reporter construct, in an appropriate package. In some embodiments, the kit comprises in different containers a Compound and an Orthomyxovirus vaccine. In one embodiment, the kit comprises in different containers a Compound and an influenza virus vaccine. In specific embodiments, the kit contains instructions for use.

6. EXAMPLE 1: IDENTIFICATION OF SMALL RNA EXPRESSED BY

INFLUENZA A VIRUS AND COMPOUNDS THAT MODULATE THE SAME

[00440] This example demonstrates that influenza A virus expresses a small RNA which is involved in regulating the switch from transcription to replication of the viral genome. This example also demonstrates that compounds that modulate the function or expression of svRNA can be used to inhibit production of influenza virus particles.

6.1 MATERIALS AND METHODS

Cell culture and viral infections. Human alveolar basal epithelial (A549) cells, African green monkey kidney (Vero) cells, human embryonic kidney (HEK) 293 cells, and Madin-Darby canine kidney (MDCK) cells were grown in complete media containing Dulbecco's minimal essential medium (DMEM, GIBCO) with 0.2% Sodium Bicarbonate (Sigma), 10% fetal bovine serum (PAA) and 1% penicillin/streptomycin (Mediatech). Human IFNP treatments were performed at a concentration of 50 units/mL (ATCC, BEI Resources). Virus infections of A549 cells were performed as previously described (TenOever et al., 2007). Briefly, infections were performed at a multiplicity of infection (MOI) of 1 for the indicated times; virus infections of HEK293 cells were performed at an MOI of 0.1 for the indicated times; virus infections of MDCK cells were performed with 200 μΐ of harvested supernatant and harvested 24 hours post infection (hpi), unless otherwise indicated. Influenza A virus infections were performed with the A/Puerto Rico/8/34 (A/PR/8/34) strain unless otherwise indicated. H5N1 and H3N2 infections were performed using A/Vietnam/ 1203/2004 and

A/Wyoming/03/2003, respectively. Vesicular Stomatitis Virus (VSV) infections were performed with the Indiana VSV strain. Influenza A virus was propagated in 10 day old fertilized chicken eggs and titered by plaque assay in MDCK cells. VSV was propagated and tittered by plaque assay in Vera cells.

[00441] Deep Sequencing. Deep sequencing was performed on human alveolar basal epithelial (A549) cells infected with influenza A/PR/8/34 at a MOI of one for 12 hrs. RNA smaller than 40 nucleotides was isolated from total RNA samples using a

FlashPAGE fractionator (Ambion) and SOLiD small RNA libraries were prepared using the SOLiD Small RNA Expression Kit (Ambion). Briefly, RNA adaptors were ligated to small RNAs, reverse transcription was performed with ArrayScript (Ambion), and the cDNA was treated with RNase H. The cDNA library was amplified by PCR using 18 cycles and size-selected for -105-130 base pair products on a 6% PAGE gel. The resulting libraries were quantified on a Flashgel (Lonza) using a Quant Ladder (Lonza) and assayed for quality on a Bioanalyzer (Agilent). The libraries were amplified onto SOLiD sequencing beads by emulsion PCR using the SOLiD ePCR Kit (Applied Biosystems). The templated beads were isolated, enriched, and were deposited into an eighth of a SOLiD sequencing slide (Applied Biosystems) using the SOLiD Bead Deposition Kit (Applied Biosystems). The slides were sequenced on a SOLiD Version 3 (Applied Biosystems). Color-space base calling and quality value assignment were performed on the SOLiD on-instrument cluster. The resulting reads were processed using the SOLiD Small RNA Analysis Tool (Applied Biosystems). Base-space reads were generated from color-space reads using the SOLiD System GFF Conversion Tool. The sequences were translated from color-space to sequence space allowing up to 2 mismatches to the viral genome segments. The sequences, and mappings were stored in a relational database (MySQL, http://www.mysql.com) and analyzed using custom scripts written in Perl. The density of mappings across the segments allowed for the identification if the peaks at the ends of the segments. The ends of segments were aligned against each other and a sequence logo was constructed

(http://weblogo.berkeley.edu/) allowing for the identification of a conserved motif.

[00442] Synthetic svRNA and anti-svRNA LNA oligonucleotides. To exogenously deliver svRNA, a T7 RNA polymerase transcript was synthesized using the Ambion T7 MegaScript kit. Each specific DNA template oligo was preceded with a minimal T7 promoter (5 '-TAATACGACTCACTATAGGG-3 ') as per the manufacturer's instructions. The transcribed oligonucleotides were double stranded versions of the following sequences: svRNA: 5'- AGTAGAAACAAGGGTGTTTTTTTGTCAC-3', scrambled: 5 ' -AGAGCAGAAGAACGGC ATC AAGGTGAAC-3 ' . All transcribed RNAs were purified by Qiagen RNeasy purification prior to transfection. For Northern blot analysis, HEK293 cells were mock transfected or transfected with 2μg T7 transcribed scrambled RNA or svRNA as previously described and total RNA extracted 24 hpt. For immunostimulation, A549 cells were mock treated, infected with VSV, or transfected with 2μg of polylC, T7 transcribed scrambled RNA, or T7 transcribed svRNA. 6 hours post treatment, cell extracts were harvested for Western blot analysis. For quantitative RT-PCR, HEK293 cells were mock transfected, transfected with 2(^g scrambled RNA oligo, or transfected with 2(^g svRNA oligo. Transfected HEK293 cells were subsequently infected with A/PR/8/34 at an MOI of 0.1 12 hpt in complete media. Total RNA was harvested 16 hpi with Trizol (Invitrogen), reverse transcribed with Superscript II (Invitrogen), and analyzed by QRT-PCR. To block endogenously produced svRNA, a locked nucleic acid (LNA) anti-svRNA corresponding to segment 4 svRNA was synthesized by Exiqon (sequence:

AGGAAAAACACCCUUGUUUCUACU) and resuspended in DEPC-treated H₂0. An LNA scrambled control (sequence above) was synthesized as well. For infection kinetics, HEK293 cells were mock transfected, transfected with 50 nM scrambled LNA, or transfected with 50 nM anti-svRNA. 12 hpt, cells were infected with A/PR/8/34 at an MOI of 0.1 in complete media, and protein was harvested at indicated times and analyzed by Western blot. Supematants were collected at indicated time points and 200 μΐ was used to infect MDCK cells in the presence of TPCK-trypsin. 24 hpi protein was harvested and analyzed by Western blot. For segment specificity, HEK293 cells were mock transfected, transfected with 100 nM scrambled LNA, or transfected with 25 nM, 50 nM, or 100 nM anti-svRNA. 12 hpt, cells were infected with A/PR/8/34 at an MOI of 0.1 in complete media. Supematants were collected at indicated time points and titers determined by standard plaque assay in MDCK cells. Protein was harvested 48 hpi and analyzed by Western blot.

[00443] RNA-dependent RNA polymerase Firefly Luciferase reporter assay.

HEK293 cells were transfected with protein expression plasmids for the influenza A RNA-dependent RNA polymerase (RdRp) components (12.5 ng PB2, 31.25 ng PB1, 31.25 ng PA, and 125 ng NP), 10 ng constitutively expressed Renilla luciferase, and 50 ng RNA Polymerase I-driven firefly Luciferase reporter flanked by influenza A virus vRNA non-coding regions corresponding to segment 5, in the presence or absence of synthetic svRNA (conditions include mock, 1 ug scrambled, 0.1 ug svRNA, 0.5 ug svRNA, or 1 ug svRNA). Trans fections were performed with Lipofectamine 2000 (Invitrogen) in Optim-Mem (GIBCO). The Dual-Luciferase® Reporter Assay

(Promega) kit was used to determine firefly luciferase activity 24 hours post

transfection. Plotted values are expressed as a ratio of firefly Luciferase activity to firefly Renilla activity, averaged over three replicates, and presented as a percentage of activity as compared to scrambled control. A two-tailed student's t-test was used to determine p-values as compared to scrambled control, values below 0.05 were considered significant, and error bars reflect +/- standard deviation of the three replicates.

[00444] Quantitative PCR. Quantitative PCR was performed on indicated cDNA samples using KAPA SYBR® FAST qPCR Master Mix (KAPA Biosystems) and the Mastercycler ep realplex (Eppendorf). AACT values were calculated over replicates using tubulin as the endogenous housekeeping gene and mock infected or mock transfected samples as the calibrator in respective experiments. Values represent the fold difference for each condition as compared to mock infected or transfected samples. Error bars reflect +/- standard deviation of fold induction. Primers used for QRT-PCR are included in Table 2, below.

[00445] Western blot analysis. Whole-cell extracts (WCE) were obtained using standard NP-40 lysis buffer (0.25% NP-40 detergent, 50 mM Tris (pH 7.4), 150 mM NaCl, 5 mM EDTA, 10% glycerol, 30 mM NaF, and 40 mM β-glycerophosphate). Briefly, cell pellets were incubated in lysis buffer for 30 minutes and soluble fractions were measured by standard Bradford assay after a 10 minute spin at 13000 rpm. 100 ug of WCE was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% polyacrylamide gels. Following electrophoresis, proteins were transferred to Hybond-C nitrocellulose membrane (Amersham) in a buffer containing 30 mM Tris, 200 mM glycine, and 20% methanol for 2 h at 4°C. The membrane was blocked in 5% dried milk in phosphate-buffered saline (PBS) for 1 h at room

temperature and then probed with indicated antibodies. Antibodies to A/PR/8/34 HA, NP, and NS1 were all kind gifts from Dr. P. Palese (Mount Sinai School of Medicine, New York, New York). The antibody for beta-actin was purchased from AbCam (ab8226-100). Western blots were all developed using the same conditions. Primary antibodies were used at a concentration of 1 ug/mL. Incubations were done overnight at 4°C, and incubation mixtures were washed in PBS three times for a total of 15 min. Following washes, the membrane was incubated with peroxidase-conjugated goat anti- rabbit antibody (GE) at a dilution of 1 :5000 for 1 hr at room temperature. Following the incubation with the secondary antibody, the membrane was washed again for 15 min and then visualized with the enhanced chemiluminescence (ECL) detection system as recommended by the manufacturer (Millipore).

6.2 RESULTS

[00446] To investigate if influenza A virus produced small RNAs, deep sequencing on infected lung epithelial cells 12 hpi was performed and small RNA fractions (<40 nt) from these cells were compared to mock infected extract (Figure 1A). Comparing over four million unique reads, it was found that 0.12% of the sequenced RNA within this small fraction derived specifically from influenza A virus transcripts (Figure IB).

Moreover, while 70%> of these sequences mapped with equal distribution across each of the viral segments, an enrichment of 5' vRNA ends accounted for the remaining 30%. Influenza A virus-derived svRNAs ranged from 20 nt to 30 nt in length, were unique to each of the 8 segments at positions 14-16 and beyond the 21^st base, and terminated within seven bases of the polyU tract (Figure 1C). Moreover, as these RNA species undoubtedly contain a 5 ' triphosphate, their inefficient ligation during sample preparation would result in a gross underestimate of the percentage of svRNA to total RNA captured during sequencing (Nandakumar et al, 2006).

[00447] To determine whether svRNA was produced at detectable levels, kinetic studies in infected lung epithelial cells were performed. In order to monitor total svRNA produced during the course of infection, a pan-specific probe, capable of hybridizing to each of the eight 5' vRNA segments, was generated. Northern blot analysis for total svRNA expression demonstrated inducible levels of small RNA products of -22 and -26 nucleotides from infected extract; these species were detectable as early as 8 hpi and increased in concentration for the duration of the infection (Figure 2A). To ensure that svRNA was specific to influenza A virus and not a virus- or interferon (IFN)-inducible miRNA, total RNA from Vesicular Stomatitis Virus (VSV) and ΙΚΝβ-treated (IFN-I) lung epithelial cells was analyzed. Northern blot analysis demonstrated the appearance of influenza A virus-specific svRNAs of 22 and 26 nucleotides that was absent in both VSV and IFN-I treated samples (Figure 2B).

[00448] To investigate how svRNA species are generated, the viral components required for its production were determined. Exogenous expression of bi-directional based plasmids, producing DNA-dependent RNA Polymerase I (Pol-I)- vRNA and Pol- II-dependent mRNA from the same segment, generated robust production of svRNA when all 8 segments were transfected into human fibroblasts (Figure 2C). In contrast, removal of segments 1(PB2), 2(PB1), 3(PA), or 8, which encodes the non-structural protein (NS1) as well as the nuclear export protein (NEP), resulted in a complete loss of svRNA; whereas removal of segments 4 and 6, encoding hemagglutinin (HA) and neuraminidase (NA), resulted in no significant changes in svRNA levels. Loss of segment 7, encoding the matrix proteins Ml and M2, demonstrated a decrease in svRNA production. Interestingly, loss of segment 5, which encodes NP, resulted in a loss of the two major species of svRNA but the production of two additional fragments of -32 and -42 nucleotides (Figure 2C). Taken together, these data confirm that influenza A virus produces a specific small RNA during infection in an RdRp-dependent manner, and indicates a possible structural role for NP, and an unknown requirement for segment 8 vRNA, NS1, and/or NEP. Furthermore, svRNAs were detected from H1N1

(A/PR/8/34), H5N1 (AVN/1203/04), and H3N2 (A/Wyoming/2003/3) infections in Madin-Darby Canine Kidney (MDCK) cells (Figure 2D).

[00449] Since NS 1 of influenza A virus is known to stimulate viral protein expression (Salvatore et al., 2002), a requirement for segment 8 may reflect an indirect role in the generation of svRNAs by enhancing RdRp expression. Alternatively, it is possible that svRNAs, which contain a 5' triphosphate, are pathogen associated molecular patterns (PAMPs), recognized by the RNA helicase RIG-I, and viral replication therefore requires the antagonistic activity of NSl(Pichlmair et al., 2006). To determine the cellular response to svRNA, a T7-derived svRNA mimetic was transfected into cells in the absence of infection. Despite robust levels (Figure 3A), and the exposed 5' triphosphate, svRNA failed to induce RIG-I mediated IRF3 phosphorylation as compared to VSV infection or the double-stranded RNA (dsRNA) mimetic polylC

(Figure 3B). These results are consistent with the model that RIG-I requires both an exposed 5' triphosphate as well as dsRNA formation (Schmidt et al, 2009).

Quantitative RT-PCR was also performed on the interferon-and virus-inducible transcription factor, IRF7 (Figure 3C). While levels of IRF7 following influenza A virus (Flu), VSV, Newcastle Disease virus (NDV), or IFN treatment resulted in increased levels of IRF7, exogenous expression of vRNA did not induce significant antiviral activity (Figure 3C). Thus, it can be concluded that svRNAs have no inherent immunostimulatory properties and that the requirement for segment 8 may reflect the need for enhancement of RdRp expression in the production of svRNA.

[00450] These results demonstrate that influenza A virus produces a distinct small RNA late in infection. As this RNA does not appear to be a by-product of the cell's antiviral defenses, it was investigated whether it is a functional component of the viral life cycle. Past studies have demonstrated that the last 15 nucleotides of the 5' end of the vRNA, delivered in trans, are required for RdRp activity on a template containing only the 3 ' vRNA end, indicating that both transcription and replication require a double stranded promoter (Fodor et al., 1994). As the switch from primary transcription to replication also demands the linearization of the genome without disruption of this promoter, it was surmised that svRNA may act as a 5 ' end surrogate thereby permitting genome replication.

[00451] To analyze the impact of svRNA in RNA transcription and replication, a synthetic RNA capable of hybridizing to each of the eight viral segments was generated, and transfected with an RdRp-dependent luciferase construct containing the viral 5 ' and 3' vRNA ends of segment five (Perez et al, 2009). Expression of NP, PA, PB1, and PB2 induced robust luciferase activity, which was moderately decreased with the delivery of scrambled RNA (Figure 3D). In contrast to this non-specific inhibition, addition of equal amounts of svRNA resulted in an approximately 50% decrease in luciferase activity. To determine whether the dampened luciferase activity was the result of decreased transcription and increased replication, scrambled RNA or svRNA was transfected and a de novo infection with influenza A/PR/8/34 H1N1 virus was performed and the levels of NEP mRNA versus full length segment 8 RNA were analyzed (Figure 3E). Quantification of NEP mRNA levels, which excludes vRNA and cRNA, indicated a 20% decrease in transcription in the presence of svRNA. In contrast, analysis of full-length segment 8 RNA, which does not distinguish vRNA, cRNA, and/or mRNA, exhibited a 40% increase following transfection of svRNA, indicating that svRNA promotes vRNA/cRNA synthesis at the expense of transcription.

[00452] To further delineate the roles of PA, PB 1 , PB2, NP, NS 1 , and/or NEP in svRNA production, exogenous plasmids encoding only PB1, PB2, and PA mRNA were transfected alongside plasmids encoding segment 4 or segment 8 vRNA (Figure 3F). Transient expression of these constructs, in the absence of virus infection, resulted in a predominant RNA species of -42bp from segment 4, and 40bp from segment 8, with low levels of svRNA. As this banding pattern was similar to that observed following the removal of NP (Figure 2C), PB1, PB2, PA and NP protein were exogenously expressed with the same two vRNA segments. These assays resulted in the generation of svRNA, but did not result in a loss of the 42 and 40bp products. Thus, NP appeared to stabilize the production of these fragments, as well as of svRNA. In addition, these results did not change following RdRp-dependent expression of NS1 or NEP from the vRNA of segment 8 (Figure 3F, lane 8) or when NS 1 was expressed independently in context of segment 4 (Figure 3F, lane 10). Taken together, these results suggest that segment 8, perhaps due to its shorter length, may produce more svRNA in the context of this in vitro model system and that NS 1 and NEP are not required for svRNA generation.

[00453] To ascertain whether the bias towards transcription over replication in the absence of soluble svRNA could be observed, a locked nucleic acid (LNA™) anti- svRNA, complementary to segment 4 svRNA (Anti-svRNA) (Wahlestedt, et al, 2000), was synthesized. In contrast to transfection of an svRNA mimetic, which decreased viral mRNA while increasing vRNA/cRNA, anti-svRNA should irreversibly bind endogenous svRNA and thereby prevent the switch to viral replication. Further, anti- svRNA had minimal impact on HA, NP, or NS1 transcription following the transfection of scrambled- or anti-svRNA during the first 24 hours of infection at an multiplicity of infection (MOI) of 0.1 (Figure 4A). Despite normal viral protein production in anti- svRNA treated samples, the supernatant from these infections demonstrated a dramatic decrease in viral progeny when applied to target MDCK cells. As efficient influenza A virus egress requires all eight segments (Noda et al, 2006; Fujii et al, 2005; Marsh et al, 2008), loss of HA, NP and NS1 following infection with the supernatant derived from the original anti-svRNA transfections suggests a defect in vRNA packaging due to inhibition of svRNA. In order to determine whether the svRNA specifically inhibited HA svRNA, increasing concentrations of anti-svRNA were transfected into infected cells to determine whether late time points beyond 48 hrs would result in a specific loss of vRNA and subsequent HA production (Figure 4B). In comparison to no treatment, or delivery of a scrambled LNA-oligo, the anti-svRNA induced a dramatic loss of HA expression while having no significant impact on NP or NS1 protein levels (Figure 4B). Furthermore, viral growth curves in the presence of either scrambled or HA-specific anti-svRNA corroborated the loss of viral protein production as titers were reduced by 80% (Figure 4C). Taken together, the data presented support a model in which svRNA expression impacts the transition from transcription to replication and further indicates that the svRNA may function in a segment- specific manner. In the model's most simplistic form, production of svRNA would act in trans on the 3 ' end of the vRNA to reconstitute the RdRp promoter, thereby releasing the segment's 5' end to promote genome replication (Figure 4D). Alternatively, svRNA may directly associate with the RdRp, allowing it to act as a holoenzyme that can act upon the 3' end of the vRNA in the absence of the panhandle/corkscrew structure.

[00454] The generation of a small RNA responsible for regulating the virus life cycle represents a new paradigm in virus biology. The identification of svRNAs elucidates a unique mechanism by which influenza A virus can control both transcription and replication.

7. EXAMPLE 2: IDENTIFICATION OF SMALL RNA EXPRESSED BY

INFLUENZA A VIRUS AND COMPOUNDS THAT MODULATE THE SAME

[00455] This example demonstrates that influenza A viruses express small RNAs that are involved in regulating the switch from transcription to replication of the viral genome. This example also demonstrates that compounds that modulate the function or expression of svRNAs can be used to inhibit production of influenza virus particles.

7.1 Experimental Procedures

[00456] Cell culture and viral infections. Human alveolar basal epithelial (A549) cells, African green monkey kidney (Vero), human embryonic kidney (HEK) 293 cells, and Madin-Darby canine kidney (MDCK) cells were grown in complete media containing Dulbecco's minimal essential medium (DMEM, GIBCO) with 0.2% Sodium Bicarbonate (Sigma), 10% fetal bovine serum (PAA) and 1% penicillin/streptomycin (Mediatech). Human ΙΚΝβ treatments were performed at a concentration of 50 units/mL (ATCC, BEI Resources). Virus infections of A549s were performed as previously described (Tenoever et al., 2007). Briefly, infections were performed at a multiplicity of infection (MOI) of 1 for the indicated times; virus infections of HEK293s were performed at an MOI of 10 for primer extension and an MOI of 0.1 for the remaining for the indicated times; virus infections of MDCKs were performed with 200 μΐ of harvested supernatant and harvested 24 hours post infection (hpi); and virus infections of embryonated chicken eggs were performed with 100 PFU of virus and harvested 48 hpi; unless otherwise indicated. Influenza A virus infections were performed with A/Puerto Rico/8/34, A/Panama/2007/99, or A/Vietnam/ 1203/04 (HA with poly basic cleavage site disrupted; Steel et al, 2009) as indicated, and Vesicular Stomatitis virus infections were performed with Indiana VSV. Influenza A viruses were propagated in 10 day old fertilized chicken eggs and titered by plaque assay in MDCK cells. VSV was propagated and plaqued in Vero cells.

[00457] Deep Sequencing. Deep sequencing was performed on human alveolar basal epithelial cells (A549) untreated or infected with influenza A/PR/8/34 at a MOI of one for 12 hrs. RNA smaller than 40 nucleotides was isolated from total RNA samples using a FlashPAGE fractionator (Ambion) and SOLiD small RNA libraries were prepared using the SOLiD Small RNA Expression Kit (Ambion). Briefly, RNA adaptors were ligated to small RNAs, reverse transcription was performed with ArrayScript (Ambion), and the cDNA was treated with RNase H. The cDNA library was amplified by PCR using 18 cycles and size-selected for -105-130 base pair products on a 6% PAGE gel. The resulting libraries were quantified on a Flashgel (Lonza) using a Quant Ladder (Lonza) and assayed for quality on a Bioanalyzer (Agilent). The libraries were amplified onto SOLiD sequencing beads by emulsion PCR using the SOLiD ePCR Kit (Applied Biosystems). The templated beads were isolated, enriched, and were deposited into an eighth of a SOLiD sequencing slide (Applied Biosystems) using the SOLiD Bead Deposition Kit (Applied Biosystems). The slides were sequenced on a SOLiD Version 3 (Applied Biosystems). Color-space base calling and quality value assignment were performed on the SOLiD on-instrument cluster. The resulting reads were processed using the SOLiD Small RNA Analysis Tool (Applied Biosystems). Base-space reads were generated from color-space reads using the SOLiD System GFF Conversion Tool. The sequences were translated from color-space to sequence space allowing up to 2 mismatches to the viral genome segments. The sequences, and mappings were stored in a relational database (MySQL, http://www.mysql.com) and analyzed using custom scripts written in Perl. The density of mappings across the segments allowed us to identify the peaks at the ends of the segments. The ends of segments were aligned against each other and a sequence logo was constructed (http://weblogo.berkeley.edu/) allowing the identification of a conserved motif.

[00458] svRNA Detection. Detection of svRNA was performed by Northern blot in a similar manner as that previously described for miRNAs (Pall and Hamilton, 2008). Briefly, RNA was resolved on a 15% denaturing polyacrylamide gel containing 7.5M urea and 20 mM MOPS-NaOH (pH 7) and transferred to Hybond NX membrane (Amersham) in DEPC-treated water at 350 mA for 60 minutes. Chemical crosslinking was performed per the above-mentioned protocol for one hour at 60°C, blocked for one hour at 65°C in 6xSSC, 7% SDS, and subsequently probed with radiolabeled

oligodeoxyribonucleotides. Probes were designed as follows: pan specific DNA oligo complimentary to the 5' non-coding region of influenza A viral RNA: 5'- AAAAANNNCCTTGTTTCTACT-3' and control anti-U6 5'-

GCC ATGCTAATCTTCTCTGTATC-3 ' . T4 polynucleotide kinase (Invitrogen) and [γ- 32-PJATP (Perkin Elmer) were used to radiolabel the probes, which were subsequently purified by Sephadex G-25 columns (GE Healthcare), and resulting blots were imaged overnight by autoradiogram. Depicted Northern blots are representative results of multiple experiments.

[00459] Plasmid-based svRNA production. For plasmid-based generation of svRNA, bi-directional plasmids encoding each of the 8 viral segments of A/PR/8/34 driven by both RNA polymerase I and RNA pol II were utilized (pDZl-8, gift from Dr. P. Palese, Mount Sinai School of Medicine, New York, NY), resulting in the production of vRNA and mRNA respectively. HEK293s were mock transfected or transfected with indicated combinations of bidirectional plasmids (1 ug DNA each segment) using Lipofectamine 2000 (Invitrogen) in Opti-Mem media (GIBCO). Trans fections were performed in duplicate for total protein and RNA isolation at 24 hrs post transfection. Total RNA was harvested 24hpt and analyzed by Northern blot or DNase treated (DNase I, Roche), reverse transcribed with Superscript II (Invitrogen), and analyzed by QRT-PCR. For polymerase reconstitution and segment 4- and 8- specific production of svRNA,

HEK293s were transfected as above with the influenza A virus RdRp protein expression plasmids (PB2, PB1, PA, +/- NP, 3-5 ug each), with or without NS1 protein expression vector (3 ug), segment 4 vRNA-producing vector (3 ug), or segment 8 vRNA-producing vector (3 ug). Total RNA was extracted 24hpt and analyzed by Northern blot.

[00460] RNA-dependent RNA polymerase luciferase reporter assay. HEK293s were transfected with protein expression plasmids for the influenza A RNA-dependent RNA polymerase (RdRp) components (12.5 ng PB2, 31.25 ng PB1, 31.25 ng PA, and 125 ng NP), 10 ng constitutively expressed firefly renilla, and 50 ng RNA Polymerase I-driven firefly luciferase reporter flanked by influenza A virus vRNA non-coding regions corresponding to segment 5, in the presence or absence of synthetic svRNA (conditions include mock, 1 ug scrambled, 0.1 ug svRNA, 0.5 ug svRNA, or 1 ug svRNA).

Transfections were performed with Lipofectamine 2000 (Invitrogen) in Optim-Mem (GIBCO). The Dual-Luciferase® Reporter Assay (Promega) kit was used to determine firefly luciferase activity 24 hours post transfection. Plotted values are expressed as a ratio of firefly luciferase activity to firefly renilla activity, averaged over three replicates, and presented as a percentage of activity as compared to scrambled control. A two- tailed student's t-test was used to determine p-values as compared to scrambled control, values below 0.05 were considered significant, and error bars reflect +/- standard deviation of the three replicates.

[00461] Quantitative PCR. Quantitative PCR was performed on indicated cDNA samples using KAPA SYBR® FAST qPCR Master Mix (KAPA Biosystems) and the Mastercycler ep realplex (Eppendorf). AACT values were calculated over replicates using tubulin as the endogenous housekeeping gene and mock infected or mock transfected samples as the calibrator in respective experiments). Values represent the fold difference for each condition as compared to mock infected or transfected samples. Error bars reflect +/- standard deviation of fold induction. Primers used for QRT-PCR can be found in Table 2 below.

[00462] Primer Extension. For analysis of HA mRNA, cRNA and vRNA, primer extension was performed on HEK293s that were mock transfected, transfected with 100 nM scrambled LNA, or transfected with 25 nM scrambled LNA, or HA-, NA-, or NS- anti-svRNA where indicated. 12 hpt, cells were infected with A/PR/8/34 at an MOI of 10 in Opti-mem (Gibco), and total RNA was harvested at the indicated times and subjected to RT-PCR with an HA positive sense specific primer:

TTTCCGTTGTGGCTGTCTTC or other previously published primers where indicated. The resulting cDNA was resolved by 6% denaturing gel electrophoresis, transferred to Hybond-N nylon membrane (Amersham) at 350 mA for 60 minutes, UV crosslinked at 200,000 μΤ/CM², and viewed by autoradiogram.

Table 2. Primers used for Q RT-PCR. Primer sequences for quantitative RT- PCR experiments.

[00463] Western blot analysis. Whole-cell extracts (WCE) were obtained using standard NP-40 lysis buffer (0.25% NP-40 detergent, 50 mM Tris (pH 7.4), 150 mM NaCl, 5 mM EDTA, 10% glycerol, 30 mM NaF, and 40 mM β-glycerophosphate). Briefly, cell pellets were incubated in lysis buffer for 30 minutes and soluble fractions were measured by standard Bradford assay after a 10 minute spin at 13000 rpm. 100 ug of WCE was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on 10%> polyacrylamide gels. Following electrophoresis, proteins were transferred to Hybond-C nitrocellulose membrane (Amersham) in a buffer containing 30 mM Tris, 200 mM glycine, and 20% methanol for 2 h at 4°C. The membrane was blocked in 5% dried milk in phosphate-buffered saline (PBS) for 1 h at room

temperature and then probed with indicated antibodies. Antibodies to A/PR/8/34 HA, NP, and NS1 were all gifts from Dr. P. Palese (Mount Sinai School of Medicine, New York, NY). The membrane was blocked in 5% dried milk in phosphate -buffered saline (PBS) for 1 h at room temperature and then probed with indicated antibodies.

Antibodies to RIG-I and PA were gifts from Dr. A. Garcia-Sastre (Mount Sinai School of Medicine, New York, NY). The antibody for beta-Actin was purchased from AbCam (ab8226-100). Western blots were all developed using the same conditions.

[00464] Primary antibodies were used at a concentration of lug/mL. Incubations were done overnight at 4°C, and incubation mixtures were washed in PBS three times for a total of 15 min. Following washes, the membrane was incubated with peroxidase- conjugated goat anti-rabbit antibody (GE) at a dilution of 1 :5000 for 1 hr at room temperature. Following the incubation with the secondary antibody, the membrane was washed again for 15 min and then visualized with the enhanced chemiluminescence (ECL) detection system as recommended by the manufacturer (Millipore).

7.2 Results

7.2.1 Small RNA Deep Sequencing from Influenza A Virus

Infected Cells

[00465] Given the need for a double stranded RNA promoter in the context of the influenza virus single stranded genome, a small RNA could serve to reconstitute promoter functionality. In contrast, a small RNA could be incorporated into the RdRp to modify its replicase activity, similar to many cellular RNP complexes.

[00466] To investigate if influenza A virus produced small RNAs that function during replication, deep sequencing on both mock treated and influenza A/PR/8/34 (H1N1) virus-infected lung epithelial cells was performed. 12 hours post-infection (hpi), total RNA was resolved by polyacrylamide electrophoresis and RNA, 10-40 nucleotides in length, was isolated and processed for SOLiD-based deep sequencing (Shendure and Ji, 2008). Comparing over four million unique reads, it was found that greater than 90% of the sequences were composed of cellular microRNAs (miRNAs) (Bartel, 2009). Very little modulation in miRNA levels in response to virus infection was observed, with the significant changes that were observed being limited to only miRNAs that were found in low copy number (less than 0.1% of total miRNAs)(Figures 6A and 6B). The species of miRNAs that did demonstrate changes in expression in response to virus infection were either undetectable by Northern blot or demonstrated such modest changes that it is doubtful they would impede virus replication or significantly affect the cellular transcriptome (Brown et al., 2007; Perez et al., 2009).

[00467] In addition to cellular miRNAs, a percentage of the total captured sequences in infected cells derived directly from influenza A virus (Table 3).

Table 3. Total reads and percentage of reads for influenza A virus specific and 5' vRNA specific (svRNA) captured sequences.

[00468] While most of these small RNAs comprise viral breakdown products which are equally distributed across the viral genome in both polarities, 30% of the influenza sequences captured in this size fraction were significantly enriched for the 5 ' end of the vRNA (Figure 5B and Table 3; see also Figures 6 A and 6B). Influenza A virus- derived small RNAs (svRNAs) ranged from 22 nucleotides (nt) to 27 nt in length, were unique to each of the eight segments at positions 14-16 and beyond the 21st base, and terminated 3-4 bases from the polyU tract (Table 4).

Table 4. Consensus sequences and lengths for svRNA captured sequences per influenza A virus segment.

Consensus svRNA: S'-AGUAGAAACAAGGNNNUUUUUNNNNNNN-S' Length (nt)

Segment 1 : S'~AGUAGAAACAAGGUC6UUUUUUUAAA 3' 27

Segment 2; 5'-AGUAGAAACAAGGCAUUUUUUCAUG-3' 25

Segment 3: 5'~AGUAGAAACAAGGUACUUUUUUGGA-3' 25

Segment 4: 5'~AGUAGAAACAAGGGUGUUUUUUUCCUC-3' 27

Segment 5: S -AGUAGAAACAAGGGUAUUUUUUUCUUU-S' 27

Segment 6: 5^f-AGUAGAAACAAGGAGUUUUUUGAAC-3' 25

Segment 7: S'-AGUA6AAACAAGGUAGUUUUUUACU-3' 25

Segment 8: S'-AGUAGAAACAAGGGUGUUUUUUAUU-S' 25

[00469] Moreover, as these RNA species undoubtedly contain a 5 ' triphosphate, their inefficient ligation during sample preparation would result in a gross underestimate of the percentage of svRNA to total RNA captured during sequencing (Nandakumar et al., 2006). Overall, the predominant species lengths were 25 (Segments 2, 3, 6, 7, and 8) and 27 nts (Segments 1, 4, and 5) although lengths ranging from 22 to 28 nts were also present (Table 4 and data not shown).

[00470] Of the eight segments that comprise the influenza A virus genome, segment 3 svRNA was the most represented (41.24% of segment-specific reads), with segment 7 svRNA being the least captured (9.15%) (Table 5). While svRNA segment

representation was on average 30%>, the under representation of segment 7 was largely due to a second small RNA that was abundant at the termination site of the M2 transcript (Figure 5B).

Table 5. Total reads and percentage of reads per segment for influenza A

virus specific and 5' vRNA specific (svRNA) captured sequences, as well as each segments' contribution (as a percentage) to the total svRNA population.

7.2.2 Characterization of svRNA Expression

[00471] To ascertain whether svRNA was produced at significant levels for detection by Northern blot, and to determine the kinetics of svRNA synthesis, time course studies in infected lung epithelial cells were performed. In order to monitor total svRNA produced during the course of infection, a pan-specific probe, capable of hybridizing to each of the eight svRNAs, was generated. Total svRNA expression demonstrated accumulation of small RNA products from infected extract; these species were detectable at 8 hpi and increased in concentration for the duration of the experiment (Figure 7A). Total svRNA expression demonstrated accumulation at approximately 12 hpi (Figure 7A). While viral RNA breakdown products, which were also reflected in the deep sequencing results, were evident by Northern blot, the predominant

accumulation of small RNA products between 22 and 25 nts corroborated the abundance of this 5 ' small RNA. To ascertain how the kinetics of svRNA synthesis correlated to viral transcription, non- structural 1 (NS 1) protein levels were determined by Western blot (Figure 7B). These levels demonstrated that protein expression, visible within 8 hpi, preceded the detection of svRNA. Furthermore, quantitative PCR (qPCR) using a reverse transcription strategy selective for genomic viral RNA, demonstrated a dramatic switch to viral replication at 12 hpi, concurrent with the appearance of svRNA (Figure 7C). To ensure that svRNA was specific to influenza A virus and not a virus- or interferon (IFN)-inducible miRNA, total RNA from Vesicular Stomatitis Virus (VSV) or Type I interferon beta (IFN-I) treated lung epithelial cells was analyzed. Northern blot analysis demonstrated the appearance of influenza A virus-specific svRNAs of 22 and

25 nucleotides that were absent in both VSV- and IFN-I-treated samples (Figure 7D).

To ensure that svRNA was not specific to a particular influenza A virus subtype, total

RNA from 10-day-old eggs inoculated with H1N1 (A/PR/8/34), H3N2

(A/Panama/2007/99), and H5N1 (A/Vietnam/ 1203/04) was isolated and the generation of svRNA was analyzed (Figure 7E). Analysis of total RNA demonstrated that svRNA was produced by all three influenza A virus subtypes in the context of an in ovo infection. Only H1N1 virus produced the two dominant species of svRNA, as both

H3N2 and H5N1 predominantly generated the 25 nt product (Figure 7E); these overall levels correlated with the extent of in ovo virus replication (Figure 7F). Lastly, to ensure that svRNA production could be observed in the context of virus infection regardless of species, H1N1 infections were performed in human, canine tissue and murine fibroblasts and in chicken in vivo. While each species demonstrated robust svRNA production, the sizes ranged from 22 to 35 nts, suggesting that host factors may influence svRNA production (Figure 7G). Collectively, these data indicate that svRNA is an abundant virus-specific RNA species, it is produced by a broad range of influenza

A virus subtypes, its production is not cell- or species-specific, and that synthesis corresponds to a shift from viral transcription to replication.

7.2.3 svRNA production in trans requires RdRp activity, NP and

NEP/NS2

[00472] To investigate how svRNA species are generated, the viral components required for their production was determined. To this end, bi-directional plasmids, representing each of the eight viral segments, were transfected into fibroblasts (Figure 8A). As each segment-specific plasmid produces an RNA Polymerase I (Pol-I)- dependent vRNA (3 ' to 5 ' RNA of negative polarity with a 5 ' triphosphate and no polyA tail) and a Pol-II-dependent mRNA (5 ' to 3 ' RNA of positive polarity with both a 5 ' cap and a 3' poly A tail), transfection serves both as a template source of vRNA as well as the expression of the segment-specific proteins. To determine whether svRNA production could be generated in the absence of virus infection, and to ascertain which proteins were required for its processing, each of the eight bi-directional segment- specific plasmids was transfected into fibroblasts and total RNA was analyzed by Northern blot (Figure 8B). As compared to mock treatment, transfection of each of the influenza A virus segments induced robust expression of svRNA. In contrast, removal of segments 1(PB2), 2(PB1), 3(PA), or 8, which encodes the non-structural protein (NS1) as well as the nuclear export protein (NEP/NS2), resulted in a complete loss of svRNA. However, removal of segments 4 and 6, encoding hemagglutinin (HA) and

neuraminidase (NA), resulted in no significant changes. Loss of segment 7, encoding the matrix proteins Ml and M2, while demonstrating a decrease in svRNA production, did not have the same dramatic loss as observed for segments 1,2,3 and 8. Loss of segment 5, which encodes NP, resulted in a loss of svRNA but the production of two fragments of ~32 and ~42 nts. To ensure that the bi-directional plasmids produced each of their respective proteins in trans, quantitative PCR (qPCR) was performed on NP, M, and PB2 (Figures 8C, 8D, and 8E). In each case, loss of PB2 and PB1 expression caused a dramatic decrease in NP and M expression levels, indicating that the majority of mRNA from these transcripts was being produced from the RdRp, rather than from the transfected bi-directional plasmid directly. In contrast, loss of PA still demonstrated robust expression of these transcripts, thus suggesting a minor role for PA in

vRNA/cRNA amplification under these conditions. Taken together, this suggests that the inability to detect svRNA in the absence of segment 3 (Figure 8B) was not the result of a loss of vRNA/cRNA amplification, but rather a structural or catalytic role for PA in the generation of svRNA. A catalytic requirement would be consistent with the idea that PA encodes the endonuclease activity that cleaves host mRNA (Dias et al., 2009; Yuan et al, 2009).

[00473] To further elucidate the role for segment 8 products in the generation of svRNA, segments 1-7 were co-expressed with plasmids expressing either NS1 or NEP/NS2 (Figure 9). While the expression of NS1 failed to rescue svRNA production, expression of NEP/NS2 demonstrated a partial rescue. Taken together, these data suggest that NEP/NS2 provides an essential component of the viral machinery responsible for the generation of svRNA. Furthermore, given the recent implication of NEP/NS2 in genome replication (Bullido et al, 2001; Robb et al, 2009), the total requirement for the RdRp, NP and NEP/NS2 strongly suggests that a functional polymerase and vRNA template are the minimal components for the production of svRNA. These data confirm that influenza A virus produces a specific small RNA during infection in an RdRp-dependent manner, suggest a possible structural role for NP, and implicate an unknown requirement for segment 8 vRNA, NS1, and/or NEP. 7.2.4 svRNA does not induce the cell's autonomous antiviral defenses

[00474] As the pattern recognition receptor RIG-I has been found to associate with 5 ' triphosphate containing R As, the possibility that svR As, which contain a 5' triphosphate, act as pathogen associated molecular patterns (PAMPs) was evaluated. To determine the cellular response to svRNA, a T7-derived svRNA mimetic was transfected into cells in the absence of infection. Despite robust levels (Figure 10A), and the exposed 5' triphosphate, svRNA failed to induce RIG-I mediated IRF3 phosphorylation as compared to VSV infection or the double-stranded RNA (dsRNA) mimetic polylC (Figure 10B). These results are consistent with the model that RIG-I requires both an exposed 5' triphosphate as well as dsRNA formation (Schmidt et al, 2009). Thus, it is postulated that svRNAs have no inherent immunostimulatory properties.

7.2.5 Modulating the levels of svRNA impacts the ratio of mRNA to cRNA: Anti-svRNA Induces Loss of vRNA and Inhibits Viral Spread

[00475] As svRNA does not appear to be a by-product of the cell's antiviral defenses, it was investigated whether it is a functional component of the viral life cycle. Past studies have demonstrated that the last 15 nucleotides of the 5' end of the vRNA, delivered in trans, are required for RdRp activity on a template containing only the 3' vRNA end, suggesting that both transcription and replication require a double stranded promoter (Fodor et al., 1994). As the switch from primary transcription to replication also demands the linearization of the genome without disruption of this promoter, it was postulated that svRNA may act as a 5 ' end surrogate thereby permitting promoter formation while maintaining linearity for genomic replication. As inhibiting mRNA synthesis would be detrimental to overall virus replication, it was hypothesized that svRNA would only moderately bias cRNA/vRNA synthesis, yet its inhibition would result in a dramatic loss of genomic RNA.

[00476] To analyze the impact of svRNA in RNA transcription and replication, a synthetic svRNA capable of hybridizing to each of the eight viral segments was used, and it was transfected with an RdRp-dependent luciferase construct containing the viral 5' and 3' vRNA ends of segment 5. While expression of NP, PA, PB1, and PB2 induced robust RdRp-generated activity in the presence of scrambled RNA, addition of equal amounts of svRNA resulted in an approximate 50% decrease in luciferase activity (Figure IOC). [00477] Based on these results, it was postulated that if exogenous expression of svRNA results in decreased mRNA levels, then inhibiting svRNA function should promote cRNA/vRNA synthesis. To analyze the impact of svRNA inhibition on RNA replication, a Locked Nucleic Acid (LNA) anti-svRNA, complementary to segment 4 svRNA (Anti-HA) (Wahlestedt et al, 2000), was synthesized. Scrambled LNA or anti- HA svRNA LNA were transfected, a de novo infection with influenza A/PR/8/34 (H1N1) virus was performed, and the levels of HA mRNA and cRNA were analyzed by primer extension (Figure 11 A). Levels of cRNA demonstrated a 3 fold decrease in the presence of the anti-HA LNA, suggesting that svRNA promotes vRNA/cRNA synthesis which, when inhibited, results in steady state levels of mRNA at the expense of strand replication. These results demonstrate that anti-HA LNA has a minimal impact on both HA mRNA and cRNA but induced a significant reduction of HA vRNA.

7.2.6 LNA Anti-svRNA Induces Loss of vRNA and Decreased

Viral Fitness

[00478] To ascertain whether loss of vRNA, in the absence of soluble svRNA, is observed during a single cycle infection, scrambled LNA or anti-HA were transfected into cells and protein production was monitored directly following the inoculation of influenza A/PR/8/34 virus. In agreement with the hypothesis that svRNA modulates the synthesis of genomic RNA, anti-HA had minimal impact on HA, NP, or NS1 protein levels following transfection (Figure 11B). Despite normal protein production in anti- HA treated samples, the supernatant from these initial infections demonstrated a dramatic decrease in viral progeny when applied to target MDCK cells (Figure 11C). As efficient influenza A virus egress requires RNP association (Noda et al, 2006), the near total loss of HA, NP and NS1 in the target MDCK cells suggests a defect in packaging, possibly due to the loss of HA vRNA. This is further supported by the fact that HA vRNA packaging sequences are essential components required for viral egress (Gao et al, 2009).

7.2.7 svRNA Function is Segment Specific

[00479] In order to determine whether blocking svRNA resulted in the disruption of vRNA in a segment specific manner, anti-NA and anti-NS svRNA LNAs were synthesized and evaluated by primer extension (Figure 11D). These results

demonstrated that only loss of HA svRNA impacted HA transcripts. Whereas a modest decrease of mRNA was observed in the presence of anti-HA, a robust loss of vRNA was evident. In contrast, anti-NA or anti-NS svRNA LNAs had no significant impact on any HA transcripts.

[00480] To further corroborate svRNA segment specificity, it was determined whether prolonged treatment with anti-HA LNA would result in only a specific loss of HA vRNA and the consequential loss of HA mRNA and protein. Increasing

concentrations of anti-svRNA were transfected into infected cells, and it was determined whether late time points beyond 48 hrs would result in a specific loss of HA vRNA and the consequential loss of HA mRNA and protein. In comparison to a "no treatment" control, or delivery of a scrambled LNA-oligo, the anti-svRNA against the HA segment induced a dramatic loss of HA expression while having no significant impact on NP or NS1 protein levels (Figure HE). Furthermore, viral growth curves in the presence of either scrambled LNA or HA-specific anti-svRNA corroborated the loss of viral protein production, as titers were reduced by 80% (Figure 11F).

7.3 Discussion

[00481] Taken together, these data support a model in which svRNA expression impacts the transition from transcription to replication and further suggests that it may function in a segment-specific manner.

[00482] The generation of a small RNA acting as a component of the replication machinery represents a new paradigm in virus biology. The identification of influenza A virus svRNAs elucidates a unique mechanism by which a virus can control the switch between transcription and replication.

[00483] With respect to svRNA synthesis, RdRp could cleave vRNA segments or could synthesize svRNA from cRNA. Cleavage of vRNA, while being the most rapid means of generating svRNA, is unlikely as this would destroy genomic template and therefore be detrimental to the viral life cycle. Alternatively, synthesis from cRNA is possible, but this would demand a stochastic event where cRNA would need to be produced in an svRNA-independent manner. This latter model is supported by data suggesting that cRNA stability is critical for the viral switch from transcription to replication (and would further explain why blocking svRNA results only in a selective loss of vRNA) (Vreede et al, 2004). If the source of svRNA does indeed require stochastic, svRNA-independent cRNA synthesis, perhaps NP function is required to temporally block the secondary structure of the panhandle and allow for complete cRNA synthesis. This would help explain why NP accumulation has also been associated with the switch from transcription to replication (Beaton and Krug, 1986). Furthermore, the requirement for NEP/NS2 in the generation of svRNA supports the idea that svRNA aids in the formation of an alternative RdRp replicase complex, a phenomenon already bestowed on NEP/NS2 (Robb et al, 2009).

[00484] In conclusion, these data support a model in which svRNA regulates the levels of vRNA synthesis during de novo virus infection, and it is clear that its presence is essential in converting the RdRp from a transcriptase to a replicase.

[00485] Given the occurrence of annual influenza virus epidemics, and the potential threat for periodic pandemics, this finding provides a new target for broad spectrum anti- virals.

8. EXAMPLE 3: GENERATION OF INTRON-BASED SVRNA

ANTAGONISTS

[00486] Based on the results described in the foregoing examples, an intron-based svRNA antagonist, containing three copies of an anti-svRNA specific for the influenza A HA segment, was generated (Figure 12A and Figure 12B). As shown in Figure 12C, the antagonist is effective at reducing influenza A virus vRNA (compare lane 8 with lanes 6 and 7). These data validate the concept that anti-svRNA Compounds can be expressed from an intron, which may be an effective method of generating cells and/or animals with genomically encoded anti-svRNA transgenes.

PREFERENCES CITED

[00487] Bullido, R., Gomez-Puertas, P., Saiz, M.J., and Portela, A. (2001). Influenza A virus NEP (NS2 protein) downregulates RNA synthesis of model template RNAs. J Virol 75, 4912-4917.

[00488] De Clercq, E. Antiviral agents active against influenza A viruses. Nat Rev Drug Discov 5, 1015-1025 (2006).

[00489] Gao, Q., and Palese, P. (2009). Rewiring the RNAs of influenza virus to prevent reassortment. Proc Natl Acad Sci U S A 106, 15891-15896.

[00490] Robb, N.C., Smith, M., Vreede, F.T., and Fodor, E. (2009). NS2/NEP protein regulates transcription and replication of the influenza virus RNA genome. J Gen Virol 90, 1398-1407.

[00491] Steel, J., Lowen, A.C., Pena, L., Angel, M., Solorzano, A., Albrecht, R., Perez, D.R., Garcia-Sastre, A., and Palese, P. (2009). Live attenuated influenza viruses containing NSl truncations as vaccine candidates against H5N1 highly pathogenic avian influenza. J Virol 83, 1742-1753.

[00492] Layne, S.P., Monto, A.S. & Taubenberger, J.K. Pandemic influenza: an inconvenient mutation. Science 323, 1560-1561 (2009).

[00493] Fields, B.N., Knipe, D.M., Howley, P.M., & Ovid Technologies Inc. Fields virology (Lippincott Williams & Wilkins, Philadelphia, PA, 2007), Chapter 47, pp. 1 electronic text.

[00494] Krug, R.M., Priming of influenza viral RNA transcription by capped heterologous RNAs. Curr Top Microbiol Immunol 93, 125-149 (1981).

[00495] Dias, A. et al, The cap-snatching endonuclease of influenza virus

polymerase resides in the PA subunit. Nature 458 (7240), 914-918 (2009).

[00496] Yuan, P. et al., Crystal structure of an avian influenza polymerase PA(N) reveals an endonuclease active site. Nature 458 (7240), 909-913 (2009).

[00497] Robertson, J.S., 5' and 3' terminal nucleotide sequences of the RNA genome segments of influenza virus. Nucleic Acids Res 6 (12), 3745-3757 (1979).

[00498] Hsu, M.T., Parvin, J.D., Gupta, S., Krystal, M., & Palese, P., Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle. Proc Natl Acad Sci U S A 84 (22), 8140-8144 (1987).

[00499] Desselberger, U., Racaniello, V.R., Zazra, J.J., & Palese, P., The 3' and 5'- terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity. Gene 8 (3), 315-328 (1980).

[00500] Brownlee, G.G. & Sharps, J.L., The RNA polymerase of influenza a virus is stabilized by interaction with its viral RNA promoter. J Virol 76 (14), 7103-7113 (2002).

[00501] Plotch, S.J., Bouloy, M., Ulmanen, I., & Krug, R.M., A unique

cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral RNA transcription. Cell 23 (3), 847-858 (1981).

[00502] Honda, A., Ueda, K., Nagata, K., & Ishihama, A., Identification of the RNA polymerase-binding site on genome RNA of influenza virus. J Biochem 102 (5), 1241-

1249 (1987).

[00503] Poon, L.L., Pritlove, D.C., Sharps, J., & Brownlee, G.G., The RNA polymerase of influenza virus, bound to the 5' end of virion RNA, acts in cis to polyadenylate niRNA. J Virol 72 (10), 8214-8219 (1998).

[00504] Hay, A.J., Lomniczi, B., Bellamy, A.R., & Skehel, J.J., Transcription of the influenza virus genome. Virology 83 (2), 337-355 (1977). [00505] Robertson, J.S., Schubert, M., & Lazzarini, R.A., Polyadenylation sites for influenza virus mRNA. J Virol 38 (1), 157-163 (1981).

[00506] Shapiro, G.I. & Krug, R.M., Influenza virus RNA replication in vitro:

synthesis of viral template RNAs and virion RNAs in the absence of an added primer. J Virol 62 (7), 2285-2290 (1988).

[00507] Young, R.J. & Content, J., 5'-terminus of influenza virus RNA. Nat New Biol 230 (13), 140-142 (1971).

[00508] Fodor, E., Pritlove, D.C., & Brownlee, G.G., The influenza virus panhandle is involved in the initiation of transcription. J Virol 68 (6), 4092-4096 (1994).

[00509] Vreede, F.T., Gifford, H., & Brownlee, G.G., Role of initiating nucleoside triphosphate concentrations in the regulation of influenza virus replication and transcription. J Virol 82 (14), 6902-6910 (2008).

[00510] Vreede, F.T., Jung, T.E., & Brownlee, G.G., Model suggesting that replication of influenza virus is regulated by stabilization of replicative intermediates. J Virol 78 (17), 9568-9572 (2004).

[00511] Jorba, N., Coloma, R., & Ortin, J., Genetic trans-complementation establishes a new model for influenza virus RNA transcription and replication. PLoS Pathog 5 (5), el 000462 (2009).

[00512] Nandakumar, J., Shuman, S., & Lima, CD., RNA ligase structures reveal the basis for RNA specificity and conformational changes that drive ligation forward. Cell 127 (1), 71-84 (2006).

[00513] Salvatore, M. et al., Effects of influenza A virus NSl protein on protein expression: the NSl protein enhances translation and is not required for shutoff of host protein synthesis. J Virol 76 (3), 1206-1212 (2002).

[00514] Pichlmair, A. et al., RIG-I-mediated antiviral responses to single-stranded

RNA bearing 5^*-phosphates. Science 314 (5801), 997-1001 (2006).

[00515] Schmidt, A. et al, 5 '-triphosphate RNA requires base-paired structures to activate antiviral signaling via RIG-I. Proc Natl Acad Sci U S A 106 (29), 12067-12072

(2009).

[00516] Perez, J.T. et al, MicroRNA-mediated species-specific attenuation of influenza A virus. Nat Biotechnol 27 (6), 572-576 (2009).

[00517] Wahlestedt, C. et al, Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci U S A 97 (10), 5633-5638 (2000). [00518] Noda, T. et al., Architecture of ribonucleoprotein complexes in influenza A virus particles. Nature 439 (7075), 490-492 (2006).

[00519] Fujii, K. et al, Importance of both the coding and the segment-specific noncoding regions of the influenza A virus NS segment for its efficient incorporation into virions. J Virol 79 (6), 3766-3774 (2005).

[00520] Marsh, G.A., Rabadan, R., Levine, A.J., & Palese, P., Highly conserved regions of influenza a virus polymerase gene segments are critical for efficient viral RNA packaging. J Virol 82 (5), 2295-2304 (2008).

[00521] TenOever, B.R. et al., Multiple functions of the IK -related kinase

IK epsilon in interferon-mediated antiviral immunity. Science 315 (5816), 1274-1278 (2007).

[00522] Pinto, L.H. and Lamb, R.A. (1995) Understanding the mechanism of action of the anti-influenza virus drug amantadine. Trends Microbiol 3(7), 271.

[00523] Wharton, S.A., Belshe, R.B., Skehel, J.J. and Hay, A.J. (1994) Role of virion M2 protein in influenza virus uncoating: specific reduction in the rate of membrane fusion between virus and liposomes by amantadine. J Gen Virol 75 ( Pt 4), 945-8.

[00524] Bright, R.A., Shay, D.K., Shu, B., Cox, N.J. and Klimov, A.I. (2006) Adamantane resistance among influenza A viruses isolated early during the 2005-2006 influenza season in the United States. JAMA 295(8), 891-4.

[00525] Cheung, C.L., Rayner, J.M., Smith, G.J., Wang, P., Naipospos, T.S., Zhang, J., Yuen, K.Y., Webster, R.G., Peiris, J.S., Guan, Y. and Chen, H. (2006) Distribution of amantadine-resistant H5N1 avian influenza variants in Asia. J Infect Dis 193(12), 1626- 9.

[00526] Garman, E. and Laver, G. (2004) Controlling influenza by inhibiting the virus's neuraminidase. Curr Drug Targets 5(2), 119-36.

[00527] Le, Q.M., Kiso, M., Someya, K., Sakai, Y.T., Nguyen, T.H., Nguyen, K.H., Pham, N.D., Ngyen, H.H., Yamada, S., Muramoto, Y., Horimoto, T., Takada, A., Goto, H., Suzuki, T., Suzuki, Y. and Kawaoka, Y. (2005) Avian flu: isolation of drug-resistant H5N1 virus. Nature 437(7062), 1108.

[00528] World Health Organization (2008) Influenza A(H IN 1 ) virus resistance to oseltamivir; http://www.who.int/csr/disease/influenza/hlnl_table/en/index.html;

02/28/08.

[00529] Takada, A., Kuboki, N., Okazaki, K., Ninomiya, A., Tanaka, H., Ozaki, H., Itamura, S., Nishimura, H., Enami, M., Tashiro, M., Shortridge, K.F. and Kida, H. (1999) Avirulent Avian influenza virus as a vaccine strain against a potential human pandemic. J Virol 73(10), 8303-7.

[00530] Tree, J.A., Richardson, C, Fooks, A.R., Clegg, J.C. and Looby, D. (2001) Comparison of large-scale mammalian cell culture systems with egg culture for the production of influenza virus A vaccine strains. Vaccine 19(25-26), 3444-50.

[00531] Romanova, J., Katinger, D., Ferko, B., Vcelar, B., Sereinig, S., Kuznetsov, O., Stukova, M., Erofeeva, M., Kiselev, O., Katinger, H. and Egorov, A. (2004) Live cold-adapted influenza A vaccine produced in Vero cell line. Virus Res 103(1-2), 187- 93.

[00532] Oxford, J.S., Manuguerra, C, Kistner, O., Linde, A., Kunze, M., Lange, W., Schweiger, B., Spala, G., Rebelo de Andrade, FL, Perez Brena, P.R., Beytout, J., Brydak, L., Caraffa de Stefano, D., Hungnes, O., Kyncl, J., Montomoli, E., Gil de Miguel, A., Vranckx, R. and Osterhaus, A. (2005) A new European perspective of influenza pandemic planning with a particular focus on the role of mammalian cell culture vaccines. Vaccine 23(46-47), 5440-9.

[00533] Barrel, D.P. (2009). MicroRNAs: target recognition and regulatory functions. Cell 136, 215-233.

[00534] Beaton, A.R., and Krug, R.M. (1986). Transcription antitermination during influenza viral template RNA synthesis requires the nucleocapsid protein and the absence of a 5' capped end. Proc Natl Acad Sci U S A 83, 6282-6286.

[00535] Brown, B.D., Gentner, B., Cantore, A., Colleoni, S., Amendola, M., Zingale, A., Baccarini, A., Lazzari, G., Galli, C, and Naldini, L. (2007). Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state. Nat Biotechnol 25, 1457-1467.

[00536] Collins, L.J., Kurland, C.G., Biggs, P., and Penny, D. (2009). The modern RNP world of eukaryotes. J Hered 100, 597-604.

[00537] Crow, M., Deng, T., Addley, M., and Brownlee, G.G. (2004). Mutational analysis of the influenza virus cRNA promoter and identification of nucleotides critical for replication. J Virol 78, 6263-6270.

[00538] de Veer, M.J., Holko, M., Frevel, M., Walker, E., Der, S., Paranjape, J.M., Silverman, R.H., and Williams, B.R. (2001). Functional classification of interferon- stimulated genes identified using microarrays. J Leukoc Biol 69, 912-920. [00539] Donelan, N.R., Basler, C.F., and Garcia-Sastre, A. (2003). A recombinant influenza A virus expressing an RNA-binding-defective NS 1 protein induces high levels of beta interferon and is attenuated in mice. J Virol 77, 13257-13266.

[00540] Fechter, P., Mingay, L., Sharps, J., Chambers, A., Fodor, E., and Brownlee, G.G. (2003). Two aromatic residues in the PB2 subunit of influenza A RNA polymerase are crucial for cap binding. J Biol Chem 278, 20381-20388.

[00541] Flick, R., Neumann, G., Hoffmann, E., Neumeier, E., and Hobom, G. (1996). Promoter elements in the influenza vRNA terminal structure. RNA 2, 1046-1057.

[00542] Guilligay, D., Tarendeau, F., Resa-Infante, P., Coloma, R., Crepin, T., Sehr, P., Lewis, J., Ruigrok, R.W., Ortin, J., Hart, D.J., et al. (2008). The structural basis for cap binding by influenza virus polymerase subunit PB2. Nat Struct Mol Biol 15, 500- 506.

[00543] He, X., Zhou, J., Bartlam, M., Zhang, R., Ma, J., Lou, Z., Li, X., Li, J., Joachimiak, A., Zeng, Z., et al. (2008). Crystal structure of the polymerase PA(C)- PB1(N) complex from an avian influenza H5N1 virus. Nature 454, 1123-1126.

[00544] Kato, H., Takeuchi, O., Mikamo-Satoh, E., Hirai, R., Kawai, T., Matsushita, K., Hiiragi, A., Dermody, T.S., Fujita, T., and Akira, S. (2008). Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp Med 205, 1601-1610.

[00545] Li, M.L., Rao, P., and Krug, R.M. (2001). The active sites of the influenza cap-dependent endonuclease are on different polymerase subunits. EMBO J 20, 2078- 2086.

[00546] Neumann, G., and Hobom, G. (1995). Mutational analysis of influenza virus promoter elements in vivo. J Gen Virol 76 ( Pt 7), 1709-1717.

[00547] Obayashi, E., Yoshida, H., Kawai, F., Shibayama, N., Kawaguchi, A., Nagata, K., Tame, J.R., and Park, S.Y. (2008). The structural basis for an essential subunit interaction in influenza virus RNA polymerase. Nature 454, 1127-1131.

[00548] Pall, G.S., and Hamilton, A.J. (2008). Improved northern blot method for enhanced detection of small RNA. Nat Protoc 3, 1077-1084.

[00549] Saito, T., and Gale, M., Jr. (2008). Differential recognition of double- stranded RNA by RIG-I-like receptors in antiviral immunity. J Exp Med 205, 1523- 1527.

[00550] Shendure, J., and Ji, H. (2008). Next-generation DNA sequencing. Nat Biotechnol 26, 1135-1145. [00551] Shi, L., Summers, D.F., Peng, Q., and Galarz, J.M. (1995). Influenza A virus RNA polymerase subunit PB2 is the endonuclease which cleaves host cell mRNA and functions only as the trimeric enzyme. Virology 208, 38-47.

[00552] Sugiyama, K., Obayashi, E., Kawaguchi, A., Suzuki, Y., Tame, J.R., Nagata, K., and Park, S.Y. (2009). Structural insight into the essential PB1-PB2 subunit contact of the influenza virus RNA polymerase. EMBO J 28, 1803-1811.

[00553] Tarendeau, F., Boudet, J., Guilligay, D., Mas, P.J., Bougault, CM., Boulo, S., Baudin, F., Ruigrok, R.W., Daigle, N., Ellenberg, J., et al. (2007). Structure and nuclear import function of the C-terminal domain of influenza virus polymerase PB2 subunit. Nat Struct Mol Biol 14, 229-233.

[00554] Torreira, E., Schoehn, G., Fernandez, Y., Jorba, N., Ruigrok, R.W., Cusack, S., Ortin, J., and Llorca, O. (2007). Three-dimensional model for the isolated

recombinant influenza virus polymerase heterotrimer. Nucleic Acids Res 35, 3774-3783.

10. EQUIVALENTS

[00555] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[00556] The invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

[00557] Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by the embodiments described herein and exemplified in the appended claims.

Claims

WHAT IS CLAIMED IS:

1. An isolated anti-svR A compound, wherein the anti-svR A compound has a nucleobase sequence comprising 5'-AAAAAUUUCCUUGUUUCUUCU-3', or a portion thereof.

2. An isolated anti-svRNA compound, wherein the anti-svRNA compound has a nucleobase sequence comprising 5'- AAAAANNNCCUUGUUUCUACU-3', or a portion thereof, wherein N is U, C, A , or G.

3. An isolated anti-svRNA compound, wherein the anti-svRNA compound has a nucleobase sequence comprising AGGAAAAACACCCUUGUUUCUACU.

4. An isolated anti-svRNA compound, wherein the anti-svRNA compound has a nucleobase sequence comprising GUUUAAAAAAACGACCUUGUUUCUACU; CAUGAAAAAAUGCCUUGUUUCUACU;

UCCAAAAAAGUACCUUGUUUCUACU;

GAGGAAAAAAACACCCUUGUUUCUACU;

AAAGAAAAAAAUACCCUUGUUUCUACU;

GUUCAAAAAACUCCUUGUUUCUACU;

AGUAAAAAACUACCUUGUUUCUACU; or

AAUAAAAAACACCCUUGUUUCUACU.

5. An isolated anti-svRNA compound, wherein the anti-svRNA compound has a nucleobase sequence comprising 5'-AAAAAGAAGACCUGAUGGAUGAAU-3'.

6. An isolated DNA sequence, wherein the DNA sequence encodes an anti- svRNA compound of any one of claims 1 to 5.

7. An isolated synthetic svR A, wherein the synthetic svRNA is encoded by a DNA nucleobase sequence comprising 5'-

AGTAGAAAC AAGGGTGTTTTTTTGTC AC-3 '

8. An isolated synthetic svRNA, wherein the synthetic svRNA has a nucleobase sequence comprising 5'- AGUAGAAACAAGGNNNUUUUU-3', wherein N is U, C, A, or G; or 5'-AGUAGAAACAAGGGUGUUUUUUUGUCAC-3'.

9. An isolated synthetic svRNA, wherein the synthetic svRNA has a nucleobase sequence comprising 5'- AGUAGUAUCAAGUUUUUUUUU -3'.

10. An isolated synthetic svRNA, wherein the synthetic svRNA has a nucleobase sequence comprising 5'-AG(U/C)AG-X₆-A-X₈-CAAG-Xi3-Xi4-Xi5-Xi6- UUUUU-3^*, wherein:

X₆ is U, C, A, or G;

X₈ is U, C, A, or G;

Xis is U, C, A, or G;

Xi4 is U, C, A, or G;

Xi5 is U, C, A, or G; and

Xie is U, C, A, or G.

1 1. An isolated synthetic svRNA, wherein the synthetic svRNA has a nucleobase sequence comprising 5'-AGUAGAAACAAGG-Xi4-Xi₅-Xi6-UUUUU-X₂2- X23-X24-X25-X26-X27-X28-3', wherein:

Xi4 is U, C, A, or G;

Xis is U, C, A, or G;

Xie is U, C, A, or G;

X₂₂ is U, C, or G;

X23 is U or C or A or is absent;

X24 is U, C, A, G, or is absent;

X25 is U, C, A, G, or is absent;

X26 is U or A or is absent;

X27 is U or C or is absent; and

X28 is U, C, A, G, or is absent.

12. An isolated synthetic svRNA, wherein the synthetic svRNA has a nucleobase sequence comprising 5'-

UUAAAC ACC AUAUUC AUCC AUC AGGUCUUCUUUUU-3 ' .

13. An isolated DNA sequence, wherein the DNA sequence encodes a synthetic svRNA of any one of claims 8 to 12.

14. A method of modulating influenza virus replication, comprising contacting a substrate infected with an influenza virus with an anti-svRNA compound complementary to an influenza virus svRNA.

15. The method of claim 14, wherein the substrate is a cell or egg.

16. A method for treating influenza virus infection in a subject, comprising administering to a subject in need of such treatment an effective amount of an anti- svRNA compound complementary to an influenza virus svRNA.

17. A method for treating influenza virus infection in a subject, comprising administering to a subject in need of such treatment an effective amount of a synthetic influenza virus svRNA.

18. A method for treating influenza virus infection in a subject, comprising administering to a subject in need of such treatment an effective amount of the anti- svRNA compound of claim 1.

19. A method for treating influenza virus infection in a subject, comprising administering to a subject in need of such treatment an effective amount of a synthetic svRNA of any one of claims 7 to 10.

20. The method of any one of claims 16 to 19, wherein the influenza virus is an influenza A virus.

21. A method for treating influenza A virus infection in a subject, comprising administering to a subject in need of such treatment an effective amount of an anti- svRNA compound of claim 2, 3, or 4.

22. A method for treating influenza A virus infection in a subject, comprising administering to a subject in need of such treatment an effective amount of a synthetic svRNA of claim 11.

23. The method of any one of claims 16 to 22, wherein the subject is a human.

24. The method of any one of claims 16 to 22, wherein the subject is a non- human animal.

25. The method of claim 24, wherein the non-human animal is a pig or avian.

26. A method for generating an attenuated influenza A virus, comprising producing influenza A virus in the presence of an anti-svRNA compound

complementary to an influenza A virus svRNA specific for the NA genome segment.

27. The method of claim 26, wherein the anti-svRNA compound has a nucleobase sequence comprising GUUCAAAAAACUCCUUGUUUCUACU.

28. A non-human transgenic animal comprising an anti-svRNA compound complementary to an influenza A virus svRNA stably integrated into the genome of the transgenic animal.

29. The non-human transgenic animal of claim 28, wherein the transgenic animal is a pig.

30. The non-human transgenic animal of claim 28, wherein the transgenic animal is an avian.

31. A non-human transgenic animal comprising a sequence encoding an anti- svRNA compound of any one of claims 1 to 4, wherein the sequence encoding the anti- svRNA compound is stably integrated into the genome of the transgenic animal.

32. A transgenic salmon comprising a sequence encoding an anti-svRNA compound, wherein the anti-svRNA compound is complementary to an infectious salmon anemia virus svRNA, and wherein the anti-svRNA compound is stably integrated into the genome of the transgenic animal.

33. The transgenic salmon of claim 32, wherein the anti-svRNA compound has a nucleobase sequence comprising 5'-AAAAAGAAGACCUGAUGGAUGAAU-3'.

34. A method for preventing or treating a symptom or disease associated with an Orthomyxovirus infection in a non-human animal, comprising engineering the non- human animal to express a nucleic acid anti-svRNA compound.

35. The method of claim 34, wherein the Orthomyxovirus is an Isavirus and the non-human animal is salmon.

36. The method of claim 35, wherein the nucleic acid anti-svRNA compound has a nucleobase sequence comprising 5'-AAAAAGAAGACCUGAUGGAUGAAU-3'.

37. The method of claim 34, wherein the Orthomyxovirus is an influenza A virus and the non-human animal is an avian or a pig.