WO2011067225A1 - Compositions ciblant le récepteur cb1 pour la régulation de la prise alimentaire - Google Patents

Compositions ciblant le récepteur cb1 pour la régulation de la prise alimentaire Download PDF

Info

Publication number
WO2011067225A1
WO2011067225A1 PCT/EP2010/068466 EP2010068466W WO2011067225A1 WO 2011067225 A1 WO2011067225 A1 WO 2011067225A1 EP 2010068466 W EP2010068466 W EP 2010068466W WO 2011067225 A1 WO2011067225 A1 WO 2011067225A1
Authority
WO
WIPO (PCT)
Prior art keywords
receptor
receptor agonist
gaba
agonist
glutamate
Prior art date
Application number
PCT/EP2010/068466
Other languages
English (en)
Inventor
Giovanni Marsicano
Luiggi Bellocchio
Original Assignee
INSERM (Institut National de la Santé et de la Recherche Médicale)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by INSERM (Institut National de la Santé et de la Recherche Médicale) filed Critical INSERM (Institut National de la Santé et de la Recherche Médicale)
Publication of WO2011067225A1 publication Critical patent/WO2011067225A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4468—Non condensed piperidines, e.g. piperocaine having a nitrogen directly attached in position 4, e.g. clebopride, fentanyl
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • A61K31/5513—1,4-Benzodiazepines, e.g. diazepam or clozapine

Definitions

  • the present invention relates to compositions and methods for controlling
  • Obesity is widely recognized as a serious health problem that is increasing in prevalence across the United States and the world. According to the 1998 National Institute of Health (NIH) Clinical Guidelines on the Identification, Evaluation and Treatment of Overweight and Obesity in Adults, an estimated 97 million people in the US are classified as either overweight or obese. The medical and other costs related to obesity have risen considerably in the last two decades. In addition, many pets or companion animals, such as dogs or cats, have become obese and their owners may seek veterinary treatment to cure their obesity and associated medical problems.
  • NASH National Institute of Health
  • Agents that have been or are currently being used for the treatment of obesity include phenylpropanolamine, dexfenfluramine, phentermine/fenfluramine, sibutramine and orlistat. Unfortunately, all of these drugs have serious adverse effects and dexfenfluramine and fenfluramine have been withdrawn because of toxicity associated with valvular heart disease in a small subset of patients.
  • the endocannabinoid system comprises endogenous ligands commonly referred to as endocannabinoids (anandamide, 2-arachidonoyl glycerol, 2-arachidonyl glyceryl ether (noladin ether), virodhamine), and two cannabinoid receptor subtypes (CB1 and CB2). Marijuana and the major plant cannabinoid, delta(9)tetrahydrocannabinoid, have been implicated in the changes of feeding behavior in both man and animals.
  • the cannabinoid CB1 receptor has received the greatest attention with respect to appetite and body weight regulation, leading to the development of a new class of appetite suppressants and/or weight regulating drugs that appear to work by selectively blocking CB1 receptors.
  • the discovery of the first selective CB1 receptor antagonist was reported several years ago. This antagonist compound, [Lambda]/-(piperidin-l - yl)-5-(4- chlorophenyl)- 1 -(2,4-dichlorophenyl)-4-methyl- 1 /-/-pyrazole-3-carboxamide
  • SR141716A (SR141716A or rimonabant), has been shown to have anorectic efficacy and produce a sustained reduction in body weight.
  • SR141716A is the hydrochloride of SR 141716. See U.S. Patent No. 6,344,474.
  • SR141716A binds to CB1 receptors and competitively antagonizes many of the CB1 receptor-mediated effects of cannabinoids or stabilize an inactive form of the receptor.
  • synthesis of an antagonist such a SR141716A that selectively binds to CB1 receptors without producing cannabimimetic activity in vivo suggests that recognition and activation of cannabinoid receptors are separable events.
  • CB1 receptors are expressed in brain regions controlling food intake, where they presynaptically regulate both excitatory and inhibitory neurotransmission [1-4].
  • ECS endocannabinoid system
  • An alternative unexplored possibility is that endogenous and/or exogenous cannabinoids might activate different sets of CB1 receptors expressed in different neuronal populations to oppositely control food intake. Accordingly, it is an object of the present invention to provide alternative and improved compositions and methods for controlling food intake.
  • Agonists of the cannabinoid receptor CBl exert biphasic effects on food intake, with low dose having a hyperphagic effect and high doses a hypophagic one, respectively.
  • the inventors found that these effects are due to a selective decrease of glutamatergic and GABAergic transmission, respectively.
  • the inventors found also surprisingly that the effects of low doses (hyperphagic) are transformed into hypophagic ones by the combination of the drugs with allosteric activators of glutamatergic receptors.
  • the hypophagic effects of higher doses become hyperphagic upon simultaneous administration of an allosteric activator of GABA-A receptors.
  • the side effects of CBl agonists are likely due to their action on glutamatergic transmission.
  • CBl agonists combined with allosteric modulators of glutamatergic transmission (e.g. D-cyclo-serine, DCS, that is used in clinics for treating tubercolosis), could have a strong hypophagic effect, avoiding any side effect of CBl antagonists (e.g. rimonabant, Accomplia from Sanofi) and blunting psychotropic effects of CBl agonists, like Delta-9-tetrahydrocannabinol (THC).
  • the invention is the combination of cannabinoid CBl agonists with either of these two classes of drugs: allosteric enhancers of glutamate receptors and allosteric enhancers of GABA-A receptors.
  • the doses used in the present invention for allosteric enhancers of glutamate receptors and allosteric enhancers of GABA-A receptors are 10-15 time less that the doses normally used in the clinics to exert their psychotropic effects (i. e. D-cycloserine is clinically used to at a dose of 50-250 mg to treat Obsessive Compulsive Disorder, schizophrenia, phobias, whereas diazepam is used at doses of 5-40 mg to treat anxiety and neuropsychiatric disorders).
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a low amount of at least one CBl receptor agonist and an amount of at least one glutamate agonist and optionally a pharmaceutically acceptable carrier.
  • This pharmaceutical composition comprising a low amount of at least one CBl receptor agonist and an amount of at least one glutamate agonist is for use in the prevention or the treatment of obesity, obesity related diseases, overweight or overeating in a mammal in need thereof.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a high amount of at least one CBl receptor agonist and an amount of at least one GABA agonist and, optionally a pharmaceutically acceptable carrier.
  • This pharmaceutical composition comprising a high amount of at least one CBl receptor agonist and an amount of at least one GABA agonist is for use in the prevention or the treatment of anorexia cachexia syndrome (ACS), underweight or under eating in a mammal in need thereof.
  • ACS anorexia cachexia syndrome
  • the present invention also relates to a kit containing:
  • the present invention also relates to a kit containing:
  • ACS anorexia cachexia syndrome
  • the present invention also relates to a method for the prevention and/or the treatment of obesity, obesity-related disease, overweight or overeating in a mammal in need thereof, comprising administering the individual with a prophylactically or therapeutically effective quantity of a CBl receptor agonist at low amount and a glutamate receptor agonist, most preferably an allosteric enhancers of NMD A receptor.
  • the present invention also relates to a method for the prevention and/or the treatment of anorexia cachexia syndrome (ACS), underweight or under eating in a mammal in need thereof, comprising administering the individual with a prophylactically or therapeutically effective quantity of a CBl receptor agonist at high amount and a GAB A receptor agonist, most preferably an allosteric enhancers of GAB A A receptor.
  • ACS anorexia cachexia syndrome
  • CBl receptor has its general meaning in the art and may include naturally occurring CBl receptor and variants and modified forms thereof.
  • the CBl receptor can be from any source, but typically is a mammalian (e.g., human and non- human primate) CBl, particularly a human CBl .
  • CBl receptors include for example, two iso forms: a long isoform (Accession No NP-057167) and a shorter one truncated in the NH2 terminal part corresponding to a splice variant (Accession No NP- 149421).
  • CBl receptor agonist refers to any CBl receptor agonist (direct agonist or allosteric agonist) that is currently known in the art or that will be identified in the future, and includes any chemical entity that, upon administration to a patient, results in activation or up-regulation of a biological activity associated with activation of the CBl receptor in the patient, including any of the downstream biological effects otherwise resulting from the binding to CBl receptor of its natural ligands (endocannabinoids).
  • Such CBl receptor agonists include any agent that can help CBl receptor activation or any of the downstream biological effects of CBl receptor activation.
  • CBl receptor agonist can act by occupying the ligand binding site or a portion thereof of the CB 1 receptor, thereby making the receptor more accessible to its natural ligand so that its normal biological activity is enhanced.
  • CBl receptor agonist also refers to "indirectly CBl receptor active agent" which means a compound able to inhibit the degradation or the uptake of endocannabinoids, thereby enhancing the activation of CBl receptors (for examples of such compounds, see the reviews [21] and [22], which are incorporated by reference).
  • CBl or CB2 receptors A number of agonists with significant selectivity for CBl or CB2 receptors have been developed [14, 15]. Examples of most selective CBl receptor agonists include the eicosanoid cannabinoids, anandamide and 2-arachidonoyl-glycerol. Reference may be made also to DELTA-9-THC, WIN55212-2, HU-210 and CP55,940, which are mixed CB1/CB2 receptor agonists.
  • Important CBl -selective agonists include the anandamide analogues, R- (+)- methanandamide, arachidonyl-20-chloroethylamide (ACEA), arachidonyl- cyclopropylamide (ACPA) and 0-1812.
  • Another CBl -selective agonist of note is 2- arachidonyl glyceryl ether (noladin ether).
  • selective CBl receptor agonist refers to a compound able to activate selectively CBl receptors and not any other receptor such as CB2 receptors.
  • non selective CBl receptor agonist refers to compound natural or not which has the capability to activate CB2 receptors but also CBl receptors.
  • Agonist activity toward CBl receptor must be determined by any well known method in the art.
  • the discovery and pharmacological validation of new cannabinoid receptor agonists relies on the availability of suitable bioassays [14, 15].
  • CBl receptor agonists the most commonly used in vivo bioassay is the mouse tetrad, in which their ability to produce hypokinesia, hypothermia, catalepsy in the Pertwee ring test and antinociception in the tail-flick or hot plate test is determined in the same animal.
  • There are no standard in vivo bioassays for CB2 receptor agonists There are no standard in vivo bioassays. As to established in vitro bioassays for CBl and CB2 receptor agonists, these all involve the use of membrane or tissue preparations that contain CBl and/or CB2 receptors, expressed either naturally or after transfection [14, 15].
  • binding assays that measure the ability of test compounds to displace a radiolabeled cannabinoid receptor ligand such as [3H]CP55940 from membranes obtained from CBl and/or CB2 receptor- expressing cells or tissues.
  • a radiolabeled cannabinoid receptor ligand such as [3H]CP55940 from membranes obtained from CBl and/or CB2 receptor- expressing cells or tissues.
  • some of these measure the effects of test compounds on CBl or CB2 receptor signalling, for example stimulation of binding to G proteins of the hydrolysis-resistant GTP analogue [35S]GTPgS, Gi/o-mediated inhibition of basal or drug-induced cyclic AMP production and elevation of intracellular free Ca 2+ , which is presumably a Gs-mediated effect.
  • the bioassay of CBl receptor agonists can also be performed with isolated nerve-smooth muscle preparations such as the mouse vas deferens. These bioassays exploit the ability of cannabinoid agonists to act through neuronal CBl receptors to produce a concentration- related inhibition of electrically-evoked contractile transmitter release and hence of the contractions resulting from this release.
  • CB1 and CB2 receptor-mediated rely on the availability of selective CB1 and CB2 receptor antagonists (Cannabinoid CB1 and CB2 receptor antagonists), of cells or tissues that express either CB1 or CB2 receptors (but not both these receptor types), or of animals or tissues from which CB1 and/or CB2 receptors have been genetically deleted.
  • CB1 and CB2 receptor antagonists Cannabinoid CB1 and CB2 receptor antagonists
  • binding assays may be used.
  • binding assays with tritiated CB1/CB2 agonist may be carried out on membranes prepared from rat forebrain (for CB1) or from frozen mouse spleen (for CB2). Reference may be made for instance to the assay described in the US patent specification US2006030563.
  • the pharmaceutical compounds of the present invention are in preferred embodiment, for GABA receptor agonist and Glutamate receptor agonist, are allosteric enhancer.
  • an "allosteric modulation" of a receptor results from the binding of allosteric modulators at a different site (regulatory site) other than of the endogenous ligand (orthosteric ligand) and enhances or inhibits the effects of the endogenous ligand. It normally acts by causing a conformational change in a receptor molecule, which results in a change in the binding affinity of the ligand.
  • an allosteric ligand "modulates” its activation by a primary "ligand” and can be thought to act like a dimmer switch in an electrical circuit, adjusting the intensity of the receptor's activation.
  • Ago-allosteric modulator proposed term for 'a ligand that functions both as an agonist on its own and as an allosteric modulator of the efficacy (co-agonist) and/or the potency of the orthosteric ligand'.
  • the effect of the ago-allosteric modulator can be positive with regard to both efficacy and potency, but might also be negative or inhibitory in terms of, for example, potency while being positive in terms of efficacy.
  • Allosteric agonist 'a ligand that is able to mediate receptor activation in its own right by binding to a recognition domain on the receptor macro molecule that is distinct from the primary (orthosteric) site' - as defined and differentiated from allosteric enhancer by the IUPHAR committee on quantitative pharmacology [16].
  • Allosteric enhancer 'a modulator that enhances the affinity and/or efficacy of the orthosteric ligand while having no effect on its own' - as defined by the IUPHAR committee on quantitative pharmacology [16].
  • the term “treating” or “treatment” means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
  • the treatment of the disorder may consist in the treatment of obesity, overweight or overeating in a mammal in need thereof, or in the treatment of anorexia, underweight or under eating in a mammal in need thereof.
  • the term "subject" or “individual” to be treated is intended for a human or non-human mammal (such as a rodent (mouse, rat), a feline, a canine, or a primate).
  • a human or non-human mammal such as a rodent (mouse, rat), a feline, a canine, or a primate.
  • the subject is a human.
  • “Pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate.
  • a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi- so lid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • the present invention provides methods and compositions (such as pharmaceutical compositions) for treating obesity and/or obesity-related disorders.
  • an object of the invention is pharmaceutical composition comprising a low amount of CB1 receptor agonist and an amount of glutamate receptor agonist for use in the prevention or the treatment of obesity and/or obesity-related disorders, overweight or overeating in a mammal in need thereof.
  • glutamate receptor agonist is an allosteric enhancer of glutamate receptor, more preferably an allosteric enhancer of NMD A receptor.
  • a low amount of CB1 receptor agonist means using dose with a limited or no psychotropic effect of CB1 agonists wherein the amount of at least one CB1 agonist is supplied at a dosage level inferior to 5 mg.
  • compositions and use at low dose of CB1 agonist according to the invention may be administered at a dose of about 0.05 to 5 mg for humans
  • mice (or about 0.5 to 1.75 mg/kg body weight for mice).
  • Glutamate receptor refers to any receptor that binds and is activated by the neurotransmitter glutamate. Glutamate receptors can be divided into two groups according to the mechanism by which their activation gives rise to a postsynaptic current: lonotropic glutamate receptors and Metabotropic glutamate receptors. lonotropic glutamate receptors include NMDA, AMPA and Kainate receptors, form the ion channel pore that activates when glutamate binds to the receptor. Metabotropic glutamate receptors (mGluR) indirectly activate ion-channels on the plasma membrane through a signalling cascade that involves G proteins.
  • mGluR Metabotropic glutamate receptors
  • the glutamate receptor of the invention is selected more specifically from the NMDA receptor and AMPA receptor.
  • glutamate receptor agonist refers to any glutamate receptor, agonist (direct agonist or allosteric agonist) that is currently known in the art or that will be identified in the future, and includes any chemical entity that, upon administration to a patient, results in activation or up-regulation of a biological activity associated with activation of the glutamate receptors in the patient, including any of the downstream biological effects otherwise resulting from the binding to glutamate receptor of its natural ligand (glutamic acid).
  • glutamate receptor agonists include any agent that can help glutamate receptor activation or any of the downstream biological effects of glutamate receptor activation.
  • the glutamate receptor agonist is an allosteric enhancer of glutamate receptor, and more preferably an allosteric enhancer of NMDA receptor.
  • amount of glutamate receptor agonist means using dose with a limited or no psychotropic effect of glutamate agonists wherein the amount of at least one glutamate agonist is supplied at a dosage level inferior to 25 mg.
  • compositions and use of an amount of glutamate receptor agonist according to the invention may be administered at a dose of about 5 to 25 mg for human.
  • NMDA receptor means a specific type of ionotropic glutamate receptor.
  • NMDA N-methyl D-aspartate
  • the NMDA receptor is distinct in two ways; first that it is both ligand-gated and voltage-dependent, and second that it requires co-activation by two ligands, glutamate and glycine.
  • Activation of NMDA receptors requires binding of glutamate or aspartate (aspartate does not stimulate the receptors as strongly).
  • NMDARs also require the binding of the co-agonist glycine for the efficient opening of the ion channel, which is a part of this receptor.
  • D-serine has also been found to co-agonize the NMDA receptor with even greater potency than glycine.
  • a third requirement is membrane depolarization.
  • allosteric enhancers of glutamate means an allosteric NMDA enhancer or an allosteric AMPA enhancer. A variety of accepted tests are used to determine whether a given agent is a positive modulator of an AMPA or an NMDA receptor.
  • the primary in vitro assay is measurement of the enlargement of the excitatory postsynaptic potential (EPSP) in in vitro brain slices, such as rat hippocampus brain slices.
  • Modulators useful in the present embodiments are agents that cause an increased ion flux through the AMPA or NMDA receptor complex channels. Increased ion flux is typically measured as at least a 10% increase in decay time, amplitude of the waveform and/or the area under the curve of the waveform and/or a decrease of at least 10% in rise time of the waveform, for example.
  • Allosteric enhancers of NMDA receptor may affect any of a number of interactions among the NMDA receptor, glycine and glutamate
  • the NMDA receptors exhibit a variety of modulatory sites and, in particular, exhibit the binding site for the amino acid glycine.
  • Several compounds acting at the glycine site of the NMDA receptor have been proposed as cognitive enhancers such as D- serine and D-cycloserine, for example. Further, inhibitors of glycine uptake exert similar effects as glycine, and are proposed as cognitive enhancers.
  • Drugs acting as positive modulators of NMDA receptors are also termed «nemdakines"
  • allosteric enhancers of NMDA receptor include L-alanine, D-alanine, D- cycloserine, N-methylglycine, L-serine, D-serine, ⁇ , ⁇ , ⁇ -trimethylglycine, 3-amino-l- hydroxypyrrolid-2-one (HA966), (R)-(N-[3-(4 , -fluorophenyl>3-(4 * - phenylphenoxy)propyl])sarcosine (ALX5407), N-methyl-N-[3 -[(4- trifluoromethyl)phenoxy]-3 -phenyl-propyl] glycine (ORG 24598), a polyamine, neurosteroid, a salt thereof, an ester thereof, a precursor thereof, a metabolite thereof, a derivative thereof, a racemic mixture thereof, or a combination thereof, for example.
  • Such positive modulators may have a mechanism of action as follows.
  • Antist at the glycine site Positive modulators at the glycine site are likely located on the NR1 subunit of the NMDA receptor. Glycine acts as a co-agonist with glutamate; neither glutamate nor glycine alone can activate the NMDA receptor. While glutamate increases the rate of dissociation of glycine from the NMDA receptor, the partial agonist at the glycine site HA966 reduces the affinity of glutamate for the NMDA receptor also by increasing its dissociation rate. Since binding of glutamate and glycine are necessary for channel opening and thus, for synaptic activation, the influence of one by the other has necessarily an impact on the transition states of the kinetic scheme.
  • Positive modulators of the glycine site include D-serine, L-alanine, L-serine, 3-amino-l- hydroxypyrrolid-2-one (HA966), D-cycloserine, and derivatives thereof.
  • Blockers of glycine uptake/transport Positive modulators of the glycine transporter site that block the re-uptake/transport of glycine out of the synaptic cleft, thereby increasing concentrations of glycine include (R)-(N-[3-(4'-fluorophenyl)-3-(4'- phenylphenoxy)propyl])sarcosine (ALX5407) , N-methyl-N- [3 -[(4-trifluoromethyl)phenoxy] -3 -phenyl-propyl] glycine (ORG 24598), and derivatives thereof.
  • Positive modulators of channel sites include agents that reduce activity for Mg2+, for PCP, for MK801, and for ketamine, for example.
  • Positive modulators of sites on the NR2 subunits include agents that reduce activity for Zn2+, and for protons.
  • Positive modulators at the NR2 subunits include polyamines such as spermine, spermidine, neomycine, for example, that enhance synaptic activity by preventing the proton-induced inhibition of receptor activity; neurosteroids, in particular, pregnenolone sulphate acts on a segment of the extracellular domain next to a transmembrane portion called SMDl (steroid modulatory domain 1); ATP and derivatives thereof.
  • Further positive modulators of the NR2 subunits include agents for preventing Ca2+ dependent calmodulin-sensitive and calmodulin- insensitive inactivation of NMD A receptor activity. Additional positive modulators of the NR2 subunits signal intracellular proteins that convey to the second messenger cascade via the proteins anchored to the postsynaptic density (PSD95) and other mechanisms downstream leading to receptor trafficking.
  • PSD95 postsynaptic density
  • AMPA receptor means the a-amino-3-hydroxy-5-methyl-4- isoxazolepropionic acid receptor (also known as AMPA receptor, AMPAR, or quisqualate receptor) is a non-NMDA-type ionotropic transmembrane receptor for glutamate that mediates fast synaptic transmission in the central nervous system (CNS). Its name is derived from its ability to be activated by the artificial glutamate analog, AMPA. AMPARs are found in many parts of the brain and are the most commonly found receptor in the nervous system.
  • ampakines acts as positive modulators of AMPA receptors (PARMs).
  • Ampakines have been proposed as cognitive enhancers due to their ability to facilitate learning in a variety of tasks in mammals and humans. Ampakines are in clinical trials to treat various indications including mild cognitive impairment (MCI) associated with aging.
  • MCI mild cognitive impairment
  • a positive modulator of an AMPA receptor likely acts on a transition state of the AMPA receptor complex by reducing deactivation, slowing channel closing, accelerating channel opening, reducing/blocking desensitization or accelerating the recovery from desensitization, for example.
  • Modulation may occur at or near the dimer interface, at levels downstream of the receptor channel involving proteins linked to the postsynaptic densities (PSD) and to proteins engaged in the cascade of second messengers and even further downstream to transcriptional and translational mechanisms involving, among others, CREB.
  • PSD postsynaptic densities
  • a positive modulator of an AMPA receptor may also be an agent having activity for reducing an effect of a negative modulator.
  • an agent having activity for soaking up protons is a positive modulator since protons promote receptor desensitization.
  • An agent that deactivates thiocyanate is also a positive modulator of AMPA receptors.
  • a positive modulator of an AMPA receptor may also be an agent that reduces the effect of a noncompetitive antagonist (also called negative allosteric modulators) and derivatives thereof such as 1-4-aminophenyl- methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI 52466) (Vizi et al, 1996, CNS Drug Rev.
  • Positive modulators of AMPA receptors include, for example, an azepine, a benzamide, benzoylpiperidine, benzoylpyrrolidine, benzoxazine, benzothiadiazide, benzothiadiazine, biarylpropylsulfonamide, pyrrolidinone, pyrroline, tetrahydropyridine, phenoxyacetamide, sulfur-containing organic nitrate ester, lectin, a salt thereof, an ester thereof, a precursor thereof, a metabolite thereof, a derivative thereof, a racemic mixture thereof, or a combination thereof.
  • the term "obesity” refers to a condition characterized by an excess of body fat.
  • the operational definition of obesity is based on the Body Mass Index (BMI), which is calculated as body weight per height in meter squared (kg/m 2 ).
  • BMI Body Mass Index
  • Obesity refers to a condition whereby an otherwise healthy subject has a BMI greater than or equal to 30 kg/m 2 , or a condition whereby a subject with at least one co-morbidity has a BMI greater than or equal to 27 kg/m 2 .
  • An "obese subject” is an otherwise healthy subject with a BMI greater than or equal to 30 kg/m 2 or a subject with at least one co-morbidity with a BMI greater than or equal 27 kg/m 2 .
  • a "subject at risk of obesity” is an otherwise healthy subject with a BMI of 25 kg/m 2 to less than 30 kg/m 2 or a subject with at least one comorbidity with a BMI of 25 kg/m 2 to less than 27 kg/m 2 .
  • the increased risks associated with obesity may occur at a lower BMI in people of Asian descent.
  • "obesity” refers to a condition whereby a subject with at least one obesity-induced or obesity-related co-morbidity that requires weight reduction or that would be improved by weight reduction, has a BMI greater than or equal to 25 kg/m 2 .
  • an “obese subject” in these countries refers to a subject with at least one obesity- induced or obesity-related co-morbidity that requires weight reduction or that would be improved by weight reduction, with a BMI greater than or equal to 25 kg/m 2 .
  • a “subject at risk of obesity” is a person with a BMI of greater than 23 kg/m2 to less than 25 kg/m 2 .
  • obesity-related disorders encompasses disorders that are associated with, caused by, or result from obesity.
  • obesity-related disorders include overeating and bulimia, diabetes, hypertension, elevated plasma insulin concentrations and insulin resistance, dyslipidemia, hyperlipidemia, breast, prostate, endometrial and colon cancer, heart disease, cardiovascular disorders, abnormal heart rhythms and arrhythmias, myocardial infarction, congestive heart failure, coronary heart disease, angina pectoris, cerebral infarction, cerebral thrombosis and transient ischemic attack.
  • Other examples include pathological conditions showing reduced metabolic activity or a decrease in resting energy expenditure as a percentage of total fat-free mass.
  • obesity-related disorders include metabolic syndrome, also known as syndrome X, insulin resistance syndrome, type II diabetes, impaired fasting glucose, impaired glucose tolerance, inflammation, such as systemic inflammation of the vasculature, atherosclerosis, hypercholesterolemia, hyperuricaemia, as well as secondary outcomes of obesity such as left ventricular hypertrophy.
  • Obesity-related disorders also include the liver abnormalities associated with obesity such as non-alcoholic fatty liver disease (NAFLD) a rising cause of cirrhosis associated to obesity and metabolic syndrome.
  • NAFLD non-alcoholic fatty liver disease
  • NAFLD can present as simple steatosis or evolve towards inflammation and steatohepatitis (NASH), with a 20 % risk of cirrhosis after 20 years.
  • Dyslipidemia is a major risk factor for coronary heart disease (CHD).
  • CHD coronary heart disease
  • HDL high density lipoprotein
  • LDL low density cholesterol
  • Preferred obesity-related disorders may be in particular selected from the group consisting of dyslipidemia, non-insulin-dependent diabetes mellitus, insulin resistance, metabolic syndrome, coronary heart disease, atherosclerosis and non-alcoholic fatty liver disease.
  • obesity and obesity-related diseases are not of genetic origin.
  • obesity and obesity-related diseases induced by overeating, high fat diet, and/or hyperglycaemic diet are preferably contemplated.
  • the present invention also relates to a method for the prevention and/or the treatment of obesity, obesity related disease, overweight or overeating in a mammal in need thereof, comprising administering the individual with a prophylactically or therapeutically effective quantity of CB1 receptor agonist at low dose and glutamate receptor agonist, most preferably allosteric enhancers of NMD A receptor
  • treating refers to reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
  • treatment of obesity and obesity-related disorders may refer to the administration of the compounds or combinations of the present invention to reduce or maintain the body weight of an obese subject.
  • One outcome of treatment may be reducing the body weight of an obese subject relative to that subject's body weight immediately before the administration of the compounds of the present invention.
  • Another outcome of treatment may be preventing body weight regain of body weight previously lost as a result of diet, exercise, or pharmacotherapy.
  • Another outcome of treatment may be decreasing the occurrence of and/or the severity of obesity-related diseases.
  • Another outcome of treatment may be to maintain weight loss.
  • prevention of obesity and obesity-related disorders may refer to the administration of the compounds of the present invention to reduce or maintain the body weight of a subject at risk of obesity.
  • One outcome of prevention may be reducing the body weight of a subject at risk of obesity relative to that subject's body weight immediately before the administration of the compounds of the present invention.
  • Another outcome of prevention may be preventing body weight regain of body weight previously lost as a result of diet, exercise, or pharmacotherapy.
  • Another outcome of prevention may be preventing obesity from occurring if the treatment is administered prior to the onset of obesity in a subject at risk of obesity.
  • Another outcome of prevention may be decreasing the occurrence and/or severity of obesity-related disorders if the treatment is administered prior to the onset of obesity in a subject at risk of obesity.
  • Another outcome of prevention may be to prolong resistance to weight gain.
  • Another outcome of prevention may be to prevent weight regain.
  • treatment may prevent the occurrence, progression or severity of obesity-related disorders.
  • the present invention related to a glutamate receptor agonist, preferably an allosteric enhancer of glutamate receptor, more preferably an allosteric enhancer of NMD A receptor in order to allow use of a CB1 receptor agonist in the prevention or the treatment of obesity, and obesity related disorder, overweight or overeating in a mammal in need thereof.
  • the present invention provides methods and compositions (such as pharmaceutical compositions) for treating anorexia cachexia syndrome (ACS), underweight or under eating in a mammal in need thereof.
  • ACS anorexia cachexia syndrome
  • an object of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising a high amount of at least one CB1 receptor agonist as a high dosage and an amount of at least one GABA receptor agonist for use in the prevention or the treatment of anorexia cachexia syndrome (ACS), underweight or under eating in a mammal in need thereof.
  • ACS anorexia cachexia syndrome
  • the amount of said CB1 agonist is supplied at a dosage level superior to 5 mg.
  • said CB1 agonist according to the invention may be administered at a dose of about 5 to 20 mg for human (or about 1.75 to 5 mg/kg body weight for mice).
  • GABA receptor means class of receptors that respond to the neurotransmitter gamma-aminobutyric acid (GABA), the chief inhibitory neurotransmitter in the vertebrate central nervous system.
  • GABA neurotransmitter gamma-aminobutyric acid
  • GABA B GABA B receptors
  • GAB A- A receptors are ligand-gated ion channels (also known as ionotropic receptors)
  • GABA B receptors are G protein-coupled receptors (also known as metabotropic receptors).
  • the active site of the GAB A- A receptor is the binding site for GAB A and several drugs such as muscimol, gaboxadol, and bicuculline.
  • the protein also contains a number of different allosteric binding sites which modulate the activity of the receptor indirectly. These allosteric sites are the targets of various other drugs, including the benzodiazepines, nonbenzodiazepines, barbiturates, ethanol, neuroactive steroids, inhaled anaesthetics, and picrotoxin, among others.
  • GABA receptor agonist refers to any GABA receptor agonist that is currently known in the art or that will be identified in the future, and includes any chemical entity that, upon administration to a patient, results in activation or up-regulation of a biological activity associated with activation of the GABA receptors in the patient, including any of the downstream biological effects otherwise resulting from the binding to GABA receptor of its natural ligand (GABA).
  • GABA receptor agonists include any agent that can help glutamate receptor activation or any of the downstream biological effects of glutamate receptor activation.
  • Most preferred gaba receptor agonist of the invention is an allosteric enhancer of GABA-A receptor.
  • GABA-A Agonists include but are not limited to : gaboxadol, isoguvacine, isonipecotic acid, muscimol.
  • GABA-A allosteric enhancers may be selected from the group consisting of: barbiturates, benzodiazepines (like diazepam : Valium®), carisoprodol, ethanol, etomidate, glutethimide, kavalactones, L-theanine, meprobamate, neuroactive steroids, nonbenzodiazepines, propofol, volatile/inhaled anaesthetics.
  • amount of GABA receptor agonist means using dose with a limited or no psychotropic effect of GABA agonist wherein the amount of at least one GABA agonist is supplied at a dosage level inferior to 1 mg.
  • compositions and use of an amount of GABA agonist according to the invention may be administered at a dose of about 0.1 to 1 mg for human.
  • Cachexia refers to a state of general ill health and malnutrition. It is often associated with and induced by malignant cancer, and it is characterized by loss of appetite, loss of body mass, especially lean body mass, and muscle wasting.
  • Cachexia is a syndrome characterized by an involuntary loss of weight and may include one or more of progressive loss of both fat and skeletal muscle, refractoriness of weight loss to increase nutritional input, elevated resting energy expenditure (REE), decreased protein synthesis, altered carbohydrate metabolism, hyper-catabolism/increased degradation of muscle via the ATP-ubiquitin-proteasome pathway of proteolysis and of adipose tissue via lipo lysis, asthenia, anemia, chronic fatigue, nausea, and loss of bone mass. Typically, at least 5% or 5 pounds of pre-illness body weight must have been lost before the patient is diagnosed with cachexia.
  • one or more of the above symptoms may or may not be present in a given subject depending on the underlying disease or condition associated with it and of the treatment already received by the subject for treating the underlying disease or condition.
  • the above symptoms or physiological conditions may also be present at various degrees.
  • Cachexia may or may not be associated with anorexia.
  • Anorexia refers simply to a loss of appetite, whether brought on by medical or psychological factors. Anorexia is often closely associated with, and generally contributes to, the cachexia seen in patients with advanced cancers
  • Anorexia is a medical term for appetite loss. Manifestations of anorexia include a decreased sense of taste and smell of food, early satiety, a decreased sense of hunger and even outright aversion of food.
  • Anorexia-Cachexia Syndrome is a generic term used by physician as a diagnostic of patients having either anorexia or cachexia.
  • ACS designates anorexia or cachexia.
  • Diseases or conditions associated with or likely to be associated with ACS include but are not limited to, cancer, immunodeficiency disorders such as AIDS, other infectious diseases including viral, bacterial and parasitic diseases, sepsis, rheumatoid arthritis and chronic diseases of the bowel, liver, kidneys, lungs and heart including congestive heart failure and chronic organ failure. It can also manifest itself as a condition in aging or as a result of physical traumas and burn injuries.
  • diseases, conditions or disorders that are typically associated with cachexia include, but are not limited to, cancer, AIDS, liver cirrhosis, diabetes mellitus, chronic renal failure, chronic obstructive pulmonary disease, chronic cardiac failure, immune system diseases (e.g., rheumatoid arthritis and systemic lupus erythematosus), tuberculosis, cystic fibrosis, gastrointestinal disorders (e.g., irritable bowel syndrome and inflammatory bowel disease), Parkinson's disease, dementia, major depression, anorexia nervosa, an aged condition and sarcopenia.
  • cancer cancer
  • AIDS AIDS
  • liver cirrhosis CAD
  • diabetes mellitus chronic renal failure
  • chronic obstructive pulmonary disease chronic cardiac failure
  • immune system diseases e.g., rheumatoid arthritis and systemic lupus erythematosus
  • tuberculosis e.g., cystic fibrosis
  • the diseases, conditions or disorders that are associated with cachexia include, but are not limited to, cancer, AIDS, liver cirrhosis, chronic renal failure, chronic obstructive pulmonary disease, chronic cardiac failure, immune system diseases (e.g., rheumatoid arthritis and systemic lupus erythematosus), tuberculosis, cystic fibrosis, gastrointestinal disorders (e.g., irritable bowel syndrome and inflammatory bowel disease), Parkinson's disease, dementia, major depression, anorexia nervosa, an aged condition and sarcopenia.
  • Cachexia is a strong independent risk factor for morbidity and mortality.
  • cancer cachexia occurs in about half of all cancer patients and is more common in patients with lung and upper gastrointestinal cancers. Cancer patients with an involuntary 5% weight loss have a shorter median survival rate than patients with stable weight. Cancer patients with weight loss can respond poorly to chemotherapy and also can require increased chemotherapy treatments.
  • An "underlying disease or condition” is a disease or condition that is associated with ACS or that is likely to be associated with ACS.
  • Cancer Anorexia-Cachexia-Syndrome is intended to include any form of cancer associated with ACS or likely to be associated with ACS.
  • Non- limiting examples of cancers that are most often associated with ACS include gastric cancer, pancreatic cancer, non-small cell lung cancer, small cell lung cancer lung cancer, prostate cancer, colon cancer, non-Hodgkin's lymphoma, sarcoma, acute non- lymphocytic leukaemia and breast cancer.
  • a subject in need thereof is a subject diagnosed with ACS or having a disease or condition that is likely to be associated with ACS.
  • Subjects having cancer or AIDS are examples of likely candidates.
  • a subject in need thereof is a subject suffering from cancer.
  • the subject in need thereof is a subject suffering from cancer but which has not yet developed ACS.
  • a subject in need thereof is a subject suffering from an immunodeficiency such as AIDS.
  • the subject in need thereof is a subject which has lost at least 5%, 8%, 10%, 12%, 15% or more of his/her initial weight prior to the onset of ACS. In another embodiment, the subject in need thereof is a subject which has lost at least 5%, 8%, 10%, 12%, 15%) or more of his/her weight within a six-month period.
  • the subject in need thereof is a subject that is desirous of increasing his/her appetite and/or weight.
  • a subject in need thereof is a subject undergoing therapy for the underlying disease or condition which is associated with ACS or likely to be associated with ACS.
  • the pharmaceutical composition comprising CB1 agonist and GAB A- A agonist is administered prior to the onset of ACS as a preventive measure.
  • the pharmaceutical composition of the present invention is administered in combination with a drug or drugs used to treat the underlying disease or condition.
  • the composition of the present invention is administered once the subject has been diagnosed with ACS.
  • the composition of the present invention is administered in combination with one or more other drugs or food supplements used for the prevention and/or treatment of ACS.
  • a further object of the invention relates to a method for the prevention and/or the treatment of anorexia, cachexia, underweight or under eating in a mammal in need thereof in a mammal in need thereof, comprising administering the individual with a prophylactically or therapeutically effective quantity of CB1 receptor agonist at high dose and GABA-A receptor agonist, most preferably allosteric enhancers of GABA-A receptor.
  • the present invention related to an agonist GABA, most preferably an allosteric enhancer of GABA-A receptor, in order to allow the use of a CB1 receptor agonist in the prevention or the treatment of ACS, underweight or under eating in a mammal in need thereof.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one
  • the invention also relates to a pharmaceutical composition comprising at least one CB 1 receptor agonist as defined above and at least one GAB A receptor agonist as defined above, and optionally a pharmaceutically acceptable carrier.
  • the pharmaceutical composition also comprises a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate.
  • a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi- so lid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • compositions for example, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc.
  • compositions of the invention can notably be formulated for an intravenous, intramuscular, subcutaneous, mhaled/mirfmasal, oral and rectal administration, and the like.
  • compositions of the invention may contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
  • vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
  • These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
  • an effective amount of the receptor agonist may be dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form is preferably sterile and is fluid to the extent that easy syringability exists. It is preferably stable under the conditions of manufacture and storage and is preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • a composition of the invention can be formulated into a composition in a neutral or salt form.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
  • the carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof.
  • the preparation of more, or highly concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small tumor area.
  • compositions 1 of the invention may be administered for a low amount of CBl agonist at a dose of about 0.05 to 5 mg or about 0.1 to .5 mg or about 0.2 to 5 mg or about 0.5 to 5 mg for human.
  • compositions 2 of the invention may be administered for a high amount of CBl agonist at a dose of about 5 to 20 mg/kg body weight or about 5 to 15 mg or about 5 to 10 mg for human.
  • the invention also relates to a kit containing:
  • said glutamate agonist is an allosteric enhancers of glutamate receptor, more preferably an allosteric enhancer of NMD A receptor.
  • the invention also relates to a kit containing:
  • said glutamate agonist is an allosteric enhancer of GABA-A receptor
  • a first receptor agonist can be administered prior to, concomitantly with, or subsequent to the administration of the second receptor agonist to a subject which had, has, or is susceptible to obesity related disease or ACS.
  • the CBl agonist and the GABA agonist or glutamate agonist molecules are administered to a subject in a sequence and within a time interval such that the first receptor agonist can act together with the second receptor agonist to provide an increased benefit than if they were administered otherwise.
  • the binding molecules are administered simultaneously to the subject with an obesity related disease or ACS.
  • the molecules are administered simultaneously and every day to said patient.
  • FIG. 1 Deletion of CB1 from cortical glutamatergic or GABAergic neurons results in opposite phenotypes in fasting-induced food intake, due to altered GABAergic or glutamatergic transmission, respectively, (a) Glu-CBl-KO mice (lacking CB1 receptors from cortical glutamatergic neurons) exhibit a decrease in food intake under vehicle treatment (left black and white bars).
  • NMD A receptor antagonist MK-801 (0.03 mg/kg, solid and dashed black bars) abolishes the phenotype of Glu-CBl- KO mice (white bars)
  • GABA-CB1-KO mice (lacking CB1 receptors from GABAergic neurons) display a hyperphagic phenotype (left black and white bars).
  • An ineffective dose of the GABA-A receptor antagonist picrotoxin (0.3 mg/kg, solid and dashed black bars,) abolishes the phenotype of GABA-CB1-KO (white bars).
  • N 6-15 per group.
  • FIG. 2 The doses of 1 mg/kg and 2.5 mg/kg THC induce a hyperphagic and a hypophagic effect in wild-type C57BL/6NCrl mice, respectively, which do not depend on altered locomotion. Dose response of THC effects in fasting-refeeding experiments in wild-type mice. Note the clear biphasic effect of the drug.
  • the hyperphagic (1 mg/kg) and the hypophagic 2.5mg/kg) effects of THC are not accompanied by alterations in locomotor activity (figure not shown).
  • N 4-6 per group.
  • FIG 3 Schematic representation of the rationale for pharmacological experiments using THC in combination with allosteric modulators of NMD A or GABA-A receptors,
  • presynaptic action potentials and [Ca2+] levels regulate the synaptic release of GABA or glutamate.
  • the presynaptic release of the neurotransmitter activates postsynaptic receptors and induces signalling in the postsynaptic neurons. The intensity of this signalling depends on the amount of neurotransmitter released presynaptically.
  • THC activates presynaptic CB1 receptors, decreases presynaptic [Ca2+] levels, and, thus, reduces the release of the neurotransmitter and postsynaptic signalling
  • FIG. 4 The co-administration of allosteric enhancers of NMD A and GABA-A receptors (D-cyclo-serine, DCS, and diazepam, DZP,) would "restore" the postsynaptic levels of activity of these receptors, thereby compensating the effects of the low and high doses of THC, respectively.
  • FIG. 5 The hyperphagic and hypophagic effects of THC depend on glutamatergic and GABAergic transmission, respectively.
  • (a,b) Allosteric enhancement of glutamatergic (NMDA) and GABAergic (GABA-A) neurotransmission reverts the hyperphagic and hypophagic effects of 1 and 2.5 mg/kg THC in C57BL/6-N mice, respectively.
  • DCS D-cyclo-serine
  • N 6-10 per group.
  • mice All experimental procedures were approved by the Committee on Animal Health and Care of INSERM and French Ministry of Agriculture and Forestry (authorization number, 3306369). Mice, aged 2-5 months, were maintained under standard conditions with food and water ad libitum. In most experiments male mice were used. Due to low availability of animals, male and female mice were used in the experiments with double Glu/GABA-CBl mutants. No significant difference was observed between genders in these mice (not shown). CB1 mutant mice (CB1-KO, Glu-CBl-KO and GABA-CB 1 -KO) were obtained, maintained and genotyped as described [18,19,8,20]. All lines were in a mixed genetic background, with a predominant C57BL/6NCrl contribution.
  • mice All animals used in experiments involving mutant mice were littermates. For total CB1-KO mice, the parents of experimental animals were always heterozygous for the mutation.
  • conditional mutants obtained using the Cre/loxP system, Cre-positive/CBlflox/flox males were bred with Cre-negative/CBlflox/flox females (i.e. phenotypically wild-type), in order to avoid potential influence of the mother's genotype on the adult phenotype of the experimental animals.
  • Cre-positive and Cre-negative littermate mice were derived from Cre-positive/CBl-WT males crossed with wild-type C57BL/6NCrl female mice.
  • Dlx 5/6-Cre mice and NEX-Cre were the controls for the Cre effect of GABA-CB1-KO and Glu-CBl-KO, respectively [8,20].
  • Wild-type C57BL/6NCrl were purchased from JANVIER (France). Experimenters were always blind to genotypes and/or treatments.
  • Glu-CBl-KO mice were crossed with GABA-CB1-KO mice in order to obtain a first generation with male mice bearing deletion in both glutamatergic and GABAergic neurons. These males were bred with CBlflox/flox females. The resulting litters contained either wild-type, Glu-CBl-KO, GABA-CB1-KO, or Glu/GABA-CBl-KO littermates, which were used for experiments.
  • mice were genotyped by PCR, using the following primers: NEX-CRE forward primer for Glu-CBl-KO: TCTTTTTCATGTGCTCTTGG, Dlx5/6-CRE forward primer for GABA-CB1-KO: AGCAATCGCACTCACAACAGA, CRE reverse for both lines: CGCGCCTGAAGATATAGAAGA. CBlf/f alleles were detected as described [19].
  • THC effect on locomotor activity was recorded during the first hour of refeeding by an automated system (Mice Actimetry System, IMETRONIC, France) and expressed as number of bins/h.
  • Sections were washed five times for 10 min in PBS and incubated in blocking buffer (5% normal goat serum, 2.5% BSA, 0.3% Triton X-100) for 1 hour at room temperature.
  • the primary antibody (LI 5 polyclonal rabbit anti CB1, a generous gift of Ken Mackie, Indiana University, Bloomington, IN, U.S.A.) was diluted 1 : 1000 in PBS containing 1% normal goat serum, 0.1 % BSA and 0.1 % Triton X-100.
  • the slides were incubated 48 hours with the primary antibody at 4°C, washed five times for 10 min with PBS containing 0.1% Triton X-100.
  • CB1-KO cortical glutamatergic
  • GABA-CB1-KO GABAergic neurons
  • the CB1 agonist A9-tetrahydrocannabinol (THC) exerted a biphasic effect on food intake in fasting-refeeding experiments (Fig. 2).
  • a hyperphagic (1 mg/kg) or a hypophagic dose (2.5 mg/kg) of THC was administered to CB1 mutant mice and their wild-type littermate controls.
  • THC was inactive in CBl-KO mice.
  • the hyperphagic dose of THC bore no effect in Glu-CBl-KO mice, whereas the higher dose decreased food intake in these mutants.
  • CB1 receptors might vary according to the neuronal populations where they are expressed. For instance, cortical glutamatergic neurons contain very limited amounts of the receptor [3], which could be maximally stimulated by low doses of agonists, whereas GABAergic terminals containing large amounts of CBl protein [3] might need higher concentrations of agonists to display a significant effect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention a pour objet des compositions et des méthodes pour la régulation de la prise alimentaire exploitant les effets synergiques des agonistes du récepteur CB1 avec les agonistes du récepteur GABA ou du récepteur du glutamate, respectivement. Plus particulièrement, la présente invention concerne des compositions et une méthode pour la réduction de la prise alimentaire et/ou du poids corporel chez un mammifère, comprenant l'administration audit mammifère d'une quantité pharmaceutiquement faible d'au moins un agoniste du récepteur CB1 et d'une quantité d'au moins un agoniste du récepteur du glutamate. La présente invention concerne également des compositions et une méthode pour l'élévation de la prise alimentaire et/ou du poids corporel chez un mammifère, comprenant l'administration audit mammifère d'une quantité pharmaceutiquement élevée d'au moins un agoniste du récepteur CB1 et d'une quantité d'au moins un agoniste du récepteur GABA.
PCT/EP2010/068466 2009-12-01 2010-11-30 Compositions ciblant le récepteur cb1 pour la régulation de la prise alimentaire WO2011067225A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP09306163 2009-12-01
EP09306163.8 2009-12-01

Publications (1)

Publication Number Publication Date
WO2011067225A1 true WO2011067225A1 (fr) 2011-06-09

Family

ID=41800466

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/068466 WO2011067225A1 (fr) 2009-12-01 2010-11-30 Compositions ciblant le récepteur cb1 pour la régulation de la prise alimentaire

Country Status (1)

Country Link
WO (1) WO2011067225A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016137841A1 (fr) * 2015-02-26 2016-09-01 William Paterson University Of New Jersey Souris transgéniques

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053956A1 (fr) * 1998-04-16 1999-10-28 Yamanouchi Pharmaceutical Co., Ltd. Remedes contre l'obesite
US6344474B1 (en) 1997-01-28 2002-02-05 Sanofi-Synthelabo Use of central cannabinoid receptor antagonists for regulating appetence
US20060030563A1 (en) 1999-10-18 2006-02-09 Alexandros Makriyannis Novel pyrazole analogs acting on cannabinoid receptors
US20080103193A1 (en) * 2006-10-26 2008-05-01 Trevor Percival Castor Methods for making compositions and compositions for treating pain and cachexia

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6344474B1 (en) 1997-01-28 2002-02-05 Sanofi-Synthelabo Use of central cannabinoid receptor antagonists for regulating appetence
WO1999053956A1 (fr) * 1998-04-16 1999-10-28 Yamanouchi Pharmaceutical Co., Ltd. Remedes contre l'obesite
US20060030563A1 (en) 1999-10-18 2006-02-09 Alexandros Makriyannis Novel pyrazole analogs acting on cannabinoid receptors
US20080103193A1 (en) * 2006-10-26 2008-05-01 Trevor Percival Castor Methods for making compositions and compositions for treating pain and cachexia

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
BARRECA ET AL., J. CHEM. INF. COMPUT. SCL, vol. 43, 2003, pages 651 - 655
BARTH F: "Cannabinoid receptor agonists and antagonists", EXP. OPINION. THERAP. PATENTS, vol. 8, no. 3, 1998, pages 301 - 313
BASAVARAJAPPA BS: "Critical enzymes involved in endocannabinoid metabolism", PROTEIN PEPT LETT., vol. 14, no. 3, 2007, pages 237 - 46
BERGHUIS,P. ET AL.: "Hardwiring the brain: endocannabinoids shape neuronal connectivity", SCIENCE, vol. 316, 2007, pages 1212 - 1216
CHEVALEYRE,V.; TAKAHASHI,K.A.; CASTILLO,P.E.: "Endocannabinoid- Mediated Synaptic Plasticity in the CNS", ANNU. REV. NEUROSCI., 2006
DI MARZO,V. ET AL.: "Leptin-regulated endocannabinoids are involved in maintaining food intake", NATURE, vol. 410, 2001, pages 822 - 825
FOWLER CJ: "The pharmacology of the cannabinoid system--a question of efficacy and selectivity", MOL NEUROBIOL., vol. 36, no. L, August 2007 (2007-08-01), pages 15 - 25
GOYA P.; JAGEROVIC N.: "Recent advances in cannabinoid receptor agonists and antagonists", EXP. OPINION. THERAP. PATENTS., vol. 10, no. 10, 2000, pages 1529 - 1538
HERMAN,J.P.; TASKER,J.G.; ZIEGLER,D.R.; CULLINAN,W.E.: "Local circuit regulation of paraventricular nucleus stress integration: glutamate-GABA connections", PHARMACOL. BIOCHEM. BEHAV., vol. 71, 2002, pages 457 - 468
HOWLETT AC; BARTH F; BONNER TI; CABRAL G; CASELLAS P; DEVANE WA ET AL.: "International Union of Pharmacology. XXVII. Classification of cannabinoid receptors", PHARMACOL REV, vol. 54, 2002, pages 161 - 202
KANO,M.; OHNO-SHOSAKU,T.; HASHIMOTODANI,Y.; UCHIGASHIMA,M.; WATANABE,M.: "Endocannabinoid-mediated control of synaptic transmission", PHYSIOL REV., vol. 89, 2009, pages 309 - 380
KELLEY,A.E.; BALDO,B.A.; PRATT,W.E.; WILL,M.J.: "Corticostriatalhypothalamic circuitry and food motivation: integration of energy, action and reward", PHYSIOL BEHAV., vol. 86, 2005, pages 773 - 795
LETT B T ET AL: "CHLORDIAZEPOXIDE ATTENUATES ACTIVITY-INDUCED ANOREXIA AND WEIGHT LOSS IN RATS", EXPERIMENTAL AND CLINICAL PSYCHOPHARMACOLOGY, AMERICAN PSYCHOLOGICAL ASSOCIATION, WASHINGTON, DC, US, vol. 6, no. 4, 1 November 1998 (1998-11-01), pages 360 - 366, XP009085585, ISSN: 1064-1297 *
MARSICANO, G. ET AL.: "CB1 cannabinoid receptors and on-demand defense against excitotoxicity", SCIENCE, vol. 302, 2003, pages 84 - 88
MARSICANO, G. ET AL.: "The endogenous cannabinoid system controls extinction of aversive memories", NATURE, vol. 418, 2002, pages 530 - 534
MARSICANO,G.; KUNER,R.: "Anatomical distribution of receptors, ligands and enzymes in the brain and in the spinal cord: Circuitries and neurochemistry in Cannabinoids and the brain", 2008, SPRINGER, pages: 161 - 201
MARSICANO,G.; LUTZ,B.: "Neuromodulatory functions of the endocannabinoid system", J. ENDOCRINOL. INVEST, vol. 29, 2006, pages 27 - 46
MATIAS,I.; DI MARZO: "V. Endocannabinoids and the control of energy balance", TRENDS ENDOCRINOL. METAB, vol. 18, 2007, pages 27 - 37
MONORY, K. ET AL.: "Genetic dissection of behavioural and autonomic effects of Delta(9)-tetrahydrocannabinol in mice", PLOS. BIOL., vol. 5, 2007, pages E269
MONORY,K. ET AL.: "The endocannabinoid system controls key epileptogenic circuits in the hippocampus", NEURON, vol. 51, 2006, pages 455 - 466
MULDER,J. ET AL.: "Endocannabinoid signaling controls pyramidal cell specification and long-range axon patterning", PROC. NATL. ACAD. SCI. U. S. A, vol. 105, 2008, pages 8760 - 8765
PAGOTTO,U.; MARSICANO,G.; COTA,D.; LUTZ,B.; PASQUALI,R.: "The emerging role of the endocannabinoid system in endocrine regulation and energy balance", ENDOCR. REV., vol. 27, 2006, pages 73 - 100
PERTWEE RG: "Cannabinoids", 2005, SPRINGER-VERLAG, article "Pharmacological actions of cannabinoids", pages: 1 - 51
PETITET F; IMPERATO A: "The Therapeutic applications of cannabinoid agonists and antagonists", EMERGING DRUGS, 1998, pages 39 - 53
R.R. NEUBIG ET AL.: "International Union of Pharmacology Committee on Receptor Nomenclature and Drug Classification. XXXVIII. Update on terms and symbols in quantitative pharmacology", PHARMACOT. REV., vol. 55, 2003, pages 597 - 606
VIZI ET AL., CNS DRUG REV., vol. 2, 1996, pages 91 - 126
VOLICER L ET AL: "EFFECTS OF DRONABINOL ON ANOREXIA AND DISTURBED BEHAVIOR IN PATIENTS WITH ALZHEIMER'S DISEASE", INTERNATIONAL JOURNAL OF GERIATRIC PSYCHIATRY, JOHN WILEY AND SONS, CHICHESTER, GB, vol. 12, no. 9, 1 September 1997 (1997-09-01), pages 913 - 919, XP008000789, ISSN: 0885-6230 *
WALSH ET AL: "The Efficacy and Tolerability of Long-Term Use of Dronabinol in Cancer-Related Anorexia: A Case Series", JOURNAL OF PAIN AND SYMPTOM MANAGEMENT, ELSEVIER, NEW YORK, NY, US, vol. 30, no. 6, 1 December 2005 (2005-12-01), pages 493 - 495, XP005221370, ISSN: 0885-3924 *
YAMADA, NEUROBIOLOGY OF DISEASE, vol. 5, 1998, pages 67 - 80

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016137841A1 (fr) * 2015-02-26 2016-09-01 William Paterson University Of New Jersey Souris transgéniques

Similar Documents

Publication Publication Date Title
Ohyama et al. A synergistic antiobesity effect by a combination of capsinoids and cold temperature through promoting beige adipocyte biogenesis
Daniels et al. Divergent behavioral roles of angiotensin receptor intracellular signaling cascades
Lam et al. Brain serotonin system in the coordination of food intake and body weight
Vasudevan et al. Membrane-initiated actions of estrogens in neuroendocrinology: emerging principles
Moldrich et al. Glutamate metabotropic receptors as targets for drug therapy in epilepsy
Rossi et al. Iron overload causes osteoporosis in thalassemia major patients through interaction with transient receptor potential vanilloid type 1 (TRPV1) channels
Gemes et al. Store-operated Ca2+ entry in sensory neurons: functional role and the effect of painful nerve injury
Li et al. Role of NR2B-type NMDA receptors in selective neurodegeneration in Huntington disease
Chavez-Noriega et al. Metabotropic glutamate receptors: potential drug targets for the treatment of schizophrenia
Bashour et al. Progesterone directly and rapidly inhibits GnRH neuronal activity via progesterone receptor membrane component 1
Jochems et al. Enhancement of stress resilience through histone deacetylase 6–mediated regulation of glucocorticoid receptor chaperone dynamics
Santollo et al. Activation of membrane-associated estrogen receptors decreases food and water intake in ovariectomized rats
Daniels et al. Food intake inhibition and reduction in body weight gain in lean and obese rodents treated with GW438014A, a potent and selective NPY-Y5 receptor antagonist
Jin et al. Metabotropic glutamate receptor 5 upregulates surface NMDA receptor expression in striatal neurons via CaMKII
Giribaldi et al. Group I metabotropic glutamate autoreceptors induce abnormal glutamate exocytosis in a mouse model of amyotrophic lateral sclerosis
von Loga et al. Does pain at an earlier stage of chondropathy protect female mice against structural progression after surgically induced osteoarthritis?
Rashmi et al. Glucocorticoid-induced leucine zipper protein regulates sodium and potassium balance in the distal nephron
US20070191326A1 (en) Methods for modulating glutamate receptors for treating neuropsychiatric disorders comprising the use of modulators of serum and glucocorticoid inducible kinases
Dalvi et al. Glucagon-like peptide-2 directly regulates hypothalamic neurons expressing neuropeptides linked to appetite control in vivo and in vitro
Palazzo et al. Supraspinal metabotropic glutamate receptor subtype 8: a switch to turn off pain
Robins et al. Behavioral characterization of β-arrestin 1 knockout mice in anxiety-like and alcohol behaviors
Tracy et al. CaV3. 1 isoform of T-type calcium channels supports excitability of rat and mouse ventral tegmental area neurons
Yoon et al. Receptor-mediated muscle homeostasis as a target for sarcopenia therapeutics
Zhang et al. Central NPFF signalling is critical in the regulation of glucose homeostasis
Jang et al. Physiological difference between dietary obesity-susceptible and obesity-resistant Sprague Dawley rats in response to moderate high fat diet

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10782625

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10782625

Country of ref document: EP

Kind code of ref document: A1