WO2011075085A1

WO2011075085A1 - Method for identifying virulence of plasmodium falciparum isolates

Info

Publication number: WO2011075085A1
Application number: PCT/SG2010/000471
Authority: WO
Inventors: Laurent Renia; Bruce Russell; Rossarin Suwanarusk; Francois Nosten
Original assignee: Agency For Science, Technology And Research; The Chancellor, Masters And Scholars Of The University Of Oxford
Priority date: 2009-12-16
Filing date: 2010-12-16
Publication date: 2011-06-23

Abstract

There is provided a method for determining the virulence of a Plasmodium falciparum isolate. The method comprises identifying the phenotype of the C-terminal repeat region of the knob-associated histidine-rich protein (KAHRP) of the isolate, wherein a knobless phenotype is indicative of a strain that causes uncomplicated malaria and a knob-positive phenotype is indicative of a strain that causes severe malaria.

Description

METHOD FOR IDENTIFYING VIRULENCE OF PLASMODIUM

FALCIPARUM ISOLATES

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims benefit of, and priority from, U.S. provisional patent appHcation No. 61/282,100, filed on December 16, 2009, the contents of which are hereby incorporated herein by reference.

FIELD OF THE INVENTION

[0002] The present invention relates to methods of typing Plasmodium falciparum isolates.

BACKGROUND OF THE INVENTION

[0003] Malaria infects approximately 500 million people worldwide each year, resulting in 2-3 million deaths each year. The pathology of severe malaria is facilitated by knob-shaped nanostructures on the surface of the infected red blood cell (ERBC) membrane which allow the IRBC to cytoadhere to the vascular endothelia under shear stress.

[0004] Red blood cells (RBCs) parasitized by Plasmodium falciparum are rigid and poorly deformable and show abnormal circulatory behaviour. During parasite development, knob-associated histidine-rich protein (KAHRP) and P falciparum erythrocyte membrane protein 3 (PfEMP3) are exported from the parasite and interact with the RBC membrane skeleton, and have been identified as contributing to the increased rigidity of IRBCs.

SUMMARY OF THE INVENTION

[0005] In one aspect, the present invention provides a method for deterrnining the virulence of a Plasmodium falciparum isolate, comprising identifying the phenotype of the C-terminal repeat region of the knob-associated histidine-rich protein (KAHRP) of the isolate, wherein a knobless phenotype is indicative of a strain that causes

uncomplicated malaria and a knob-positive phenotype is indicative of a strain that causes severe malaria.

[0006] The knobless phenotype may be characterized by one or more of the following deletions in the C-terminal repeat region of the KAHRP:

(i) deletion of a portion of one of the repeats of the ten amino acid

repeated sequence;

(ii) deletion of one to four repeats of the ten amino acid repeated sequence; and

(iii) deletion of some or all of the nine amino acid repeated sequence.

[0007] In particular embodiments, the knobless phenotype is characterized by a

C-terminal repeat region having a sequence of any one of SEQ ID NOs: 2 to 5.

[0008] The knob-positive phenotype may be characterized by a wildtype C- terminal repeat region or by one or more of the following insertions in the C-terminal repeat region of the KAHRP:

(i) insertion of a portion of one of the repeats of the ten amino acid

repeated sequence;

(ii) insertion of one or more repeats of the ten amino acid repeated

sequence; and

(iii) insertion of some or all of the nine amino acid repeated sequence.

[0009] In particular embodiments, the knob-positive phenotype is characterized by a C-terminal repeat region having 90% or greater sequence identity with any one of SEQ ID NOs: 1 and 6 to 8.

[0010] In the method, the identifying may comprise directly identifying the C- terminal repeat region of the KAHRP. For example, the identifying may comprise identifying the C-terminal repeat region with an antibody or an antigen binding fragment thereof.

[0011 ] Alternatively, the identifying may comprise identifying a nucleic acid sequence encoding the C-terminal repeat region. For example, the identifying may comprise a primer extension assay, a sequencing assay, PCR amplification, or a probe binding assay. In one embodiment, the identifying comprises PCR amplification of at least part of the nucleic acid sequence encoding the C-terminal repeat region.

[0012] In another aspect, the present invention provides a vaccine comprising one or more Plasmodium falciparum strains having a knobless phenotype, or comprising one or more antigens of one or more Plasmodium falciparum strains having a knobless phenotype, or comprising a nucleic acid molecule from one or more Plasmodium falciparum strains having a knobless phenotype.

[00 3] The knobless phenotype may be characterized by one or more of the following deletions in the C-terminal repeat region of the KAHRP:

(iv) deletion of a portion of one of the repeats of the ten amino acid

repeated sequence;

(v) deletion of one to four repeats of the ten amino acid repeated sequence; and

(vi) deletion of some or all of the nine amino acid repeated, sequence.

[0014] The knobless phenotype may be characterized by a C-terminal repeat region having a sequence of any one of SEQ ID NOs: 2 to 5.

[0015] In another aspect, the present invention provides a method of inducing an immune response to Plasmodium falciparum in an individual, comprising administering a vaccine as described herein to the individual.

[0016] In another aspect, the present invention provide use of a vaccine as described herein for inducing an immune response to Plasmodium falciparum in an individual.

[0017] In another aspect, the present invention provides a vaccine as described herein for use in inducing an immune response to Plasmodium falciparum in an individual.

[0018] Other aspects and features of the present invention will become apparent to those of ordinary skill in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The figures, which illustrate, by way of example only, embodiments of the present invention, are as follows.

[0020] Figure 1 is a schematic depiction of the knob-associated histidine-rich protein (KAHRP) from Plasmodium falciparum, with the sequence of the C-terminal repeat region (residues 544 to 593) shown, as well as the C-terminal region for various KAHRP deletion and insertion mutations; and

[0021 ] Figure 2 is a graph showing the prevalence of various KAHRP mutants in different geographical regions in which isolates were typed.

DETAILED DESCRIPTION

[0022] The inventors have discovered that many patients with non-severe

(uncomplicated) malaria have very low proportions of knob covered IRBCs. This recent discovery is in contrast to the previous notion that all clinical isolates of Plasmodium falciparum are knob covered. That is, it was previously thought that all naturally occurring Plasmodium falciparum strains and isolates formed knobs and that knobless strains had only been generated in a laboratory setting, for example by genetic engineering of specific constructs.

[0023] The reduced severity of infection associated with these knobless IRBCs may be due to such knobless IRBCs having reduced cytoadherence. In contrast to uncomplicated malaria, a significantly higher proportion of IRBCs from severe cases (from patients with cerebral malaria) were found by the inventors to be covered with knobs.

[0024] The inventors have also discovered that presence or absence of knobs in clinical isolates, and thus the level of virulence of a particular Plasmodium falciparum isolate, correlates with specific mutations in the 3' coding region of the gene responsible for the knobs main structural component, knob-associated histidine-rich protein

(KAHRP).

[0025] The KAHRP gene possesses a C-terminal region of 49 amino acid residues that contain four repeats of a ten amino acid sequence with a single base change in the fourth repeat, followed by a related nine amino acid sequence. For example, in some wildtype strains of Plasmodium falciparum that cause severe malaria, residues 544 to 593 of KAHRP have the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKGA TKEASTTEG [SEQ ID NO: 1], as depicted in Figure 1. It will be appreciated that minor variations (i.e. substitution mutation) in this 49 amino acid sequence may occur without affecting the ability of KAHRP to participate in knob formation and without affecting the virulence of the strain of Plasmodium falciparum or the ability of such a strain to cause severe malaria infections.

[0026] Thus, the inventors have identified that a region in the C-terrninal region of KAHRP containing multiple repeats of a ten amino acid sequence may play a significant role in the virulence and thus regulation of Plasmodium falciparum populations in a single human patient. The determination of the relative mutation balance in single patient or human population may allow clinicians and health planners to better select treatment regimens, based on the identified virulence as indicated by the distribution of C-terminal mutations in KAHRP within the population. Identification of less virulent Plasmodium falciparum strains may also allow for the production of a vaccine containing one or more of such strains.

[0027] Figure 1 depicts specific deletion mutations within the region of residues

544 to 593 of KAHRP. The presence of a natural deletion mutation of one or two repeats of the TKEASTSKEA [SEQ ID NO: 9] sequence or deletion of the TKEASTSKGA [SEQ ID NO: 10] sequence (corresponding to 30 or 60 base pair deletion in the 3' coding region of the gene) was associated with the knobless phenotype in isolates and with uncomplicated malaria. It is likely that IRBCs infected with a strain of Plasmodium falciparum with the C-terminal KAHRP deletions will be less sticky and more deformable, reducing the possibility of severe disease. In addition, the presence of the deletion mutation and knobless phenotype may be protective for patients infected with such Plasmodium falciparum strains.

[0028] Figure 1 also depicts a specific insertion mutation within the region of residues 544 to 593 of KAHRP. In contrast to the deletion mutations, the wildtype sequence at residues 544 to 593 or an insertion mutation of the TKEASTSKEA [SEQ ID NO: 9] sequence (corresponding to 30 base pair insertion in the 3' coding region of the gene), was associated with the knob phenotype in isolates and with severe malaria, for example with cerebral or renal complications. This is likely because a wildtype KAHRP sequence produces a full length protein that interacts strongly with spectrin in the erythrocyte cytoskeleton, leading to the production of sticky knobs and increasing the overall rigidity IRBCs.

[0029] Thus, there is provided a method of determining the virulence of a

Plasmodium falciparum isolate. The method comprises identifying the phenotype of the C-terminal repeat region of KAHRP, in which an isolate having a knobless phenotype is indicative of a less virulent strain that causes uncomplicated malaria whereas an isolate having a knob-positive phenotype is indicative of a virulent strain that causes severe malaria.

[0030] As used herein, reference to the C-terminal repeat region of KAHRP is reference to the region that corresponds to the 49 amino acid residues 544 to 593 in a full-length KAHRP protein, such as a wildtype KAHRP protein, in which no deletion or insertion mutations have occurred. In one embodiment, the C-terminal repeat region of KAHRP has the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA

TKEASTSKGA TKEASTTEG [SEQ ID NO: 1]. In other embodiments, the C-terminal repeat region has 90% sequence identity or 95% sequence identity with SEQ ID NO: 1. In other embodiments, the C-terminal repeat region has one or more amino acids inserted into SEQ ID NO: 1.

[0031] As used herein, reference to a wildtype KAHRP (or reference to a wildtype C-terminal repeat region of KAHRP) includes reference to a KAHRP (or reference to a C-terminal repeat region) in which the C-terminal repeat region has a full- length 49 amino acid sequence (for example corresponding to residues 544 to 593 in a full-length KAHRP) and which the KAHRP is capable of participating in formation of knobs in an IRBC infected with Plasmodium falciparum. It will be appreciated that other proteins and factors are also involved in knob formation, and thus a wildtype KAHRP will form knobs when in the context of the other necessary functional parasitic and cellular machinery. Reference to wildtype KAHRP also includes KAHRPs having the full-length, 49 amino acid C-terminal repeat region having the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKGA TKEASTTEG [SEQ ID NO: l] or full- length, 49 amino acid C-terminal repeat region that has one or more amino acid substitutions within SEQ ID NO:l, including naturally occurring substitutions, but which KAHRP still retains the ability to participate in knob formation. For example, in some wildtype KAHRPS, one, two, three, four, five, six, seven, eight, nine or ten amino acids may be substituted within SEQ ID NO: 1 provided the wildtype KAHRP will still retain the function of participating in knob formation. The full-length 49 amino acid sequence of the C-terminal repeat region may have 90% or greater sequence identity with SEQ ID NO:l or 95% or greater sequence identity with SEQ ID NO:l provided the wildtype KAHRP will still retain the function of participating in knob formation.

[0032] As used herein, reference to knobless phenotype (or knobless phenotypic) of a Plasmodium falciparum isolate is intended to refer to a Plasmodium falciparum isolate in which a deletion mutation has occurred within the C-terminal repeat region of a KAHRP and which isolate does not form knobs in an IRBC infected with the isolate. For example, one, two, three or four repeats of the ten amino acid repeated sequence in the C- terminal repeat region of a full-length KAHRP protein may be deleted, and/or a portion of a ten amino acid repeated sequence may be deleted. A ten amino acid repeated sequence refers to one of the four TKEASTSKEA [SEQ ED NO: 9] / TKEASTSKGA [SEQ ID NO: 10] sequences (or corresponding sequences in which an amino acid substitution has occurred as described above in the context of wildtype KAHRP) of the C-terminal repeat region of KAHRP. Alternatively or as well, some or all of the nine amino acid sequence TKEASTTEG [SEQ ID NO: 11] (or corresponding sequence in which an amino acid substitution has occurred as described above in the context of wildtype KAHRP) of the C-terminal repeat region of KAHRP may be deleted. In some embodiments, all of the 49 amino acid C-terminal repeat region may be deleted from the KAHRP. Thus, any combination of part or all of each of the four ten amino acid repeated sequences and the nine amino acid sequence (i.e. any region of the 49 amino acid C- terminal repeat region) may be deleted in a knobless phenotype KAHRP.

[0033] In one embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has one repeat of the ten amino acid repeated sequence deleted. In one embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has two repeats of the ten amino acid repeated sequence deleted. In one embodiment, the C- terminal repeat region of KAHRP in a knobless phenotype has three repeats of the ten amino acid repeated sequence deleted. In one embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has four repeats of the ten amino acid repeated sequence deleted. In one embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the nine amino acid sequence deleted.

[0034] In one embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKEA TKEASTSKGA

TKEASTTEG [SEQ ID NO: 2]. In another embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKGA TKEASTTEG [SEQ ID NO: 3]. In another embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTTEG [SEQ ID NO: 4]. In another embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKEA TKEASTTEG [SEQ ID NO: 5]. [0035] As used herein, reference to uncomplicated malaria is intended to refer to symptomatic infection with Plasmodium falciparum in which the infected individual does not display signs of severity and/or evidence of vital organ dysfunction, in contrast to severe malaria.

[0036] As used herein, reference to knob-positive phenotype (or knob-positive phenotypic) of a Plasmodium falciparum isolate is intended to refer to a Plasmodium falciparum isolate having a wildtype C-terrninal repeat region of a KAHRP or in which an insertion mutation has occurred within a wildtype C-terminal repeat domain of a KAHRP protein and which isolate retains the ability to form knobs in an IRBC infected with the isolate. For example, one, two, three or four or more repeats of the ten amino acid repeated sequence in the wildtype C-terminal repeat region of a KAHRP protein may be inserted, and/or a portion of a ten amino acid repeated sequence may be inserted. Alternatively or as well, some or all of the nine amino acid sequence of the C-terminal repeat region of KAHRP may be inserted. Thus, any insertion mutation, including any combination of repetition of part or all of each of the four ten amino acid repeated sequences and the nine amino acid sequence (i.e. any region of the 49 amino acid C- terminal repeat region) may be inserted in a knob-positive phenotype KAHRP.

[0037] In one embodiment of a knob-positive phenotype, the C-terminal repeat region of KAHRP has the sequence of a wildtype C-terrninal repeat region. In another embodiment of a knob-positive phenotype, the C-terminal repeat region of KAHRP has one repeat of the ten amino acid repeated sequence inserted. In another embodiment of a knob-positive phenotype, the C-terminal repeat region of KAHRP has two repeats of the ten amino acid repeated sequence inserted. In another embodiment of a knob-positive phenotype, the C-terminal repeat region of KAHRP has three repeats of the ten amino acid repeated sequence inserted. In another embodiment of a knob-positive phenotype, the C-terminal repeat region of KAHRP has four repeats of the ten amino acid repeated sequence inserted. In another embodiment of a knob-positive phenotype, the C-terminal repeat region of KAHRP has one or more repeat of the nine amino acid repeated sequence inserted. [0038] In one embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA

TKEASTSKGA TKEASTTEG [SEQ ID NO: 1]. In another embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKGA TKEASTTEG [SEQ ID NO: 6]. In another embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKGA TKEASTTEG [SEQ ID NO: 7]. In another embodiment, the C-terminal repeat region of KAHRP in a knobless phenotype has the sequence TKEASTSKEA TKEASTSKEA TKEASTSKEA TKEASTSKGA TKEASTSKGA TKEASTTEG [SEQ ID NO: 8]. In other embodiments, the C-terminal repeat region of KAHRP has 90% or greater sequence identity or 95% or greater sequence identity with any one of SEQ ID NOs: 1 and 6 to 8.

[0039] As used herein, reference to severe malaria is intended to refer to symptomatic infection with Plasmodium falciparum in which the infected individual displays one or more of the following symptoms: coma, convulsions, a severe drop in blood pressure, respiratory distress, jaundice, blood in the urine, extreme weakness or prostration, kidney impairment, gastrointestinal complications, metabolic impairment (hypoglycaemia, acidosis), severe anaemia and hyperparasitemia (greater than 4% parasitemia).

[0040] The isolate used in the method may be any isolate of Plasmodium falciparum obtained from a naturally occurring source. An isolate is a Plasmodium falciparum parasite or population of parasites that has been obtained from a naturally occurring source, including for example a sample from an infected human subject, an infected ape subject (including for example a chimpanzee, a gorilla or a Bonobo), or a reservoir such as a mosquito, for example an anopheles mosquito.

[0041] Thus, the isolate may be directly obtained from a sample, including a clinical sample taken from an infected individual, for example a blood sample. The method may be performed directly on a sample, including any necessary steps to prepare the sample prior to performing the identifying step, for example isolation of DNA contained within the sample.

[0042] In the method, identifying the phenotype of the C-terminal region of

KAHRP of a Plasmodium falciparum isolate comprises directly identifying the C- terminal region of KAHRP or indirectly determining the phenotype by identifying the genotype of the isolate in the 3' coding region of the KAHRP gene that encodes the C- terminal repeat region. That is, the method involves determining which form of the C- terminal region is present in the KAHRP expressed by the particular isolate, either by examining the protein itself or by examining the nucleic acid sequence encoding the protein.

[0043] Identification and detection techniques are known in the art, including methods for identifying proteins as well as methods for identifying nucleic acids.

[0044] For example, methods for detecting and identifying the C-terminal repeat region of KAHRP include without limitation protein or peptide sequencing methods, mass spectrometry methods and immunodetection methods. Immunodetection methods comprise techniques in which an antibody or an antigen binding fragment thereof is used to detect the presence of a particular protein antigen or epitope such as a particular C- terminal repeat region of KAHRP of a knobless phenotype or a knob-positive phenotype.

[0045] Antibodies or antigen binding fragments of antibodies can readily be generated or obtained, including polyclonal antibodies or monoclonal antibodies, using standard laboratory techniques. Antibodies or antigen binding fragments thereof that specifically bind to a particular C-terminal repeat region of a knobless phenotype or of a particular knob-positive phenotype can thus be obtained without undue experimentation. As will be appreciated, specific binding of an antibody or antigen binding fragment thereof to an antigen or epitope refers to a binding interaction in which an antibody or antigen binding region of an antibody recognizes and binds a target epitope in an antigen in a reversible, saturatable manner that can be displaced with a competitor, and that binds the epitope with greater affinity than for non-specific binding targets. [0046] Immunodetection techniques that may be used in the method include without limitation ELISAs, immunoprecipitation methods, Western blot methods, and immunochromatography methods.

[0047] Alternatively, methods for detecting and identifying a nucleic acid of interest are also known in the art. For example, methods for detecting and identifying the particular nucleic acid sequences such as a sequence encoding a C-terminal repeat region of KAHRP of a knobless phenotype or a knob-positive phenotype are known and can be performed without any undue experimentation.

[0048] Such methods include without limitation primer extension assays, sequencing assays, amplification techniques such as PCR amplification, and probe binding assays.

[0049] In a particular embodiment, identifying the phenotype of the C-terminal repeat region of KAHRP comprises indirect identification by identifying the genotype of the isolate in the 3' coding region of the KAHRP gene that encodes the C-terminal repeat region, using a PCR amplification assay.

[0050] Such assay techniques are known in the art. For example, forward and reverse primers designed to amplify a region that encompasses the 3' coding region of the KAHRP gene that encodes the C-terminal repeat region may be used. One or both primers may be designed to bind to regions that flank the region that encodes the C- terminal repeat region, or one or both primers may be designed to bind to the region that encodes the C-terminal repeat region. The genotype of the isolate may be determined based on the size of the amplified product.

[0051] In one embodiment, a forward repeat primer corresponding to the sequence of bases 1948 to 1969 in the KAHRP gene and a reverse primer corresponding to the complementary sequence of bases 2331 to 2354 in the KAHRP gene may be used to amplify the region encoding the C-terminal repeat region of KAHRP. For example, forward prime CAACAAATGCTGCTACACCAG [SEQ ID NO: 12] and reverse primer CCTCTTGACATTACTTGTTCACC [SEQ ID NO: 13]. [0052] Once amplified, the region may further be sequenced or probed with a nucleic acid probe if desired, in keeping with standard techniques.

[0053] As indicated above, identification of whether an isolate has a knobless phenotype or a knob-positive phenotype can be used to assess virulence. Knobless phenotypes are associated with uncomplicated malaria infections, whereas knob-positive phenotypes are associated with severe malaria infections.

[0054] The method as described herein may be used to determine the virulence of a given isolate or population within a single individual or within a geographic region. Such information may be used to identify appropriate treatment regimens for the individual or for application within the geographic region.

[0055] Also provided is a kit comprising a reagent for identifying the form of C- terminal repeat region in a KAHRP from a Plasmodium falciparum isolate, packaged together with instructions for use. The reagent may be any reagent involved in identifying the protein, for example a polyclonal or monoclonal antibody specific for a particular form of the C-terminal repeat region. Alternatively, the reagent may be any reagent involved in identifying a nucleic acid encoding the C-terminal repeat region of KAHRP, for example one or more primers or one or more probes.

[0056] As indicated above, the knobless phenotype may confer protection in an infected individual against infection with a knob-positive strain of Plasmodium falciparum.

[0057] Thus, there is provided a vaccine comprising one or more Plasmodium falciparum strains having a knobless phenotype, or comprising one or more antigens of one or more Plasmodium falciparum strains having a knobless phenotype, or comprising a nucleic acid molecule expressing one or more antigen from one or more Plasmodium falciparum strains having a knobless phenotype.

[0058] In one embodiment, the vaccine comprises one or more attenuated

Plasmodium falciparum strains having a knobless phenotype, or one or more dead

Plasmodium falciparum strains having a knobless phenotype, as described herein. [0059] The vaccine may be formulated as a pharmaceutical composition for administration to an individual. The vaccine may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives and various compatible carriers or diluents. The vaccine may further comprise comprise an adjuvant.

Pharmaceutically acceptable ingredients, including carriers and adjuvants are known in the art.

[0060] The proportion and identity of any pharmaceutically acceptable carrier is determined by chosen route of administration, compatibility with the vaccine components, particularly in the case of a live attenuated parasite, and standard pharmaceutical practice. Suitable vehicles and diluents are described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA 1985).

[0061] Forms of the vaccine suitable for injectable use include sterile aqueous solutions or dispersion and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions, wherein the term sterile does not extend to any live parasite that may be included in the vaccine.

[0062] Kits and commercial packages containing the vaccine, are contemplated. Such a kit or commercial package will also contain instructions regarding use of the included vaccine, for example, use to induce an immune response in an individual, including an immune response to a knob-positive phenotypic Plasmodium falciparum strain.

[0063] Also provided is a method of inducing an immune response to Plasmodium falciparum in an individual, comprising administering a vaccine as described herein to the individual. Similarly, uses and vaccines for use are also provided, including use of a vaccine as described herein for inducing an immune response to Plasmodium falciparum in an individual and a vaccine as described herein for use in inducing an immune response to Plasmodium falciparum in an individual.

[0064] The individual is any subject in whom an immune response to a Plasmodium falciparum strain is desired to be raised, including a mammal, particularly a human subject.

[0065] Methods for administering vaccines are known, including vaccines that comprise live or dead parasites, protein preparations from a parasite, or a nucleic acid vector encoding an antigen from a parasite. Thus, an appropriate method of

administration can be chosen based on the nature of the vaccine. For example, where the vaccine is a nucleic acid vaccine, a nucleic acid of the invention may be delivered to cells in an individual using methods such as direct injection of DNA, receptor-mediated DNA uptake, viral-mediated transfection or non- viral transfection and lipid based transfection, all of which may involve the use of expression vectors as described herein. A delivery apparatus (e.g., a "gene gun") for injecting DNA into cells in vivo may be used. Such an apparatus may be commercially available (e.g., from BioRad).

[0066] The vaccine may be administered in an amount sufficient to achieve the desired result, for example, inducing an immune response against a Plasmodium falciparum strain, including a knob-positive phenotypic strain. For example, the vaccine may be administered in quantities and dosages necessary to induce an immune response, including in a priming dose followed by a boosting dose.

[0067] The present methods, uses and vaccines are further exemplified by way of the following non-limiting examples.

EXAMPLES

[0068] EXAMPLE 1

[0069] A 5 year study was performed on Thai, Indonesian and African clinical P. falciparum isolates and knobless clinical IRBCs with reduced or no cytoadherence were identified. These natural populations of knobless P. falciparum were identified as having deletion mutations in the KAHRP gene, which encodes the main structural component of the knobs. The presence of such a natural deletion mutation (named the 'SMRU deletion') occurs in the 3' repeat region of the KAHRP gene and results in a shortening of the gene, for example by 30 to 60 bp (for 10 or 20 amino acid deletion, which corresponds to one or two of the ten amino acid repeat sequences). SMRU deletions were found in 93% of the Thai isolates tested. This gene deletion appears to be responsible for the knobless phenotype seen in almost all the Thai isolates examined. The SMRU deletions occured naturally and were not knocked out using laboratory techniques.

[0070] EXAMPLE 2

[0071 ] Genotyping was conducted on 100 isolates from uncomplicated malaria patients from NW Thailand and 318 malaria isolates (unknown clinical phenotype) from Africa (Nigeria, Kenya, Ghana and Tanzania).

[0072] The genotyping of the KHARP c-terminal region from the above-described samples has revealed the following information.

[0073] The SMRU mutation specifically results from the deletion of ten amino acids (TKEASTSKEA) or 20 amino acids (TKEASTSKEA TKEASTSKEA) from the C- terminal repeat area of the KAHRP gene (see Figure 1). The genotyping of African isolates has revealed the existence of a novel mutation involving the insertion of an extra ten amino acids (TKEASTSKEA) in the C-terminal repeat area of the KAHRP gene (see Figure 1). The addition of an extra repeat segment in KHARP is referred to as the A* STAR insertion.

[0074] An analysis of the distribution of the KAHRP C-terminal repeat area genotype listed in Figure 1 (SMRU deletions, Wild type and A* STAR insertion) showed some highly significant geographical patterns. The predominate genotype of KAHRP in NW Thailand is the SMRU deletion (98%), in contrast to the African countries where the wild type is makes up at least 30% of the total genotypes tested. Importantly the A* STAR mutation was only found in Africa (see Figure 2).

[0075] The above results demonstrate that the predominant KAHRP genotype is distinct in different geographical regions. Importantly, the SMRU deletion (which may be protective) is dominant in NW Thailand where severe malaria is rare. In contrast, the wild type and A*STAR insert genotypes (which is likely to be associated with severe pathology) are common in Africa where most of the malaria related deaths in the world occur.

[0076] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

[0077] As used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural reference unless the context clearly dictates otherwise. As used in this specification and the appended claims, the terms "comprise", "comprising", "comprises" and other forms of these terms are intended in the non-limiting inclusive sense, that is, to include particular recited elements or components without excluding any other element or component. As used in this specification and the appended claims, all ranges or lists as given are intended to convey any intermediate value or range or any sublist contained therein. Unless defined otherwise all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.

[0078] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A method for determining the virulence of a Plasmodium falciparum isolate, comprising identifying the phenotype of the C-terminal repeat region of the knob- associated histidine-rich protein (KAHRP) of the isolate, wherein a knobless phenotype is indicative of a strain that causes uncomplicated malaria and a knob-positive phenotype is indicative of a strain that causes severe malaria.

2. The method of claim 1, wherein the knobless phenotype is characterized by one or more of the following deletions in the C-terminal repeat region of the KAHRP: a. deletion of a portion of one of the repeats of the ten amino acid repeated sequence; b. deletion of one to four repeats of the ten amino acid repeated sequence; and c. deletion of some or all of the nine amino acid repeated sequence.

3. The method of claim 2, wherein the knobless phenotype is characterized by a C-terminal repeat region having a sequence of any one of SEQ ID NOs: 2 to 5.

4. The method of any one of claims 1 to 3, wherein the knob-positive phenotype is characterized by a wildtype C-terminal repeat region or by one or more of the following insertions in the C-terminal repeat region of the KAHRP: a. insertion of a portion of one of the repeats of the ten amino acid repeated sequence; b. insertion of one or more repeats of the ten amino acid repeated sequence; and c. insertion of some or all of the nine amino acid repeated sequence.

5. The method of claim 4, wherein the knob-positive phenotype is characterized by a C-terminal repeat region having 90% or greater sequence identity with any one of SEQ ID NOs: 1 and 6 to 8.

6. The method of any one of claims 1 to 5, wherein said identifying comprises directly identifying the C-terminal repeat region of the KAHRP.

7. The method of claim 6, wherein said identifying comprises identifying the C- terminal repeat region with an antibody or an antigen binding fragment thereof.

8. The method of any one of claims 1 to 5, wherein said identifying comprises identifying a nucleic acid sequence encoding the C-terminal repeat region.

9. The method of claim 8, wherein identifying comprises a primer extension assay, a sequencing assay, PCR amplification, or a probe binding assay.

10. The method of claim 9, wherein identifying comprises PCR amplification of at least part of the nucleic acid sequence encoding the C-terminal repeat region.

11. A vaccine comprising one or more Plasmodium falciparum strains having a knobless phenotype, or comprising one or more antigens of one or more Plasmodium falciparum strains having a knobless phenotype, or comprising a nucleic acid molecule from one or more Plasmodium falciparum strains having a knobless phenotype.

12. The vaccine of claim 11, wherein the knobless phenotype is characterized by one or more of the following deletions in the C-terminal repeat region of the KAHRP: a. deletion of a portion of one of the repeats of the ten amino acid repeated sequence; b. deletion of one to four repeats of the ten amino acid repeated sequence; and c. deletion of some or all of the nine amino acid repeated sequence.

13. The vaccine of claim 12, wherein the knobless phenotype is characterized by a C-terminal repeat region having a sequence of any one of SEQ ED NOs: 2 to 5.

14. A method of inducing an immune response to Plasmodium falciparum in an individual, comprising administering a vaccine of any one of claims 11 to 13 to the individual.

15. Use of a vaccine of any one of claims 11 to 13 for inducing an immune response to Plasmodium falciparum in an individual.

16. A vaccine of any one of claims 11 to 13 for use in inducing an immune response to Plasmodium falciparum in an individual.