WO2011072115A1 - Quantification de ldl et procédés d'utilisation - Google Patents

Quantification de ldl et procédés d'utilisation Download PDF

Info

Publication number
WO2011072115A1
WO2011072115A1 PCT/US2010/059664 US2010059664W WO2011072115A1 WO 2011072115 A1 WO2011072115 A1 WO 2011072115A1 US 2010059664 W US2010059664 W US 2010059664W WO 2011072115 A1 WO2011072115 A1 WO 2011072115A1
Authority
WO
WIPO (PCT)
Prior art keywords
ldl
subject
level
oclpi
alpi
Prior art date
Application number
PCT/US2010/059664
Other languages
English (en)
Inventor
Cynthia L. Bristow
Original Assignee
Bristow Cynthia L
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bristow Cynthia L filed Critical Bristow Cynthia L
Publication of WO2011072115A1 publication Critical patent/WO2011072115A1/fr
Priority to US13/492,294 priority Critical patent/US20130023472A1/en
Priority to US13/948,446 priority patent/US20140005108A1/en
Priority to US15/844,353 priority patent/US20180092964A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/55—Protease inhibitors
    • A61K38/57—Protease inhibitors from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the method further comprises administering a LDL inhibitor.
  • the nucleic acid inhibitor is a siRNA.
  • the invention also provides a method of treating a subject with a disease, comprising; administering to the subject alPI or at least one peptide derived from alPI identified as capable of decreasing the level of LDL in the subject wherein following the administration, there is a decrease in the level of LDL in the subject thereby treating the disease.
  • the invention also provides a method of monitoring the treatment of a subject diagnosed with a disease associated with an increase in the level of LDL comprising: determining the level of LDL in the subject; administering to the subject alPI or at least one peptide derived from alPI; and comparing the level of LDL of the subject with the level of LDL of a control subject that is not diagnosed with the disease.
  • the invention also provides a method of treating a subject with a disease associated with an increase in the level of LDL comprising: administering to the subject alPI or at least one peptide derived from alPI; and determining the level of
  • the invention also provides a method of designing a treatment protocol for a subject diagnosed with a disease associated with an increase in the level of LDL; comprising determining the level of LDL in the subject diagnosed with the disease; and comparing the level of LDL in the subject with the level of LDL of a control subject that does not have the disease;
  • the methods of the invention further comprise obtaining alPI or at least one peptide derived from alPI or the pharmaceutically acceptable salt or prodrug thereof.
  • the therapeutically effective amount of the alPI or at least one peptide derived from alPI is administered by topical application, intravenous drip or injection, subcutaneous, intramuscular, intraperitoneal, intracranial and spinal injection, ingestion via oral route, inhalation, trans-epithelial diffusion or an implantable, time-release drug delivery device.
  • the results of the determining step are reported to the subject and/or a health care professional.
  • the invention also provides for a packaged pharmaceutical comprising oclPI or at least one peptide derived from oclPI or a pharmaceutically acceptable salt or prodrug thereof which, upon administration to a subject, decreases the level of LDL of a subject.
  • the invention also provides for a packaged pharmaceutical comprising (a) oclPI or at least one peptide derived from oclPI or a pharmaceutically acceptable salt or prodrug thereof; and
  • the oclPI or at least one peptide derived from oclPI is present as a pharmaceutical composition comprising a therapeutically effective amount or a pharmaceutically acceptable salt or prodrug thereof and a
  • the packaged pharmaceutical further comprises a step of identifying a subject in need of the pharmaceutical.
  • the packaged pharmaceutical further comprises a step of identifying the oclPI or at least one peptide derived from oclPI as capable of decreasing the level of LDL in a subject.
  • Figure 1 is a graph that shows the influence of ociPI on serum lipid levels
  • Lipid levels mg/dL
  • ⁇ Lipid levels
  • Figure 2 is a graph that shows the kinetic influence of ociPI on HIV binding, (a) As compared with buffer (purple) or isotype control (pink), flow cytometric analysis depicts SHIV or STV (green) bound to U937 clone 10 cells that had been preconditioned with ociPI for 15 min (t 15 ), but not 60 min (t 6 o).
  • Figure 4 demonstrates feedback regulation by LDL and ociPI.
  • LDL levels decreased in two HIV-1 patients Alpha (a) and Beta (b) placed on ociPI augmentation therapy (Zemaira ® , CSL Behring) (Table S2).
  • ociPI augmentation therapy Zemaira ® , CSL Behring
  • Figure 5 demonstrates the expression of VLDLR but not LRP on U937 clone 10 cells.
  • CD91 was not detected on (a) U937 clone 10 cells, but was detected on (b) primary monocytic cells, (c) As compared to 10 ⁇ nonspecific siRNA, there was dose- dependent loss of VLDLR expression 48 hrs after transfection of cells with (3 ⁇ 43 ⁇ 43 ⁇ 4)
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50.
  • alPI serves as a pseudo-substrate for elastase; elastase attacks the reactive center loop of the alPI molecule by cleaving the bond between
  • treatment or “treating” is also used herein in the context of administering agents prophylactically.
  • effective dose or “effective amount” or “effective dosage” or “therapeutic dosage” is defined as an amount sufficient to achieve or at least partially achieve the desired effect.
  • therapeutically effective dose and “therapeutically effective amount” are defined as an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease.
  • non-human mammal refers to any mammal that is not a human.
  • treating refers to preventing the onset of disease and/or reducing, delaying, or eliminating disease symptoms, such as an increase in the level of LDL.
  • treating is meant restoring the patient or subject to the basal state as defined herein, and/or to prevent a disease in a subject at risk thereof.
  • modulate refers to increase or decrease, or an increase or a decrease, for example an increase or decrease in the level of LDL.
  • OclPI OclPI or at least one peptide derived therefrom of the invention as compared to before a 1PI or at least one peptide derived therefrom of the invention.
  • a “therapeutically effective amount” of oclPI or at least one peptide derived therefrom of the invention according to the invention is in the range of 5-100 ⁇ subject. In another embodiment, a “therapeutically effective amount” of a 1PI or at least one peptide derived therefrom is in the range of 10-75 ⁇ per subject. In another embodiment, a “therapeutically effective amount” of a 1PI or at least one peptide derived therefrom is in the range of 20-50 ⁇ per subject.
  • a "therapeutically effective amount" of a 1PI or at least one peptide derived therefrom is in the range of 18-48 ⁇ per subject. In another embodiment, a “therapeutically effective amount” of a 1PI or at least one peptide derived therefrom is in the range of 5-25 ⁇ per subject. In another embodiment, a “therapeutically effective amount” of a 1PI or at least one peptide derived therefrom is in the range of 5-20 ⁇ per subject. In another embodiment, a "therapeutically effective amount" of a 1PI or at least one peptide derived therefrom is in the range of 5-10 ⁇ per subject.
  • MIA Magnetic Activated AChibdenosine satuene
  • MIV has a single aa substitution, at position 213, Ala to Val.
  • the M3 allele has a single aa difference with M1V, Glu to Asp at position 376.
  • the M2 allele has a single aa difference with M3, Arg to His at position 101.
  • a second activity of ociPI is the stimulation of cell migration. It has long been known that coupling of active ociPI to soluble granule-released HLE (HLE G ) inactivates both proteins and exposes the C-terminal domain of ociPI (C-36, VT IP) which then binds to receptors for low density lipoprotein (LDL) (Janciauskiene et al., 2001).
  • HLE G soluble granule-released HLE
  • C-36, VT IP C-terminal domain of ociPI
  • LDL low density lipoprotein
  • ociPI peptides Two preferred methods are briefly described below for producing recombinant ociPI peptides; one allows expression of ociPI peptides in rice cells and the other allows bacterial expression.
  • the cDNA encoding human ociPI is obtained from a human cDNA bank and amplification of the fragment in accession number K01396 using two PCR primers: N-terminal primer 5' GAGGATCCCCAGGGAGATGCTGCCCAGAA 3 ' and C-terminal primer 5 ' CGCGCTCGAGTTATTTTTGGGTGGGATTCACCAC 3' as previously described (Courtney et al., 1984; Terashima et al., 1999; Jean et al., 1998).
  • the OCiPI peptides cDNA are expressed in Escherichia coli strain BL21 transformed with pDS560CiPI/hf (Invitrogen, Carlsbad, CA). Protein expression is induced by addition of ImM isopropyl b-D-thiogalactoside, and cultures are grown overnight at 31°C. The cells are washed in metal-chelation chromatography binding buffer (5 mM imidazole/0.5M NaCl/20mM Tris, pH 7.9) and disrupted by cavitation.
  • Modification within the domain that determines LDL receptor recognition is prepared by site-directed mutagenesis of Met (aa 385) to Phe, Thr, He, Leu, Val, or Gly.
  • PBMC peripheral blood mononuclear cells
  • HLEcs was detected using FITC- conjugated rabbit anti-HLE (Biodesign, Kennebunkport, ME) or using rabbit anti- HLE (Biodesign) and negative control rabbit IgG (Chemicon, Temecula, CA) which had been conjugated to Alexa Fluor 647 (Molecular Probes, Eugene, OR).
  • VLDLR expression relative to negative control siRNA using U937 clone 10 cells was achieved 48 hr after transfecting 2nmol siRNA/lxlO 6 cells.
  • Cells were measured for cell viability and for expression of CD91 (LRP), VLDLR, CD4, CXCR4, and HLE CS by flow cytometric analysis.
  • CD4-IgG 2 Biotinylated CD4-IgG 2 was detected using HRP-conjugated streptavidin (NEN Life Science Products), and CD4-IgGi was detected using HRP- conjugated Rb anti-human IgG (Sigma). CD4-IgG-labeled cells were coupled to FITC using the Tyramide signal amplification system (NEN Life Science Products, Boston, MA, USA) as previously described (Frank et al., 2002).
  • LRP6 transduces a canonical Wnt signal independently of Axin degradation by inhibiting GSK3's phosphorylation of +!-catenin.
  • OMIM Online Mendelian Inheritance in Man, OMIM (TM). McKusick-Nathans Institute for Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD). 2000.
  • Phorbol esters cause sequential activation and deactivation of complement receptors on polymorphonuclear leukocytes. J. Immunol. 136, 1759-1764.
  • LRP1 Low Density Lipoprotein Receptor-related Protein
  • Stable antisense RNA expression neutralizes the activity of low-density lipoprotein receptor-related protein and promotes urokinase accumulation in the medium of an astrocytic tumor cell line.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention porte, sous certains de ces aspects, sur des procédés pour favoriser l'endocytose de LDL à l'aide de alPI ou des peptides dérivés de alPI. La présente invention porte également sur des procédés pour diminuer les taux de LDL en réponse à une thérapie d'augmentation d'OCiPI. Dans des modes de réalisation privilégiés, les procédés sont appropriés pour un sujet qui souffre d'une maladie ou d'un trouble choisi parmi une maladie cardiaque, une athérosclérose, l'hypertension, une infection par le VIH, une infection virale, une infection bactérienne, la leucémie, une tumeur solide ou une maladie auto-immune.
PCT/US2010/059664 2009-12-09 2010-12-09 Quantification de ldl et procédés d'utilisation WO2011072115A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US13/492,294 US20130023472A1 (en) 2009-12-09 2012-06-08 Ldl quantitation and method of use
US13/948,446 US20140005108A1 (en) 2009-12-09 2013-07-23 Method for decreasing low density lipoprotein levels
US15/844,353 US20180092964A1 (en) 2009-12-09 2017-12-15 Ldl quantitation and methods of use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US26797509P 2009-12-09 2009-12-09
US61/267,975 2009-12-09

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/492,294 Continuation US20130023472A1 (en) 2009-12-09 2012-06-08 Ldl quantitation and method of use

Publications (1)

Publication Number Publication Date
WO2011072115A1 true WO2011072115A1 (fr) 2011-06-16

Family

ID=44145911

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/059664 WO2011072115A1 (fr) 2009-12-09 2010-12-09 Quantification de ldl et procédés d'utilisation

Country Status (2)

Country Link
US (3) US20130023472A1 (fr)
WO (1) WO2011072115A1 (fr)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080124355A1 (en) 2006-09-22 2008-05-29 David Gordon Bermudes Live bacterial vaccines for viral infection prophylaxis or treatment
US8241623B1 (en) 2009-02-09 2012-08-14 David Bermudes Protease sensitivity expression system
US8771669B1 (en) 2010-02-09 2014-07-08 David Gordon Bermudes Immunization and/or treatment of parasites and infectious agents by live bacteria
US9597379B1 (en) 2010-02-09 2017-03-21 David Gordon Bermudes Protease inhibitor combination with therapeutic proteins including antibodies
US8524220B1 (en) 2010-02-09 2013-09-03 David Gordon Bermudes Protease inhibitor: protease sensitivity expression system composition and methods improving the therapeutic activity and specificity of proteins delivered by bacteria
KR101432159B1 (ko) * 2013-02-05 2014-08-20 에이피시스템 주식회사 온도측정 파이로미터의 교정 장치
US9593339B1 (en) 2013-02-14 2017-03-14 David Gordon Bermudes Bacteria carrying bacteriophage and protease inhibitors for the treatment of disorders and methods of treatment
US20190151415A1 (en) * 2016-06-02 2019-05-23 Leonid V. Medved Compositions for inhibiting fibrin-vldl receptor-dependent inflammation and methods of treatment
US11180535B1 (en) 2016-12-07 2021-11-23 David Gordon Bermudes Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria
US11129906B1 (en) 2016-12-07 2021-09-28 David Gordon Bermudes Chimeric protein toxins for expression by therapeutic bacteria

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6150332A (en) * 1997-01-09 2000-11-21 Virginia Commonwealth University Method and composition for lowering low density lipoprotein cholesterol
US20070275914A1 (en) * 2003-03-07 2007-11-29 Muthiah Manoharan Therapeutic Compositions
US20080009442A1 (en) * 2005-12-06 2008-01-10 Institute For Human Genetics And Biochemistry Therapeutic use for alpha1 proteinase inhibitor in hematopoiesis

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008033890A2 (fr) * 2006-09-12 2008-03-20 Beth Israel Deaconess Medical Center, Inc. Compositions contenant de l'alpha-1-antitrypsine et leurs procédés d'utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6150332A (en) * 1997-01-09 2000-11-21 Virginia Commonwealth University Method and composition for lowering low density lipoprotein cholesterol
US20070275914A1 (en) * 2003-03-07 2007-11-29 Muthiah Manoharan Therapeutic Compositions
US20080009442A1 (en) * 2005-12-06 2008-01-10 Institute For Human Genetics And Biochemistry Therapeutic use for alpha1 proteinase inhibitor in hematopoiesis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MEDH ET AL.: "The 39-kDa Receptor-associated Protein Modulates Lipoprotein Catabolism by Binding to LDL Receptors", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, 13 January 1995 (1995-01-13), pages 536 - 540 *

Also Published As

Publication number Publication date
US20140005108A1 (en) 2014-01-02
US20180092964A1 (en) 2018-04-05
US20130023472A1 (en) 2013-01-24

Similar Documents

Publication Publication Date Title
US20180092964A1 (en) Ldl quantitation and methods of use
US20150011479A1 (en) Alpha1 proteinase inhibitor peptides methods and use
Stepanova et al. Urokinase as a multidomain protein and polyfunctional cell regulator
US10539551B2 (en) Therapeutic use for α1 proteinase inhibitor in hematopoiesis
Magérus-Chatinet et al. Galactosyl ceramide expressed on dendritic cells can mediate HIV-1 transfer from monocyte derived dendritic cells to autologous T cells
Lindemann et al. Cellular entry of retroviruses
CN112512570A (zh) 疗法中的pla2-gib调节
JP2006504427A (ja) Ｒｎａ干渉物質を用いる遺伝子発現の阻害方法
US8088571B2 (en) Methods of reducing a viral infection and kits therefore
Bristow et al. A Feedback Regulatory Pathway Between LDL and Alpha 1 Proteinase Inhibitor in Chronic Inflammation and Infection
Kaufmann et al. PAR-1-and PAR-3-type thrombin receptor expression in primary cultures of human renal cell carcinoma cells
Handley et al. A role for urokinase-type plasminogen activator in human immunodeficiency virus type 1 infection of macrophages
Huet et al. Long-lasting enfuvirtide carrier pentasaccharide conjugates with potent anti-human immunodeficiency virus type 1 activity
Brignone et al. Proteases produced by activated neutrophils release soluble CD23 fragments endowed with proinflammatory effects
Elmaleh et al. Anti-viral activity of human antithrombin III
BAHBOUHI et al. Effect of alpha-1 antitrypsin Portland variant (α1-PDX) on HIV-1 replication
CA2264570C (fr) Agents inducteurs d'invasion et inhibiteurs d'invasion s'utilisant dans la guerison de plaies et le traitement du cancer
KR20210117217A (ko) 제대혈 혈장 유래의 엑소좀 또는 이의 모방체 및 이의 면역억제 용도
US20100135989A1 (en) Anti-hiv agents
Peng et al. A Novel Cleavage Pattern of Complement C5 Induced by Chlamydia trachomatis Infection via the Chlamydial Protease CPAF
LU501764B1 (en) Gasdermin e expression in human t cells as a marker for proinflammatory t cell functions
US20030232738A1 (en) Method and composition for increasing CD4+ T lymphocyte immune responsiveness
CA2808165A1 (fr) Composes et applications therapeutiques associees a l'inhibition de l'activite et d'evenements de signalisation des immunorecepteurs des cellules dendritiques (dcir)
Chéneau et al. Lactoferrin retargets adenoviruses to TLR4 to induce an abortive NLRP3-associated pyroptotic response in human dendritic cells
Geng et al. Monocytes reprogrammed by 4-PBA potently contribute to the resolution of inflammation and atherosclerosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10836673

Country of ref document: EP

Kind code of ref document: A1

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10836673

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10836673

Country of ref document: EP

Kind code of ref document: A1