WO2011078662A1 - Dsrna for improved genetic modification of plant dna - Google Patents

Abstract

The present invention relates to methods and compositions for carrying out targeted genetic recombination or mutation. The present invention is efficient to perform and is in particular suitable for plant cells. Any part of a double-stranded nucleic acid of a plant cell can be modified by the method according to the invention. The method uses recombination processes that are endogenous in all cells, while at the same time efficiently suppressing pathways in the plant cell, and which were found to negatively influence targeted genetic modification in the plant cell when not suppressed.

Description

Title: dsRNA for improved genetic modification of plant DNA

Background Art Genetic modification is the process of deliberately creating changes in the genetic material of living cells with the purpose of modifying one or more genetically encoded biological properties of that cell, or of the organism of which the cell forms part or into which it can regenerate. These changes can take the form of deletion of parts of the genetic material, addition of exogenous genetic material, or changes like substitutions in the existing nucleotide sequence of the genetic material.

Methods for the genetic modification of eukaryotic organisms have been known for over 20 years, and have found widespread application in plant and animal cells and microorganisms for improvements in the fields of agriculture, human health, food quality and environmental protection.

The common methods of genetic modification consist of adding exogenous DNA fragments to the genome of a cell, which will then confer a new property to that cell or its organism over and above the properties encoded by already existing genes (including applications in which the expression of existing genes will thereby be suppressed). Although many such examples are effective in obtaining the desired properties, these methods are nevertheless not very precise, because there is no control over the genomic positions in which the exogenous DNA fragments are inserted (and hence over the ultimate levels of expression). In addition, the desired effect will have to manifest itself over the natural properties encoded by the original and well-balanced genome. A common problem encountered is that due to random integration of the exogenous DNA fragments in the genomic DNA of the host essential or beneficial genes are inactivated of modified, causing unwanted loss of desirable

characteristics of the host. On the contrary, methods of genetic modification that will result in the addition, deletion or conversion of nucleotides in predefined genomic loci will allow the precise modification of existing genes.

With the advent of genomics over the past decade, it is now possible to decipher the genomes of animals, plants and bacteria quickly and cost effectively. This has resulted in a wealth of genes and regulatory sequences, which can be linked to phenotypes such as disease susceptibility in animals or yield characteristics in plants. This will allow the putative function of a sequence to be quickly established, but the ultimate proof that a gene is responsible for an observed phenotype must be obtained by creating a mutant line that shows the expected altered phenotype.

One of the most attractive methods of targeted genetic recombination and creating mutants is through the use of zinc finger nucleases (ZFN). Zinc finger nucleases are proteins custom designed to cut at a certain DNA sequence. Zinc finger domains comprise of approximately 30 amino acids which folds into a characteristic structure when stabilized by a zinc ion. The zinc finger domains are able to bind to DNA by inserting into the major groove of the DNA helix. Each zinc finger domain is able to bind to a specific DNA triplet (3 bps) via key amino acid residues at the a-helix region of the zinc finger. Thus, by changing these key amino acids, it is possible to alter the recognition specificity of a zinc finger for a certain triplet.

The flexibility of the system is derived from the fact that the zinc finger domains can be joined together in series to bind to long DNA sequences. For instance, six zinc finger domains in series recognizes a specific 18 bps sequence which is long enough to be unique in a complex eukaryotic genome. A zinc finger nuclease (ZFN) is comprised of a series of zinc fingers fused to a nuclease like Fokl. The ZFN is introduced into the cell, and will recognize and bind to a specific genomic sequence.

As the Fokl nuclease cuts as a dimer, a second ZFN is required which recognizes a specific sequence on the opposite DNA strand at the cut site. A DNA cut, or double strand break (DSB) is then made in between the two targeted DNA sequences (see Figure 4). In a next step, repair of the DSB via homologous recombination (HR) with a donor construct introduced to the cell occurs. Information from the donor construct is copied into the targeted DNA sequences. The donor construct contains alterations compared with the original chromosomal locus, and thus the process of HR incorporates these alterations the genome (See Figure 5).

Indeed this process of gene targeting is a powerful technique that has many applications in both medicine and agriculture. It allows the precise manipulation of the genome, enabling biologists to study and exploit gene function. However, the efficiency of HR in nearly all cell types is low as it relies on the presence of a DSB in the chromosomal locus. The usefulness of ZFN's is thus their ability to induce a DSB at any chromosomal locus, and have been used to improve the efficiency of gene targeting a 100 fold. However, better methods of targeted genetic recombination are needed that are more general, efficient, and/or reproducible than currently available techniques.

Description of the Invention

Definitions

In the following description and examples, a number of terms are used. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given to such terms, the following definitions are provided. Unless otherwise defined herein, all technical and scientific terms used have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The disclosures of all publications, patent applications, patents and other references are incorporated herein in their entirety by reference.

As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, a method for isolating "a" DNA molecule, as used above, includes isolating a plurality of molecules (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more molecules).

As used herein, the term "donor" or "donor construct" "refers to the entire set of DNA segments to be introduced into the host cell or organism as a functional group. The term "donor nucleic acid" as used herein refers to a DNA segment with sufficient homology to the region of the target locus to allow participation in homologous recombination at the site of the targeted double strand break. The term "gene" means a DNA sequence comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene may thus comprise several operably linked sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3'non- translated sequence comprising e.g. transcription termination sites.

A "host cell" or a "recombinant host cell" or "transformed cell" or "transgenic cell" are terms referring to a new individual cell (or organism) arising as a result of at least one nucleic acid molecule, especially comprising a chimeric gene encoding a desired protein or a nucleic acid sequence which upon transcription yields an antisense RNA or an inverted repeat RNA (or hairpin RNA) for silencing of a target gene/gene family, having been introduced into said cell. The host cell is preferably a plant cell or a bacterial cell. The host cell may contain the nucleic acid construct as an extra-chromosomally (episomal) replicating molecule, or more preferably, comprises the chimeric gene integrated in the nuclear or plastid genome of the host cell. Throughout the text the term "host" may also refer to the host plant species, but this will be clear from the context. Plant species are classified as "host" (including primary and/or secondary hosts) or "non-host" species in relation to, for instance, insect pests.

"Identity" is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A. M., ed., Oxford University Press, New York, 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D. W., ed., Academic Press, New York, 1993; COMPUTER ANALYSIS OF

SEQUENCE DATA, PART I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G.,

Academic Press, 1987; and SEQUENCE ANALYSIS PRIMER; Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 ). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H., and Lipton, D., SIAM J. Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in GUIDE TO HUGE

COMPUTERS, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J. Applied Math (1988) 48:1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al., Nucleic Acids Research (1984) 12(1 ):387), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J. Molec. Biol. (1990) 215:403).

As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 95% "identity" to a reference nucleotide sequence encoding a polypeptide of a certain sequence it is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference polypeptide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted and/or substituted with another nucleotide, and/or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence, or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Similarly, by a polypeptide having an amino acid sequence having at least, for example, 95% "identity" to a reference amino acid sequence of SEQ ID NO: 1 is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of SEQ ID NO: 1. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.

As used herein, the term "locus" (loci plural) means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found. For example, the ".. locus" refers to the position in the genome where the .. gene (and at least two .. alleles) is (are) found.

A "nucleic acid" according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated by reference in its entirety for all purposes). The present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated or glycosylated forms of these bases, and the like. The polymers or oligomers may be heterogenous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single- stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.

The term "ortholog" of a gene or protein refers herein to the homologous gene or protein found in another species, which has the same function as the gene or protein, but (usually) diverged in sequence from the time point on when the species harboring the genes diverged (i.e. the genes evolved from a common ancestor by speciation).

The terms "protein" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 dimensional structure or origin. A "fragment" or "portion" of a protein may thus still be referred to as a "protein". An "isolated protein" is used to refer to a protein which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell. For the purposes of the present invention, the term "recombination "is used to indicate the process by which genetic material at a given locus is modified as a consequence of an interaction with other genetic material. For the purposes of the present invention, the term "homologous recombination" is used to indicate recombination occurring as a consequence of interaction between segments of genetic material that are homologous, or partially identical. In contrast, for purposes of the present invention, the term "non-homologous recombination" is used to indicate a recombination occurring as a consequence of interaction between segments of genetic material that are not partially homologous, or identical. Nonhomologous end joining (NHEJ) is an example of non-homologous recombination. The frequency of homologous recombination in any given cell is influenced by a number of factors. Different cells or organisms vary with respect to the amount of homologous recombination that occurs in their cells and the relative proportion of homologous

recombination that occurs is also species-variable. The length of the region of homology between donor and target affects the frequency of homologous recombination events, the longer the region of homology, the greater the frequency.

The length of the region of homology needed to observe homologous recombination is also species specific. However, differences in the frequency of homologous recombination events can be offset by the sensitivity of selection for the recombinations that do occur. It will be appreciated that absolute limits for the length of the donor-target homology or for the degree of donor-target homology cannot be fixed but depend on the number of potential events that can be scored and the sensitivity of the selection for homologous recombination events.

A "recombinant plant" or "recombinant plant part" or "transgenic plant" is a plant or plant part (seed or fruit or leaves, for example) which comprises the chimeric gene in all cells and plant parts, at the same locus, even though the gene may not be expressed in all cells. Within the context of the current invention, the term "target DNA sequence" refers to consecutive nucleotides present in the plant cell, and in which, according to the invention, a genetic modification is to be introduced. Such target DNA sequence can be of any length, for example consist of 10, 50, 100 or more consecutive nucleotides. The target sequence might be a gene, part of a gene, coding, or non-coding, be part of a promoter region and so on. Preferably the target DNA sequence is (part of) the coding region of a gene.

As used herein, the term "targeted genetic recombination" refers to a process wherein recombination occurs within a DNA target locus present in a host cell or host organism. Recombination can involve either homologous or non-homologous DNA. One example of homologous targeted genetic recombination would be cleavage of a selected locus of host DNA by a zinc finger nuclease (ZFN), followed by homologous recombination of the cleaved DNA with homologous DNA of either exogenous or endogenous origin. One example of nonhomologous targeted genetic recombination would be cleavage of a selected locus of host DNA by a ZFN, followed by non-homologous end joining (NHEJ) of the cleaved DNA.

Double-strand breaks may be created by introduction into the cell nucleus of zinc-finger nucleases (e.g. see Lloyd et al., 2005), meganucleases such as I-Sce1 (Epinat et al., 2003), or triplex-forming oligonucleotides coupled to mutagenic chemical groups (Havre et al., 1993).

The term "zinc finger nuclease" or "ZFN" refers to a chimeric protein molecule comprising at least one zinc finger DNA binding domain effectively linked to at least one nuclease capable of cleaving DNA. A zinc finger nuclease (ZFN) is capable of directing targeted genetic recombination or targeted mutation in a host cell by causing a double stranded break (DSB) at the target locus. A ZFN of the present invention includes a DNA-binding domain and a DNA-cleavage domain, wherein the DNA binding domain is comprised of at least one zinc finger and is operatively linked to a DNA-cleavage domain. The zinc finger domain of the present invention can be derived from any class or type of zinc finger, including the Cis2His2 type of zinc finger that is very generally represented, for example, by the zinc finger transcription factors TFIIIA or Sp1. For example, the zinc finger domain can comprise three Cis2His2 type zinc fingers.

The DNA recognition and/or the binding specificity of a ZFN can be altered in order to accomplish targeted genetic recombination at any chosen site in cellular DNA. Such modification can be accomplished using known molecular biology and/or chemical synthesis techniques, (see, for example, M. Bibikova et al. (2002) Genetics 161 : 1 169-1 175). The ZFN DNA-cleavage domain is derived from a class of non-specific DNA cleavage domains, for example the DNA-cleavage domain of a Type II restriction enzyme. In a particular embodiment the DNA-cleavage domain is derived from the Type II restriction enzyme, Fokl.

For example, a ZFN may comprise three Cis2His2 type of zinc fingers, and a DNA-cleavage domain derived from the type II restriction enzyme, Fokl. In this way, each zinc finger contacts 3 consecutive base pairs of DNA creating a 9 bp recognition sequence for the ZFN DNA binding domain. The DNA-cleavage domain of the preferred embodiment requires dimerization of two ZFN DNA-cleavage domains for effective cleavage of double-stranded DNA. (See, for example, J. Smith et al., (2000) Nucleic Acids Res. 28: 3361 -3369). This imposes a requirement for two inverted recognition (target DNA) sites within close proximity for effective targeted genetic recombination. If all positions in the target sites are contacted specifically, these requirements enforce recognition of a total of 18 base pairs of DNA.

There may be a space between the two sites. The space between recognition sites for ZFNs of the present invention may be equivalent to 6 to 35 bp of DNA. The region of DNA between the two recognitions sites is herein referred to as the "spacer".

Detailed description of the invention

The present invention relates to methods and compositions for carrying out targeted genetic recombination or mutation. The present invention is efficient to perform and is in particular suitable for plant cells. As will be explained below, any part of a double-stranded nucleic acid of a plant cell can be modified by the method according to the invention. The method uses recombination processes that are endogenous in all cells, while at the same time efficiently suppressing pathways in the plant cell, and which were found to negatively influence targeted genetic modification in the plant cell when not suppressed.

The method according to the invention for targeted genetic modification in a plant cell comprises

Providing a plant cell having at least one target DNA sequence, preferably an endogenous chromosomal target DNA sequence in which a genetic modification is to be introduced; Introducing a double strand break in said target DNA sequence; Introducing at least one donor nucleic acid comprising a sequence that is homologous, for example which has at least 90%, preferably at least 93%, even more preferably at least 99% identity to at least part of said target DNA sequence;

Prior or simultaneously with the previous step (step c)

temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA; and/or temporarily suppressing mRNA from a gene encoding a protein involved in the nonhomologous end-joining pathway, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA .

In a first step of the method according to the invention, there is provided a plant cell in which a genetic modification is to be introduced in a target DNA sequence present in the plant cell.

The plant cell can be derived from any plant, and is not limited to any particular species of plant, as long as the plant cell is suitable for use in the method according to the invention, for example because a external donor construct can be introduced in said plant cell, without destroying the plant cell beyond the point that the cell is not viable. The plant cell can be in singular form or in the form of a tissue (connected cells).

The plant cell can for example be monocot or dicot. Examples include, but are not limited to sugar cane, wheat, rice, maize, potato, sugar beet, cassava, barley, soybean, sweet potato, oil palm fruit, tomato, sorghum, orange, grape, banana, apple, cabbage, watermelon, coconut, onion, cottonseed, rapeseed and yam, members of the Solanaceae species tobacco, tomato, melon, potato and pepper, soybean, potatoes, cabbage, broccoli, cauliflower, brussel sprouts, turnips, melon.

The genetic modification to be introduced can be any modification required, including deletions, insertion or substitution of at least one nucleotide in the target DNA sequence. For example, the method according to the invention is suitable for introducing a deletion of one or more nucleotides in the target DNA sequence, for replacing (substituting) one or more nucleotides in the target DNA sequence, for inserting one or more, for example three, nucleotides in the target DNA sequence. The method according to the invention is also suitable for, at the same time, or in successive order, introducing one or more deletions and/or one or more substitutions and/or one or more insertions in the target DNA sequence. As will be understood to the skilled person, due to the nature of the method according to the invention, the original target DNA sequence is modified by the method according to the invention and is in this way replaced/substituted by the modified target sequence. The target DNA sequence can be any sequence present in the plant, as defined above. The target DNA sequence can be present in an organelle such as mitochondria, be present on a plasmid, or be part of a chromosome. The target DNA might be endogenous to the plant or, at an earlier stage, be introduced in the plant (for example, from another plant). Any DNA sequence present in the plant can be defined as a target DNA sequence, once one has interest in modifying it, for example to introduce a desired property, or phenotype, or to remove a undesired property, op phenotype, but also if one is interested to learn the function of, for example, a gene to which the target DNA belongs, or in case one wants to screen for possible desirable properties by (randomly) introducing modifications in one or more target DNA sequences in the plant.

In a next step, there is introduced a double strand break in the target DNA sequence. The double strand break is preferably no more than 1000 nucleotides, preferably no more than 500, even more preferably no more than 250, even more preferably no more than 100 nucleotides from a position in the target DNA sequence at which a modification is to be introduced (for example a deletion, an insertion or a substitution). For example, in the case in a target DNA sequence comprising the sequence TTTATTT, the A is to be deleted, the double strand break should not be more than 1000, 500, 250 or 100 nucleotides from the A to be deleted. As will be understood by the skilled person, the position of the double strand break is within the target DNA sequence within the context of the current invention, in other words the target DNA sequence is not limited to only that region close to where the modification is to be introduced, but includes the position at which the double strand break is introduced.

The double strand break is introduced in the target DNA sequence by methods known to the skilled person. Double-strand breaks may be created by introduction into the cell nucleus of zinc-finger nucleases (e.g. see Wright et a/.2005 "High frequency homologous recombination in plants mediated by zinc finger nucleases" Plant J. 44, 693-705), meganucleases such as I- Sce1 (Epinat et al., 2003 Nucleic Acids Res. 31 , 2952-2962), or triplex-forming

oligonucleotides coupled to mutagenic chemical groups (Havre et al., 1993 Proc. Natl. Acad. Sci. USA 90, 7989-7983) and Majumdat et al. (J. Biol. Chem. 283, No. 17, pp. 1 1244-

1 1252), and references cited therein (herewith incorporated by reference). Obviously, double strand breaks also occur naturally in the plant cell, albeit with low frequency. Preferably, the double strand break is introduced using zinc finger nucleases, as described herein.

In order to be capable of genetically modifying the plant cell, a donor nucleic acid is provided to the plant cell. The donor nucleic acid comprises a sequence that is homologous to at least part of a portion of (part of) said target DNA sequence, such that homologous recombination can occur between the target DNA sequence and the donor nucleic acid.

The exogenous donor nucleic acid thus includes a sequence that is homologous to at least part of the (endogenous) target DNA in the plant cell, and is presented to/in the cell under conditions which permit homologous recombination to occur between the donor nucleic acid and the target DNA. In a preferred embodiment, the donor nucleic acid comprises a sequence that is homologous to at least part of the target DNA sequence containing or adjacent to the target DNA sequence at which the double strand break is introduced (for example by a nuclease), such that homologous recombination occurs between the donor nucleic acid and the target sequence.

In a preferred embodiment, the donor nucleic acid has at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably 95%, still even more preferably 98%, most preferably 100% identity to at least part of the target DNA. The donor nucleic acid and/or the sequence comprised in said donor nucleic acid and that is homologous to at least part of said target DNA sequence can have any length, as long as it allows for homologous recombination to occur between the target DNA sequence and the donor nucleic acid. In practice, and although the donor nucleic acid and the sequence that is homologous to the at least part of the target DNA can have any length, the length of the sequence of the donor nucleic acid that is homologous to the at least part of the target DNA construct is for example at least 20 nucleotides long and preferably about 1000 nucleotides long. Prior to or simultaneously with performing the step of introducing the at least one donor nucleic acid to the plant cell (performed by such methods known in the art, see Pena, A. 2005. "Transgenic Plants, Methods and Protocols" Methods in Molecular Biology Volume 286, Humana Press ) the step is performed of -temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA; and/or - temporarily suppressing mRNA from a gene encoding a protein involved in the nonhomologous end-joining pathway, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA . It has been found that in particular in plant cells, even more particular in plant cell protoplasts, the efficacy of targeted genetic modification can be further improved in comparison to those methods described in the art described for other organisms, by temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair and/or the non-homologous end-joining pathway (see Examples). In other words, the amount of successful desired homologous recombination events that lead to the introduction of a desired genetic modification in the plant cell is increased by temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair and/or the nonhomologous end-joining pathway. Preferably, this step in the method according to the invention is performed by temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair and the non-homologous end-joining pathway, for at least part, at the same time. Preferably the suppression should be at least 50% in comparison to the situation of no suppression of mRNA.

The term "temporarily" refers to the fact that the suppression is only for a limited period of time, for example for at most 10 days, preferably at most 5 days, even more preferably 3 days. The period of time desirable under particular conditions depends on the type of plant cell used, and depends for example on the period of time that the ZFN and/or donor constructs persist or are present in the cell. Vectors carrying a ZFN or reporter gene such as GFP or GUS show high levels of gene expression beginning after 3 hours after transfection and lasting up to 48 hours at which point the expression levels decrease presumably due to degradation of the vectors which are unable to replicate autonomously. The suppression is for example not the consequence of a genetic modification in the DNA sequence of the gene encoding a protein involved in the cellular mismatch repair and/or the non-homologous end- joining pathway. Such genetic modification, for example leading to lowered expression or a less stable protein, will be passed from generation to generation, and, as was found by the current inventors, will lead to undesired effects, in particular with respect to chromosomal integrity of the DNA of the plant cell.

In contrast, due to the temporarily nature of the suppression in the method according to the invention, in other words the transient suppression as described above, homologous recombination is only temporarily increased in the plant cell, during a period in which a double strand break in introduced in the target sequence and during a period in which a suitable donor nucleic acid is introduced in the plant cell, allowing for improved homologous recombination at the desired position in the target DNA, and with improved efficacy due to the suppression of at least one gene encoding for a protein involved in the cellular mismatch repair and/or the non-homologous end-joining pathway.

Without being bound by theory, the inventors suspect, based on their finding the following: It is generally accepted that introducing a double strand break (DSB) in DNA can increase the rate of homologous recombination in the region of the breakage. This can for example be achieved with so-called endonucleases like the l-Sce I endonuclease from the yeast

Saccharomyces cerevisiae genomes (Thierry et al. /'Cleavage of yeast and bacteriophage T7 genomes at a single site using the rare cutter endonuclease l-Sce I, "Nucleic Acids Res. 19 (1 ) : 189-190 (1991 ) ), or, for example with zinc finger nucleases. Cutting of the DNA in a cell with such enzymes increases homologous recombination at the position where the site has been introduced (see for Example Puchta et al., "Homologous recombination in plant cells is enhanced by in vivo induction of double strand breaks into DNA by a site-specific

endonuclease, Nucleic Acids Res. 21 (22): 5034-5040 (1993) or Townsend et al., High- frequency modification of plant genes using engineered zinc-finger nucleases (2009) Nature 459(7245):442-5.)

Under normal conditions, the cell uses two different methods to repair double strand break (DSB) DSB, non-homologous end joining (NHEJ) or homologous recombination (HR). NHEJ is an inaccurate form of repair and often results in small deletions or insertions at the DSB site. NHEJ utilizes microhomologies (a few complementary bases) from each side of the DSB to stabilize the DNA ends and then a ligase to join the ends back together. Several genes are known to play a role in NHEJ, including KU70, KU80, LIG4, XRCC4, MRE1 1 , RAD50, NBS1 and PARP-1 (see review Hartelrode, A.J. & Scully, R. (2009). Biochem. J. 423: 157-168)

HR is the most accurate form of repair, and is essentially a copy and paste mechanism that normally uses the homologous sequence from the undamaged sister chromatid to repair the DSB. HR is also the basis for the process of gene targeting whereby, rather than the sister chromatid being used for repair, information is copied from a donor construct that is introduced into the cell. The donor construct contains alterations compared with the original chromosomal locus, and thus the process of HR incorporates these alterations the genome. The efficiency of homologous recombination, and thus gene targeting was now surprisingly found to be enhanced under conditions that the NHEJ pathway is temporary suppressed in plant cells, more particular in plant protoplasts.

The cellular mismatch repair (MMR) system also plays a role in homologous recombination. The MMR system is involved in the repair of non-complementary bases in the DNA helix which are a result of the DNA dependent DNA polymerase incorporates the incorrect nucleotide on the newly synthesized (daughter) DNA strand during DNA replication. These replication errors result in mismatch of nucleotides (e.g G:A, T:C, G:G etc) in the DNA duplex which must be corrected to maintain the genetic integrity of the cell.

The MMR complex in E.coli consists of 3 classes of subunits, the MutS, MutL and MutH proteins. There are several MutS proteins that function as heterodimers and are able to bind to mismatches in the DNA duplex. These MutS heterodimers differ in their affinity for different mismatches. Once bound to the mismatch, the MutS heterodimer recruits the MutL heterodimers to the mismatch, which in turn recruits the MutH protein. MutH is able to nick the newly synthesized DNA strand close to and on one side of the mismatch. Beginning at the nick, an exonuclease then degrades the newly synthesized DNA, including the mismatched nucleotide. The repair of the mismatch is then completed by re-synthesis of the daughter strand. The MMR system is ubiquitous and orthologs of MutS and MutL proteins have been found in both prokaryotic and eukaryotic genomes, including those of animals and plants (for review see Kolodner & Marsishky 1999, Curr.Opin. Genet.Dev. 9: 89-96).

In plants, four MutS orthologs (MSH2, MSH3, MSH6 and MSH7) and four MutL orthologs (MLH1 , MLH2, MLH3 and PMS1 ) are present. Mismatch recognition of base-base mispairs or single extrahelical nucleotides is accomplished by MutSa (a MSH2::MSH6 heterodimer) while larger extrahelical loopouts are recognized by MutS3 (MSH2::MSH3 heterodimer). The MSH7 gene has been identified in plants but not thus far in animals. MSH7 is most similar to MSH6 and also forms a heterodimer (MutSv) with MSH2 (Culligan & Hays, 2000, Plant Cell 12: 991 -1002). However, the MutSa and MutSy exhibit somewhat different affinities for the range of mismatches. The MutL orthologs form the following heterodimers, MutLa

(MLH1 ::PMS1 ), MutL3 (MLH1 ::MLH3) and MutLy (MLH1 ::MLH2) and each heterodimer is involved in the repair of a different DNA lesion. MLH1 is the common component of all the heterodimers and also plays a role during meiosis. Plants lacking the C terminus of Mlh1 show an 80% reduction in seed set (Dion et al. 2007 Plant J. 51:431 -440) Human patients with hereditary nonpolyposis colorectal cancer (HNPCC) syndrome have a defective MMR system, with defects in MLH1 being the most common cause of the disease. The MMR system plays a role in HR inhibiting recombination between non-identical sequences. During DSB repair by HR, the DNA sequence information from the undamaged locus on the sister chromatid is normally used, restoring the original sequence of the damaged locus. Due to the complexity of the genome however, it is possible that a similar, but not identical, sequence is used for repair. If allowed to proceed, this would result in the copying of (under normal conditions) the incorrect DNA sequence to repair the DSB and seriously affect the genomic integrity of the cell. The MMR system plays a central role in detecting the sequence mismatches between the damaged and the non-identical intact locus and aborting the copying process (Trouillier et al. 2006. Nucleic Acids Res. 34, No.1 ).

The current inventor now found that by suppressing the MMR system, more in particular by temporarily suppressing mRNA derived from a gene encoding a protein involved in the MMR system, targeted genetic modification, using a donor nucleic acid comprising the genetic modification to be introduced in the target DNA sequence, efficiency is improved since the MMR system is temporarily unable to detect any sequence mismatches between the damaged and the non-identical intact locus, thus allowing the process to continue.

The inventors for the first time realize that although the cellular homologous recombination machinery can advantageously be used for targeted genetic modification, efficiency of the process can be improved by in fact inhibiting/suppressing part of the machinery, more in particular the MMR system, that normally plays an important role in HR.

It was realized by the current inventors that the challenge is to devise a methodology whereby a plant cell can be isolated that has a down regulation of the NHEJ or MMR pathways, preferably both, and is in a state where it is amenable to introduction of DNA which is able to create and repair a DSB (for example zinc finger nucleases and donor constructs). A common method to suppress such pathways is to isolate plant lines which have mutations in genes involved in these pathways. Such mutants can be isolated from collections of plants containing randomly inserted transposons or T-DNA copies. If the sequence is known, then such collections can be screened for plant lines containing a transposon and/or T-DNA inserted into the gene of interest. The insertions usually inactivate the gene by disruption of the coding sequence. As such insertions usually give a recessive phenotype, the lines must be first selfed to obtain lines homozygous for the insertion event. The problem, and thus the work and time involved, becomes greater when multiple knockouts are required. Multiple mutants must be crossed and then selfed to generate the required lines.

Such insertion collections are only available for a limited number of plant species, including the models Arabidopsis thaliana, Lotus japonica and the crop species Zea mays. For other crops, EMS-treated collections are available which can be screened for mutations in the gene of interest by TILLING (Barkley, N.A. & Wang, M.L. 2008. Curr Genomics 9, 212-216) or sequence based methods (Rigola, D. et al. 2009. Plos One 4, e4761 ), but the mutation density in such populations is often low and due to the nature of single nucleotide alterations, most mutations do not alter the protein function.

In any case, a permanent disruption of a gene is not desirable for the goal of the current invention as a permanent knock-out also mean permanent and possible undesirable knockout of the pathways.

An alternative method for down regulation of gene activity in crop plants is RNA interference (RNAi) (see review: Kusaba, M. 2004. Curr Opin Biotechnol. 15: 139-143). RNAi uses constructs that consist of identical complementary regions of the target gene cloned as an inverted repeat and separated by a short non-specific DNA sequence. This construct can be introduced into the plant cell as a transgene which then becomes stably integrated into the plant genome. Upon transcription, the complementary regions anneal to form a region of double stranded RNA with the non-specific DNA forming a loop structure. This double stranded RNA region is then processed into small interfering RNAs (siRNA) by DICER, which are then incorporated into the RISC complex and cause degradation of the target mRNA. Less (or none) of the target protein is produced, giving the desired dominant phenotype.

While this approach does not require screening of large collections of plants, constructs must be generated and transgenic lines produced. For many crop plants, this is not trivial. For instance, it takes approximately a year to produce a transgenic rice plant and for many crop species protocols for transformation are not yet known.

For efficient gene targeting using, for example, ZFN's, plant protoplasts are preferred (Townsend et al., High-frequency modification of plant genes using engineered zinc-finger nucleases (2009) Nature 459(7245):442-5.). This is because protoplasts can be isolated in large numbers and multiple DNA constructs can be simultaneously transformed by chemical or electroporation methods, achieving high transformation efficiency. This is useful when applying the ZFN technology to plants because three DNA constructs must be

simultaneously introduced into the plant cell, two ZFN constructs and the donor construct for gene targeting. On the other hand, it was found that in protoplasts the NHEJ and/or the MMR pathway/system are upregulated (see Examples) making (in first instance) plant protoplast less desirable as a system for targeted genetic modification. By the current method however, the inventors have achieved overcoming many of the above problems, without the necessity of producing transgenic plant lines.

Indeed, the present inventors have found that the efficiency of gene targeting in plant cells may be significantly improved by the transient suppression of the NHEJ and/or MMR pathways in plant protoplasts. The method includes, in a preferred embodiment,

simultaneous transfection of in vitro synthesized dsRNA (Zhai et al. 2009. Plant Phys. 149, 642-652) driving the degradation of endogenous NHEJ and MMR mRNA's together with ZFN's and donor constructs to produce the desired gene targeting outcome. As down regulation of transcript levels by dsRNA is transient, the NHEJ and MMR systems will only be inactivated for, for example, 48-72 hrs. However, this is sufficient as exogenously added DNA is degraded rapidly in plant protoplasts and eliminated after, for example, 72 hours. After this period the NHEJ and/or MMR transcripts will return to their normal levels thus preventing undesirable effects of permanent down regulation. This method is applicable to a wide range of plant species as protoplast isolation and transfection is broadly applicable and removes the major bottlenecks which prevent efficient gene targeting in crop species.

In a preferred embodiment of the method according to the invention, the plant cell is a protoplast, even though the MMR pathway and/or the NHEJ pathway are upregulated in the protoplast. It was surprisingly found that even in protoplasts the MMR pathway and/or NHEJ pathway could efficiently be temporarily suppressed, as described herein.

In a preferred embodiment, the step of temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA and/or temporarily suppressing mRNA from a gene encoding a protein involved in the non-homologous end-joining pathway, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA , comprises introducing double-stranded RNA into said plant cells. The double stranded RNA comprises at least one sequence that is substantially

complementary to at least part of a mRNA derived from a gene encoding a protein involved in the cellular mismatch repair pathway (MMR system) and/or to at least part of a mRNA derived from a gene encoding a protein involved in the non-homologous end-joining pathway. Preferably, the dsRNA comprises sequences that are substantially complementary to at least part of a mRNA derived from a gene encoding a protein involved in the cellular mismatch repair pathway (MMR system) and to at least part of a mRNA derived from a gene encoding a protein involved in the non-homologous end-joining pathway (NHEJ).

In another embodiment, at least one dsRNA comprising at least one sequence that is substantially complementary to at least part of a mRNA derived from a gene encoding a protein involved in the cellular mismatch repair pathway (MMR system) and at least one dsRNA comprising at least one sequence that is substantially complementary to at least part of a mRNA derived from a gene encoding a protein involved in the non-homologous end- joining pathway are used.

The sequence comprised in the dsRNA is considered "substantially complementary" as used herein, as long as it is capable of down regulating the expression of a protein involved in the cellular mismatch repair pathway and/or the non-homologous end joining pathway, for example since it is capable of inducing endogenous mRNA degradation (for example via the Dicer enzyme; see below). In a preferred embodiment, the sequence comprised in the dsRNA has at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably 95%, still even more preferably 98%, most preferably 100% identity to at least part of the sequence of a mRNA derived from a gene encoding a protein involved in the cellular mismatch repair pathway (MMR system) and/or has at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably 95%, still even more preferably 98%, most preferably 100% identity to at least part of the sequence of a mRNA derived from a gene encoding a protein involved in the non-homologous end-joining pathway.

The dsRNA can have any length, for example 50-500 bp, or even longer. The skilled person knowns how to prepare such dsRNA according to the invention. For example, a method has been described in the literature for the transient down regulation of specific mRNA's in plant protoplasts. An et al. (2003 Biosci.Biotechnol.Biochem. 67: 2674-2677) prepared long double stranded RNA (dsRNA) targeted to luciferase by in vitro transcription. This was then co- transformed into Arabidopsis protoplasts together with a luciferase expressing plasmid and was shown to suppress transient luciferase activity. This suppression was independent of the length of the dsRNA used (50 bp, 100 bp, 250 bp or 500 bp) and a 90% inhibition luciferase expression was observed up to 14 days after protoplast transformation. It is believed that the in vitro prepared dsRNA is also recognized the DICER enzyme and processed into shorter fragments which can induce endogenous mRNA degradation.

It is still important to establish that in vitro prepared dsRNA can down regulate endogenous plant genes which, compared with transient luciferase expression, are expressed at relatively low levels, and is able to do so in a manner and with an efficacy that allows application in the method according to the invention ,

Although according to the current invention, also siRNA might be used as a method for suppressing mRNA derived from a gene encoding a protein involved in the MMR pathway and/or NHEJ pathway, it was found that for the method according to the current invention, and in plant cells, dsRNA is more suitable for the transient suppression of endogenous gene transcripts that these other types of RNA molecules (siRNA) more routinely used in animal studies.

siRNA's are short (-21 nt) single stranded RNA molecules that are synthesized in vitro and then transfected to the cells where they are directly incorporated into the RISC complex and direct the sequence specific cleavage of homologous mRNA's. While siRNAs work efficiently in animal cells, their use in the method according to the invention seems limited, although it has been suggested that expression of siRNA's is sufficient to inhibit the accumulation of plant viruses in cultured plant cells (Vanitharani et al. 2003 Proc. Natl. Acad. Sci. USA 100: 9632-9636) or to reduce the transient expression of exogenously added GUS or luciferase genes (Bart et al. 2006 Plant Methods 2: 13).

In contrast, in animal cells, dsRNA is not suitable for the suppression of endogenous mammalian gene transcripts. In mammalian cells dsRNA causes non-specific suppression and degradation of all mRNA species via the interferon pathway which is important as a defense system against viral infection and is triggered by viral dsRNA. Transfection of dsRNA to animal cells thus results in activation of this pathway and apoptosis. Therefore, the knowledge for animal cells cannot easily be copied to plant cells, and visa versa.

In a preferred embodiment, the method according to the invention comprises temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair and temporarily suppressing mRNA from a gene encoding a protein involved in the nonhomologous end-joining pathway, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA. It has been found that in particular the combination of temporarily suppressing at least one protein from both pathways described above is advantageous in a method for targeted genetic modification according to the invention. In another embodiment, the protein involved in cellular mismatch repair is selected from the group consisting of MutS orthologs, including MSH2, MSH3, MSH6 and MSH7, MutL orthologs including MLH1 , MLH2, MLH3 and PMS1 (In Arabidopsis named At3g18524 (MSH2), At4g25540 (MSH3), At4g02070 (MSH6), At3g24495 (MSH7), At4g09140 (MLH1 ), At5g54090 (MLH3), At4g02460 (PMS1 )). In another embodiment, the protein involved in non-homologous end-joining pathway is selected from the group consisting of Rad50

(At2g31970), Mre1 1 (At5g54260), NBS1 (At3g02680), Ku70 (At1 g16970), Ku80

(At1 g48050), Lig4 (At5g57160), XRCC4 (At3g23100), and PARP-1 (At4g02390), PARP-2 (At2g31320).

In a preferred embodiment more than one protein, preferably from both pathways is down- regulated by suppressing the corresponding mRNA's.

In another embodiment, a compound selected from the group consisting of vanillin, salvicin, OK-1035, LY294002, NU7026, NU7441 , IC87102, IC87361 , AG14361 , NU1025, PARP-1 inhibitors, UCN-01 , Go6976, SB-218078, Caffeine, Vanadate, cadmium, Anthracen and derivatives, H7 and Quercetin is added during or prior to the step of temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA; and/or temporarily suppressing mRNA from a gene encoding a protein involved in the non-homologous end-joining pathway, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA . As already suggested above, in a preferred embodiment of the invention, the said double strand break is introduced by contacting a zinc finger endonuclease (ZFN or ZFE) comprising an endonuclease domain that cuts DNA and a zinc finger domain comprising a plurality of zinc fingers that bind to a (specific) nucleotide sequence within said target DNA in said plant cell with said endogenous chromosomal target DNA sequence to allow said zinc finger endonuclease to cut both strands of a nucleotide sequence within said target DNA sequence.

A ZFN includes a zinc finger domain with specific binding affinity for a desired specific target sequence, in the current invention to a sequence in the target DNA. The specific nucleic acid sequence can be any sequence in a nucleic acid region where it is desired to enhance homologous recombination. For example, the nucleic acid region may be a region which contains a gene in which it is desired to introduce a mutation, such as a point mutation or deletion, insertion or substitution, or a region into which it is desired to introduce a gene conferring a desired phenotype.

There are a large number of naturally occurring zinc finger DNA binding proteins which contain zinc finger domains that may be incorporated into a ZFN designed to bind to a specific endogenous sequence. Each individual zinc finger in the ZFN recognizes a stretch of three consecutive nucleic acid base pairs. The ZFN may have a variable number of zinc fingers. For example, ZFNs with between one and six zinc fingers can be designed.

Therefore, the ZFNs used in the methods of the present invention may be designed to recognize any desired endogenous target sequence, thereby avoiding the necessity of introducing a cleavage site recognized by the endonuclease into the genome through genetic engineering.

Appropriate ZFN domains can be designed based upon many different considerations. For example, a yeast HO domain can be linked to a single protein that contains six zinc fingers because the HO domain cuts both strands of DNA. Alternatively, the Fok I endonuclease domain only cuts double stranded DNA as a dimer. Therefore, two ZFN proteins can be made and used. These ZFNs can each have a Fok I endonuclease domain and a zinc finger domain with three fingers. They can be designed so that both Fok I ZFNs bind to the DNA and dimerise. The designs and use of zinc fingers in known to the skilled person, and is, for example described in detail in Segal et al. (1999. Proc.Natl.Acad.Sci.USA 96, 2758-2763).

In a preferred embodiment, the zinc finger is introduced to the cell by transfecting said plant cells with a vector comprising a cDNA encoding said zinc finger nuclease and expressing a zinc finger nuclease protein in said plant cell. The skilled person knows how to prepare such vector comprising cDNA encoding said desired zinc finger nuclease.

The method according to the invention can be used for any desirable genetic modification including insertion, deletion or substitution, or for creating a knock-out of for random mutagenesis. For example, in some embodiments, the donor nucleic acid may comprise a gene which is desired to be introduced into the genome of the cell. In some embodiments, the gene may be operably linked to a promoter. In some embodiments the gene may be a gene from the same organism as the cells in which it is to be introduced. For example, the gene may be a wild type gene which rescues a genetic defect in the cell after it is introduced through homologous recombination. Alternatively, the gene may confer a desired phenotype, such as disease resistance or enhanced nutritional value, on the organism in which it is introduced. In some embodiments, the insertion sequence introduces a point mutation into an endogenous chromosomal gene after homologous recombination has occurred. The point mutation may disrupt the endogenous chromosomal gene or, alternatively, the point mutation may enhance or restore its activity. In other embodiments, the insertion sequence introduces a deletion into an endogenous chromosomal gene after homologous recombination has occurred. In such embodiments, the insertion sequence may "knock out" the target gene.

In an embodiment of the current method at least at least 1 ,2,3,4,5,6,7,8,9,10 or more nucleotides in the target DNA sequence are modified. In another embodiment, the donor nucleic acid comprises at least 1 ,2,3,4,5,6,7,8,9,10 or more nucleotides different in comparison to the target DNA.

In another embodiment, the method according to the invention can be used for introducing random substitutions in the target DNA sequence, for example by simultaneously presenting various donor nucleic acids to various plant cells (in the same experiment), and wherein these various donor nucleic acids each target the same target DNA sequence, but differ from each other with respect to for example one, two or more nucleotides, thereby capable of introduction of distinct modification in the target DNA. By treating plant cells with the above method, a collection of different mutants will be obtained, and which can be screened, for example, for a preferred phenotype of characteristic.

In other words, there is provided for a method according to the invention, wherein at least 2 donor nucleic acids for the target DNA are provided simultaneously to at least 2, preferably a plurality of plant cells, and wherein said at least 2 donor nucleic acids are capable of introduction distinct modifications in the target DNA.

Also provided is a method according to the invention wherein at least two target DNA's are modified by providing in step c) of claim 1 at least two donor nucleic acids, and wherein each donor nucleic acid is capable of introducing a modification in one of the at least two target DNA's. This embodiment allows for introducing a genetic modification in two different target DNA sequences in the plant cell, for example in two different genes, or at two distinct positions in a gene, thereby creating double-mutants, or allowing for screening for double mutants (in particular when using at least two donor nucleic acids for each target DNA sequence, each donor nucleic acid capable of introducing a distinct genetic modification in the target sequence).

In an embodiment, the plant is a monocotyledon, preferably selected from the group consisting of maize, rice or wheat; or a dicotyledon, preferably selected from the group consisting of potato, soybean, tomato, members of the Brassica family, or Arabidopsis; or a tree.

Legends to the Figures

Figure 1 shows the levels of MSH2 in tobacco and tomato protoplasts upon addition of dsRNA.

Figure 2 displays inhibition of NHEJ genes Ku70 and Rad50 in tomato protoplasts by dsRNA. Figure 3 displays inhibition of the MMR gene MLH1 in tomato protoplasts by dsRNA.

Figure 4 is a schematic overview of formation of DNA double strand breaks by a zinc finger nuclease (ZFN). Zinc finger nucleases are designed which recognize a specific sequence (in this case 9 bps) on either the upper or lower DNA strand. Dimerization of the Fokl nuclease domain produces a DNA double strand break which is repaired by either non-homologous end joining (NHEJ) or homologous recombination (HR).

Figure 5 is a schematic overview of DSB repair by either the NHEJ or HR pathways. Repair of the DSB by the NHEJ pathway involves the proteins Ku70 and PARP-1 . Ku70 binds to and stabilizes the DNA ends and recruits additional factors for re-ligation. This pathway is error prone and can lead to the formation of INDEL's at the position of the DSB. Repair of the DSB by the HR pathway involves in this case copying of information from an introduced donor construct which is introduced into the cell along with the ZFN constructs. The donor construct contains an deliberate engineered mutation that, upon HR, becomes introduced into the plant genome. This mutation is recognized by components of the mismatch repair system (MMR) which normally detects nucleotide differences between almost identical sequences. The MMR system thus aborts the HR process, thus reducing the efficiency of gene targeting. Figure 6 is a schematic overview of a preferred embodiment of the method according to the invention, showing use of double stranded RNA to enhance ZFN mediated gene targeting. Double stranded RNA (dsRNA) is produced to down regulate the levels of Ku70 so that it is no longer available for DNA end binding. The NHEJ pathway can be further inhibited by addition of chemicals to inhibit PARP-1 action. This shutdown of the NHEJ pathway ensures that more DSB's are shuttled into the HR pathway. During HR, dsRNA to down regulate the levels of MSH2 / MLH1 , key enzymes in the MMR system, are present. This ensures that the mutation on the donor construct is no longer recognized by the MMR system, and inhibition of HR by MMR does not occur. Figure 7 is a schematic overview of a in particular preferred embodiment of the method according to the invention, showing gene targeting in plant protoplasts. Through the use of plant protoplasts, many different types of nucleic acids (RNA, DNA, dsRNA) can be introduced and the cells can also be treated with chemicals. The protoplasts are isolated from any plant material, treated, and then regenerated into mature plants.

Examples

Example 1

Transient suppression of MMR and NHEJ mRNA in tobacco and tomato protoplasts

Experiments were performed to demonstrate that dsRNA is able to down regulate

endogenous mRNA's of the MMR and NHEJ pathways in tobacco and tomato protoplasts. Plant Mismatch Repair genes

The public databases were screened for tobacco and tomato EST's sharing homology with genes involved in the MMR pathway (MSH2 and MLH1 ) and the NHEJ pathway (Ku70). The regions used to produce dsRNA are underlined (see below). dsRNA was produced as previously described (Zhai et al. 2009. Plant Phys. 149, 642-652). In addition, we also generated a non-specific dsRNA species derived from a plasmid which shows no significant homology with any of the genes of interest (see below). This was used as a control to demonstrate that the presence of dsRNA per se is not responsible for suppression of specific mRNA's.

Tobacco MLH1 (SEQ ID NO:1 )

ccgaaggagccgccgaagataaagcggctggaggaatcagtagtgaacagaatcgcagctggggaagtaatccaacggcc agtatctgcagtaaaagagctcatcgaaaacagcttagatgctaattccacctctatctccgtcgtcgttaaggattccggccttaaa cttatccaagtttccgacgacggccacggcatacgttacgaagatttacccattttatgcgagcggcacacgacgtctaagctgagt aagtttgaagatttacagacgattagttcaatgggatttagaggtgaagctttagctagtatgacttacgtaggtcacgtaactgtcac tactattaccgacggccagctgtacggatacagagcaacgtatagagatggtttaatggtagatgaaccaaaaccttgtgctgctg ttaaaggtacacagataatgattgagaatttattttataacatggcggcgcgaaggaaaaccctagagaattcttcggccgatgatt atccgaaaattgttgacctaattagtaggtttgcaattcatcacattaatgtgagcttctcttgtagaaaacatggagctggtagagca gatgtttacagtctagctacttgttcgaggattgattcgattagatctgtttatggagtttcagttgctcgaaatctgatgaaaattgaagtt tctgatactggt

Tomato MLH1 (SEQ ID NO: 2)

atggaagacgaagccattccagtgccgattccgaaggagccaccgaagattcagcggctggaagaatgtgtggtgaacagaa tagcggctggcgaagtcatccaaaggccagtctctgccgtgaaagagctcattgagaacagcctggatgctgattccacctctatt tccgttgttgttaaggatggcggtcttaaacttatccaagtttccgacgatggccatggaatccgttatgaagatttgccaattttatgcg agaggtatactacgtccaagctgagtaaatttgaagatttgcagtccattaggtcgatgggatttagaggagaagccttggctagc atgacatatgtgggtcacgtcactgtcaccaccattactatgggccagttgcatggatacagggcaacatatagagatggtttgatg gtggatgagccaaaggcttgtgctgctgtcaagggtacccagataatgattgaaaatttattttataacatggctgcacgaaggaa aacccttcaaaattctgccgatgactatccaaaaattgttgacattattagtaggtttggaattcatcacacacatgtgagcttctcttgt agaaagcatggagctggtagagcagatgttcacactattgctacttcttcaaggctcgatgcaattagatccgtttatggagcttcag ttgctcgagatctgatgaatatcgaagtttctgatactggtccattaatttcagtttttaagatggatggtttcatctccaactctaattatatt gcgaagaagacaacaatggtgctttttataaatgatagactcattgattgtggtgctttgaagagggcaattgaaatagtctatactg caacattgcctaaagcatcaaaacctttcatatacatgtcaatcattttgccgcccgagcatgttgatgtgaatatacacccaacaa agagagaggtaagctttttgaatcaagagttcgtcattgagaagatccagtctgtagtagggtcaaaattgagaagctccaatgag tcgaggacattccaggaacagactatggatttatcttcatctggtccaatgggccaagattccactaaagaatcgtctccttctggga taaagtcacaaaaagtgccacataaaatggtacgaacagatactttggacccttctggaaggctgcacgcttacatgcaaatga agcctcctggtaattcagaaagaggtccttgctttagctctgtgaggtcttctatcagacaaaggaggaatcctagtgacaccgcag acctcactagcatccaagagctcgttaatgagattgataatgactgtcaccctggtctattggatattgttaggaattgcacatatact gggatggcggatgagatttttgctttgcttcaacacaatacacacctttatcttgttaatgtgattaacttgagtaaagagcttatgtatca gcaagttttacgtcggtttgcccatttcaatgcaattcaactgagtgaaccagcatcattacctgagttagtaatgcttgctctgaaaga agagggttcagatccagaaggcaacgaaagcaaagagctaagaggaaagattgccgagattgaatacagaactgctcaagc aaaaggctggaatgctagaaggagtattttagtattcattatcgattcaaatggaaatatgtctagtcttcctgtatactgggatcagta cacacctgacatgggaccgcatcccagaaatttattactttggttcaggaaaattttgaactggggaaggacgaaaaaatttggtttt caagacaattggctggtggtcctaaggaaaatttttttgccatgcattccgccattattgcctaaatccctcaggggatggcttgaaatt ctacagaagagagaactttcaagtggttcagaagtaacttcaatagataacatagagaatgataccacggaggctgaatttgac gaagaactacgtttggaggctgaaaatgcctgggctcaacgtgaatggtcaattcagcatgttctgtttccctccctcaggctcttctt caagccccctacttccatggttacaaatggaacttttgttcaggttgcatcactggaaaagctctacagaattttcgagagatgttaaa cctaggagaattttgatgtggcctccttgaagcaaaaggatgtaaaatgtacagtttctgatttgagaaggaaattccctggccccta cccccaaagaaccaaaatatgaaaaactggttcaactttttttttggtgtgaagacaaccacccccctacatcaaacgttttattgtg aaaagaagcaaaaatggaaggaatacattttgtctcttttactctattccatcaaactagtggtgtagacatggtgttatacgcaaga aatgagttaagcaaataggagttcaaaagaaaaaaaaaaaaaaaaaa

Tobacco MSH2 (SEQ ID NO: 3)

GGAGCTACTGATAGATCATTGATTATAATTGATGAGTTGGGCCGTGGTACATCAACCTAT G ATG G CTTTG GTTTAG CTTG GG CTATTTGTG AGCACATTGTTG AAG AAATTAAG GCACCA ACATTGTTTG CCACTCACTTTCATG AGCTG ACTG CATTG G CCAACAAG AATG GTAACAAT G GACATAAGC AAAATG CTGG G ATAG CAAATTTTC ATGTTTTTG CACACATTGACCCTTCT AATCG CAAG CTAACTATG CTTTACAAGGTTCAACC AG GTG CTTGTG ATCAG AGTTTTG GT ATTCATGTTGCTGAATTTGCAAATTTTCCACCGAGTGTTGTGGCCCTGGCCAGAGAAAA GGCATCTGAGTTGGAGGATTTCTCTCCTATTGCCATAATTCCAAATGACATTAAAGAGGC AGCTTCAAAACGGAAGAGAGAATTTGACCCTCATGACGTGTCTAGAGGTACTGCCAGAG CTCGGCAATTCTTACAGGATTTCTCTCAGTTGCCACTGGATAAGATGGATCCAAGCGAG GTCAGGCAACAGTTGAGCAAAATGAAAACCGACCTGGAGAGGGATGCAGTTGACTCTC ACTGGTTTCAGCAATTCTTTTAGTTCTTCAGATTAGAACTATATCTTCTATTCTGTGAAGC TTGGGGGAATGATAGTGATGGGTTTTGTGGATATAACTTAGCCTAAGTGTAAAGTTTCGT TTAAATCCTTACCCCAAACATGATTCTCTGTAATCAGGGGACTTTTGTATGCATCCTGTG TTAAATAGTAAACGTTATCTTATGGTCAGCTAACATTGGTAGTAGTCTATTGAATTATTCC TTCACAACGACTAAACAACCTTCCCTTCTCTTAAAACACCCTAAACT Tomato MSH2 (SEQ ID NO 4)

TTTG ATG G CTTTGGTTTAGCTTG G GCTATTTGTG AG CAC ATTGTTGAAGAAATTAAAGC A CCAACATTGTTTGCCACTCACTTTCATGAGCTGACTGCATTAGCCAACAAGAATGGAGA CAATGGACATAAGAAAAATGCTGGGATAGCAAATTTTCATGTTTTTGCACACATTGACCC TTCTAATCG CAAG CTAACTATG CTTTACAAG GTTCACCC AG GTGCTTGTG ATC AG AGTTT TGGTATTCATGTTGCTGAATTTGCAAATTTTCCACCGAGTGTTGTGGCCCTGGCTAGAGA AAAGGCATCTGAGTTGGAGGATTTCTCTCCTATTGCCATAATTCCAAATGACATTAAAGA GGCAGCTTCAAAACGGAAGAGAGAATTTGACCGCCATGACGTGTCTAGAGGTACTGCC AGAGCTCGGCAATTCTTACAGGATTTCGCTCAGTTGCCACTGGATAAGATGGATCCAAA CGAGGTCAGGCAACAGTTA

Tobacco Ku70 (SEQ ID NO 5)

TG CTGCTATAATTCAG GAG CCTGTAAAG CG CTTTCAATCTTACAAAAATGAG AACGTCAT GTTTTCTATGGATGAGCTTTCAGAAGTCAAGAGAGTTTCAACTGGTCATCTTCGTCTTCT GGGCTTCAAGCCATTAAGCTGCTTAAAGGATTATCATAACCTGAAGCCAGCAACTTTTGT CTTTCCCAGTGATGAGGAACTGATTGGAAGCACTTGTCTTTTCGTTGCTCTCCACAGATC AATGGTGCGGCTTAAGCGCTTTGCAGTTGCTTTCTATGGGAATTCAAGTCATCCTCAATT GGTTGCTCTTGTTGCACAAGATGAAATAATGACTCCTAGTGGTCAAGTCGAGCCACCAG GGATGCATCTCATTTATCTTCCACATTCTGACGATATCAGACATGTTGAAGAGCTTCATA CTGATCCAAATTCCGTACCTCATGCAACTGACGACCAGATAAAGAAGGCCTCTGCTTTA GTGAGACGTATTGACCTCAAAGATTTTTCCGTGTGTCAATTCGCCAATCCTGCATTGCAG AGACATTATGCAGTATTGCAAGCTCTTGCACTTGATGAAGACGAGATGCCTGAAATTAAA GACGAGACTCTTCCCGATGAAGAAGGGATGGCCAGGCCTGGTATTGTCAAAGCATTGG AAG AATTTAAG CTCTCTGTATATG G GG AGAACTATG AG G AGG ACGATG CAAAAACTGAT GGAAAAGCTGAACCCTCTAGGAAACGGAAAGCGAATGCTATGAAAGAATATTCCAACTA TG ACTG GTCTG ACCTTG CAGATAATG G GAAGTTAAAG GATTTAACAGTG GTAG AGC

Tomato Ku70 (SEQ ID NO 6)

GGAAGATCTGAACGACCAGCTTAGGAAACGCATGTTTAAGAAGCGCAGAGTTCGAAGA CTTCGACTTGTAATTTTTAATGGATTATCTATCGAACTTAACACCTATGCTTTGATCCGTC CAACTAATCCAGGGACAATTACTTGGCTTGATTCGATGACTAATCTTCCTTTGAAGACTG AGAGAACCTTCATATGTGCTGATACTGGTGCTATAGTTCAGGAGCCTCTAAAACGCTTTC AGTCTTACAAAAATGAGAATGTCATCTTTTCTGCGGATGAGCTTTCAGAAGTCAAAAGAG TTTCAACTG G ACATCTTCGTCTGTTG G GCTTCAAGC CTTTGAG CTGCTTAAAAG ACTATC ATAACCTG AAG CCAG CAACTTTTGTCTTTC CCAGTG ATG AGG AAGTG GTTG G AAG CACT TGTCTTTTCGTTGCTCTCCAAAGATCAATGTTGCGGCTTAAGCGTTTTGCAGTTGCTTTC TATGGGAATTTAAGTCATCCTCAATTGGTTGCTCTTGTTGCACAAGATGAAGTAATGACT CCTAGTGGTCAAGTCGAGCCACCAGGGATGCATCTGATTTATCTTCCATATTCTGATGAT ATCAGACATGTTGAAGAGCTTCATACTGATCCTAATTCCGTGCCTCATGCCACTGATGAC CAGATAAAGAAGGCCTCCGCTTTAGTGAGACGTATTGACCTCAAAGATTTTTCTGTGTG GCAATTTGCTAATCCTGCATTGCAGAGACATTATGCAGTATTACAAGCTCTTGCACTTG Tomato RAD50 (SEQ ID NO 7)

TAGATGCGCTAATACAATCTGTATTAACATTTGACAGGCTTTTCCAAGGGATTCAGGTTC GGCAGAAGCAGGTTGATGATTTGGAATATGGTCTAGATATCCGTGGGCAAGGGGTAAG ATCCATGGAGGAAATTCAATCAGAATTGGATGAACTGCAGAGCAAAAAAGACAATTTGTA TACGGAGGTGGAGAAGCTGAGAAATGACCAGAGATACATGGAAAATGAATATGCAAGTT TCCAACTAAGATG GG CTAATGTAAG GG AAG AGAAGTCACG AGTAG CAAACAGATTG GA G CAAATTAAAAG G ATAGAAG AG G AATTGG ATCGCTTCACG G AG GAG AAAAATCAAATTG AGCTTG AAG AG AAG CATCTTGC AG AC GCTTTTG GTTCCTTATTGAAG G AAAAG GACAAA CACTTTAGAGACCACAAGGATCTGAAAATAAAACTTGGTGAACAGTTGGAAGAGCAGGC AGAAATTAGAAGAAATTATCAACAGGAAGTAGATTCACTTTTGAAGATTACCTCCAAAATT AAAGAATATTATGATTTG AAG AAAG AACAAAG ATTG AATG AACTG CAG G ACAAG CG AAG CCTGTCAGAATCTCAACTCCAAAGTTGCGAGTCCAGAAAGGATGCGATTTTGGCTGAAG TGAAGAAAAGTAAGGATTTAATGGGGAACCAGGATAGGTTGAGACGTAACATTGAGGAT AACTTGAACTATCGTAAAATTAAGTCTGAAGTTGATGAGCTCACTCATGAGATTGAATTA CTG G AAGATAAAGTG CTG ACGTTG G GTG G GTTTTCTTCTGTTGAAG CTG AGCTTAAAAA GCTTTCACACGAAAGAGAGAGGCTACTCTCTGAGTTAAACAAGTGTCATGGCACCTTAT CTGTTTATCAAAG CAATATCTCCAAG AACAAAGTTG ATCTTAAG CAG G CACAAT ACAAG G ATATTG ACAAACG CTATTTTGATCAG CTAATCC AG CTTAAG ACTACG GAG ATG GC AAACA AGGATCTGGACAGATATTACAATGCCCTTGATAAAGCACTGATGCGATTCCACTCAATGA AAATG G AAG AAATAAATAAG ATTATC AG G G AACTGTG G C AAC AAAC ATAC AG G G G C CAG GACATAGACTACATAAGCATTCATTCACATTCTGAAGGATCTGGCACTCGATCCTACAGC TATAAGGTTGTGATGTTGACTGGTGATACTGAACTAGAAATGCGAGGGAGGTGTAGTGC TGGCCAAAAGGTCCTTGCATCACTCATCATACGATTGGCGTTGGCTGAAACTTTTTGTCT CAACTGCGGAATTCTAGCACTGGATGAACCTACCACAAACCTAGACGGCCCCAACAGTG AGAGTCTTGCTGCAGCTCTGTTAAGAATTATGGAGGACAGAAAAGGCCAAGAAAACTTT CAACTAATTGTCATTACACACGATGAGCGATTTGCTCAATATATTGGCCAACGCCAGCAT GCAGAAAAGTATTATCGCATCTCAAAAGACGACCATCAGCACAGTATAATTGAAGCTCAA GAAATATTTGATTGATATCACATGGTTTCAGTCTCCGACGGTATTATATATTAAGACGCTT CATAGCTCGACTTATGTAC

Sequence used for the production of the non-specific dsRNA (SEQ ID NO 8)

GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTT ACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCC AGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTAC Tobacco protoplast isolation

In vitro shoot cultures of Nicotiana tabacum cv Petit Havana line SR1 are maintained on MS20 medium with 0.8% Difco agar in high glass jars at 16/8 h photoperiod of 2000 lux at 25°C and 60-70% RH. MS20 medium is basic Murashige and Skoog's medium (Murashige, T. and Skoog, F., Physiologia Plantarum, 1_5: 473-497, 1962) containing 2% (w/v) sucrose, no added hormones and 0.8% Difco agar. Fully expanded leaves of 3-6 week old shoot cultures are harvested. The leaves are sliced into 1 mm thin strips, which are then transferred to large (100 mm x 100 mm) Petri dishes containing 45 ml MDE basal medium for a preplasmolysis treatment of 30 min. MDE basal medium contained 0.25 g KCI, 1 .0 g MgS0₄.7H₂0, 0.136 g of KH₂P0₄, 2.5 g polyvinylpyrrolidone (MW 10,000), 6 mg naphthalene acetic acid and 2 mg 6-benzylaminopurine in a total volume of 900 ml. The osmolality of the solution is adjusted to 600 mOsm.kg^"1 with sorbitol, the pH to 5.7. 5 mL of enzyme stock SR1 are then added. The enzyme stock consists of 750 mg Cellulase Onozuka R10, 500 mg driselase and 250 mg macerozyme R10 per 100 ml, filtered over Whatman paper and filter- sterilized. Digestion is allowed to proceed overnight in the dark at 25°C. The digested leaves are filtered through 50 μηη nylon sieves into a sterile beaker. An equal volume of cold KCI wash medium is used to wash the sieve and pooled with the protoplast suspension. KCI wash medium consisted of 2.0 g CaCI₂.2H₂0 per liter and a sufficient quantity of mannitol to bring the osmolality to 540 mOsm.kg^"1. The suspension is transferred to 10 mL tubes and protoplasts are pelleted for 10 min at 85x g at 4^°C. The supernatant is discarded and the protoplast pellets carefully resuspended into 5 mL cold MLm wash medium, which is the macro-nutrients of MS medium (Murashige, T. and Skoog, F., Physiologia Plantarum, 1_5: 473-497, 1962) at half the normal concentration, 2.2 g of CaCI₂.2H₂0 per liter and a quantity of mannitol to bring the osmolality to 540 mOsm.kg^"1. The content of 2 tubes is combined and centrifuged for 10 min at 85x g at 4^°C. The supernatant is discarded and the protoplast pellets carefully resuspended into 5 mL cold MLs wash medium which is MLm medium with mannitol replaced by sucrose./esp The content of 2 tubes is pooled and 1 mL of KCI wash medium added above the sucrose solution care being taken not to disturb the lower phase. Protoplasts are centrifuged for 10 min at 85x g at 4^°C. The interphase between the sucrose and the KCI solutions containing the live protoplasts is carefully collected. An equal volume of KCI wash medium is added and carefully mixed. The protoplast density is measured with a haemocytometer.

Tomato protoplast isolation

Isolation and regeneration of tomato leaf protoplasts has been previously described (Shahin, 1985 Theor.Appl. Genet. 69: 235-240; Tan et al. 1987 Theor.Appl. Genet. 75: 105-108; Tan et a/. 1987 Plant Cell Rep. 6: 172-175) and the solutions required can be found in these publications. Briefly, Solanum lycopersicum seeds were sterilized with 0.1 % hypochlorite grown in vitro on sterile MS20 medium in a photoperiod of 16/8 hours at 2000 lux at 25°C and 50-70% relative humidity. 1 g of freshly harvested leaves were placed in a dish with 5ml CPW9M and, using a scalpel blade, cut perpendicular to the main stem every mm. These were transferred to a fresh plate of 25ml enzyme solution (CPW9M containing 2% cellulose onozuka RS, 0.4% macerozyme onozuka R10, 2.4-D (2mg/ml), NAA (2mg/ml), BAP

(2mg/ml) pH5.8) and digestion proceeded overnight at 25°C in the dark. The protoplasts were then freed by placing them on an orbital shaker (40-50 rpm) for 1 hour. Protoplasts were separated from cellular debris by passing them through a 50μηι sieve, and washing the sieve 2x with CPW9M. Protoplasts were centrifuged at 85g, the supernatant discarded, and then taken up in half the volume of CPW9M. Protoplasts were finally taken up in 3ml CPW9M and 3ml CPW18S was then added carefully to avoid mixing the two solutions. The protoplasts were spun at 85g for 10 mins and the viable protoplasts floating at the interphase layer were collected using a long pasteur pipette. The protoplast volume was increased to 10ml by adding CPW9M and the number of recovered protoplasts was determined in a haemocytometer.

Introduction of dsRNA into protoplasts and regeneration

Both tobacco and tomato protoplasts were transformed using the same method. The protoplast suspension is centrifuged at 85x g for 10 minutes at 5°C. The supernatant is discarded and the protoplast pellet resuspended to a final concentration of 10⁶.ml_^"1 in KCI wash medium. In a 10 mL tube, 250 μΙ_ of protoplast suspension +/-12^g dsRNA and 250 μΙ of PEG solution (40% PEG4000 (Fluka #81240), 0.1 M Ca(N0₃)₂, 0.4M mannitol) are gently but thoroughly mixed. After 20 min. incubation at room temperature, 5 mL cold 0.275 M Ca(N0₃)₂ is added dropwise. The protoplast suspension is centrifuged for 10 min at 85x g at 4^°C and the supernatant discarded. For tobacco the protoplast pellet was carefully resuspended in 2.5 mL To culture medium supplemented with 50 μg.mL^"1 cefotaxime and 50 μς.ΓπΙ.^"1 vancomycin. T₀ culture medium contained (per liter, pH 5.7) 950 mg KN0₃, 825 mg NH₄NO₃, 220 mg CaCI₂.2H₂0, 185 mg MgS0₄.7H₂0, 85 mg KH₂P0₄, 27.85 mg FeS0₄.7H₂0, 37.25 mg Na₂EDTA.2H₂0, the micro-nutrients according to Heller's medium (Heller, R., Ann Sci Nat Bot Biol Veg 14: 1-223, 1953), vitamins according to Morel and Wetmore's medium (Morel, G. and R.H. Wetmore, Amer. J. Bot. 38: 138-40, 1951 ), 2% (w/v) sucrose, 3 mg naphthalene acetic acid, 1 mg 6-benzylaminopurine and a quantity of mannitol to bring the osmolality to 540 mOsm.kg^"1 and transferred to a 35 mm Petri dish.

After PEG treatment tomato protoplasts were embedded in alginate solution for regeneration. This was necessary because, unlike tobacco protoplasts, tomato protoplasts require embedding for further cell divisions. 2ml of alginate solution was added (mannitol 90g/l, CaCI₂.2H₂0 140mg/l, alginate-Na 20g/l (Sigma A0602)) and was mixed thoroughly by inversion. 1 ml of this was layered evenly on a Ca-agar plate (72.5 g/l mannitol, 7.35 g/l CaCI₂.2H₂0, 8g/l agar) and allowed to polymerize. The alginate discs were then transferred to 4cm Petri dishes containing 4ml of K8p culture medium and incubated in the dark at 30°C. At various time points after PEG treatment tomato protoplasts were freed from the alginate for RNA isolation.

Quantification of mRNA levels

Total RNA was isolated from protoplasts using the RNAeasy Kit (Qiagen). cDNA sysnthesis was performed using the Quantitect RT kit (Qiagen). Levels of endogenous mRNA's were measured using using a Light Cycler apparatus (Roche). The primers used for mRNA quantification are listed in Table 1 below.

Table 1 . Results

Levels of MSH2 in tobacco and tomato protoplasts upon addition of dsRNA

The results shown in Figure 1 (Levels of MSH2 in tobacco and tomato protoplasts upon addition of dsRNA) demonstrate that the level of MSH mRNA increases after isolation. It was found that in control protoplasts there is a strong induction of the level of MMR genes, indicative for increased activity in this pathway. This led to the realization that efficiently, and preferably transiently, inhibiting this strong induction of the level of MMR and/or NHEJ gene and genes could be an effective means of improving targeted genetic modification. In addition, it was found that in particular specific dsRNA directed/targeted to genes involved in the MMR-pathway provide for efficient means for reducing mRNA levels of proteins of the MMR-pathway. Addition of a non-specific dsRNA (sharing no homology with MSH2) does not affect the expression levels whereas MSH2 dsRNA is very effective at reducing MSH2 mRNA levels to 5-20% of that found in protoplasts upon isolation. Similair results wer found for the dsRNA targeted to MLH 1 or KU70 (see figures 2 and 3). Example 2

dsRNA can be used to enhance the efficiency of ZFN mediated gene targeting in plant cells Gene targeting in tobacco protoplasts was detected as described previously (Townsend et al., High-frequency modification of plant genes using engineered zinc-finger nucleases (2009) Nature 459(7245):442-5.). Briefly, ZFN's and dsRNA were transfected to tobacco protoplasts together with a donor construct designed to introduce a point mutation into the endogenous acetolactate synthase (ALS) gene by HR (as described in Townsend et al., High-frequency modification of plant genes using engineered zinc-finger nucleases (2009) Nature 459(7245):442-5.).

This mutation (P186R) confers a dominant resistance phenotype to the sulfonylurea class of herbicides. Using this assay, the frequency of gene targeting was measured when specific dsRNAs were also simultaneously introduced into the protoplasts .

Protoplast cultivation and regeneration

After 10 days of cultivation, the agarose slab is cut into 6 equal parts and transferred to a Petri dish containing 22.5 mL MAP1AO medium supplemented with 20 nM chlorsulfuron. This medium consisted of (per liter, pH 5.7) 950 mg KN0₃, 825 mg NH₄N0₃, 220 mg

CaCI₂.2H₂0, 185 mg MgS0₄.7H₂0, 85 mg KH₂P0₄, 27.85 mg FeS0₄.7H₂0, 37.25 mg Na₂EDTA.2H₂0, the micro-nutrients according to Murashige and Skoog's medium

(Murashige, T. and Skoog, F., Physiologia Plantarum, 15: 473-497, 1962) at one tenth of the original concentration, vitamins according to Morel and Wetmore's medium (Morel, G. and R.H. Wetmore, Amer. J. Bot. 38: 138-40, 1951 ), 6 mg pyruvate, 12 mg each of malic acid, fumaric acid and citric acid, 3% (w/v) sucrose, 6% (w/v) mannitol, 0.03 mg naphthalene acetic acid and 0.1 mg 6-benzylaminopurine. Samples are incubated at 25^°C in low light for 6-8 weeks. Growing calli are then transferred to MAPI medium and allowed to develop for another 2-3 weeks. MAP-i medium has the same composition as MAP-iAO medium, with however 3% (w/v) mannitol instead of 6%, and 46.2 mg.l^"1 histidine (pH 5.7). It was solidified with 0.8% (w/v) Difco agar. Calli are then transferred to RP medium using sterile forceps. RP medium consisted of (per liter, pH 5.7) 273 mg KN0₃, 416 mg Ca(N0₃)₂.4H₂0, 392 mg Mg(N0₃)2.6H₂0, 57 mg

MgS0₄.7H₂0, 233 mg (NH₄)₂S0₄, 271 mg KH₂P0₄, 27.85 mg FeS0₄.7H₂0, 37.25 mg Na₂EDTA.2H₂0, the micro-nutrients according to Murashige and Skoog's medium at one fifth of the published concentration, vitamins according to Morel and Wetmore's medium (Morel, G. and R.H. Wetmore, Amer. J. Bot. 38: 138-40, 1951 ), 0.05% (w/v) sucrose, 1.8% (w/v) mannitol, 0.25 mg zeatin and 41 nM chlorsulfuron, and is solidified with 0.8% (w/v) Difco agar. Mature shoots are transferred to rooting medium after 2-3 weeks.

Results

The results of the gene targeting experiments are shown in Table 3.

Chlorsulfuron resistant calli were shown to contain the expected nucleotide change by sequencing of the ALS loci in the calli. From the results it is clear that (transiently) inhibiting the MMR-pathway, i(transiently) inhibiting the NHEJ-pathway and/or (transiently) inhibiting both pathways simultaneously, preferably with the use of dsRNA as described above, greatly and unexpectedly enhances targeted genetic modification of endogenous chromosomal target DNA. In addition it was found that suppressing both a MutS ortholog and a MutL ortholog (MSH2 and MLH1 , respectively) is more effective in increasing gene targeting in comparision to surpressing only one of these. It was found that in particular the combination of surpressing both the NHEJ and the MMR pathway , preferably surpressing both a MutS ortholog and a MutL ortholog (for example MSH2 and MLH 1 ) provides for a highly efficient method according to the invention.

Claims

C L A I M S

1 . A method for targeted genetic modification in a plant cell comprising

a. providing a plant cell having at least one target DNA sequence, preferably a endogenous chromosomal target DNA sequence in which a genetic modification is to be introduced;

b. Introducing a double strand break in said target DNA sequence;

c. Introducing at least one donor nucleic acid comprising a sequence that is homologous to at least part of said target DNA sequence;

d. Prior or simultaneously with step c)

i. temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA; and/or ii. temporarily suppressing mRNA from a gene encoding a protein involved in the non-homologous end-joining pathway, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA .

2. Method according to any of the previous claims wherein the plant cell is a protoplast.

3. Method according to any of the previous claims wherein step d) comprises introducing double-stranded RNA into said plant cells, wherein said double-stranded RNA comprises at least one sequence that is substantially complementary to at least part of a mRNA derived from a gene encoding a protein involved in cellular mismatch repair and/or introducing double-stranded RNA into said plant cells, wherein said double-stranded RNA comprises at least one sequence that is substantially complementary to at least part of a sequence of a mRNA derived from a gene encoding a protein involved in non-homologous end-joining pathway

4. Method according to any of the previous claims wherein step d) comprises temporarily suppressing mRNA from a gene encoding a protein involved in cellular mismatch repair and temporarily suppressing mRNA from a gene encoding a protein involved in the non-homologous end-joining pathway, to allow homologous recombination between said target DNA and the donor nucleic acid sequence, thereby genetically modifying said target DNA.

5. Method according to any of the previous claims wherein the protein involved in cellular mismatch repair is selected from the group consisting of MutS orthologs, including MSH2, MSH3, MSH6 and MSH7, MutL orthologs including MLH1 , MLH2, MLH3 and PMS1 .

6. Method according to any of the previous claims, wherein the protein involved in non-homologous end-joining pathway is selected from the group consisting of Ku70, Ku80 and PARP-1 .

7. Method according to any of the previous claims wherein said double strand break is introduced by contacting a zinc finger endonuclease comprising an endonuclease domain that cuts DNA and a zinc finger domain comprising a plurality of zinc fingers that bind to a nucleotide sequence within said target DNA in said plant cell with said endogenous chromosomal target DNA sequence to allow said zinc finger endonuclease to cut both strands of a nucleotide sequence within said target DNA sequence.

8. The method according to claim 7, wherein said endonuclease domain is selected from the group consisting of HO endonuclease and Fok I endonuclease.

9. The method according to any of claims 7-8, wherein said contacting comprises transfecting said plant cells with a vector comprising a cDNA encoding said zinc finger endonuclease and expressing a zinc finger endonuclease protein in said plant cell.

10. A method of generating a genetically modified plant or plant cell comprising obtaining a plant cell comprising a target DNA sequence, introducing a double- stranded break within said target DNA sequence, preferably with a zinc finger endonuclease comprising a zinc finger domain that binds to a target nucleotide sequence within said target DNA sequence and an endonuclease domain;

introducing an exogenous nucleic acid comprising a sequence homologous to at least part of said target DNA into said plant cell to allow homologous recombination between said exogenous nucleic acid and said target DNA; and generating a plant from said plant cell in which homologous recombination has occurred.

1 1 . Method according to any of the previous claims wherein the modification comprises an insertion, deletion or substitution, or wherein the method is for creating a knock-out or for random mutagenesis.

12. Method according to any of the previous claims wherein at least at least

1 ,2,3,4,5,6,7,8,9,10 or more nucleotides in the target DNA sequence are modified.

13. Method according to any of the previous claims wherein said donor nucleic acid comprises at least 1 ,2,3,4,5,6,7,8,9,10 or more nucleotides different in comparison to the target DNA.

14. Method according to any of the previous claims wherein at least 2 donor nucleic acids for the target DNA are provided simultaneously to at least 2, preferably a plurality of plant cells, and wherein said at least 2 donor nucleic acids are capable of introduction distinct modifications in the target DNA.

15. Method according to any of the previous claims wherein at least two target DNA's are modified by providing in step c) at least two donor nucleic acids, and wherein each donor nucleic acid is capable of introducing a modification in one of the at least two target DNA's.

16. The method according to any of the previous claims, wherein the plant is a monocotyledon, preferably selected from the group consisting of maize, rice or wheat.

17. The method according to any of the previous claims, wherein the plant is a dicotyledon, preferably selected from the group consisting of potato, soybean, tomato, members of the Brassica family, or Arabidopsis.

18. The method according to any of the previous claims, wherein the plant is a tree.

19. Plant or plant cell obtainable with the method according to any of claims 1 -18.