WO2011076145A1 - Tissue-based micro-rna methods for diagnosis of different subtypes of lung cancer - Google Patents

Tissue-based micro-rna methods for diagnosis of different subtypes of lung cancer Download PDF

Info

Publication number
WO2011076145A1
WO2011076145A1 PCT/CN2010/080242 CN2010080242W WO2011076145A1 WO 2011076145 A1 WO2011076145 A1 WO 2011076145A1 CN 2010080242 W CN2010080242 W CN 2010080242W WO 2011076145 A1 WO2011076145 A1 WO 2011076145A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
hsa
nucleic acid
lung cancer
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CN2010/080242
Other languages
French (fr)
Inventor
Ying Wu
Shaohua Lu
Wei Huang
Hongguang Zhu
Jian Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Original Assignee
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University filed Critical Fudan University
Priority to CN201080064794.8A priority Critical patent/CN102770561B/en
Publication of WO2011076145A1 publication Critical patent/WO2011076145A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/10Production naturally occurring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to the validated miRNA biomarkers and corresponding methods for reliably diagnosis of different subtypes of lung cancers in the surgical and biopsy lung tissues, particularly of discriminating different subtypes of lung cancer.
  • the subtypes of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
  • Lung cancer remains the most common cause of cancer-related deaths among man and woman worldwide. There estimated to 1.4 million new cases in 2009 with average annual increase for 2.51% (Frost & Sullivan estimates) and the majority of patients diagnosed with lung cancer in 2009 will die of their disease (Higgins, M.J. et al. (2009) Expert Rev Anticancer Ther 9, 1365-1378). Despite some improvements in surgical techniques and combined therapies over the last several decades, the five-year survival rate for all stages combined is about 15% in the United States and Europe.
  • Lung cancers are classified as either small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC).
  • SCLC small cell lung cancer
  • NSCLC non-small cell lung cancer
  • the predominant (>80%) histological form of lung cancer is NSCLC including adenocarcinoma and squamous-cell carcinoma.
  • Cigarette smoking is the most important risk factor for lung cancer, accounting for about 80% of lung cancer cases in men and 50% in women worldwide.
  • Treatment for lung cancer differs according to the subtype of cancer.
  • the treatment of choice for early stage NSCLC is surgery with a 5 year overall survival of 40%.
  • a majority of patients are at an advanced disease stage at the time of diagnosis, which limits first-line therapy to multi-agent chemotherapy and an expected survival is less than 8 months.
  • Recent advances in targeted therapies require greater accuracy in the subclassification of non-small-cell lung cancer (NSCLC).
  • NSCLC non-small-cell lung cancer
  • Inhibitors of tumor angiogenesis pose higher risk for adverse response in cases of squamous cell carcinoma (Lebanoy, D. (2009) / Clin Oncol 27, 2030-2037).
  • Small cell lung cancer (SCLC) is the most deadly form of the disease, with a case-fatality rate greater than 90%.
  • SCLC small cell lung cancer
  • miRNAs small regulatory RNA molecules
  • nt nucleotides
  • miRNAs have advantages over mRNAs as cancer biomarkers, since they are very stable in vitro and long-lived in vivo (Lu, J. et al., (2005) Nature 435, 834-838; Lim, L.P. et al., (2005) Nature 433, 769-773).
  • MiRNAs are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another RNase III termed Dicer cleaves of the loop of the pre-miRNA hairpin to form a short double- stranded (ds) RNA, one strand of which is incorporated as mature miRNA into a miRNA-protein (miRNP).
  • ds double- stranded
  • miRNA-protein miRNA-protein
  • the miRNA guides the miRNPs to their target mRNAs where they exert their function (Bartel, D.P. (2004) Cell 23, 281- 292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531).
  • miRNAs can guide different regulatory processes.
  • Target mRNAs that are highly complementary to miRNAs are specifically cleaved by mechanisms identical to RNA interference (RNAi).
  • RNAi RNA interference
  • the miRNAs function as short interfering RNAs (siRNAs).
  • Target mRNAs with less complementarity to miRNAs are either directed to cellular degradation pathways or are translationally repressed without affecting the mRNA level.
  • the mechanism of how miRNAs repress translation of their target mRNAs is still a matter of controversy.
  • High-throughput miRNA quantification technologies such as miRNA microarray, real-time RT-PCR-based TaqMan miRNA assays, have provided powerful tools to study the global miRNA profile in whole cancer genome. Emerging data available indicate that dysregulation of miRNA expression may inter alia be associated with the development and/or progression of certain types of cancer. For example, two miRNAs, miR-15 and miR-16-1, were shown to map to a genetic locus that is deleted in chronic lymphatic leukemia (CLL) and it was found that in about 70% of the CLL patients, both miRNA genes are deleted or down-regulated.
  • CLL chronic lymphatic leukemia
  • miRNAs are aberrantly expressed in malignant tissues as compared to nonmalignant lung tissue.
  • studies found that some miRNAs may be related to prognosis Yu, S.L. et al. (2008) Cancer Cell 13, 48-57; Raponi, M. et al (2009) Cancer Res 69, 5776-5783.
  • miRNAs may provide insights into cellular processes involved in the malignant transformation and progression.
  • lung cancer manifested as an adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer by determining a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells analyzed as compared to control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of lung cancer.
  • miRNA microRNA
  • the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of adenocarcinoma lung cancer.
  • the nucleic acid expression biomarker may comprise at least four nucleic acid molecules.
  • the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa- miR-29a, hsa-miR-34a and hsa-miR-375.
  • the expressions of hsa-miR-34a and hsa-miR-375 are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a and hsa-miR-29a are down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-34a/hsa-miR- 27a and hsa-miR-34a/hsa-miR-29a.
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a, hsa-miR-27a and hsa- miR-34a.
  • the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer.
  • the nucleic acid expression biomarker may comprise at least four nucleic acid molecules.
  • the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-25, hsa-miR-29a and hsa-miR-375.
  • the expressions of hsa-miR-205 and hsa-miR-25 are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-29a and hsa-miR-375 are down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-205/hsa-miR- 29a, hsa-miR-25/hsa-miR-29a, hsa-miR-205/hsa-miR-375, hsa-miR-25/hsa-miR-375.
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205, hsa-miR-25 and hsa-miR-29a.
  • the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer.
  • the nucleic acid expression biomarker may comprise at least five nucleic acid molecules.
  • the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-375.
  • the expressions of hsa-miR-25 and hsa-miR-375 are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa-miR-29a and hsa-miR-29b are down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-25/hsa-miR- 27a, hsa-miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-irriR-375/hsa-miR- 29a.
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a and hsa-miR-375.
  • the present invention relates to a diagnostic kit of molecular markers for discriminating squamous cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer or adenocarcinoma lung cancer.
  • the nucleic acid expression biomarker may comprise at least four nucleic acid molecules.
  • the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-25, hsa-miR-27a and hsa-miR-375.
  • the expressions of hsa-miR-205, hsa-miR-25, hsa- miR-27a are up-regulated and the expression of one nucleic acid molecule encoding hsa-miR-375 is down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-205/hsa-miR-375 and hsa-miR-25/hsa-miR-375.
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205, hsa-miR-25 and hsa- miR-375.
  • the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or adenocarcinoma lung cancer.
  • the nucleic acid expression biomarker may comprise at least six nucleic acid molecules.
  • the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.
  • the expressions of hsa-miR-25 and hsa-miR-375 are up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a are down- regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-25/hsa-miR-27a, hsa- miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a.
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-25, hsa-miR-34a and hsa-miR-375.
  • the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or squamous cell lung cancer.
  • the nucleic acid expression biomarker may comprise at least six nucleic acid molecules.
  • the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.
  • the expression of hsa-miR-375 is up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a are down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-375/hsa-miR-27a and hsa-miR-375/hsa-miR-29a.
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29b and hsa-miR-375.
  • the present invention relates to a method for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer, the method comprising: (a) collecting a biopsy or surgical tissue from a patient; (b) preparing tissue section on a slide; (c) hybridizing at least one nucleic acid molecule biomarker encoding a microRNA sequence to the section on the slide, (d) quantifying the miRNA expression under microscope or by digital pathology solution; (e) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (f) determining the expression levels of the plurality of nucleic acid molecules in one or more control cells; and (g) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (e) and (f
  • the method is manifested as in situ hybridization.
  • hsa-miR-205 For quantitative determination, 7 validated miRNA biomarkers are used: hsa-miR-205, hsa-miR-25, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.
  • the nucleic acid expression molecule encoding hsa-miR-24 may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 may be preferably used, which does not expressed in lung tissues.
  • the present invention relates to a method for preventing or treating lung cancer, the method comprising: (a) identifying a nucleic acid expression biomarker by using a method, as defined herein; and (b) modifying the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression is up-regulated is down- regulated and the expression of a nucleic acid molecule whose expression is down- regulated is up-regulated.
  • the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated from lung cancer patients, as defined herein.
  • the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
  • Other embodiments of the present invention will become apparent from the detailed description hereinafter.
  • Figure 1 depicts a flow chart schematically illustrating the essential method steps in the seventh aspect for determining an expression biomarker according to the present invention for identifying one or more target cells exhibiting adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer. Particularly of discriminating the different subtypes of lung cancer using in situ hybridization method.
  • Figure 2A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the first aspect according to the present invention for identifying one or more target cells exhibiting adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with adenocarcinoma lung cancer as compared to normal lung tissues (i.e. an up-regulation or a down-regulation). The data indicate that adenocarcinoma lung cancer can be reliably discriminated from normal lung tissues in FFPE surgical tissues.
  • Figure 2B depicts stepwise logistic regression analysis of one combination (hsa-miR-27a, hsa-miR-29a and hsa-miR-34a) in the first aspect according to the present invention for identifying one or more target cells exhibiting adenocarcinoma lung cancer in FFPE surgical tissues.
  • Figure 3A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the second aspect according to the present invention for identifying one or more target cells exhibiting squamous cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to normal lung tissues (i.e. an up- regulation or a down-regulation). The data indicate that squamous cell lung cancer can be reliably discriminated from normal lung tissues in FFPE surgical tissues.
  • Figure 3B depicts stepwise logistic regression analysis of one combination (hsa-miR-205, hsa-miR-25 and hsa-miR-29a) in the second aspect according to the present invention for identifying one or more target cells exhibiting squamous cell lung cancer in FFPE surgical tissues.
  • Figure 4A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the third aspect according to the present invention for identifying one or more target cells exhibiting small cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with small cell lung cancer as compared to normal lung tissues (i.e. an up-regulation or a down- regulation). The data indicate that small cell lung cancer can be reliably discriminated from normal lung tissues in FFPE surgical tissues.
  • Figure 4B depicts stepwise logistic regression analysis of one combination (hsa-miR-29a and hsa-miR-375) in the third aspect according to the present invention for identifying one or more target cells exhibiting small cell lung cancer in FFPE surgical tissues.
  • Figure 5A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the fourth aspect according to the present invention for discriminating squamous cell lung cancer from adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to the patients with adenocarcinoma lung cancer (i.e. an up-regulation or a down-regulation). The data indicate that squamous cell lung cancer can be reliably discriminated from adenocarcinoma lung cancer in FFPE surgical tissues.
  • Figure 5B depicts stepwise logistic regression analysis of one combination (hsa-miR-205, hsa-miR-25 and hsa-miR-375) in the fourth aspect according to the present invention for discriminating squamous cell lung cancer from adenocarcinoma lung cancer in FFPE surgical tissues.
  • Figure 6A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the fifth aspect according to the present invention for discriminating small cell lung cancer from adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with small cell lung cancer as compared to the patients with adenocarcinoma lung cancer (i.e. an up-regulation or a down-regulation). The data indicate that small cell lung cancer can be reliably discriminated from adenocarcinoma lung cancer in FFPE surgical tissues.
  • Figure 6B depicts stepwise logistic regression analysis of one combination (hsa-miR-25, hsa-miR-34a and hsa-miR-375) in the fifth aspect according to the present invention for discriminating small cell lung cancer from adenocarcinoma lung cancer in FFPE surgical tissues.
  • Figure 7A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the sixth aspect according to the present invention for discriminating small cell lung cancer from squamous cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with small cell lung cancer as compared to the patients with squamous cell lung cancer (i.e. an up-regulation or a down-regulation). The data indicate that small cell lung cancer can be reliably discriminated from squamous cell lung cancer in FFPE surgical tissues.
  • Figure 7B depicts stepwise logistic regression analysis of one combination (hsa-miR-29b and hsa-miR-375) in the sixth aspect according to the present invention for discriminating small cell lung cancer from squamous cell lung cancer in FFPE surgical tissues.
  • the present invention is based on the unexpected finding that lung cancer can be reliably identified and different subtypes of lung cancer can be discriminated based on particular miRNA expression profiles with high sensitivity and specificity, wherein the expression biomarkers as defined herein typically comprises both up- and down-regulated human miRNAs. More specifically, said miRNA expression biomarkers - by analyzing the overall miRNA expression pattern and/or the respective individual miRNA expression level(s) - allow the detection of lung cancer at an early disease state and discriminating the different subtypes of lung cancer.
  • lung cancer manifested as an adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer by determining a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells analyzed as compared to control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of lung cancer.
  • miRNA microRNA
  • cancer also referred to as “carcinoma”
  • cancer generally denotes any type of malignant neoplasm, that is, any morphological and/or physiological alterations (based on genetic re-programming) of special tissue exhibiting or having a predisposition to develop characteristics of a carcinoma as compared to unaffected (healthy) wild-type control tissues.
  • alterations may relate inter alia to cell size and shape (enlargement or reduction), cell proliferation (increase in cell number), cell differentiation (change in physiological state), apoptosis (programmed cell death) or cell survival.
  • lung cancer refers to uncontrolled cell growth in the tissue of lung, or cancerous growths in the lung.
  • different subtypes of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.
  • Adenocarcinoma lung cancer or “adenocarcinoma lung carcinoma” is a form of non-small cell lung cancer. Eighty percent of lung cancers are non-small cell cancers (NSCLC), and of these, about 50% are adenocarcinomas. Adenocarcinoma of the lung begins in the outer parts of the lung, and it can be present for a long time before it is diagnosed. It is the type of lung cancer most commonly seen in women and is often seen in non-smokers.
  • Squamous cell lung cancer or “squamous cell lung carcinoma” is a form of non-small cell lung cancer. About 30% of NSCLC are squamous cell lung cancer. Squamous cell lung carcinomas usually begin in the bronchial tubes (large airways) in the central part of the lungs. Many people have symptoms early on, commonly hemoptysis (coughing up blood).
  • SCLC small cell lung carcinoma
  • patient refers to a human being at least supposed to have lung cancer, or certain types of lung cancer; whereas the term
  • “healthy individual” or “normal control” typically denotes a healthy person not having characteristics of such a cancerous phenotype. However, in some applications, for example, when comparing different types of lung cancer, the individual having the other types of lung cancer is typically considered the "control".
  • the sample used for detection in the in vitro methods of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved.
  • the samples to be analyzed are typically from tissue. Furthermore, blood and other types of sample can be used as well.
  • microRNA (or “miRNA”), as used herein, is given its ordinary meaning in the art (Bartel, D.P. (2004) Cell 23, 281-292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531). Accordingly, a "microRNA” denotes an RNA molecule derived from a genomic locus that is processed from transcripts that can form local RNA precursor miRNA structures.
  • the mature miRNA is usually 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides.
  • the miRNA encoding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within an imperfect RNA duplex (herein also referred to as stem-loop or hairpin structure or as pre-miRNA), which serves as an intermediate for miRNA processing from a longer precursor transcript.
  • This processing typically occurs through the consecutive action of two specific endonucleases termed Drosha and Dicer, respectively.
  • Drosha generates from the primary transcript (herein also denoted "pri-miRNA”) a miRNA precursor (herein also denoted "pre-miRNA”) that typically folds into a hairpin or stem-loop structure.
  • miRNA duplex is excised by means of Dicer that comprises the mature miRNA at one arm of the hairpin or stem-loop structure and a similar- sized segment (commonly referred to miRNA*) at the other arm.
  • the miRNA is then guided to its target mRNA to exert its function, whereas the miRNA* is degraded.
  • miRNAs are typically derived from a segment of the genome that is distinct from predicted protein-coding regions.
  • miRNA precursor refers to the portion of a miRNA primary transcript from which the mature miRNA is processed.
  • pre-miRNA folds into a stable hairpin (i.e. a duplex) or a stem-loop structure.
  • the hairpin structures typically range from 50 to 80 nucleotides in length, preferably from 60 to 70 nucleotides (counting the miRNA residues, those pairing to the miRNA, and any intervening segment(s) but excluding more distal sequences).
  • nucleic acid molecule encoding a microRNA sequence denotes any nucleic acid molecule coding for a microRNA (miRNA). Thus, the term does not only refer to mature miRNAs but also to the respective precursor miRNAs and primary miRNA transcripts as defined above. Furthermore, the present invention is not restricted to RNA molecules but also includes corresponding DNA molecules encoding a microRNA, e.g. DNA molecules generated by reverse transcribing a miRNA sequence.
  • a nucleic acid molecule encoding a microRNA sequence according to the invention typically encodes a single miRNA sequence (i.e. an individual miRNA). However, it is also possible that such nucleic acid molecule encodes two or more miRNA sequences (i.e. two or more miRNAs), for example a transcriptional unit comprising two or more miRNA sequences under the control of common regulatory sequences such as a promoter or a transcriptional terminator.
  • nucleic acid molecule encoding a microRNA sequence is also to be understood to include “sense nucleic acid molecules” (i.e. molecules whose nucleic acid sequence (5'— > 3') matches or corresponds to the encoded miRNA (5'— > 3') sequence) and “anti-sense nucleic acid molecules” (i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5'— > 3') sequence or, in other words, matches the reverse complement (3'— > 5') of the encoded miRNA sequence).
  • sense nucleic acid molecules i.e. molecules whose nucleic acid sequence (5'— > 3') matches or corresponds to the encoded miRNA (5'— > 3') sequence
  • anti-sense nucleic acid molecules i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5'— > 3') sequence or, in other words, matches the reverse complement (3'— > 5') of the encoded miRNA sequence.
  • complementary refers to the capability of an "anti-sense” nucleic acid molecule sequence of forming base pairs, preferably Watson-Crick base pairs, with the corresponding "sense” nucleic acid molecule sequence (having a sequence complementary to the anti-sense sequence).
  • two nucleic acid molecules may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides.
  • the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions).
  • the "complementary" nucleic acid molecule comprises at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in corresponding "sense" nucleic acid molecule.
  • the plurality of nucleic acid molecules encoding a miRNA sequence that are comprised in a diagnostic kit of the present invention may include one or more "sense nucleic acid molecules" and/or one or more "anti-sense nucleic acid molecules".
  • the diagnostic kit includes one or more "sense nucleic acid molecules” (i.e. the miRNA sequences as such), said molecules are to be considered to constitute the totality or at least a subset of differentially expressed miRNAs (i.e. molecular markers) being indicative for the presence of or the disposition to develop a particular condition, here lung cancer.
  • a diagnostic kit includes one or more "anti-sense nucleic acid molecules” (i.e.
  • said molecules may comprise inter alia probe molecules (for performing hybridization assays) and/or oligonucleotide primers (e.g., for reverse transcription or PCR applications) that are suitable for detecting and/or quantifying one or more particular (complementary) miRNA sequences in a given sample.
  • a plurality of nucleic acid molecules as defined within the present invention may comprise at least two, at least ten, at least 50, at least 100, at least 200, at least 500, at least 1.000, at least 10.000 or at least 100.000 nucleic acid molecules, each molecule encoding a miRNA sequence.
  • the term “differentially expressed”, as used herein, denotes an altered expression level of a particular miRNA in the disease cells as compared to the healthy controls, or as compared to other types of disease samples, which may be an up- regulation (i.e. an increased miRNA concentration) or a down-regulation (i.e. a reduced or abolished miRNA concentration).
  • the nucleic acid molecule is activated to a higher or lower level in the disease cells than in the control cells.
  • a nucleic acid molecule is to considered differentially expressed if the respective expression levels of this nucleic acid molecule in disease samples and control samples typically differ by at least 5% or at least 10%, preferably by at least 20% or at least 25%, and most preferably by at least 30% or at least 50%.
  • the latter values correspond to an at least 1.3-fold or at least 1.5-fold up-regulation of the expression level of a given nucleic acid molecule in the disease samples compared to the control samples or vice versa an at least 0.7-fold or at least 0.5-fold down-regulation of the expression level in the disease samples, respectively.
  • expression level refers to extent to which a particular miRNA sequence is transcribed from its genomic locus, that is, the concentration of a miRNA in the sample to be analyzed.
  • control cells typically denotes a cell sample collected from (healthy) individual not having characteristics of a lung cancer phenotype. However, in some applications, for example, when comparing different types of lung cancers, the cells collected from other types of lung cancer is typically considered the "control cells”.
  • determining of expression levels typically follows established standard procedures well known in the art (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M. et al. (2001) Current Protocols in Molecular Biology. Wiley & Sons, Hoboken, NJ). Determination may occur at the RNA level, for example by Northern blot analysis using miRNA-specific probes, or at the DNA level following reverse transcription (and cloning) of the RNA population, for example by quantitative PCR or real-time PCR techniques.
  • the term "determining”, as used herein, includes the analysis of any nucleic acid molecules encoding a microRNA sequence as described above. However, due to the short half-life of pri-miRNAs and pre-mRNAs typically the concentration of only the mature miRNA is measured.
  • the standard value of the expression levels obtained in several independent measurements of a given sample for example, two, three, five or ten measurements
  • the standard value may be obtained by any method known in the art. For example, a range of mean + 2 SD (standard deviation) or mean + 3 SD may be used as standard value.
  • control nucleic acids e.g. housekeeping genes whose expression levels are known not to differ depending on the disease states of the individual from whom the sample was collected.
  • housekeeping genes include inter alia ⁇ -actin, glycerinaldehyde 3-phosphate dehydrogenase, and ribosomal protein PI .
  • the control nucleic acid is another miRNA known to be stably expressed during the various noncancerous and (pre-)cancerous states of the individual from whom the sample was collected.
  • the expression levels for cell sample it may also be possible to define based on experimental evidence and/or prior art data on or more cut-off values for a particular disease phenotype (i.e. a disease state).
  • the respective expression levels for the cell sample can be determined by using a stably expressed control miRNA for normalization. If the "normalized” expression levels calculated are higher than the respective cutoff value defined, then this finding would be indicative for an up-regulation of gene expression. Vice versa, if the "normalized” expression levels calculated are lower than the respective cutoff value defined, then this finding would be indicative for a down- regulation of gene expression.
  • the term "identifying lung cancer and/or discriminating different subtypes of lung cancer” is intended to also encompass predictions and likelihood analysis (in the sense of "diagnosing”).
  • the biomarkers and methods disclosed herein are intended to be used clinically in making decisions concerning treatment modalities, including therapeutic intervention, diagnostic criteria such as disease stages, and disease monitoring and surveillance for the disease.
  • an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease.
  • the invention may be used to detect cancerous changes through cell sample, and provide a doctor with useful information for diagnosis.
  • the invention may also be used to discriminate between different subtypes of lung cancers.
  • one or more differentially expressed nucleic acid molecules identified together represent a nucleic acid expression biomarker that is indicative for lung cancer.
  • expression biomarker denotes a set of nucleic acid molecules (e.g., miRNAs), wherein the expression level of the individual nucleic acid molecules differs between the cells collected from lung cancer patient and the healthy control.
  • a nucleic acid expression biomarker is also referred to as a set of markers and represents a minimum number of (different) nucleic acid molecules, each encoding a miRNA sequence that is capable for identifying a phenotypic state of an individual.
  • the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of adenocarcinoma lung cancer.
  • the nucleic acid expression biomarker as defined herein, may comprise at least four nucleic acid molecules.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-34a (SEQ ID NO:6) and hsa-miR- 375 (SEQ ID NO:7).
  • the expressions of hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7) are up-regulated and the expression of any one or more of the nucleic acid molecules encoding (SEQ ID NO:3) and hsa-miR-29a (SEQ ID NO:4) are down -regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-34a (SEQ ID NO:6)/hsa-miR-27a (SEQ ID NO:3) and hsa-miR-34a (SEQ ID NO:6)/hsa-miR-29a (SEQ ID NO:4).
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a (SEQ ID NO:4), hsa-miR-27a (SEQ ID NO:3) and hsa-miR-34a (SEQ ID NO:6).
  • the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
  • nucleic acid may relate to any subgroup of the plurality of nucleic acid molecules, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid molecules, each encoding a microRNA sequence that are comprised in the nucleic acid expression biomarker, as defined herein.
  • the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer.
  • the nucleic acid expression biomarker may comprise at least four nucleic acid molecules.
  • the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7).
  • the expressions of hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2) are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7) are down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-205 (SEQ ID NO:l)/hsa-miR-29a (SEQ ID NO:4), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-29a (SEQ ID NO:4), hsa-miR-205 (SEQ ID NO:l)/hsa-miR-375 (SEQ ID NO:7), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-375 (SEQ ID NO:7).
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-29a (SEQ ID NO:4).
  • the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
  • nucleic acid sequences of the above -referenced miRNAs are listed in Table 2.
  • the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer.
  • the nucleic acid expression biomarker may comprise at least five nucleic acid molecules.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-375 (SEQ ID NO:7).
  • the expressions of hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7) are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) are down-regulated in the one or more target cells compared to the one or more normal control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-25 (SEQ ID NO:2)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7)/hsa-miR-29a (SEQ ID NO:4).
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7).
  • the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
  • nucleic acid sequences of the above -referenced miRNAs are listed in Table 3.
  • the present invention relates to a diagnostic kit of molecular markers for discriminating squamous cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer or adenocarcinoma lung cancer.
  • the nucleic acid expression biomarker may comprise at least four nucleic acid molecules.
  • the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3) and hsa-miR-375 (SEQ ID N0:7).
  • the expressions of hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3) are up-regulated and the expression of one nucleic acid molecule encoding hsa-miR-375 (SEQ ID NO:7) is down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-205 (SEQ ID NO:l)/hsa-miR-375 (SEQ ID NO:7) and hsa-miR-25 (SEQ ID NO:2)/hsa-miR-375 (SEQ ID NO:7).
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7).
  • the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
  • nucleic acid sequences of the above -referenced miRNAs are listed in Table 4.
  • the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or adenocarcinoma lung cancer.
  • the nucleic acid expression biomarker may comprise at least six nucleic acid molecules.
  • the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).
  • the expressions of hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7) are up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-34a (SEQ ID NO:6) are down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-25 (SEQ ID NO:2) /hsa- miR-27a (SEQ ID NO:3), hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-25 (SEQ ID NO:2) /hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7)/hsa-miR-29a (SEQ ID NO:4).
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-25 (SEQ ID NO:2), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).
  • the nucleic acid expression molecule encoding hsa-miR-24 may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 may be preferably used, which does not expressed in lung tissues.
  • nucleic acid sequences of the above -referenced miRNAs are listed in Table 5.
  • the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or squamous cell lung cancer.
  • the nucleic acid expression biomarker may comprise at least six nucleic acid molecules.
  • the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).
  • the expression of hsa-miR-375 is up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-34a (SEQ ID NO:6) are down-regulated in the one or more target cells compared to the one or more control cells.
  • the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3) and hsa-miR-375 (SEQ ID NO:7) /hsa-miR-29a (SEQ ID NO:4).
  • the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29b (SEQ ID NO:5) and hsa-miR-375 (SEQ ID NO:7).
  • the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
  • nucleic acid sequences of the above -referenced miRNAs are listed in Table 6.
  • the present invention relates to a method for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer, the method comprising:
  • step (g) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (e) and (f), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, as defined herein, that is indicative for the presence of adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.
  • the method is manifested as in situ hybridization.
  • 7 validated miRNA biomarkers are used: hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).
  • the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues.
  • the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
  • In situ hybridization techniques allow specific nucleic acid sequences to be detected in morphologically preserved chromosomes, cells or tissue sections. In combination with immunocytochemistry, in situ hybridization can relate microscopic topological information to gene activity at the DNA, mRNA, and protein level.
  • nonradioactive hybridization methods There are two types of nonradioactive hybridization methods: direct and indirect. Direct methods using fluorescein or other fluorochromes directly coupled to the nucleotide (Baumann, J. G. J. et al. ((1980) Exp. Cell Res. 138, 485-490). Indirect methods using digoxigenin (detected by specific antibodies) and biotin (detected by streptavidin) (Leary, J. L et al (1983) Proc. Natl. Acad. Sci. USA 80, 4045-4049).
  • the present invention relates to a method for preventing or treating lung cancer, the method comprising:
  • nucleic acid expression biomarker (b) modifying the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression is up-regulated is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated is up-regulated.
  • modifying the expression of a nucleic acid molecule encoding a miRNA sequence denotes any manipulation of a particular nucleic acid molecule resulting in an altered expression level of said molecule, that is, the production of a different amount of corresponding miRNA as compared to the expression of the "wild-type" (i.e. the unmodified control).
  • a manipulation as defined herein, may either up-regulate (i.e. activate) or down-regulate (i.e. inhibit) the expression (i.e. particularly transcription) of a nucleic acid molecule.
  • expression of one or more nucleic acid molecules encoding a microRNA sequence comprised in the nucleic acid expression signature is modified in such way that the expression of a nucleic acid molecule whose expression is up-regulated in cells is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in cells is up-regulated.
  • the modification of expression of a particular nucleic acid molecule encoding a miRNA sequence occurs in an anti-cyclical pattern to the regulation of said molecule in cells of cancer patients in order to interfere with the "excess activity" of an up-regulated molecule and/or to restore the "deficient activity" of a down-regulated molecule in cells.
  • down-regulating the expression of a nucleic acid molecule comprises introducing into the patient a nucleic acid molecule encoding a sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated.
  • complementary sequence is to be understood that the "complementary" nucleic acid molecule (herein also referred to as an "anti- sense nucleic acid molecule”) introduced into blood is capable of forming base pairs, preferably Watson-Crick base pairs, with the up-regulated endogenous "sense" nucleic acid molecule.
  • nucleic acid molecules may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides.
  • the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions).
  • the "complementary" nucleic acid molecule comprises a stretch of at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in the up- regulated "sense" nucleic acid molecule.
  • the "complementary" nucleic acid molecule i.e. the nucleic acid molecule encoding a nucleic acid sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated
  • the "complementary" nucleic acid molecule may be a naturally occurring DNA- or RNA molecule or a synthetic nucleic acid molecule comprising in its sequence one or more modified nucleotides which may be of the same type or of one or more different types.
  • nucleic acid molecule comprises at least one ribonucleotide backbone unit and at least one deoxyribonucleotide backbone unit.
  • the nucleic acid molecule may contain one or more modifications of the RNA backbone into 2'-O-methyl group or 2'- O-methoxyethyl group (also referred to as "2'-O-methylation"), which prevented nuclease degradation in the culture media and, importantly, also prevented endonucleolytic cleavage by the RNA-induced silencing complex nuclease, leading to irreversible inhibition of the miRNA.
  • LNAs locked nucleic acids
  • RNA inhibitors that can be expressed in cells, as RNAs produced from transgenes, were generated as well.
  • microRNA sponges these competitive inhibitors are transcripts expressed from strong promoters, containing multiple, tandem binding sites to a microRNA of interest (Ebert, M.S. et al. (2007) Nat. Methods 4, 721-726).
  • a nucleic acid molecule is referred to as "capable of expressing a nucleic acid molecule" or capable “to allow expression of a nucleotide sequence” if it comprises sequence elements which contain information regarding to transcriptional and/or translational regulation, and such sequences are “operably linked” to the nucleotide sequence encoding the polypeptide.
  • An operable linkage is a linkage in which the regulatory sequence elements and the sequence to be expressed (and/or the sequences to be expressed among each other) are connected in a way that enables gene expression.
  • promoter regions necessary for gene expression may vary among species, but in general these regions comprise a promoter which, in prokaryotes, contains both the promoter per se, i.e. DNA elements directing the initiation of transcription, as well as DNA elements which, when transcribed into RNA, will signal the initiation of translation.
  • promoter regions normally include 5' non-coding sequences involved in initiation of transcription and translation, such as the -35/- 10 boxes and the Shine-Dalgarno element in prokaryotes or the TATA box, CAAT sequences, and 5'-capping elements in eukaryotes.
  • These regions can also include enhancer or repressor elements as well as translated signal and leader sequences for targeting the native polypeptide to a specific compartment of a host cell.
  • the 3' non-coding sequences may contain regulatory elements involved in transcriptional termination, polyadenylation or the like. If, however, these termination sequences are not satisfactory functional in a particular host environment, then they may be substituted with signals functional in that environment.
  • the expression of the nucleic molecules may also be influenced by the presence, e.g., of modified nucleotides (cf. the discussion above).
  • modified nucleotides cf. the discussion above.
  • LNA locked nucleic acid
  • LNA monomers are thought to increase the functional half-life of miRNAs in vivo by enhancing the resistance to degradation and by stabilizing the miRNA-target duplex structure that is crucial for silencing activity (Naguibneva, I. et al. (2006) Biomed Pharmacother 60, 633-638).
  • a nucleic acid molecule of the invention to be introduced into patient may include a regulatory sequence, preferably a promoter sequence, and optionally also a transcriptional termination sequence.
  • the promoters may allow for either a constitutive or an inducible gene expression. Suitable promoters include inter alia the E. coli /acUV5 and tet (tetracycline-responsive) promoters, the T7 promoter as well as the SV40 promoter or the CMV promoter.
  • the nucleic acid molecules of the invention may also be comprised in a vector or other cloning vehicles, such as plasmids, phagemids, phages, cosmids or artificial chromosomes.
  • the nucleic acid molecule is comprised in a vector, particularly in an expression vector.
  • Such an expression vector can include, aside from the regulatory sequences described above and a nucleic acid sequence encoding a genetic construct as defined in the invention, replication and control sequences derived from a species compatible with the host that is used for expression as well as selection markers conferring a selectable phenotype on host. Large numbers of suitable vectors such as pSUPER and pSUPERIOR are known in the art, and are commercially available.
  • the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated from lung cancer patients, as defined herein.
  • the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
  • suitable pharmaceutical compositions include inter alia those compositions suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), peritoneal and parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Administration may be local or systemic. Preferably, administration is accomplished via the oral or intravenous routes.
  • the formulations may also be packaged in discrete dosage units.
  • compositions according to the present invention include any pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as ointments, and oil- in water emulsions such as creams, lotions, and balms.
  • pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as oint
  • the ("sense” and "anti-sense”) nucleic acid molecules described above can be formulated into pharmaceutical compositions using pharmacologically acceptable ingredients as well as established methods of preparation (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams & Wilkins, Philadelphia, PA; Crowder, T.M. et al. (2003 ) A Guide to Pharmaceutical Particulate Science. Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRC Press, Boca Raton, FL).
  • pharmaceutically inert inorganic or organic excipients i.e. carriers
  • pharmaceutically inert inorganic or organic excipients i.e. carriers
  • a suitable excipient for the production of solutions, suspensions, emulsions, aerosol mixtures or powders for reconstitution into solutions or aerosol mixtures prior to use include water, alcohols, glycerol, polyols, and suitable mixtures thereof as well as vegetable oils.
  • the pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect.
  • additives such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect.
  • additives such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect.
  • the nucleic acid molecules may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes, nanoparticles, and microcapsules.
  • One approach involves covalently coupling the passenger strand (miRNA* strand) of the miRNA to cholesterol or derivatives/conjugates thereof to facilitate uptake through ubiquitously expressed cell-surface LDL receptors (Soutschek, J. et al. (2004) Nature 432, 173-178).
  • unconjugated, PBS-formulated locked-nucleic-acid-modified oligonucleotides (LNA-antimiR) may be used for systemic delivery (Elmen, J. et al. (2008) Nature 452, 896-899).
  • Another strategy for delivering miRNAs involves encapsulating the miRNAs into specialized liposomes formed using polyethylene glycol to reduce uptake by scavenger cells and enhance time spent in the circulation.
  • lipidoids synthesis scheme based upon the conjugate addition of alkylacrylates or alkyl-acrylamides to primary or secondary amines
  • RNAi therapeutics Akinc, A. et al. (2008) Nat Biotechnol 26, 561-569.
  • a further targeting strategy involves the mixing of miRNAs with a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge (Song, E. et al. (2005) Nat. Biotechnol. 23, 709-717).
  • a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge
  • a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge
  • Example 1 Patient materials
  • FFPE formalin-fixed, paraffin-embedded
  • Patient data (age, sex, imaging data, therapy, other medical conditions, family history, and the like) were derived from the hospital databases for matching the various samples collected.
  • Pathologic follow-up (for example, histological analysis via hematoxylin and eosin (H&E) staining) was used for evidently determining the disease state (i.e. normal control, adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer) of a given sample as well as to ensure a consistent classification of the specimens.
  • H&E histological analysis via hematoxylin and eosin
  • a transparent transfer film is applied to the surface of a tissue section or specimen. Under a microscope, the thin tissue section is viewed through the glass slide on which it is mounted and clusters of cells are identified for isolation. When the cells of choice are in the center of the field of view, a near IR laser diode integral with the microscope optics is activated. The pulsed laser beam activates a spot on the transfer film, fusing the film with the underlying cells of choice. The transfer film with the bonded cells is then lifted off the thin tissue section (reviewed, e.g., in Emmert-Buck, M.R. et al.
  • FFPE surgical tissues were used in the validation study. Once FFPE tissues were selected for the analysis, H&E-stained sections were prepared in order to check the proportion of tumour material in each sample. If a tumour has more than 75% neoplastic cells, it shall be deemed suitable for analysis without further purification of tumour cells. If, however, histology shows the tumour to have ⁇ 75% neoplastic cells, it will be selected and marked tumours for macrodis section. In addition to tumour lesions, control tissue shall be derived from at least 10 cm from tumour loci.
  • Example 3 The microarray data
  • a qualitative analysis of the miRNAs differentially expressed in a particular sample may optionally be performed using the 5 Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA).
  • the microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 126 LCM-selected lung samples were used as inputs for labeling via Cy3 incorporation. Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed 10 according to the protocols in the Agilent miRNA microarray system. The raw data obtained for single-color (CY3) hybridization were normalized by applying a Quantile method and using GeneSpring GX10 software (Agilent Technologies, Santa Clara, CA, USA) known in the art.
  • Unpaired t-test after Fisher test was used to identify top candidate miRNA biomarkers amongst adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.
  • MedCalc software was used to perform receiver 20 operating characteristic (ROC) curve analysis to determine the specificity and sensitivity of the candidate miRNA as diagnostic biomarkers. 95% confidence interval was used to determine the significance.
  • Example 4 Validation of the microarray data in FFPE surgical tissues
  • RT reverse transcription
  • Taqman microRNA RT Kits according to the instruction from Applied Biosystem. lOOng total 20 RNA was reverse-transcripted in 15ul RT solution mix that contains IX Reverse Transcription Buffer, IX RT primer, InM dNTP, 4U RNase Inhibitor and 50U MultiScribe Reverse Transcriptase. Then the RT solutions were performed by using the thermal program of 16°C, 30min; 42°C, 30min; 85°C, 5min on the PCR machine (Thermal cycler alpha engine, Bio-rad). Quantitative PCR was performed with TaqMan Universal PCR Master Mix kit and and Taqman microRNA assays kits according to the instruction from Applied Biosystem.
  • 2ul RT products were PCR amplified in IX TaqMan Universal PCR Master Mix, No AmpErase UNG, IX TaqMan MicroRNA Assay mix.
  • the real-time PCR was performed in Roch Light Cycling 480 machine with the program of 96°C, 5min initial heating; then 45 or 50 cycles of 95°C, 15s; 60°C, 60s.
  • Cp value was calculated with 2nd derivative method in LC480 software. Then miRNAs were absolutely quantified with the standard samples Cp values.
  • Unpaired t-test after Fisher test was used to determine the differentially expressed miRNAs.
  • For MedCalc software was used to perform receiver operating characteristic (ROC) curve analysis to determine the specificity and sensitivity of the validated miRNA as diagnostic biomarkers. Stepwise logistic regression analysis was performed to determine the specificity and sensitivity of combined miRNAs as diagnostic biomarkers. 95% confidence interval was used to determine the significance.
  • ROC receiver operating characteristic
  • the experimental data on 4 validated miRNA biomarkers in FFPE surgical tissues in the first aspect for discriminating adenocarcinoma lung cancer from normal lung tissues are shown in Table 14.
  • Particularly preferred hsa-miR-27a (SEQ ID NO: 3), hsa-miR-29a (SEQ ID NO: 4) and hsa-miR-34a (SEQ ID NO: 6) are shown in bold.
  • hsa-miR-34a/hsa-miR-27a 9.0E-1 7 2 .66 78% 96% 0.903 hsa-miR-34a/hsa-miR-29a 1 .3E-1 2 2.61 81 % 87% 0.861
  • hsa-miR-205 SEQ ID NO: 1
  • hsa-miR-25 SEQ ID NO: 2
  • hsa-miR-29a SEQ ID NO: 3
  • hsa-miR-205 SEQ ID NO: 1
  • hsa-miR-25 SEQ ID NO: 2
  • hsa-miR-375 SEQ ID NO: 7
  • the experimental data on 5 validated miRNA biomarkers in FFPE surgical tissues in the fifth aspect for discriminating small cell lung cancer from adenocarcinoma lung cancer are shown in Table 18.
  • Particularly preferred hsa-miR-205 5 (SEQ ID NO: 1), hsa-miR-34a (SEQ ID NO: 6), and hsa-miR-375 (SEQ ID NO: 7) are shown in bold.
  • the experimental data on 5 validated miRNA biomarkers in FFPE surgical tissues in the sixth aspect for discriminating small cell lung cancer from squamous cell lung cancer are shown in Table 19.
  • the results obtained demonstrate a highly specific regulation of miRNA expression in lung cancer.
  • the respective subsets of miRNAs specified herein 10 represent unique miRNA expression biomarkers for expression profiling of lung cancer that do not only allow the identification of a cancerogenous state as such but also enables the discrimination between different subtypes of lung tumors.
  • a quantitative analysis of the miRNA biomarkers (differentially) expressed in a particular sample may optionally be performed by quantitative RT-PCR employing a TaqMan MicroRNA assay (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.
  • the quantification of the miRNA biomarkers is 20 performed by using in situ hybridization (Fig.l).
  • the method comprising: (a) collecting a biopsy or surgical tissue from a patient; (b) preparing tissue section on a slide; (c) hybridizing at least one nucleic acid molecule encoding a microRNA sequence to the section on the slide; (d) quantifying the miRNA expression under microscope or by digital pathology solution; (e) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (f) determining the expression levels of the plurality of nucleic acid molecules in one or more control cells; and (g) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (e) and (f), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker,
  • nucleic acid expression signature hsa-miR-24 For normalizing the expression levels obtained for the nucleic acid molecules encoding microRNA sequences that are comprised in the nucleic acid expression signature hsa-miR-24 (SEQ ID NO:8) may be preferably used, which is stably expressed in colorectal tissues.
  • nucleic acid expression signature hsa-miR-122 For negative control of the expression levels obtained for the nucleic acid molecules encoding microRNA sequences that are comprised in the nucleic acid expression signature hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in colorectal tissues.
  • Probe for hybridization is a synthesized unmodified sequence that hybridizes to the target miRNA including a 30 base residue (GGGGGTCCTATATGGCTCCACTTCTCCCCC). The residue sequence is shown in bold. The probe is labelled with a fluorophore at the 5' end. Singe or multiple probes with separate fluorescent dyes can be hybridized in parallel.
  • the probe sequences for in situ hybridization in the invention are given in Table 20.
  • the residue forms 5' hairpin (GGGGG-CCCCC pair) to stabilize the hybridization between the probe and target miRNA and increase the hybridization specificity.
  • the same principle can be used to design probes for other miRNA biomarkers using in situ hybridization.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides diagnostic kits comprising a plurality of nucleic acid molecules encoding microRNA sequences for identifying one or more mammalian target cells exhibiting lung cancer, wherein the nucleic acid molecules are differentially expressed in target cells and in control cells. The invention further provides methods for identifying one or more mammalian target cells exhibiting lung cancer by using said nucleic acid molecules, and methods and pharmaceutical compositions for preventing or treating lung cancer.

Description

TISSUE-BASED MICRO-RNA METHODS FOR DIAGNOSIS OF
DIFFERENT SUBTYPES OF LUNG CANCER
FIELD OF THE INVENTION
The present invention relates to the validated miRNA biomarkers and corresponding methods for reliably diagnosis of different subtypes of lung cancers in the surgical and biopsy lung tissues, particularly of discriminating different subtypes of lung cancer. The subtypes of lung cancer include adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer.
BACKGROUND OF THE INVENTION
Lung cancer remains the most common cause of cancer-related deaths among man and woman worldwide. There estimated to 1.4 million new cases in 2009 with average annual increase for 2.51% (Frost & Sullivan estimates) and the majority of patients diagnosed with lung cancer in 2009 will die of their disease (Higgins, M.J. et al. (2009) Expert Rev Anticancer Ther 9, 1365-1378). Despite some improvements in surgical techniques and combined therapies over the last several decades, the five-year survival rate for all stages combined is about 15% in the United States and Europe.
Lung cancers are classified as either small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC). The predominant (>80%) histological form of lung cancer is NSCLC including adenocarcinoma and squamous-cell carcinoma. Cigarette smoking is the most important risk factor for lung cancer, accounting for about 80% of lung cancer cases in men and 50% in women worldwide.
Treatment for lung cancer differs according to the subtype of cancer. The treatment of choice for early stage NSCLC is surgery with a 5 year overall survival of 40%. However, a majority of patients are at an advanced disease stage at the time of diagnosis, which limits first-line therapy to multi-agent chemotherapy and an expected survival is less than 8 months. Recent advances in targeted therapies require greater accuracy in the subclassification of non-small-cell lung cancer (NSCLC). Inhibitors of tumor angiogenesis pose higher risk for adverse response in cases of squamous cell carcinoma (Lebanoy, D. (2009) / Clin Oncol 27, 2030-2037). Small cell lung cancer (SCLC) is the most deadly form of the disease, with a case-fatality rate greater than 90%. Despite often observed high, initial response rates, patients with limited-stage disease have a median survival of approximately 20 months. There is rarely a role for surgery in the management of SCLC and chemotherapy alone or combined with radiation is the choice of treatment.
Besides the different treatments on the different subtypes and etiologies of lung cancer, the inter-observer variability and the lack of specific, standardized assays also limit the current abilities to adequately stratify patients for suitable treatments. Treatment decisions for an individual patient with lung cancer will soon be based on detailed tumor and host characteristics. Specific molecular biomarkers to differentiate subtypes of lung cancers are definitely needed.
Many diagnostic assays are also hampered by the fact that they are typically based on the analysis of only a single molecular marker, which might affect detection reliability and/or accuracy. In addition, a single marker normally does not enable detailed predictions concerning latency stages, tumor progression, and the like. Thus, there is still a continuing need for the identification of alternative molecular markers and assay formats overcoming these limitations.
One approach to address this issue might be based on small regulatory RNA molecules, in particular on microRNAs (miRNAs) which, constitute an evolutionary conserved class of endogenously expressed small non-coding RNAs of 20-25 nucleotides (nt) in size that can mediate the expression of target mRNAs and thus - since their discovery about ten years ago - have been implicated with critical functions in cellular development, differentiation, proliferation, and apoptosis (Bartel, D.P. (2004) Cell 116, 281-297, Ambros, V. (2004) Nature 431, 350-355; He, L. et al. (2004) Nat Rev Genet 5, 522-531). Furthermore, miRNAs have advantages over mRNAs as cancer biomarkers, since they are very stable in vitro and long-lived in vivo (Lu, J. et al., (2005) Nature 435, 834-838; Lim, L.P. et al., (2005) Nature 433, 769-773).
MiRNAs are produced from primary transcripts that are processed to stem-loop structured precursors (pre-miRNAs) by the RNase III Drosha. After transport to the cytoplasm, another RNase III termed Dicer cleaves of the loop of the pre-miRNA hairpin to form a short double- stranded (ds) RNA, one strand of which is incorporated as mature miRNA into a miRNA-protein (miRNP). The miRNA guides the miRNPs to their target mRNAs where they exert their function (Bartel, D.P. (2004) Cell 23, 281- 292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531).
Depending on the degree of complementarity between the miRNA and its target, miRNAs can guide different regulatory processes. Target mRNAs that are highly complementary to miRNAs are specifically cleaved by mechanisms identical to RNA interference (RNAi). Thus, in such scenario, the miRNAs function as short interfering RNAs (siRNAs). Target mRNAs with less complementarity to miRNAs are either directed to cellular degradation pathways or are translationally repressed without affecting the mRNA level. However, the mechanism of how miRNAs repress translation of their target mRNAs is still a matter of controversy.
High-throughput miRNA quantification technologies, such as miRNA microarray, real-time RT-PCR-based TaqMan miRNA assays, have provided powerful tools to study the global miRNA profile in whole cancer genome. Emerging data available indicate that dysregulation of miRNA expression may inter alia be associated with the development and/or progression of certain types of cancer. For example, two miRNAs, miR-15 and miR-16-1, were shown to map to a genetic locus that is deleted in chronic lymphatic leukemia (CLL) and it was found that in about 70% of the CLL patients, both miRNA genes are deleted or down-regulated. Furthermore, down- regulation of miR-143 and miR-145 was observed in colorectal neoplasia, whereas expression of the miRNA let-7 is frequently reduced in lung cancers (Michael, M.Z. et al. (2003) Mol Cancer Res 1, 882-891; Mayr, C. et al. (2007) Science 315, 1576-1579). In fact, it has been speculated based on cancer- associated alterations in miRNA expression and the observation that miRNAs are frequently located at genomic regions involved in cancers that miRNAs may act both as tumor suppressors and as oncogenes (Esquela-Kerscher, A. and Slack, F.J (2006) Nat Rev Cancer 6, 259-269; Calin, G.A. and Croce, CM. (2007) / Clin Invest 117, 2059-2066; Blenkiron, C. and Miska, E.A. (2007) Hum Mol Genet 16, R106-R113). Demonstrated abnormal expression patterns of miRNAs in human cancers highlight their potential use as diagnostic and prognostic biomarkers.
Several studies have reported miRNA expression profiling in human lung cancer
(Johnson, S.M. et al. (2005) Cell 120, 635-647; Liang, Y. et al. (2008) BMC Med Genomics 1, 61; Kumar, M.S. et al. (2008) Proc Natl Acad Sci USA 105, 3903-3908; Miko, E. et al. (2009) Exp Lung Res 35, 646-664; Xie, Y et al. (2009 ) Lung Cancer May 13; Lebanony, D. et al. (2009) / Clin Oncol 27, 2030-2037; Kauppinen, S. et al. (2009) Clin Cancer Res 15, 1177-1183; Mascaux, C. et al. (2009) Eur Respir J 33, 352-359). Consistently, these studies have shown that specific miRNAs are aberrantly expressed in malignant tissues as compared to nonmalignant lung tissue. Moreover, studies found that some miRNAs may be related to prognosis (Yu, S.L. et al. (2008) Cancer Cell 13, 48-57; Raponi, M. et al (2009) Cancer Res 69, 5776-5783). Thus, such miRNAs may provide insights into cellular processes involved in the malignant transformation and progression.
Thus, there still remains a need for (a set of) diagnostic markers, particularly in form of a "expression signature" or a "molecular footprint", that enable the rapid, reliable and cost-saving identification and/or treatment of cells exhibiting or having a predisposition to develop different subtypes of lung cancer. In addition, there is also a continuing need for corresponding methods both for the identification and for the treatment of target cells displaying such a cancerous phenotype.
OBJECT AND SUMMARY OF THE INVENTION
It is an objective of the present invention to provide the validated miRNA biomarkers and corresponding methods for reliably diagnosis of different subtypes of lung cancer in the surgical and biopsy tissues, particularly of discriminating different subtypes of lung cancer. Specifically, lung cancer manifested as an adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer by determining a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells analyzed as compared to control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of lung cancer.
More specifically, it is an object of the invention to provide the validated miRNA biomarkers for identifying one or more mammalian target cells exhibiting lung cancer and/or discriminating adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer. Furthermore, it is an object of the invention to provide corresponding methods for identifying one or more mammalian target cells exhibiting lung cancer, discriminating different subtypes of lung cancer as well as for preventing or treating such a condition.
These objectives as well as others, which will become apparent from the ensuing description, are attained by the subject matter of the independent claims. Some of the preferred embodiments of the present invention are defined by the subject matter of the dependent claims.
In a first aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of adenocarcinoma lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least four nucleic acid molecules.
In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa- miR-29a, hsa-miR-34a and hsa-miR-375.
Particular preferably, the expressions of hsa-miR-34a and hsa-miR-375 are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a and hsa-miR-29a are down-regulated in the one or more target cells compared to the one or more normal control cells. In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-34a/hsa-miR- 27a and hsa-miR-34a/hsa-miR-29a. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a, hsa-miR-27a and hsa- miR-34a.
In a second aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least four nucleic acid molecules.
In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-25, hsa-miR-29a and hsa-miR-375.
Particular preferably, the expressions of hsa-miR-205 and hsa-miR-25 are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-29a and hsa-miR-375 are down-regulated in the one or more target cells compared to the one or more normal control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-205/hsa-miR- 29a, hsa-miR-25/hsa-miR-29a, hsa-miR-205/hsa-miR-375, hsa-miR-25/hsa-miR-375. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205, hsa-miR-25 and hsa-miR-29a.
In a third aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least five nucleic acid molecules.
In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-375.
Particular preferably, the expressions of hsa-miR-25 and hsa-miR-375 are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa-miR-29a and hsa-miR-29b are down-regulated in the one or more target cells compared to the one or more normal control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-25/hsa-miR- 27a, hsa-miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-irriR-375/hsa-miR- 29a. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a and hsa-miR-375.
In a fourth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating squamous cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer or adenocarcinoma lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least four nucleic acid molecules.
In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-25, hsa-miR-27a and hsa-miR-375.
Particular preferably, the expressions of hsa-miR-205, hsa-miR-25, hsa- miR-27a are up-regulated and the expression of one nucleic acid molecule encoding hsa-miR-375 is down-regulated in the one or more target cells compared to the one or more control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-205/hsa-miR-375 and hsa-miR-25/hsa-miR-375. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205, hsa-miR-25 and hsa- miR-375.
In a fifth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or adenocarcinoma lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least six nucleic acid molecules.
In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.
Particular preferably, the expressions of hsa-miR-25 and hsa-miR-375 are up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a are down- regulated in the one or more target cells compared to the one or more control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-25/hsa-miR-27a, hsa- miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-25, hsa-miR-34a and hsa-miR-375.
In a sixth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or squamous cell lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least six nucleic acid molecules. In preferred embodiments, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.
Particular preferably, the expression of hsa-miR-375 is up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a are down-regulated in the one or more target cells compared to the one or more control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-375/hsa-miR-27a and hsa-miR-375/hsa-miR-29a. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29b and hsa-miR-375.
In a seventh aspect, the present invention relates to a method for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer, the method comprising: (a) collecting a biopsy or surgical tissue from a patient; (b) preparing tissue section on a slide; (c) hybridizing at least one nucleic acid molecule biomarker encoding a microRNA sequence to the section on the slide, (d) quantifying the miRNA expression under microscope or by digital pathology solution; (e) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (f) determining the expression levels of the plurality of nucleic acid molecules in one or more control cells; and (g) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (e) and (f), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, as defined herein, that is indicative for the presence of adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.
Particularly preferably, the method is manifested as in situ hybridization.
For quantitative determination, 7 validated miRNA biomarkers are used: hsa-miR-205, hsa-miR-25, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.
For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 may be preferably used, which does not expressed in lung tissues.
In a eighth aspect, the present invention relates to a method for preventing or treating lung cancer, the method comprising: (a) identifying a nucleic acid expression biomarker by using a method, as defined herein; and (b) modifying the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression is up-regulated is down- regulated and the expression of a nucleic acid molecule whose expression is down- regulated is up-regulated.
In a ninth aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated from lung cancer patients, as defined herein.
Finally, in a tenth aspect, the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer. Other embodiments of the present invention will become apparent from the detailed description hereinafter.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts a flow chart schematically illustrating the essential method steps in the seventh aspect for determining an expression biomarker according to the present invention for identifying one or more target cells exhibiting adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer. Particularly of discriminating the different subtypes of lung cancer using in situ hybridization method.
Figure 2A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the first aspect according to the present invention for identifying one or more target cells exhibiting adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with adenocarcinoma lung cancer as compared to normal lung tissues (i.e. an up-regulation or a down-regulation). The data indicate that adenocarcinoma lung cancer can be reliably discriminated from normal lung tissues in FFPE surgical tissues.
Figure 2B depicts stepwise logistic regression analysis of one combination (hsa-miR-27a, hsa-miR-29a and hsa-miR-34a) in the first aspect according to the present invention for identifying one or more target cells exhibiting adenocarcinoma lung cancer in FFPE surgical tissues. The data indicate that adenocarcinoma lung cancer can be reliably discriminated from normal lung tissues (AUC=0.925) in FFPE surgical tissues.
Figure 3A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the second aspect according to the present invention for identifying one or more target cells exhibiting squamous cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to normal lung tissues (i.e. an up- regulation or a down-regulation). The data indicate that squamous cell lung cancer can be reliably discriminated from normal lung tissues in FFPE surgical tissues.
Figure 3B depicts stepwise logistic regression analysis of one combination (hsa-miR-205, hsa-miR-25 and hsa-miR-29a) in the second aspect according to the present invention for identifying one or more target cells exhibiting squamous cell lung cancer in FFPE surgical tissues. The data indicate that squamous cell lung cancer can be reliably discriminated from normal lung tissues (AUC=0.961) in FFPE surgical tissues.
Figure 4A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the third aspect according to the present invention for identifying one or more target cells exhibiting small cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with small cell lung cancer as compared to normal lung tissues (i.e. an up-regulation or a down- regulation). The data indicate that small cell lung cancer can be reliably discriminated from normal lung tissues in FFPE surgical tissues.
Figure 4B depicts stepwise logistic regression analysis of one combination (hsa-miR-29a and hsa-miR-375) in the third aspect according to the present invention for identifying one or more target cells exhibiting small cell lung cancer in FFPE surgical tissues. The data indicate that small cell lung cancer can be reliably discriminated from normal lung tissues (AUC=0.998) in FFPE surgical tissues.
Figure 5A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the fourth aspect according to the present invention for discriminating squamous cell lung cancer from adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with squamous cell lung cancer as compared to the patients with adenocarcinoma lung cancer (i.e. an up-regulation or a down-regulation). The data indicate that squamous cell lung cancer can be reliably discriminated from adenocarcinoma lung cancer in FFPE surgical tissues.
Figure 5B depicts stepwise logistic regression analysis of one combination (hsa-miR-205, hsa-miR-25 and hsa-miR-375) in the fourth aspect according to the present invention for discriminating squamous cell lung cancer from adenocarcinoma lung cancer in FFPE surgical tissues. The data indicate that squamous cell lung cancer can be reliably discriminated from adenocarcinoma lung cancer (AUC=0.922) in FFPE surgical tissues.
Figure 6A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the fifth aspect according to the present invention for discriminating small cell lung cancer from adenocarcinoma lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with small cell lung cancer as compared to the patients with adenocarcinoma lung cancer (i.e. an up-regulation or a down-regulation). The data indicate that small cell lung cancer can be reliably discriminated from adenocarcinoma lung cancer in FFPE surgical tissues.
Figure 6B depicts stepwise logistic regression analysis of one combination (hsa-miR-25, hsa-miR-34a and hsa-miR-375) in the fifth aspect according to the present invention for discriminating small cell lung cancer from adenocarcinoma lung cancer in FFPE surgical tissues. The data indicate that small cell lung cancer can be reliably discriminated from adenocarcinoma lung cancer (AUC=0.991) in FFPE surgical tissues.
Figure 7A illustrates the human miRNAs comprised in particularly preferred expression biomarkers in the sixth aspect according to the present invention for discriminating small cell lung cancer from squamous cell lung cancer. Also indicates the expression levels and accuracy of these miRNAs in the patients with small cell lung cancer as compared to the patients with squamous cell lung cancer (i.e. an up-regulation or a down-regulation). The data indicate that small cell lung cancer can be reliably discriminated from squamous cell lung cancer in FFPE surgical tissues.
Figure 7B depicts stepwise logistic regression analysis of one combination (hsa-miR-29b and hsa-miR-375) in the sixth aspect according to the present invention for discriminating small cell lung cancer from squamous cell lung cancer in FFPE surgical tissues. The data indicate that small cell lung cancer can be reliably discriminated from squamous cell lung cancer (AUC=0.982) in FFPE surgical tissues.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based on the unexpected finding that lung cancer can be reliably identified and different subtypes of lung cancer can be discriminated based on particular miRNA expression profiles with high sensitivity and specificity, wherein the expression biomarkers as defined herein typically comprises both up- and down-regulated human miRNAs. More specifically, said miRNA expression biomarkers - by analyzing the overall miRNA expression pattern and/or the respective individual miRNA expression level(s) - allow the detection of lung cancer at an early disease state and discriminating the different subtypes of lung cancer.
The present invention illustratively described in the following may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein.
The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. The drawings described are only schematic and are to be considered non-limiting.
Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. For the purposes of the present invention, the term "consisting of" is considered to be a preferred embodiment of the term "comprising of". If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also to be understood to disclose a group, which preferably consists only of these embodiments.
Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated.
The term "about" in the context of the present invention denotes an interval of accuracy that the person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from the indicated numerical value of + 10%, and preferably + 5%.
Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
Further definitions of term will be given in the following in the context of which the terms are used.
The following terms or definitions are provided solely to aid in the understanding of the invention. These definitions should not be construed to have a scope less than understood by a person of ordinary skill in the art.
It is an objective of the present invention to provide the validated miRNA biomarkers and corresponding methods for reliably diagnosis of different subtypes of lung cancer in the surgical and biopsy tissues, particularly of discriminating different subtypes of lung cancer. Specifically, lung cancer manifested as an adenocarcinoma lung cancer, squamous cell lung cancer and small cell lung cancer by determining a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA (miRNA) sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells analyzed as compared to control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is indicative for the presence of lung cancer.
More specifically, it is an object of the invention to provide the validated miRNA biomarkers for identifying one or more mammalian target cells exhibiting lung cancer and/or discriminating adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.
The term "cancer" (also referred to as "carcinoma"), as used herein, generally denotes any type of malignant neoplasm, that is, any morphological and/or physiological alterations (based on genetic re-programming) of special tissue exhibiting or having a predisposition to develop characteristics of a carcinoma as compared to unaffected (healthy) wild-type control tissues. Examples of such alterations may relate inter alia to cell size and shape (enlargement or reduction), cell proliferation (increase in cell number), cell differentiation (change in physiological state), apoptosis (programmed cell death) or cell survival.
The term "lung cancer", as used herein, refers to uncontrolled cell growth in the tissue of lung, or cancerous growths in the lung.
The term "different subtypes of lung cancer", as used herein, include adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.
"Adenocarcinoma lung cancer" or "adenocarcinoma lung carcinoma" is a form of non-small cell lung cancer. Eighty percent of lung cancers are non-small cell cancers (NSCLC), and of these, about 50% are adenocarcinomas. Adenocarcinoma of the lung begins in the outer parts of the lung, and it can be present for a long time before it is diagnosed. It is the type of lung cancer most commonly seen in women and is often seen in non-smokers.
"Squamous cell lung cancer" or "squamous cell lung carcinoma" is a form of non-small cell lung cancer. About 30% of NSCLC are squamous cell lung cancer. Squamous cell lung carcinomas usually begin in the bronchial tubes (large airways) in the central part of the lungs. Many people have symptoms early on, commonly hemoptysis (coughing up blood).
"Small cell lung cancer", or "small cell lung carcinoma" (SCLC), is thought to arise from neuroendocrine cells which form part of the epithelium (lining) of the bronchi (airways). SCLC accounts for about 18% of all cases of lung cancer. SCLCs are very aggressive. They grow quickly and spread via the bloodstream to the liver, lung, bones and brain. It is quite common for tumour deposits to be found in these organs at the time of diagnosis.
The term "patient", as used herein, refers to a human being at least supposed to have lung cancer, or certain types of lung cancer; whereas the term
"healthy individual" or "normal control" typically denotes a healthy person not having characteristics of such a cancerous phenotype. However, in some applications, for example, when comparing different types of lung cancer, the individual having the other types of lung cancer is typically considered the "control".
The sample used for detection in the in vitro methods of the present invention should generally be collected in a clinically acceptable manner, preferably in a way that nucleic acids (in particular RNA) or proteins are preserved. The samples to be analyzed are typically from tissue. Furthermore, blood and other types of sample can be used as well.
The term "microRNA" (or "miRNA"), as used herein, is given its ordinary meaning in the art (Bartel, D.P. (2004) Cell 23, 281-292; He, L. and Hannon, G.J. (2004) Nat Rev Genet 5, 522-531). Accordingly, a "microRNA" denotes an RNA molecule derived from a genomic locus that is processed from transcripts that can form local RNA precursor miRNA structures. The mature miRNA is usually 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present as well, for example 18, 19, 26 or 27 nucleotides. The miRNA encoding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within an imperfect RNA duplex (herein also referred to as stem-loop or hairpin structure or as pre-miRNA), which serves as an intermediate for miRNA processing from a longer precursor transcript. This processing typically occurs through the consecutive action of two specific endonucleases termed Drosha and Dicer, respectively. Drosha generates from the primary transcript (herein also denoted "pri-miRNA") a miRNA precursor (herein also denoted "pre-miRNA") that typically folds into a hairpin or stem-loop structure. From this miRNA precursor a miRNA duplex is excised by means of Dicer that comprises the mature miRNA at one arm of the hairpin or stem-loop structure and a similar- sized segment (commonly referred to miRNA*) at the other arm. The miRNA is then guided to its target mRNA to exert its function, whereas the miRNA* is degraded. In addition, miRNAs are typically derived from a segment of the genome that is distinct from predicted protein-coding regions.
The term "miRNA precursor" (or "precursor miRNA" or "pre-miRNA"), as used herein, refers to the portion of a miRNA primary transcript from which the mature miRNA is processed. Typically, the pre-miRNA folds into a stable hairpin (i.e. a duplex) or a stem-loop structure. The hairpin structures typically range from 50 to 80 nucleotides in length, preferably from 60 to 70 nucleotides (counting the miRNA residues, those pairing to the miRNA, and any intervening segment(s) but excluding more distal sequences).
The term "nucleic acid molecule encoding a microRNA sequence", as used herein, denotes any nucleic acid molecule coding for a microRNA (miRNA). Thus, the term does not only refer to mature miRNAs but also to the respective precursor miRNAs and primary miRNA transcripts as defined above. Furthermore, the present invention is not restricted to RNA molecules but also includes corresponding DNA molecules encoding a microRNA, e.g. DNA molecules generated by reverse transcribing a miRNA sequence. A nucleic acid molecule encoding a microRNA sequence according to the invention typically encodes a single miRNA sequence (i.e. an individual miRNA). However, it is also possible that such nucleic acid molecule encodes two or more miRNA sequences (i.e. two or more miRNAs), for example a transcriptional unit comprising two or more miRNA sequences under the control of common regulatory sequences such as a promoter or a transcriptional terminator.
The term "nucleic acid molecule encoding a microRNA sequence", as used herein, is also to be understood to include "sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence (5'— > 3') matches or corresponds to the encoded miRNA (5'— > 3') sequence) and "anti-sense nucleic acid molecules" (i.e. molecules whose nucleic acid sequence is complementary to the encoded miRNA (5'— > 3') sequence or, in other words, matches the reverse complement (3'— > 5') of the encoded miRNA sequence). The term "complementary", as used herein, refers to the capability of an "anti-sense" nucleic acid molecule sequence of forming base pairs, preferably Watson-Crick base pairs, with the corresponding "sense" nucleic acid molecule sequence (having a sequence complementary to the anti-sense sequence).
Within the scope of the present invention, two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. Alternatively, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). Preferably, the "complementary" nucleic acid molecule comprises at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in corresponding "sense" nucleic acid molecule.
Accordingly, the plurality of nucleic acid molecules encoding a miRNA sequence that are comprised in a diagnostic kit of the present invention may include one or more "sense nucleic acid molecules" and/or one or more "anti-sense nucleic acid molecules". In case, the diagnostic kit includes one or more "sense nucleic acid molecules" (i.e. the miRNA sequences as such), said molecules are to be considered to constitute the totality or at least a subset of differentially expressed miRNAs (i.e. molecular markers) being indicative for the presence of or the disposition to develop a particular condition, here lung cancer. On the other hand, in case a diagnostic kit includes one or more "anti-sense nucleic acid molecules" (i.e. sequences complementary to the miRNA sequences), said molecules may comprise inter alia probe molecules (for performing hybridization assays) and/or oligonucleotide primers (e.g., for reverse transcription or PCR applications) that are suitable for detecting and/or quantifying one or more particular (complementary) miRNA sequences in a given sample.
A plurality of nucleic acid molecules as defined within the present invention may comprise at least two, at least ten, at least 50, at least 100, at least 200, at least 500, at least 1.000, at least 10.000 or at least 100.000 nucleic acid molecules, each molecule encoding a miRNA sequence.
The term "differentially expressed", as used herein, denotes an altered expression level of a particular miRNA in the disease cells as compared to the healthy controls, or as compared to other types of disease samples, which may be an up- regulation (i.e. an increased miRNA concentration) or a down-regulation (i.e. a reduced or abolished miRNA concentration). In other words, the nucleic acid molecule is activated to a higher or lower level in the disease cells than in the control cells.
Within the scope of the present invention, a nucleic acid molecule is to considered differentially expressed if the respective expression levels of this nucleic acid molecule in disease samples and control samples typically differ by at least 5% or at least 10%, preferably by at least 20% or at least 25%, and most preferably by at least 30% or at least 50%. Thus, the latter values correspond to an at least 1.3-fold or at least 1.5-fold up-regulation of the expression level of a given nucleic acid molecule in the disease samples compared to the control samples or vice versa an at least 0.7-fold or at least 0.5-fold down-regulation of the expression level in the disease samples, respectively.
The term "expression level", as used herein, refers to extent to which a particular miRNA sequence is transcribed from its genomic locus, that is, the concentration of a miRNA in the sample to be analyzed.
As outlined above, the term "control cells" typically denotes a cell sample collected from (healthy) individual not having characteristics of a lung cancer phenotype. However, in some applications, for example, when comparing different types of lung cancers, the cells collected from other types of lung cancer is typically considered the "control cells".
The determining of expression levels typically follows established standard procedures well known in the art (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual. 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F.M. et al. (2001) Current Protocols in Molecular Biology. Wiley & Sons, Hoboken, NJ). Determination may occur at the RNA level, for example by Northern blot analysis using miRNA-specific probes, or at the DNA level following reverse transcription (and cloning) of the RNA population, for example by quantitative PCR or real-time PCR techniques. The term "determining", as used herein, includes the analysis of any nucleic acid molecules encoding a microRNA sequence as described above. However, due to the short half-life of pri-miRNAs and pre-mRNAs typically the concentration of only the mature miRNA is measured.
In specific embodiments, the standard value of the expression levels obtained in several independent measurements of a given sample (for example, two, three, five or ten measurements) and/or several measurements within several samples or control samples are used for analysis. The standard value may be obtained by any method known in the art. For example, a range of mean + 2 SD (standard deviation) or mean + 3 SD may be used as standard value.
The difference between the expression levels obtained for disease and control cells may be normalized to the expression level of further control nucleic acids, e.g. housekeeping genes whose expression levels are known not to differ depending on the disease states of the individual from whom the sample was collected. Exemplary housekeeping genes include inter alia β-actin, glycerinaldehyde 3-phosphate dehydrogenase, and ribosomal protein PI . In preferred embodiments, the control nucleic acid is another miRNA known to be stably expressed during the various noncancerous and (pre-)cancerous states of the individual from whom the sample was collected.
However, instead of determining in any experiment the expression levels for cell sample it may also be possible to define based on experimental evidence and/or prior art data on or more cut-off values for a particular disease phenotype (i.e. a disease state). In such scenario, the respective expression levels for the cell sample can be determined by using a stably expressed control miRNA for normalization. If the "normalized" expression levels calculated are higher than the respective cutoff value defined, then this finding would be indicative for an up-regulation of gene expression. Vice versa, if the "normalized" expression levels calculated are lower than the respective cutoff value defined, then this finding would be indicative for a down- regulation of gene expression.
In the context of the present invention, the term "identifying lung cancer and/or discriminating different subtypes of lung cancer" is intended to also encompass predictions and likelihood analysis (in the sense of "diagnosing"). The biomarkers and methods disclosed herein are intended to be used clinically in making decisions concerning treatment modalities, including therapeutic intervention, diagnostic criteria such as disease stages, and disease monitoring and surveillance for the disease. According to the present invention, an intermediate result for examining the condition of a subject may be provided. Such intermediate result may be combined with additional information to assist a doctor, nurse, or other practitioner to diagnose that a subject suffers from the disease. Alternatively, the invention may be used to detect cancerous changes through cell sample, and provide a doctor with useful information for diagnosis. Furthermore, the invention may also be used to discriminate between different subtypes of lung cancers.
Within the present invention, one or more differentially expressed nucleic acid molecules identified together represent a nucleic acid expression biomarker that is indicative for lung cancer. The term "expression biomarker", as used herein, denotes a set of nucleic acid molecules (e.g., miRNAs), wherein the expression level of the individual nucleic acid molecules differs between the cells collected from lung cancer patient and the healthy control. Herein, a nucleic acid expression biomarker is also referred to as a set of markers and represents a minimum number of (different) nucleic acid molecules, each encoding a miRNA sequence that is capable for identifying a phenotypic state of an individual.
In a first aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of adenocarcinoma lung cancer. The nucleic acid expression biomarker, as defined herein, may comprise at least four nucleic acid molecules.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-34a (SEQ ID NO:6) and hsa-miR- 375 (SEQ ID NO:7).
Particular preferably, the expressions of hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7) are up-regulated and the expression of any one or more of the nucleic acid molecules encoding (SEQ ID NO:3) and hsa-miR-29a (SEQ ID NO:4) are down -regulated in the one or more target cells compared to the one or more normal control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-34a (SEQ ID NO:6)/hsa-miR-27a (SEQ ID NO:3) and hsa-miR-34a (SEQ ID NO:6)/hsa-miR-29a (SEQ ID NO:4). Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a (SEQ ID NO:4), hsa-miR-27a (SEQ ID NO:3) and hsa-miR-34a (SEQ ID NO:6).
For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
The nucleic acid sequences of the above -referenced miRNAs are listed in Table
1.
TABLE 1
miRNA Sequence (5'→ 3')
Biomarker
hsa-miR-27a uucacaguggcuaaguuccgc
hsa-miR-29a uagcaccaucugaaaucgguua hsa-miR-34a uggcagugucuuagcugguugu
hsa-miR-375 uuuguucguucggcucgcguga
Control
hsa-miR-24 uggcucaguucagcaggaacag
hsa-miR-122 uggagugugacaaugguguuug
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
The terms " at least one nucleic acid " as used herein, may relate to any subgroup of the plurality of nucleic acid molecules, e.g., any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, and so forth nucleic acid molecules, each encoding a microRNA sequence that are comprised in the nucleic acid expression biomarker, as defined herein.
In a second aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least four nucleic acid molecules.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7).
Particular preferably, the expressions of hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2) are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7) are down-regulated in the one or more target cells compared to the one or more normal control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-205 (SEQ ID NO:l)/hsa-miR-29a (SEQ ID NO:4), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-29a (SEQ ID NO:4), hsa-miR-205 (SEQ ID NO:l)/hsa-miR-375 (SEQ ID NO:7), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-375 (SEQ ID NO:7). Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-29a (SEQ ID NO:4).
For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
The nucleic acid sequences of the above -referenced miRNAs are listed in Table 2.
TAB LE 2
Figure imgf000027_0001
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158). In a third aspect, the present invention relates to a diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting small cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more normal control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least five nucleic acid molecules.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-375 (SEQ ID NO:7).
Particular preferably, the expressions of hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7) are up-regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) are down-regulated in the one or more target cells compared to the one or more normal control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-25 (SEQ ID NO:2)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-25 (SEQ ID NO:2)/hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7)/hsa-miR-29a (SEQ ID NO:4). Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7).
For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
The nucleic acid sequences of the above -referenced miRNAs are listed in Table 3.
TAB LE 3
Figure imgf000029_0001
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
In a fourth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating squamous cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of squamous cell lung cancer or adenocarcinoma lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least four nucleic acid molecules.
In more preferred embodiments, the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3) and hsa-miR-375 (SEQ ID N0:7).
Particular preferably, the expressions of hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3) are up-regulated and the expression of one nucleic acid molecule encoding hsa-miR-375 (SEQ ID NO:7) is down-regulated in the one or more target cells compared to the one or more control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-205 (SEQ ID NO:l)/hsa-miR-375 (SEQ ID NO:7) and hsa-miR-25 (SEQ ID NO:2)/hsa-miR-375 (SEQ ID NO:7). Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7).
For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
The nucleic acid sequences of the above -referenced miRNAs are listed in Table 4.
TAB LE 4
miRNA Sequence (5'→ 3')
Biomarker
hsa-miR-205 uccuucauuccaccggagucug
hsa-miR-25 cauugcacuugucucggucuga
hsa-miR-27a uucacaguggcuaaguuccgc
hsa-miR-375 uuuguucguucggcucgcguga
Control
hsa-miR-24 uggcucaguucagcaggaacag hsa-miR-122 uggagugugacaaugguguimg
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
In a fifth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from adenocarcinoma lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or adenocarcinoma lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least six nucleic acid molecules.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).
Particular preferably, the expressions of hsa-miR-25 (SEQ ID NO:2) and hsa-miR-375 (SEQ ID NO:7) are up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-34a (SEQ ID NO:6) are down-regulated in the one or more target cells compared to the one or more control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-25 (SEQ ID NO:2) /hsa- miR-27a (SEQ ID NO:3), hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3), hsa-miR-25 (SEQ ID NO:2) /hsa-miR-29a (SEQ ID NO:4) and hsa-miR-375 (SEQ ID NO:7)/hsa-miR-29a (SEQ ID NO:4). Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-25 (SEQ ID NO:2), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7). For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
The nucleic acid sequences of the above -referenced miRNAs are listed in Table 5.
TAB LE 5
Figure imgf000032_0001
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
In a sixth aspect, the present invention relates to a diagnostic kit of molecular markers for discriminating small cell lung cancer from squamous cell lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarkers that is indicative for the presence of small cell lung cancer or squamous cell lung cancer.
The nucleic acid expression biomarker, as defined herein, may comprise at least six nucleic acid molecules.
In more preferred embodiments, the nucleic acid expression signature comprises any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).
Particular preferably, the expression of hsa-miR-375 (SEQ ID NO:7) is up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-205 (SEQ ID NO:l), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5) and hsa-miR-34a (SEQ ID NO:6) are down-regulated in the one or more target cells compared to the one or more control cells.
In further preferred embodiments, the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-375 (SEQ ID NO:7)/hsa-miR-27a (SEQ ID NO:3) and hsa-miR-375 (SEQ ID NO:7) /hsa-miR-29a (SEQ ID NO:4). Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29b (SEQ ID NO:5) and hsa-miR-375 (SEQ ID NO:7).
For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
The nucleic acid sequences of the above -referenced miRNAs are listed in Table 6.
TAB LE 6
miRNA Sequence (5'→ 3')
Biomarker hsa-miR-205 uccuucauuccaccggagucug
hsa-miR-27a uucacaguggcuaaguuccgc
hsa-miR-29a uagcaccaucugaaaucgguua
hsa-miR-29b uagcaccauuugaaaucaguguu
hsa-miR-34a uggcagugucuuagcugguugu
hsa-miR-375 uuuguucguucggcucgcguga
Control
hsa-miR-24 uggcucaguucagcaggaacag
hsa-miR-122 uggagugugacaaugguguimg
All miRNA sequences disclosed herein have been deposited in the miRBase database (http://microrna.sanger.ac.uk/; see also Griffiths-Jones S. et al. (2008) Nucl. Acids Res. 36, D154-D158).
In a seventh aspect, the present invention relates to a method for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer, the method comprising:
(a) collecting a biopsy or surgical tissue from a patient;
(b) preparing tissue section on a slide;
(c) hybridizing at least one nucleic acid molecule biomarker encoding a microRNA sequence to the section on the slide;
(d) quantifying the miRNA expression under microscope or by digital pathology solution;
(e) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence;
(f) determining the expression levels of the plurality of nucleic acid molecules in one or more control cells; and
(g) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (e) and (f), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, as defined herein, that is indicative for the presence of adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.
Particularly preferably, the method is manifested as in situ hybridization. For quantitative determination, 7 validated miRNA biomarkers are used: hsa-miR-205 (SEQ ID NO:l), hsa-miR-25 (SEQ ID NO:2), hsa-miR-27a (SEQ ID NO:3), hsa-miR-29a (SEQ ID NO:4), hsa-miR-29b (SEQ ID NO:5), hsa-miR-34a (SEQ ID NO:6) and hsa-miR-375 (SEQ ID NO:7).
For normalizing the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-24 (SEQ ID NO: 8) may be preferably used, which is stably expressed in lung tissues. For negative control of the expression levels obtained for the nucleic acid molecule biomarkers encoding microRNA sequences, the nucleic acid expression molecule encoding hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in lung tissues.
In situ hybridization techniques allow specific nucleic acid sequences to be detected in morphologically preserved chromosomes, cells or tissue sections. In combination with immunocytochemistry, in situ hybridization can relate microscopic topological information to gene activity at the DNA, mRNA, and protein level. There are two types of nonradioactive hybridization methods: direct and indirect. Direct methods using fluorescein or other fluorochromes directly coupled to the nucleotide (Baumann, J. G. J. et al. ((1980) Exp. Cell Res. 138, 485-490). Indirect methods using digoxigenin (detected by specific antibodies) and biotin (detected by streptavidin) (Leary, J. L et al (1983) Proc. Natl. Acad. Sci. USA 80, 4045-4049).
In an eighth aspect, the present invention relates to a method for preventing or treating lung cancer, the method comprising:
(a) identifying a nucleic acid expression biomarker by using a method, as defined herein; and
(b) modifying the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression biomarker in such way that the expression of a nucleic acid molecule whose expression is up-regulated is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated is up-regulated. The term "modifying the expression of a nucleic acid molecule encoding a miRNA sequence", as used herein, denotes any manipulation of a particular nucleic acid molecule resulting in an altered expression level of said molecule, that is, the production of a different amount of corresponding miRNA as compared to the expression of the "wild-type" (i.e. the unmodified control). The term "different amount", as used herein, includes both a higher amount and a lower amount than determined in the unmodified control. In other words, a manipulation, as defined herein, may either up-regulate (i.e. activate) or down-regulate (i.e. inhibit) the expression (i.e. particularly transcription) of a nucleic acid molecule.
Within the present invention, expression of one or more nucleic acid molecules encoding a microRNA sequence comprised in the nucleic acid expression signature is modified in such way that the expression of a nucleic acid molecule whose expression is up-regulated in cells is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in cells is up-regulated. In other words, the modification of expression of a particular nucleic acid molecule encoding a miRNA sequence occurs in an anti-cyclical pattern to the regulation of said molecule in cells of cancer patients in order to interfere with the "excess activity" of an up-regulated molecule and/or to restore the "deficient activity" of a down-regulated molecule in cells.
In a preferred embodiment of the inventive method, down-regulating the expression of a nucleic acid molecule comprises introducing into the patient a nucleic acid molecule encoding a sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated.
The term "complementary sequence", as used herein, is to be understood that the "complementary" nucleic acid molecule (herein also referred to as an "anti- sense nucleic acid molecule") introduced into blood is capable of forming base pairs, preferably Watson-Crick base pairs, with the up-regulated endogenous "sense" nucleic acid molecule.
Two nucleic acid molecules (i.e. the "sense" and the "anti-sense" molecule) may be perfectly complementary, that is, they do not contain any base mismatches and/or additional or missing nucleotides. In other embodiments, the two molecules comprise one or more base mismatches or differ in their total numbers of nucleotides (due to additions or deletions). In further embodiments, the "complementary" nucleic acid molecule comprises a stretch of at least ten contiguous nucleotides showing perfect complementarity with a sequence comprised in the up- regulated "sense" nucleic acid molecule.
The "complementary" nucleic acid molecule (i.e. the nucleic acid molecule encoding a nucleic acid sequence that is complementary to the microRNA sequence encoded by nucleic acid molecule to be down-regulated) may be a naturally occurring DNA- or RNA molecule or a synthetic nucleic acid molecule comprising in its sequence one or more modified nucleotides which may be of the same type or of one or more different types.
For example, it may be possible that such a nucleic acid molecule comprises at least one ribonucleotide backbone unit and at least one deoxyribonucleotide backbone unit. Furthermore, the nucleic acid molecule may contain one or more modifications of the RNA backbone into 2'-O-methyl group or 2'- O-methoxyethyl group (also referred to as "2'-O-methylation"), which prevented nuclease degradation in the culture media and, importantly, also prevented endonucleolytic cleavage by the RNA-induced silencing complex nuclease, leading to irreversible inhibition of the miRNA. Another possible modification - which is functionally equivalent to 2'-O-methylation - involves locked nucleic acids (LNAs) representing nucleic acid analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA-mimicking sugar conformation (Orom, U.A. et al. (2006) Gene 372, 137-141).
Another class of silencers of miRNA expression was recently developed. These chemically engineered oligonucleotides, named "antagomirs", represent single- stranded 23-nucleotide RNA molecules conjugated to cholesterol (Krutzfeldt, J. et al. (2005) Nature 438, 685-689). As an alternative to such chemically modified oligonucleotides, microRNA inhibitors that can be expressed in cells, as RNAs produced from transgenes, were generated as well. Termed "microRNA sponges", these competitive inhibitors are transcripts expressed from strong promoters, containing multiple, tandem binding sites to a microRNA of interest (Ebert, M.S. et al. (2007) Nat. Methods 4, 721-726).
In order to unravel any potential implication of the miRNAs identified in the cancerous or pre-cancerous samples preliminary functional analyses may be performed with respect to the identification of mRNA target sequences to which the miRNAs may bind. Based on the finding that miRNAs may be involved in both tumor suppression and tumorigenesis (Esquela-Kerscher, A. and Slack, F.J (2006) supra; Calin, G.A. and Croce, CM. (2007) supra; Blenkiron, C. and Miska, E.A. (2007) supra) it is likely to speculate that mRNA target sites for such miRNAs include tumor suppressor genes as well as oncogenes.
A nucleic acid molecule is referred to as "capable of expressing a nucleic acid molecule" or capable "to allow expression of a nucleotide sequence" if it comprises sequence elements which contain information regarding to transcriptional and/or translational regulation, and such sequences are "operably linked" to the nucleotide sequence encoding the polypeptide. An operable linkage is a linkage in which the regulatory sequence elements and the sequence to be expressed (and/or the sequences to be expressed among each other) are connected in a way that enables gene expression.
The precise nature of the regulatory regions necessary for gene expression may vary among species, but in general these regions comprise a promoter which, in prokaryotes, contains both the promoter per se, i.e. DNA elements directing the initiation of transcription, as well as DNA elements which, when transcribed into RNA, will signal the initiation of translation. Such promoter regions normally include 5' non-coding sequences involved in initiation of transcription and translation, such as the -35/- 10 boxes and the Shine-Dalgarno element in prokaryotes or the TATA box, CAAT sequences, and 5'-capping elements in eukaryotes. These regions can also include enhancer or repressor elements as well as translated signal and leader sequences for targeting the native polypeptide to a specific compartment of a host cell. In addition, the 3' non-coding sequences may contain regulatory elements involved in transcriptional termination, polyadenylation or the like. If, however, these termination sequences are not satisfactory functional in a particular host environment, then they may be substituted with signals functional in that environment.
Furthermore, the expression of the nucleic molecules, as defined herein, may also be influenced by the presence, e.g., of modified nucleotides (cf. the discussion above). For example, locked nucleic acid (LNA) monomers are thought to increase the functional half-life of miRNAs in vivo by enhancing the resistance to degradation and by stabilizing the miRNA-target duplex structure that is crucial for silencing activity (Naguibneva, I. et al. (2006) Biomed Pharmacother 60, 633-638).
Therefore, a nucleic acid molecule of the invention to be introduced into patient provided may include a regulatory sequence, preferably a promoter sequence, and optionally also a transcriptional termination sequence. The promoters may allow for either a constitutive or an inducible gene expression. Suitable promoters include inter alia the E. coli /acUV5 and tet (tetracycline-responsive) promoters, the T7 promoter as well as the SV40 promoter or the CMV promoter.
The nucleic acid molecules of the invention may also be comprised in a vector or other cloning vehicles, such as plasmids, phagemids, phages, cosmids or artificial chromosomes. In a preferred embodiment, the nucleic acid molecule is comprised in a vector, particularly in an expression vector. Such an expression vector can include, aside from the regulatory sequences described above and a nucleic acid sequence encoding a genetic construct as defined in the invention, replication and control sequences derived from a species compatible with the host that is used for expression as well as selection markers conferring a selectable phenotype on host. Large numbers of suitable vectors such as pSUPER and pSUPERIOR are known in the art, and are commercially available.
In a ninth aspect, the present invention relates to a pharmaceutical composition for the prevention and/or treatment of lung cancer, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated from lung cancer patients, as defined herein, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated from lung cancer patients, as defined herein.
Finally, in a tenth aspect, the present invention relates to the use of said pharmaceutical composition for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
Within the scope of the present invention, suitable pharmaceutical compositions include inter alia those compositions suitable for oral, rectal, nasal, topical (including buccal and sub-lingual), peritoneal and parenteral (including intramuscular, subcutaneous and intravenous) administration, or for administration by inhalation or insufflation. Administration may be local or systemic. Preferably, administration is accomplished via the oral or intravenous routes. The formulations may also be packaged in discrete dosage units.
Pharmaceutical compositions according to the present invention include any pharmaceutical dosage forms established in the art, such as inter alia capsules, microcapsules, cachets, pills, tablets, powders, pellets, multi-particulate formulations (e.g., beads, granules or crystals), aerosols, sprays, foams, solutions, dispersions, tinctures, syrups, elixirs, suspensions, water-in-oil emulsions such as ointments, and oil- in water emulsions such as creams, lotions, and balms.
The ("sense" and "anti-sense") nucleic acid molecules described above can be formulated into pharmaceutical compositions using pharmacologically acceptable ingredients as well as established methods of preparation (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams & Wilkins, Philadelphia, PA; Crowder, T.M. et al. (2003 ) A Guide to Pharmaceutical Particulate Science. Interpharm/CRC, Boca Raton, FL; Niazi, S.K. (2004) Handbook of Pharmaceutical Manufacturing Formulations, CRC Press, Boca Raton, FL).
In order to prepare the pharmaceutical compositions, pharmaceutically inert inorganic or organic excipients (i.e. carriers) can be used. To prepare e.g. pills, tablets, capsules or granules, for example, lactose, talc, stearic acid and its salts, fats, waxes, solid or liquid polyols, natural and hardened oils may be used. Suitable excipients for the production of solutions, suspensions, emulsions, aerosol mixtures or powders for reconstitution into solutions or aerosol mixtures prior to use include water, alcohols, glycerol, polyols, and suitable mixtures thereof as well as vegetable oils.
The pharmaceutical composition may also contain additives, such as, for example, fillers, binders, wetting agents, glidants, stabilizers, preservatives, emulsifiers, and furthermore solvents or solubilizers or agents for achieving a depot effect. The latter is to be understood that the nucleic acid molecules may be incorporated into slow or sustained release or targeted delivery systems, such as liposomes, nanoparticles, and microcapsules.
To target most tissues within the body, clinically feasible noninvasive strategies are required for directing such pharmaceutical compositions, as defined herein, into cells. In the past years, several approaches have achieved impressive therapeutic benefit following intravenous injection into mice and primates using reasonable doses of siRNAs without apparent limiting toxicities.
One approach involves covalently coupling the passenger strand (miRNA* strand) of the miRNA to cholesterol or derivatives/conjugates thereof to facilitate uptake through ubiquitously expressed cell-surface LDL receptors (Soutschek, J. et al. (2004) Nature 432, 173-178). Alternatively, unconjugated, PBS-formulated locked-nucleic-acid-modified oligonucleotides (LNA-antimiR) may be used for systemic delivery (Elmen, J. et al. (2008) Nature 452, 896-899). Another strategy for delivering miRNAs involves encapsulating the miRNAs into specialized liposomes formed using polyethylene glycol to reduce uptake by scavenger cells and enhance time spent in the circulation. These specialized nucleic acid particles (stable nucleic acid- lipid particles or SNALPs) delivered miRNAs effectively to the liver (and not to other organs (Zimmermann, T.S. et al. (2006) Nature 441, 111-114). Recently, a new class of lipid-like delivery molecules, termed lipidoids (synthesis scheme based upon the conjugate addition of alkylacrylates or alkyl-acrylamides to primary or secondary amines) has been described as delivery agents for RNAi therapeutics (Akinc, A. et al. (2008) Nat Biotechnol 26, 561-569).
A further targeting strategy involves the mixing of miRNAs with a fusion protein composed of a targeting antibody fragment linked to protamine, the basic protein that nucleates DNA in sperm and binds miRNAs by charge (Song, E. et al. (2005) Nat. Biotechnol. 23, 709-717). Multiple modifications or variations of the above basic delivery approaches have recently been developed. These techniques are known in the art and reviewed, e.g., in de Fougerolles, A. et al. (2007) Nat. Rev. Drug Discov 6, 443-453; Kim, D.H. and Rossi, J.J. (2007) Nat Genet 8, 173-184).
The invention is further described by the figures and the following examples, which are solely for the purpose of illustrating specific embodiments of this invention, and are not to be construed as limiting the scope of the invention in any way. EXAMPLES
Example 1: Patient materials
In the discovery study, 125 frozen surgical tissues from lung cancer patients were obtained from Zhongshan Hospital in Shanghai between 2007 and 2009. All patients who participated in the study had given informed consent. The collection of the tissue specimens in accordance with the protocol was approved by the Institutional Review Board of Shanghai Zhongshan Hospital. The tissues were procured immediately after surgery, embedded in optimum cutting temperature (OCT) compound, fast-frozen in liquid nitrogen and stored at -80°C. The adjacent morphology normal tissues (at least 10 cm from tumor loci) were from the same patients with lung cancer. The specimens included 36 adenocarcinoma lung cancer, 30 squamous cell lung cancer and 16 small cell lung cancer and 44 adjacent morphology normal tissues.
In the validation study, 215 of formalin-fixed, paraffin-embedded (FFPE) tissues from lung cancer were obtained from Shanghai Zhongshan Hospital between 2004 and 2008. The FFPE tissues included 54 adenocarcinoma lung cancer, 50 squamous cell lung cancer and 56 small cell lung cancer and 55 morphology normal tissues. Baseline characteristics of the tumor specimens in both discovery and validation studies are shown in Table 7.
Table 7
Characteristics of the tissue specimens in the discovery and validation studies
Figure imgf000042_0001
Patient data (age, sex, imaging data, therapy, other medical conditions, family history, and the like) were derived from the hospital databases for matching the various samples collected. Pathologic follow-up (for example, histological analysis via hematoxylin and eosin (H&E) staining) was used for evidently determining the disease state (i.e. normal control, adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer) of a given sample as well as to ensure a consistent classification of the specimens.
Example 2: Sample preparations
In the discovery study, laser-capture micro-dissection was performed for each frozen tissue specimen in order to specifically isolate tumor cell populations (about 200.000 cells). In brief, a transparent transfer film is applied to the surface of a tissue section or specimen. Under a microscope, the thin tissue section is viewed through the glass slide on which it is mounted and clusters of cells are identified for isolation. When the cells of choice are in the center of the field of view, a near IR laser diode integral with the microscope optics is activated. The pulsed laser beam activates a spot on the transfer film, fusing the film with the underlying cells of choice. The transfer film with the bonded cells is then lifted off the thin tissue section (reviewed, e.g., in Emmert-Buck, M.R. et al. (1996). Science 274, 998-1001 ; Espina, V. et al. (2007) Expert Rev. Mol. Diagn. 7, 647-657). The preparation of the cryostat sections and the capturing step using a laser capture micro spope (Arcturus VeritasTM Laser Capture Microdissection Instrument (Molecular Devices, Inc., Sunnyvale, CA, USA) were performed essentially according to the instructions of the manufacturer.
To aid the transition from exploratory research to clinical implementation, FFPE surgical tissues were used in the validation study. Once FFPE tissues were selected for the analysis, H&E-stained sections were prepared in order to check the proportion of tumour material in each sample. If a tumour has more than 75% neoplastic cells, it shall be deemed suitable for analysis without further purification of tumour cells. If, however, histology shows the tumour to have <75% neoplastic cells, it will be selected and marked tumours for macrodis section. In addition to tumour lesions, control tissue shall be derived from at least 10 cm from tumour loci.
Total RNA was extracted from the tissue sections by using mirVana miRNA isolation kit according to the instructions from the manufacturer (Ambion, Austin, TX). The concentration was quantified by NanoDrop 1000 Spectrophotometer (NanoDrop Technologies, Waltham, MA). The quality control of RNA was performed by a 2100 Bioanalyzer using the RNA 6000 Pico LabChip kit (Agilent Technologies, Santa Clara, CA). Example 3: The microarray data
In the discovery study, a qualitative analysis of the miRNAs differentially expressed in a particular sample may optionally be performed using the 5 Agilent miRNA microarray platform (Agilent Technologies, Santa Clara, CA, USA).
The microarray contains probes for 723 human miRNAs from the Sanger database v.10.1. Total RNA (100 ng) derived from each of 126 LCM-selected lung samples were used as inputs for labeling via Cy3 incorporation. Microarray slides were scanned by XDR Scan (PMT100, PMT5). The labeling and hybridization were performed 10 according to the protocols in the Agilent miRNA microarray system. The raw data obtained for single-color (CY3) hybridization were normalized by applying a Quantile method and using GeneSpring GX10 software (Agilent Technologies, Santa Clara, CA, USA) known in the art.
Independent experiments on 126 tissue specimens were performed for 15 each measurement and the miRNA expression level determined represents the mean value of the respective individual data obtained.
Unpaired t-test after Fisher test (F-test) was used to identify top candidate miRNA biomarkers amongst adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer. MedCalc software was used to perform receiver 20 operating characteristic (ROC) curve analysis to determine the specificity and sensitivity of the candidate miRNA as diagnostic biomarkers. 95% confidence interval was used to determine the significance.
The experimental data on the array analysis of 7 key candidate miRNAs in the first aspect in the frozen surgical tissues for discriminating adenocarcinoma lung 25 cancer from normal lung are shown in Table 8.
Table 8
Candidate miRNA biomarkers in the frozen surgical tissues for discriminating
adenocarcinoma lung cancer from normal lung tissue
Adenocarcinoma lung cancer/normal lung tissue p-value fold change Sensitivity Specificity AUC
Individual mi RNA
6.2E-02
hsa-miR-205 2.13 28% 100% 0.570
4.4E-04
hsa-miR-25 1 .39 44% 95% 0.709 3.6E-05
hsa-miR-27a 0.72 83% 70% 0.768
1 .6E-01
hsa-miR-29a 1 .14 39% 84% 0.61 6
1 .3E-02
hsa-miR-29b 1 .29 67% 73% 0.714
2.4E-08
hsa-miR-34a 2.00 75% 98% 0.830
1 .6E-05
hsa-miR-375 2.75 78% 89% 0.821 mi RNA combi nation
6.3E-10
hsa-miR-34a/ hsa-miR-27a 2.79 75% 98% 0.885
2.7E-06
hsa-miR-375/ hsa-miR-27a 3.84 75% 93% 0.838
The experimental data on the array analysis of 7 key candidate miRNAs in the second aspect in the frozen surgical tissues for discriminating squamous cell lung cancer from normal lung are shown in Table 9.
5 Table 9
Candidate miRNA biomarkers in the frozen surgical tissues for discriminating
squamous cell lung cancer from normal lung tissue
Figure imgf000045_0001
The experimental data on the array analysis of 7 key candidate miRNAs 10 in the third aspect in the frozen surgical tissues for discriminating small cell lung cancer from normal lung are shown in Table 10.
Table 10
Candidate miRNA biomarkers in the frozen surgical tissues for discriminating
small cell lung cancer from normal lung tissue
Figure imgf000046_0001
5
The experimental data on the array analysis of 7 key candidate miRNAs in the fourth aspect in the frozen surgical tissues for discriminating squamous cell lung cancer from adenocarcinoma lung cancer are shown in Table 11.
Table 11
10 Candidate miRNA biomarkers in the frozen surgical tissues for discriminating
squamous cell lung cancer from adenocarcinoma lung cancer
Squamous cell lung cancer/adenocarci noma lu ng cancer p-value fold change Sensitivity Specificity AUC
Individual mi RNA
70.1
hsa-miR-205 2.1 E-1 1 94% 87% 0.915
2.7
hsa-miR-25 2.3E-12 75% 97% 0.931
1 .6
hsa-miR-27a 2.1 E-05 83% 77% 0.786
0.4
hsa-miR-29a 9.6E-09 94% 83% 0.896
0.3
hsa-miR-29b 4.0E-09 89% 87% 0.894 0.6
hsa-miR-34a 6.2E-06 67% 97% 0.791
0.0
hsa-miR-375 2.7E-13 97% 90% 0.939 mi RNA combi nation
232.7
hsa-miR-205/hsa-miR-29b 2.9E-13 94% 87% 0.925
9.0
hsa-miR-25/hsa-miR-29b 1 .4E-13 89% 93% 0.931
1563.1
hsa-miR-205/hsa-miR-375 1 .6E-14 97% 90% 0.925
60.2
hsa-miR-25/hsa-miR-375 1 .2E-16 92% 97% 0.951
190.4
hsa-miR-205/hsa-miR-29a 3.6E-13 89% 90% 0.935
7.3
hsa-miR-25/hsa-miR-29a 7.6E-13 94% 87% 0.929
The experimental data on the array analysis of 7 key candidate miRNAs in the fifth aspect in the frozen surgical tissues for discriminating small cell lung cancer from adenocarcinoma lung cancer are shown in Table 12.
5 Table 12
Candidate miRNA biomarkers in the frozen surgical tissues for discriminating
small cell lung cancer from adenocarcinoma lung cancer
Small cell lu ng cancer/adenocarci noma lung cancer p-value fold change Sensitivity Specificity AUC
Individual mi RNA
hsa-miR-205 1 .1 E-01 0.4 58% 75% 0.639 hsa-miR-25 3.7E-12 3.3 92% 94% 0.974 hsa-miR-27a 1 .2E-1 1 0.3 94% 94% 0.964 hsa-miR-29a 5.6E-07 0.2 97% 88% 0.927 hsa-miR-29b 1 .1 E-08 0.1 92% 94% 0.977 hsa-miR-34a 2.6E-09 0.2 94% 100% 0.986 hsa-miR-375 1 .1 E-1 1 1 1 .4 92% 100% 0.980 mi RNA combi nation
hsa-miR-25/hsa-miR-29b 7.9E-1 1 22.9 97% 94% 0.984 hsa-miR-375/hsa-miR-29b 3.6E-14 78.2 97% 100% 0.998 hsa-miR-25/hsa-miR-34a 3.5E-13 18.3 97% 100% 0.998 hsa-miR-375/ hsa-miR-34a 1 .1 E-1 1 62.4 97% 100% 0.995 hsa-miR-25/hsa-miR-27a 6.6E-1 1 10.3 97% 94% 0.984 hsa-miR-375/hsa-miR-27a 4.7E-12 35.3 97% 100% 0.995 hsa-miR-25/hsa-miR-29a 7.6E-10 19.7 94% 100% 0.986 hsa-miR-375/hsa-miR-29a 3.2E-12 67.2 94% 100% 0.997 The experimental data on the array analysis of 7 key candidate miRNAs in the sixth aspect in the frozen surgical tissues for discriminating small cell lung cancer from squamous cell lung cancer are shown in Table 13.
Table 13
5 Candidate miRNA biomarkers in the frozen surgical tissues for discriminating small cell lung cancer from squamous cell lung cancer
Figure imgf000048_0001
Example 4: Validation of the microarray data in FFPE surgical tissues
For validation of the miRNA expression data acquired on microarrays,
10 an established quantitative RT-PCR employing a TaqMan MicroRNA assay (Applied Biosystems, Foster City, CA, USA) was used according to the manufacturer's instructions. The assays were performed for hsa-miR-205 (SEQ ID NO: 1), hsa-miR-25 (SEQ ID NO: 2), hsa-miR-27a (SEQ ID NO: 3), hsa-miR-29a (SEQ ID NO: 4), hsa- miR-29b (SEQ ID NO: 5) hsa-miR-34a (SEQ ID NO: 6) and hsa-miR-375 (SEQ ID NO:
15 7) using 215 FFPE surgical tissues (Table 1). The expression level of the small nuclear RNA U47 was used as the normalization control. All assays were carried out in triplicate.
Briefly, reverse transcription (RT) was performed with Taqman microRNA RT Kits according to the instruction from Applied Biosystem. lOOng total 20 RNA was reverse-transcripted in 15ul RT solution mix that contains IX Reverse Transcription Buffer, IX RT primer, InM dNTP, 4U RNase Inhibitor and 50U MultiScribe Reverse Transcriptase. Then the RT solutions were performed by using the thermal program of 16°C, 30min; 42°C, 30min; 85°C, 5min on the PCR machine (Thermal cycler alpha engine, Bio-rad). Quantitative PCR was performed with TaqMan Universal PCR Master Mix kit and and Taqman microRNA assays kits according to the instruction from Applied Biosystem. 2ul RT products were PCR amplified in IX TaqMan Universal PCR Master Mix, No AmpErase UNG, IX TaqMan MicroRNA Assay mix. The real-time PCR was performed in Roch Light Cycling 480 machine with the program of 96°C, 5min initial heating; then 45 or 50 cycles of 95°C, 15s; 60°C, 60s. Cp value was calculated with 2nd derivative method in LC480 software. Then miRNAs were absolutely quantified with the standard samples Cp values.
Unpaired t-test after Fisher test (F-test) was used to determine the differentially expressed miRNAs. For MedCalc software was used to perform receiver operating characteristic (ROC) curve analysis to determine the specificity and sensitivity of the validated miRNA as diagnostic biomarkers. Stepwise logistic regression analysis was performed to determine the specificity and sensitivity of combined miRNAs as diagnostic biomarkers. 95% confidence interval was used to determine the significance.
The experimental data on 4 validated miRNA biomarkers in FFPE surgical tissues in the first aspect for discriminating adenocarcinoma lung cancer from normal lung tissues are shown in Table 14. Particularly preferred hsa-miR-27a (SEQ ID NO: 3), hsa-miR-29a (SEQ ID NO: 4) and hsa-miR-34a (SEQ ID NO: 6) are shown in bold.
Table 14
Validated miRNA biomarkers in FFPE surgical tissues for discriminating
adenocarcinoma lung cancer from normal lung tissue
Adenocarci noma lu ng cancer/normal lu ng tissue p-value Fold change Sensitivity Specificity AUC
Individual mi RNA
hsa-mi R-27a 6.2E-02 0.68 91 % 41 % 0.607 hsa-mi R-29a 5.8E-02 0.72 89% 42% 0.61 1 hsa-mi R-34a 8.0E-03 1 .81 96% 25% 0.638 hsa-miR-375 6.2E-03 1 .92 63% 75% 0.678 m i RNA co m bi nation
hsa-miR-34a/hsa-miR-27a 9.0E-1 7 2 .66 78% 96% 0.903 hsa-miR-34a/hsa-miR-29a 1 .3E-1 2 2.61 81 % 87% 0.861
Logistic regressio n
hsa-mi R-29a, 27a & 34a 83% 87% 0.925
Y=LOGI P(P)=1 3.451 8+1 .291 1 *miR-29a+2.0521 *miR-27a-2.801 1 *miR-34a
The experimental data on 4 validated miRNA biomarkers in FFPE surgical tissues in the second aspect for discriminating squamous cell lung cancer from normal lung tissues are shown in Table 15. Particularly preferred hsa-miR-205 (SEQ ID NO: 1), hsa-miR-25 (SEQ ID NO: 2) and hsa-miR-29a (SEQ ID NO: 3) are shown in bold.
Table 15
Validated miRNA biomarkers in FFPE surgical tissues for discriminating
squamous cell lung cancer from normal lung tissue
Figure imgf000050_0001
The experimental data on 5 validated miRNA biomarkers in FFPE surgical tissues in the third aspect for discriminating small cell lung cancer from normal lung tissues are shown in Table 16. Particularly preferred hsa-miR-29a (SEQ ID NO: 3) and hsa-miR-375 (SEQ ID NO: 7) are shown in bold. Table 16
Validated miRNA biomarkers in FFPE surgical tissues for discriminating small
cell lung cancer from normal lung tissue
Figure imgf000051_0001
The experimental data on 4 validated miRNA biomarkers in FFPE surgical tissues in the fourth aspect for discriminating squamous cell lung cancer from adenocarcinoma lung cancer are shown in Table 17. Particularly preferred hsa-miR-205 (SEQ ID NO: 1), hsa-miR-25 (SEQ ID NO: 2), and hsa-miR-375 (SEQ ID NO: 7) are 10 shown in bold.
Table 17
Validated miRNA biomarkers in FFPE surgical tissues for discriminating
squamous cell lung cancer from adenocarcinoma lung cancer
Squamous cell lung cancer/adenocarci noma lu ng cancer p-value Fold change Sensitivity Specificity AUC
Individual mi RNA
hsa-mi R-205 4.8E-13 28.21 78% 94% 0.880 hsa-mi R-25 1 .2E-02 1 .75 92% 26% 0.610 hsa-miR-27a 3.2E-02 1 .50 73% 51 % 0.604 hsa-mi R-375 6.9E-08 0.1 1 80% 77% 0.804 mi RNA combi nation
hsa-miR-205/hsa-miR-375 1 .1 E-15 234.48 82% 96% 0.885 hsa-miR-25/hsa-miR-375 4.7E-14 15.45 82% 91 % 0.886
Logistic regression
hsa-mi R-205/ 25 & 375 88% 90% 0.922
Y=LOGIP(P)=0.5273-0.2629*miR-205-0.6891 *miR-25+0.6285*miR-375
The experimental data on 5 validated miRNA biomarkers in FFPE surgical tissues in the fifth aspect for discriminating small cell lung cancer from adenocarcinoma lung cancer are shown in Table 18. Particularly preferred hsa-miR-205 5 (SEQ ID NO: 1), hsa-miR-34a (SEQ ID NO: 6), and hsa-miR-375 (SEQ ID NO: 7) are shown in bold.
Table 18
Validated miRNA biomarkers in FFPE surgical tissues for discriminating small
cell lung cancer from adenocarcinoma lung cancer
10
Figure imgf000052_0001
The experimental data on 5 validated miRNA biomarkers in FFPE surgical tissues in the sixth aspect for discriminating small cell lung cancer from squamous cell lung cancer are shown in Table 19. Particularly preferred hsa-miR-205 (SEQ ID NO: 1), hsa-miR-34a (SEQ ID NO: 6), and hsa-miR-375 (SEQ ID NO: 7) shown in bold.
Table 19
Validated miRNA biomarkers in FFPE surgical tissues for discriminating small 5 cell lung cancer from squamous cell lung cancer
Figure imgf000053_0001
The results obtained demonstrate a highly specific regulation of miRNA expression in lung cancer. Thus, the respective subsets of miRNAs specified herein 10 represent unique miRNA expression biomarkers for expression profiling of lung cancer that do not only allow the identification of a cancerogenous state as such but also enables the discrimination between different subtypes of lung tumors.
Example 5: Method for quantifying miRNA biomarkers
15 A quantitative analysis of the miRNA biomarkers (differentially) expressed in a particular sample may optionally be performed by quantitative RT-PCR employing a TaqMan MicroRNA assay (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.
Particularly preferably, the quantification of the miRNA biomarkers is 20 performed by using in situ hybridization (Fig.l). The method comprising: (a) collecting a biopsy or surgical tissue from a patient; (b) preparing tissue section on a slide; (c) hybridizing at least one nucleic acid molecule encoding a microRNA sequence to the section on the slide; (d) quantifying the miRNA expression under microscope or by digital pathology solution; (e) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence; (f) determining the expression levels of the plurality of nucleic acid molecules in one or more control cells; and (g) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (e) and (f), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, as defined herein, that is indicative for the presence of adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.
For normalizing the expression levels obtained for the nucleic acid molecules encoding microRNA sequences that are comprised in the nucleic acid expression signature hsa-miR-24 (SEQ ID NO:8) may be preferably used, which is stably expressed in colorectal tissues. For negative control of the expression levels obtained for the nucleic acid molecules encoding microRNA sequences that are comprised in the nucleic acid expression signature hsa-miR-122 (SEQ ID NO:9) may be preferably used, which does not expressed in colorectal tissues.
Probe for hybridization is a synthesized unmodified sequence that hybridizes to the target miRNA including a 30 base residue (GGGGGTCCTATATGGCTCCACTTCTCCCCC). The residue sequence is shown in bold. The probe is labelled with a fluorophore at the 5' end. Singe or multiple probes with separate fluorescent dyes can be hybridized in parallel. The probe sequences for in situ hybridization in the invention are given in Table 20.
The residue forms 5' hairpin (GGGGG-CCCCC pair) to stabilize the hybridization between the probe and target miRNA and increase the hybridization specificity. The same principle can be used to design probes for other miRNA biomarkers using in situ hybridization. TABLE 20
The probes for in situ hybridization
Figure imgf000055_0001
5 The present invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not 10 of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by embodiments and optional features, modifications and variations of the inventions embodied therein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

Claims

1. Diagnostic kit of molecular markers for identifying one or more mammalian target cells exhibiting lung cancer, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence,
wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target cells and in one or more control cells, and wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression signature that is indicative for the presence of lung cancer, and/or different subtypes of lung cancer, and wherein the different lung cancers consist of adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer.
2. The kit of claim 1, wherein the lung cancer is adenocarcinoma lung cancer.
3. The kit of claim 1 to 2, wherein the nucleic acid expression biomarkers may comprises at least four nucleic acid molecules.
4. The kit of claim 1 to 3, wherein the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
5. The kit of any of claims 1 to 4, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa- miR-29a, hsa-miR-34a and hsa-miR-375.
6. The kit of claim 5, wherein the expressions of hsa-miR-34a and hsa-miR-375 are up- regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a and hsa-miR-29a are down-regulated in the one or more target cells compared to the one or more normal control cells.
The kit of claim 5, wherein the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-34a/hsa-miR-27a and hsa-miR- 34a/hsa-miR-29a. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a, hsa-miR-27a and hsa-miR-34a.
The kit of claim 1, wherein the lung cancer is squamous cell lung cancer.
The kit of claim lor 8, wherein the nucleic acid expression biomarker may comprise at least four nucleic acid molecules.
The kit of claim 1 or 8 to 9, wherein the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
The kit of any of claims 1 or 8 to 10, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-25, hsa-miR-29a and hsa-miR-375.
The kit of claim 11, wherein the expressions of hsa-miR-205 and hsa-miR-25 are up- regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-29a and hsa-miR-375 are down-regulated in the one or more target cells compared to the one or more normal control cells.
The kit of any of claims 11, wherein the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-205/hsa-miR-29a, hsa- miR-25/hsa-miR-29a, hsa-miR-205/hsa-miR-375, hsa-miR-25/hsa-miR-375. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205, hsa-miR-25 and hsa-miR-29a.
The kit of claim 1, wherein the lung cancer is small cell lung cancer.
The kit of claim lor 14, wherein the nucleic acid expression biomarker may comprise at least five nucleic acid molecules.
The kit of claim 1 or 14 to 15, wherein the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more normal control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more normal control cells.
The kit of any of claims 1 or 14 to 16, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-375.
The kit of claim 17, wherein the expressions of hsa-miR-25 and hsa-miR-375 are up- regulated and the expression of any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa-miR-29a and hsa-miR-29b are down-regulated in the one or more target cells compared to the one or more normal control cells.
The kit of claim 17, wherein the nucleic acid expression biomarker comprises any one or more nucleic acid combinations encoding hsa-miR-25/hsa-miR-27a, hsa-miR- 375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29a and hsa-miR-375.
The kit of claim 1 to 19, for the further use of discriminating squamous cell lung cancer from adenocarcinoma lung cancer.
21. The kit of claim lor 20, wherein the nucleic acid expression biomarker may comprise at least four nucleic acid molecules. The kit of claim 1 or 20 to 21, wherein the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
105
The kit of any of claims 1 or 20 to 22, wherein , the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-25, hsa-miR-27a and hsa-miR-375.
The kit of claim 23, wherein the expressions of hsa-miR-205, hsa-miR-25, hsa-miR- 27a are up-regulated and the expression of one nucleic acid molecule encoding hsa- miR-375 is down-regulated in the one or more target cells compared to the one or more control cells.
The kit of claim 23, wherein the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-205/hsa-miR-375 and hsa-miR-25/hsa- miR-375. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-205, hsa-miR-25 and hsa-miR-375.
The kit of claim 1 to 19, for the further use of discriminating small cell lung cancer from adenocarcinoma lung cancer.
The kit of claim 1 or 26, wherein the nucleic acid expression biomarker may comprise at least six nucleic acid molecules.
The kit of claim 1 or 26 to 27, wherein the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
29. The kit of any of claims 1 or 26 to 28, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-25, hsa-
135 miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375.
30. The kit of claim 29, wherein the expressions of hsa-miR-25 and hsa-miR-375 are up- regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a are down-
140 regulated in the one or more target cells compared to the one or more control cells.
31. The kit of any of claims 1 or 26 to 30, wherein the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-25/hsa-miR-27a, hsa- miR-375/hsa-miR-27a, hsa-miR-25/hsa-miR-29a and hsa-miR-375/hsa-miR-29a.
145 Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-25, hsa-miR-34a and hsa-miR-375.
32. The kit of claim 1 to 19, for the further use of discriminating small cell lung cancer from squamous cell lung cancer.
150
33. The kit of claim 32, wherein the nucleic acid expression biomarker may comprise at least six nucleic acid molecules.
34. The kit of claim 1 or 32 to 33, wherein the nucleic acid expression biomarker 155 comprises at least one nucleic acid molecule encoding a microRNA sequence whose expression is up-regulated in the one or more target cells compared to the one or more control cells and at least one nucleic acid molecule encoding a microRNA sequence whose expression is down-regulated in the one or more target cells compared to the one or more control cells.
160
35. The kit of any of claims 1 or 32 to 34, wherein the nucleic acid expression biomarker comprises any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa- miR-27a, hsa-miR-29a, hsa-miR-29b, hsa-miR-34a and hsa-miR-375. The kit of claim 35, wherein the expression of hsa-miR-375 is up-regulated and the expressions of any one or more of the nucleic acid molecules encoding hsa-miR-205, hsa-miR-27a, hsa-miR-29a, hsa-miR-29b and hsa-miR-34a are down-regulated in the one or more target cells compared to the one or more control cells.
The kit of claim 35, wherein the nucleic acid expression biomarker comprises any one or more nucleic acid combinations hsa-miR-375/hsa-miR-27a and hsa-miR-375/hsa- miR-29a. Particularly, the nucleic acid expression biomarker comprises one nucleic acid combination encoding hsa-miR-29b and hsa-miR-375.
Method for identifying one or more mammalian target cells exhibiting adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer, the method comprising:
(a) collecting a biopsy or surgical tissue from a patient;
(b) preparing tissue section on a slide;
(c) hybridizing at least one nucleic acid molecule biomarker encoding a microRNA sequence to the section on the slide;
(d) quantifying the miRNA expression under microscope or by digital pathology solution;
(e) determining in the one or more target cells the expression levels of a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence;
(f) determining the expression levels of the plurality of nucleic acid molecules in one or more control cells; and
(g) identifying from the plurality of nucleic acid molecules one or more nucleic acid molecules that are differentially expressed in the target and control cells by comparing the respective expression levels obtained in steps (e) and (f), wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, as defined herein, that is indicative for the presence of adenocarcinoma lung cancer, squamous cell lung cancer or small cell lung cancer. The method of claim 38, for the further use of discriminating lung cancer selected from the group consisting of adenocarcinoma lung cancer, squamous cell lung cancer and small-cell lung cancer.
Method for preventing or treating lung cancer in one or more mammalian target cells, the method comprising:
(a) identifying in one or more target cells a nucleic acid expression signature by using a method as defined in claim 53 to 54 and
(b) modifying in the one or more cells the expression of one or more nucleic acid molecules encoding a microRNA sequence that is/are comprised in the nucleic acid expression signature in such way that the expression of a nucleic acid molecule whose expression is up-regulated in the one or more target cells is down-regulated and the expression of a nucleic acid molecule whose expression is down-regulated in the one or more target cells is up-regulated.
Pharmaceutical composition for the prevention and/or treatment of lung cancer in one or more mammalian target cells, the composition comprising one or more nucleic acid molecules, each nucleic acid molecule encoding a sequence that is at least partially complementary to a microRNA sequence encoded by a nucleic acid molecule whose expression is up-regulated in the one or more target cells, as defined in any of claims 1 to 55, and/or that corresponds to a microRNA sequence encoded by a nucleic acid molecule whose expression is down-regulated in the one or more target cells, as defined in any of claims 1 to 40.
220 42. Use of the pharmaceutical composition of claim 41 for the manufacture of a medicament for the prevention and/or treatment of lung cancer.
PCT/CN2010/080242 2009-12-24 2010-12-24 Tissue-based micro-rna methods for diagnosis of different subtypes of lung cancer Ceased WO2011076145A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201080064794.8A CN102770561B (en) 2009-12-24 2010-12-24 Tissue-based micro-RNA methods for diagnosis of different subtypes of lung cancer

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN2009075955 2009-12-24
CNPCT/CN2009/075955 2009-12-24
CNPCT/CN2010/073563 2010-06-04
CN2010073563 2010-06-04

Publications (1)

Publication Number Publication Date
WO2011076145A1 true WO2011076145A1 (en) 2011-06-30

Family

ID=44194966

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2010/080242 Ceased WO2011076145A1 (en) 2009-12-24 2010-12-24 Tissue-based micro-rna methods for diagnosis of different subtypes of lung cancer

Country Status (1)

Country Link
WO (1) WO2011076145A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102839179A (en) * 2012-09-14 2012-12-26 复旦大学附属中山医院 MicroRNA marker for identifying subtypes of lung cancer and application of microRNA marker
WO2021107791A1 (en) * 2019-11-29 2021-06-03 Uniwersytet Medyczny W Białymstoku Mirna biomarkers for differential diagnosis of histopathological subtypes of non-small cell lung cancer

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101389770A (en) * 2006-01-05 2009-03-18 俄亥俄州立大学研究基金会 microRNA-based methods and compositions for the diagnosis and treatment of solid cancers
CN101400361A (en) * 2006-01-05 2009-04-01 俄亥俄州立大学研究基金会 micro-RNA based methods and compositions for diagnosis, prognosis and treatment of lung cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101389770A (en) * 2006-01-05 2009-03-18 俄亥俄州立大学研究基金会 microRNA-based methods and compositions for the diagnosis and treatment of solid cancers
CN101400361A (en) * 2006-01-05 2009-04-01 俄亥俄州立大学研究基金会 micro-RNA based methods and compositions for diagnosis, prognosis and treatment of lung cancer

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102839179A (en) * 2012-09-14 2012-12-26 复旦大学附属中山医院 MicroRNA marker for identifying subtypes of lung cancer and application of microRNA marker
WO2021107791A1 (en) * 2019-11-29 2021-06-03 Uniwersytet Medyczny W Białymstoku Mirna biomarkers for differential diagnosis of histopathological subtypes of non-small cell lung cancer

Similar Documents

Publication Publication Date Title
US9074206B2 (en) Compositions and methods for micro-RNA expression profiling of colorectal cancer
CN102892897B (en) Compositions and methods for microRNA expression profiling of lung cancer
WO2011076142A1 (en) Compositions and methods for microrna expession profiling in plasma of colorectal cancer
WO2011076143A1 (en) Compositions and methods for microrna expression profiling of lung cancer
CN102985558B (en) For composition and the method for the micro-RNA expression spectrum analysis of hepatocellular carcinoma
WO2011076144A1 (en) Compositions and methods for microrna expession profiling in plasma of lung cancer
WO2011150855A1 (en) Micro-rna biomarkers and methods for diagnosis of early colorectal carcinoma and high-grade adenoma
US9988690B2 (en) Compositions and methods for prognosis of ovarian cancer
EP2358902A1 (en) Compositions and methods for micro-rna expression profiling of cancer stem cells
CN102892898B (en) For the diagnostic kit containing microRNA biomarker and the method for diagnosis of hepatoma
KR20100084619A (en) Diagnosis and prognosis of specific cancers by means of differential detection of micro-rnas/mirnas
CN102933719B (en) Compositions and methods for microrna expession profiling in plasma of colorectal cancer
CN104673883B (en) For predicting the microRNA biomarker and detection method of early stage non-metastatic colorectal cancer prognosis
WO2011076141A1 (en) Diagnostic kits comprising microrna biomarkers and methods for diagnosis of hepatocellular cancer
US8822144B2 (en) Compositions and methods for prognosis and treatment of prostate cancer
EP2596136B1 (en) Marker consisting of plasma microrna and new method for diagnosis of hepatocellular carcinoma
EP2196543A1 (en) Compositions and methods for micro-rna expression profiling of hepatocellular cancer
CN102770561B (en) Tissue-based micro-RNA methods for diagnosis of different subtypes of lung cancer
CN102770560B (en) For the microRNA biomarker based on blood plasma and the method for early detection colorectal cancer
Lu et al. Analysis of miR-221 and p27 expression in human gliomas
EP2196542A1 (en) Compositions and methods for micro-rna expression profiling of colorectal cancer
WO2011076145A1 (en) Tissue-based micro-rna methods for diagnosis of different subtypes of lung cancer
WO2011076147A1 (en) Plasma-based micro-rna biomarkers and methods for early detection of colorectal cancer
WO2010070637A2 (en) Method for distinguishing between adrenal tumors
CN118127152A (en) Compositions and methods for intestinal exo-miRNA expression profiling

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080064794.8

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10838708

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10838708

Country of ref document: EP

Kind code of ref document: A1