WO2011064781A1

WO2011064781A1 - S. pneumoniae adhesins

Info

Publication number: WO2011064781A1
Application number: PCT/IL2010/000998
Authority: WO
Inventors: Yaffa Mizrachi Nebenzahl; Ron Dagan
Original assignee: Ben-Gurion University Of The Negev Research And Development Authority
Priority date: 2009-11-30
Filing date: 2010-11-30
Publication date: 2011-06-03

Abstract

The present invention relates to polypeptide fragments, including variants and analogs, of Streptococcus pneumonia (S. pneumoniae) PTS system, mannose-specific IIAB components (PTS), ABC transporter substrate-binding protein (ABC) or Aspartate Carbamoyltransferase catalytic subunit (ATCase)) protein and compositions comprising the same for use in preventing adhesion of S. pneumoniae to respiratory tract cells, cell-to-cell spread and bacteremia. In particular, the present invention relates to the use of such polypeptides for treating S. pneumoniae infection and in particular for treating sepsis caused thereby.

Description

S. PNEUMONIAE ADHESINS

FIELD OF THE INVENTION

[0001] The present invention relates to Streptococcus pneumonia (5. pneumoniae) proteins PTSsystem, mannose-specific IIAB component (PTS), ABC transporter substrate-binding protein (ABC) and Aspartate Carbamoyltransferase catalytic subunit (ATCase) protein. In particular, the present invention relates to their use as a treatment against S. pneumoniae infection and sepsis.

BACKGROUND OF THE INVENTION

[0002] Streptococcus pneumoniae belongs to the commensal flora of the human respiratory tract, but can also cause invasive infections such as meningitis and sepsis. Mortality due to pneumococcal infection remains high all over the world, augmented by a wide-spread antibiotic resistance in many pneumococcal strains (Dagan et al., Pneumococcal Infections. In: Feigin R, et al, ed. Textbook of Pediatric Infectious Diseases. 5 ed. Philadelphia: Saunders Co, 2004:1204- 58). The development of new preventive and therapeutic interventions is hampered due to the incomplete understanding of pneumococcal pathogenesis. It is understood that the use of S. pneumoniae proteins in the prevention of pneumococcal pathogenesis by means of vaccination is knonwn in the art, and is disclosed, for example in WO 03/082183 and US 7,504,110, to one of the inventors of the subject invention. Thus, it is to be understood explicitly that vaccines or use of the proteins for vaccination purposes are excluded from the scope of the present invention.

[0003] Children all over the world become nasopharyngeal carriers of Streptococcus pneumoniae. Many develop pneumococcal disease that can be invasive (such as bacteremia, sepsis or meningitis), or mucosal infections (such as pneumonia and otitis media). S. pneumoniae is the leading cause of non-epidemic childhood meningitis in Africa and other regions of the developing world. Approximately, one to two million children die from pneumococcal pneumonia each year. Specifically, when considering deaths of children under five years old worldwide, about 20% is from pneumococcal pneumonia. These high morbidity and mortality rates and the persistent emergence of antibiotic resistant strains of 5. pneumoniae heighten the need to develop an effective alternate therapeutic.

SUMMARY OF THE INVENTION

[0004] In one embodiment, this invention provides a method of inhibiting adhesion of S. pneumoniae to cells of the repiratory tract, said method comprising contacting cells of a repiratory tract with a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (5. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate-binding protein (ABC) of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, wherein said synthetic or recombinant polypeptide prevents adhesion of 5. pneumoniae to host cells for example, but not restricted to, cells of the respiratory tract.

[0005] In one embodiment, the invention provides a method of treating a subject infected with S. pneumoniae, said method comprising administering to said subject a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (S. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate-binding protein (ABC) of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, wherein said synthetic or recombinant polypeptide prevents adhesion of 5. pneumoniae to cells of host cells for example, but without limitation to cells of the respiratory tract. According to this aspect, and in one embodiment, the subject is afflicted with sepsis. In some embodiments, the subject is predisposed to developing sepsis.

[0006] In one embodiment, this invention provides for the use of a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (S. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate- binding protein (ABC) of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, in the preparation of a medicament for use in preventing adhesion of S. pneumoniae to cells of a respiratory tract in a subject.

[0007] In another embodiment, this invention provides for the use of a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (S. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate-binding protein (ABC) of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, in the preparation of a medicament for use in treating a subject infected with S. pneumoniae.

[0008] Variants include substitution of one amino acid residue per each ten amino acid residues in a polypeptide sequence, namely, polypeptides having 90% or more identity are included within the scope of the present invention. According to some embodiments, sequences having at least 97% identity to the polypeptides of the present invention are provided. In some embodiments, the polypeptide of this invention comprises a fragment of a PTS system, mannose-specific IIAB components (PTS) NP_344690 GI:15900086 of SEQ ID NO:l, ABC transporter substrate-binding protein (ABC) NP_344690 GI: 15900086 of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) NP_345741.1 GI:15901137 of SEQ ID NO: 3

[0009] According to some embodiments, the PTS system, mannose-specific IIAB components (PTS) polypeptide according to the invention shares less than 30% identity with the human PTS protein, for example, according to NCBI Accession Number AAB64229.1, or NP_000308.1, or EAW67195.1, or AAA51541.1 or BAA95486.1. According to other embodiments, the PTS polypeptide according to the invention shares less than 10% identity with the human PTS protein, for example, according to NCBI Accession Number AAB64229.1, or NP_000308.1, or EAW67195.1, or AAA51541.1 or BAA95486.1.

[00010] According to some embodiments, the ABC transporter substrate -binding protein (ABC) polypeptide according to the invention shares less than 30% identity with the human ABC protein, for example, according to NCBI Accession Number NP_689914, or others. According to other embodiments, the ABC polypeptide according to the invention shares less than 10% identity with the human ABC protein, for example, according to NCBI Accession Number NP_689914.

[00011] According to some embodiments, the Aspartate Carbamoyltransferase catalytic subunit (ATCase) polypeptide according to the invention shares less than 30% identity with the human ABC protein, for example, according to NCBI Accession Number EAX00614, or EAX00613, or AAH65510, or EAX00612, or others. According to other embodiments, the ATCase polypeptide according to the invention shares less than 10% identity with the human ATCase protein, for example, according to NCBI Accession Number EAX00614, or EAX00613, or AAH65510, or EAX00612.

[00012] According to some embodiments the present invention provides for methods which make use of a synthetic or recombinant 5. pneumoniae PTS system, mannose-specific IIAB components (PTS) polypeptide having a sequence as set forth in SEQ ID NO: 1:

mtimsigiii ashgefaagi hqsgsmifge qekvqwtfm pnegpddlya kfnnavaafd

aedevlvlad lwsgspfnqa srvmgenper kfaiitglnl pmliqayter lmdaaagvek vaaniikeak dgikalpeel npveevasaa aapvaqtaip egtvigdgkl kinlarldtr

llhgqvataw tpdskanrii vasdnvakdd lrkelikqaa pgnvkanvvp iqklieiskd

prfgethali lfetpqdalr aieggvpikt lnvgsmahst gktlvntvls mdkedvatfe

kmrdlgvefd vrkvpndskk dlfdlinkan vk

[00013] According to some embodiments the present invention for methods which make use of a synthetic or recombinant S. pneumoniae PTS system, mannose-specific IIAB components (PTS) polypeptidecomprising the sequence as set forth in NCBI's Genbank Accession No.: NP_344822.

[00014] According to some embodiments the present invention provides for methods which make use of a synthetic or recombinant S. pneumoniae PTS system, mannose-specific IIAB components (PTS) polypeptide encoded by a polynucleotide comprising the sequence (SEQ ID NO: 4):

TTATTTGACATTGGCTTTGTTAATCAAGTCAAA^

TCAAATTCAACACCCAAGTCACGCATTTT TCAAATGTAGCAACGTCTTCTTTGTCCATAGACAAAACGG

TATTGACCAATGTTTTACCTGT GAGTGAGCCATAGAACCAACATTAAGAGTCTTGATTGGCACGCCGCC

TTCGATGGCACGAAGGGCATCTTGAGGTGT TCAAACAAGATAAGGGCATGTGTTTCTCCAAAACGTGGG

TCTTTTGAAATCTCAATCAGTTTTTGAATTGGAACCACGTTAGCCTTGACATTACCTGGAGCTGCTTGTT

TAATCAATTCTTTACGAAGGTCGTCTTTAGCCACGTTATCTGAAGCAACGATGATACGATTTGCTTrTGA

ATCTGGAGTCCAAGCAGTTGCAACCTGACCGTGAAGTAGACGTGTGTCAAGACGGGCAAGATTGATTTTC

AATTTACCGTCTCCGATAACAGTTCCTTCTGGGATAGCAGT TGGGCAACTGGAGCAGCTGCAGCGCTTG

CAACTTCTTCGACTGGATTTAGCTCTTCTGGAAGAGCTTTGATGCCATCTTTGGCTTCTTTAATGATATT

AGCAGCGACT TTTCTACACCTGCAGCAGCGTCCATGAGGCGCTCTGTGTAGGCTTGAATCAACATCGGT

AAGTTAAGTCCTGTGATGATGGCAAACTTACGCTCAGGATTTTCTCCCATCACGCGACTAGCTTGGTTAA

ATGGAGAACCACTCCAAAGGTCAGCCAAAACTAGAACCTCATCTTCTGCGTCAAATGCAGCAACAGCGTT

ATTAAACTTAGCGTATAGATCATCAGGACCTTCATTTGGCATAAAGGTCACAACTTGAACCTTTTCTTGT

TCACCAAAGATCATAGATCCTGACTGATGAATACCCGCAGCAAATTCGCCGTGGCTCGCAATAATGATTC

CGATACTCATTATTGTCAT.

[00015] According to some embodiments the present invention provides for methods which make use of a synthetic or recombinant S. pneumoniae ABC transporter substrate-binding protein (ABC) comprising the sequence (SEQ ID NO: 2):

mkkivkyssl aalalvaagv laacsggakk egeaaskkei ivatngspkp fiyeengelt

gyeievvrai fkdsdkydvk fektewsgvf agldadrynm avnnlsytke raekylyaap

iaqnpnvlvv kkddssiksl ddiggkstev vqattsakql eaynaehtdn ptilnytkad

lqqimvrlsd gqfdykifdk igvetviknq gldnlkviel psdqqpyvyp llaqgqdelk

sfvdkrikel ykdgtlekls kqffgdtylp aeadik

[00016] According to some embodiments the present invention for methods which make use of a synthetic or recombinant S. pneumoniae ABC transporter substrate -binding protein (ABC) comprising the sequence as set forth in NCBI's Genbank Accession No.: NP_344690.

[00017] According to some embodiments the present invention for methods which make use of a synthetic or recombinant 5. pneumoniae ABC transporter substrate-binding protein (ABC) encoded by a polynucleotide comprising the sequence (SEQ ID NO: 5): ATGAAAAAAATCGTTAAATACTCATCTCTTGCAGCCCTTGCTCTTGTTGCTGCAGGTGTGCTTGCGGCTT

GCTCAGGGGGTGCTAAGAAAGAAGGAGAAGCAGCTAGCAAGAAAGAAATCATCGTTGCAACCAATGGATC ACCAAAGCCATTTATCTATGAAGAAAATGGCGAATTGACTGGTTACGAGATTGAAGTCGTTCGCGCTATC TTTAAAGATTCTGACAAATATGATGTCAAGTTTGAAAAGACAGAATGGTCAGGTGTCTTTGCTGGTCTTG ACGCTGATCGTTACAATATGGCTGTCAACAATCTTAGCTACACTAAAGAACGTGCGGAGAAATACCTCTA TGCCGCACCAATTGCCCAAAATCCTAATGTCCTTGTCGTGAAGAAAGATGACTCTAGTATCAAGTCTCTC GATGATATCGGTGGAAAATCGACGGAAGTCGTTCAAGCCACTACATCAGCTAAGCAGTTAGAAGCATACA ATGCTGAACACACGGACAACCCAACTATCCTTAACTATACTAAGGCAGACTTGCAACAAATCATGGTACG T TGAGCGATGGACAAT TGACTATAAGATTTTTGATAAAATCGGTGTTGAAACAGTGATCAAGAACCAA GGTTTGGACAACTTGAAAGTTATCGAACn CCAAGCGACCAACAACCGTACGTTTACCCACTTCTTGCTC

AGGGTCAAGATGAGTTGAAATCGTTTGTAGACAAACGCATCAAAGAACTTTATAAAGATGGAACTCTTGA AAAATTGTCTAAACAATTCTTCGGAGACACTTATCTACCGGCAGAAGCTGATATTAAATAA.

[00018] According to some embodiments the present invention for methods which make use of a synthetic or recombinant 5. pneumoniae Aspartate Carbamoyltransferase catalytic subunit (ATCase) comprising the sequence (SEQ ID NO: 3):

msenqqalnh wsmedltvd qvmklikrgi efkngaqlpy edhpivsnlf fedstrthks fevaeiklgl erldfdvkts svnkgetlyd tiltlsalgv dvcvirhpev dyyreliasp

tittsiingg dgsgqhpsqs lldlmtiyee fghfeglkva iagdldhsrv aksnmqilkr

lgaelffagp eewrsqefad ygqfvtidei idqvdvmmfl rvqherhdsg avfskedyha

qhgltqeryd rlketailmh papinrdvei adhlveapks rivqqmtngv fvrmailesv

lasrnan.

[00019] According to some embodiments the present invention for methods which make use of a synthetic or recombinant 5. pneumoniae Aspartate Carbamoyltransferase catalytic subunit (ATCase) encoded by a polynucleotide comprising the sequence (SEQ ID NO: 6):

TTAGTTGGCGTTTCTACTCGCTAGTACGGATTCTAAGATTGCCATTCGAACAAAGACACCATTGGTCATT

TGTTGGACAATCCGTGAT TTGGTGCTTCAACCAAGTGGTCTGCTATTTCTACATCACGATTGATTGGAG

CTGGGTGCATGAGGATTGCTGTTTCTTTCAAACGATCGTAACGTTCTTGAGTCAAGCCATGTTGGGCATG

GTAGTCTTCTTTTGAAAATACAGCTCCACTATCATGGCGTTCGTGTTGCACACGGAGAAACATCATGACA

TCAACCTGATCAATGATTTCATCAATGGTTACAAACTGTCCATAGTCTGCAAACTCTTGACTTCTCCATT

CCTCAGGTCCAGCGAAAAAGAGTTCAGCTCCCAAGCGTTTCAAAATCTGCATATTGGATTTGGCAACGCG

TGAGTGGTCCAAGTCACCTGCAATAGCAACTTTAAGACCCTCAAAGTGGCCAAATTCCTCATAAATGGTC

ATCAAATCAAGCAAGCTCTGGCTAGGGTGTTGGCCCGAACCATCTCCACCATTGATGATGGAAGTCGTAA

TCGTTGGACTAGCAATCAATTCTCTATAGTAGTCGACCTCTGGATGGCGAATCACACAGACATCCACTCC TAAAGCAGACAGAGTCAAAATGGTGTCATAAAGTGTCTCACCCTTATTAACCGAGCTAGTCTTCACATCA AAGTCAAGTCGTTCCAATCCAAGTTTAATCTCTGCGACTTCAAAGGACTTATGTGTCCGTGTAGAATCCT CAAAGAAGAGATTGGAAACAATCGGATGGTCTTCATAGGGAAGCTGGGCTCCATTTTTAAACTCAATTCC TCGCTTGATCAATTTCATTACTTGATCGACAGTGAGGTCTTCCATGGACACCACATGGTTCAATGCTTGT TGATTTTCTGACAT

[00020] According to some embodiments the present invention for methods which make use of a synthetic or recombinant S. pneumoniae Aspartate Carbamoyltransferase catalytic subunit (ATCase) comprising the sequence as set forth in NCBI's Genbank Accession No.: NP_345741.1.

[00021] According to other embodiments, a composition according to the present invention further comprises at least one additional S. pneumoniae polypeptide or protein sequence.

[00022] Use of a polypeptide according to the invention for preparation of a composition against S. pneumoniae is also within the scope of the present invention, as well as use of an isolated polynucleotide according to the invention for production of a PTS system, mannose- specific IIAB components (PTS), ABC transporter substrate -binding protein (ABC) or Aspartate Carbamoyltransferase catalytic subunit (ATCase) polypeptides and/or fragments thereof, and/or variants and analogs thereof.

[00023] All the polypeptides disclosed in the present invention can be produced by recombinant methods and by chemical synthesis.

[00024] Another aspect of the present invention provides a fusion protein comprising at least one PTS system, mannose-specific IIAB components (PTS), ABC transporter substrate-binding protein (ABC) or Aspartate Carbamoyltransferase catalytic subunit (ATCase) polypeptides and/or fragments thereof and at least one additional polypeptide.

[00025] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF the FIGURES ^;

Figures 1 shows the protein expression and purification of an ABC protein for use in accordance with this invention. Figures 2 shows the protein expression and purification of a PTS protein for use in accordance with this invention.

Figures 3 graphically depicts the inhibition of 5. pneumoniae serotype 3 strain WU2 adhesion to A549 human cells cocultured with a ABC, PTS or ATCase protein.

Figure 4 graphically depicts adhesion of mutated bacteria, null for ABC (Figure 4A and 4B) or PTS expression (Figure 4C and 4D) Vs WT WU2 or R6 strains (Figure 4A/4C and 4B/4D, respectively).

Figure 5 graphically depicts the bacterial load in the nasopharynx 3 and 48 hours post inoculation with WT versus ABC and PTS mutants..

Figure 6 graphically depicts the bacterial load in the lungs 3 and 48 hours post inoculation with WT versus ABC and PTS mutants.

DETAILED DESCRIPTION OF THE INVENTION

[00026] The present invention provides for the use of 5. pneumoniae PTS, ABC or ATCase proteins, or combinations thereof in the prevention of the development or treatment of S. pneumoniae clinical disease.

[00027] Applicants surprisingly found that that 5. pneumoniae PTS, ABC or ATCase proteins, or combinations thereof directly interfere with S. pneumoniae adhesion to lung epithelial cells, which in some embodiments, directly affects colonization and invasion of lung tissue, or in some embodiments, directly effects cell-to-cell spread, and in some embodiments, can be used therefore to treat established infection or prevent or treat sepsis. Such effects can be mediated in the host, without the necessity for establishment of antibody-mediated responses, and indeed, the invention provides for the use of the polypeptides and/or provides methods of use of such polypeptides in the absence of supplying any adjuvant to the host.

[00028] In one embodiment, the polypeptide for use according to the present invention has a sequence as set forth in SEQ ID NO: 1-3, or a fragment thereof or shares significant homology thereto.

[00029] When referring to homology, as described herein, the indicated sequence will share at least 70%, or in some embodiments, at least 75%, or in some embodiments, at least 80%, or in some embodiments, at least 85%, or in some embodiments, at least 90%, or in some embodiments, at least 95%, or in some embodiments, at least 97%, or in some embodiments, at least 99% identity with the reference sequence. [00030] For convenience, certain terms employed in the specification, examples and claims are described herein.

[00031] "Amino acid sequence", as used herein, refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragment thereof, and to naturally occurring or synthetic molecules.

[00032] A "chimeric protein" or "fusion protein" are used interchangeably and refer to a polypeptide operatively linked to a polypeptide other than the polypeptide from which the PTS, ABC and/or ATCase polypeptide fragment was derived.

[00033] Recombinant production of polypeptides

[00034] The polypeptide fragments of the present invention can be prepared by expression in an expression vector per se or as a chimeric protein. The methods to produce a chimeric or recombinant protein comprising one or more PTS, ABC and/or ATCase polypeptides and/or fragment thereof are known to those with skill in the art. A nucleic acid sequence encoding one or more PTS, ABC and/or ATCase polypeptides and/or fragments thereof can be inserted into an expression vector for preparation of a polynucleotide construct for propagation and expression in host cells.

[00035] The term "expression vector" and "recombinant expression vector" as used herein refers to a DNA molecule, for example a plasmid or virus, containing a desired and appropriate nucleic acid sequences necessary for the expression of the recombinant polypeptides for expression in a particular host cell. As used herein "operably linked" refers to a functional linkage of at least two sequences. Operably linked includes linkage between a promoter and a second sequence, for example an nucleic acid of the present invention, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.

[00036] The regulatory regions necessary for transcription of the polypeptides can be provided by the expression vector. The precise nature of the regulatory regions needed for gene expression may vary among vectors and host cells. Generally, a promoter is required which is capable of binding RNA polymerase and promoting the transcription of an operably-associated nucleic acid sequence. Regulatory regions may include those 5' non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like. The non-coding region 3' to the coding sequence may contain transcriptional termination regulatory sequences, such as terminators and polyadenylation sites. A translation initiation codon (ATG) may also be provided. [00037] In order to clone the nucleic acid sequences into the cloning site of a vector, linkers or adapters providing the appropriate compatible restriction sites are added during synthesis of the nucleic acids. For example, a desired restriction enzyme site can be introduced into a fragment of DNA by amplification of the DNA by use of PCR with primers containing the desired restriction enzyme site.

[00038] An expression construct comprising a PTS, ABC and/or ATCase polypeptide and /or fragment thereof sequence operably associated with regulatory regions can be directly introduced into appropriate host cells for expression and production of polypeptide per se or as recombinant fusion protein. The expression vectors that may be used include but are not limited to plasmids, cosmids, phage, phagemids or modified viruses. Typically, such expression vectors comprise a functional origin of replication for propagation of the vector in an appropriate host cell, one or more restriction endonuclease sites for insertion of the desired gene sequence, and one or more selection markers.

[00039] The recombinant polynucleotide construct comprising the expression vector and a PTS, ABC and/or ATCase polypeptide and/or fragment thereof should then be transferred into a bacterial host cell where it can replicate and be expressed. This can be accomplished by methods known in the art. The expression vector is used with a compatible prokaryotic or eukaryotic host cell which may be derived from bacteria, yeast, insects, mammals and humans.

[00040] Once expressed by the host cell, the PTS, ABC and/or ATCase polypeptide and/or fragment thereof can be separated from undesired components by a number of protein purification methods. One such method uses a polyhistidine tag on the recombinant protein. A polyhistidine-tag consists in at least six histidine (His) residues added to a recombinant protein, often at the N- or C-terminus. Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins that are expressed in E. coli or other prokaryotic expression systems. The bacterial cells are harvested by centrifugation and the resulting cell pellet can be lysed by physical means or with detergents or enzymes such as lysozyme. The raw lysate contains at this stage the recombinant protein among several other proteins derived from the bacteria and are incubated with affinity media such as NTA-agarose, HisPur resin or Talon resin. These affinity media contain bound metal ions, either nickel or cobalt to which the polyhistidine-tag binds with micromolar affinity. The resin is then washed with phosphate buffer to remove proteins that do not specifically interact with the cobalt or nickel ion. The washing efficiency can be improved by the addition of 20 mM imidazole and proteins are then usually eluted with 150-300 mM imidazole. The polyhistidine tag may be subsequently removed using restriction enzymes, endoproteases or exoproteases. Kits for the purification of histidine-tagged proteins can be purchased for example from Qiagen.

[00041] Another method is through the production of inclusion bodies, which are inactive aggregates of protein that may form when a recombinant polypeptide is expressed in a prokaryote. While the cDNA may properly code for a translatable mRNA, the protein that results may not fold correctly, or the hydrophobicity of the sequence may cause the recombinant polypeptide to become insoluble. Inclusion bodies are easily purified by methods well known in the art. Various procedures for the purification of inclusion bodies are known in the art. In some embodiments the inclusion bodies are recovered from bacterial lysates by centrifugation and are washed with detergents and chelating agents to remove as much bacterial protein as possible from the aggregated recombinant protein. To obtain soluble protein, the washed inclusion bodies are dissolved in denaturing agents and the released protein is then refolded by gradual removal of the denaturing reagents by dilution or dialysis (as described for example in Molecular cloning: a laboratory manual, 3rd edition, Sambrook, J. and Russell, D. W., 2001; CSHL Press).

[00042] Formulation

[00043] The formulation can contain a variety of additives, such as excipient, stabilizers, buffers, or preservatives.

[00044] In preferred embodiment, the administration is oral.

[00045] According to one embodiment of the invention, the formulation may be applied to the lymphatic tissue of the nose in any convenient manner. However, it is preferred to apply it as a liquid stream or liquid droplets to the walls of the nasal passage. The intranasal composition can be formulated, for example, in liquid form as nose drops, spray, or suitable for inhalation, as powder, as cream, or as emulsion.

[00046] In another embodiment of the invention, administration is oral, for example, in the form of a tablet or encased in a gelatin capsule or a microcapsule.

[00047] The formulation of these modalities is general knowledge to those with skill in the art.

[00048] Liposomes provide another delivery system. Liposomes are bilayered vesicles composed of phospholipids and other sterols surrounding a typically aqueous center where products can be encapsulated. The liposome structure is highly versatile with many types range in nanometer to micrometer sizes, from about 25 nm to about 500 μπι. Liposomes have been found to be effective in delivering therapeutic agents to mucosal surfaces. The average survival time or half life of the intact liposome structure can be extended with the inclusion of certain polymers, for example polyethylene glycol, allowing for prolonged release in vivo. Liposomes may be unilamellar or multilamellar.

[00049] In some embodiments, the liposome further comprises a targeting moiety, which specifically targets a desired organ or tissue or cell type, as will be appreciated by the skilled artisan. In some embodiments, the targeting moiety may be any such appropriate moiety, including an antibody, a lectin, a peptide, or others, as known to the skilled artisan. Similarly, the liposome may further comprise a second therapeutic agent, as further described hereinbelow.

[00050] It is to be understood that any composition as herein described may be useful in the treatment of 5. pneumoniae infection. Similarly, it is to be understood that any composition as herein described may be useful in the prevention of S. pneumoniae adhesion to cells of the host such as, but not restricted to, respiratory tree underlying vasculature, in the lung mucosa or lung parenchyma. In some embodiments, the compositions as herein described may be useful in the treatment of extra-pulmonary seeding by S. pneumoniae, including seeding of draining lymph nodes.

[00051] In some applications an excipient may be included in the formulation. A preferred mode of administration is intranasal administration.

[00052] Compositions comprising different PTS, ABC and/or ATCase polypeptide and/or fragments thereof can be produced by mixing or linking a number of different PTS, ABC and/or ATCase polypeptides and/or fragments thereof according to the invention. In addition, PTS, ABC and/or ATCase polypeptides and/or fragments thereof according to the present invention may be included in a composition comprising any other S. pneumoniae protein or protein fragment, including mutated proteins such as detoxified pneumolysin, or they can be linked to or produced in conjunction with any such 5. pneumoniae protein or protein fragment.

[00053] In one embodiment the compositions of this invention comprise a polypeptide of this invention, alone or in some embodiments, in combination with a second pharmaceutically active or therapeutic agent. In one embodiment, the term "pharmaceutically active agent" refers to any medicament which satisfies the indicated purpose. In some embodiments, the term "agent" of this invention is a decongestant, antibiotic, bronchodilator, anti-inflammatory steroid, leukotriene antagonist or histamine receptor antagonist, and the like.

[00054] In some embodiments, the polypeptides of this invention comprise a fusion protein, wherein a second therapeutic agent is fused to the polypeptides of this invention, or in some embodiments, a targeting moiety is fused to a polypeptide of this invention. In some embodiments, such fusion proteins may further comprise an appropriate spacer, and an internal cleavage site, for cleavage between the polypeptide of the invention and the second therapeutic target and/or targeting moiety.

[00055] In one embodiment, decongestants are medicines used to relieve nasal congestion caused by swelling of the membranes lining the nasal passages. Decongestants relieve the swelling by reducing the blood supply to the swollen membranes, causing the membranes to shrink. Although any suitable decongestant can be used, the preferred decongestants of the present invention are pseudoephedrine, a pharmaceutically acceptable pseudoephedrine salt, and mixtures thereof, as well as a phenylephrine salt. Pseudoephedrine is a sympathomimetic amine. Any suitable pseudoephedrine salt may be used in the present invention; however, pseudoephedrine hydrochloride, (+)-pseudoephedrine sulfate, and/or phenylephrine salt such as phenylephrine hydrochloride, are typically used. Other suitable pseudoephedrine salts include sodium, hydrofluoric, sulfuric, sulfonic, tartic, fumaric, hydrobromic, glycolic, citric, maleic, phosphoric, succinic, acetic, nitric, benzoic, ascorbic, p-toluene, benzenesulfonic, naphthalenesulfonic, propionic, and the like. In addition to pseudoephedrine, other suitable decongestants include oxymetazoline, phenylpropanolamine, and other sympathomimetic drugs.

[00056] In one embodiment, examples of leukotriene antagonist agents are montelukast and zafirlukast which block the actions of cysteinyl leukotrienes at the CysLTl receptor on target cells such as bronchial smooth muscle.

[00057] In one embodiment, examples of bronchodilators are metaproterenol, isoetherine, terbutaline, albuterol and atropine sulfate.

[00058] In one embodiment, examples of histamine receptor antagonist are loratadine or desloratadine. Other antihistamines that may be utilized include HI antagonist antihistamines including: ethylenediamines, such as mepyramine (pyrilamine) and antazoline; ethanolamines, such as diphenhydramine, carbinoxamine, doxylamine, clemastine, dimenhydrinate; alkylamines, such as pheniramine, chlorphenamine (chlorpheniramine), dexchlorphenamine, brompheniramine, triprolidine; piperazines, such as hydroxyzine and meclizine; tricyclics, such as promethazine, alimemazine (trimeprazine), cyproheptadine, azatadine; acrivastine; astemizole; cetirizine, levocetirizine, fexofenadine, loratadine, desloratadine, mizolastine, and terfenadine.

[00059] In one embodiment, the medicament is an anti-infective agent. In one embodiment, the anti-infective agent is an antibiotic agent. In one embodiment, the antibiotic agent is a beta- lactam antibiotic. In one embodiment, beta-lactam antibiotics include, but are not limited to, penicillin, benzathine penicillin, benzylpenicillin, amoxicillin, procaine penicillin, dicloxacillin, amoxicillin, flucloxacillin, ampicillin, methicillin, azlocillin, carbenicillin, ticarcillin, mezlocillin, piperacillin, phenoxymethylpenicillin, co-amoxiclav, cephalosporin, cefalexin, cephalothin, cefazolin, cefaclor, cefuroxime, cefamandole, cefotetan, cefoxitin, ceftriaxone, cefotaxime, ceftazidime, cefepime, cefpirome, imipenem, meropenem, ertapenem, faropenem, monobactam, aztreonam, or carbapenem.

[00060] In one embodiment, the antibiotic is a tetracycline antibiotic. In one embodiment, tetracycline antibiotics include, but are not limited to, tetracycline, chlortetracycline, demeclocycline, doxycycline, lymecycline, minocycline, or oxytetracycline.

[00061] In one embodiment, the antibiotic is a macrolide antibiotic. In one embodiment, macrolide antibiotics include, but are not limited to, erythromycin, azithromycin, oxithromycin, dirithromycin, clarithromycin, josamycin, oleandomycin, kitasamycin, spiramycin, tylosin/tylocine, troleandomycin, carbomycin, cethromycin, or telithromycin.

[00062] In one embodiment, the antibiotic is an aminoglycoside antibiotic. In one embodiment, aminoglycoside antibiotics include, but are not limited to, gentamicin, tobramycin, faropenem, imipenem, kanamycin, neomycin, ertapenem, apramycin, paromomycin sulfate, streptomycin, or amikacin.

[00063] In one embodiment, the antibiotic is a quinolone antibiotic. In one embodiment, quinolone antibiotics include, but are not limited to, ciprofloxacin, norfloxacin, lomefloxacin, enoxacin, ofloxacin, ciprofloxacin, levofloxacin, sparfloxacin, gatifloxacin, moxifloxacin, trovafloxacin, or alatrofloxacin.

[00064] In one embodiment, the antibiotic is a cyclic peptide antibiotic. In one embodiment, cyclic peptide antibiotics include, but are not limited to, vancomycin, streptogramins, Microcin J25, Bacteriocin AS-48, RTD-1, or polymyxins.

[00065] In one embodiment, the antibiotic is a lincosamide antibiotic. In one embodiment, lincosamide antibiotics include, but are not limited to, clindamycin.

[00066] In one embodiment, the antibiotic is an oxazolidinone antibiotic. In one embodiment, oxazolidinone antibiotics include, but are not limited to, linezolid, U-100592, DA-7867, AZD2563, or U- 100766.

[00067] In one embodiment, the antibiotic is a sulfa antibiotic. In one embodiment, sulfa antibiotics include, but are not limited to, sulfisoxazole.

[00068] In one embodiment, the antibiotic is an antiseptic agent. In one embodiment, antiseptic agents include, but are not limited to, alcohols, chlorhexidine, chlorine, hexachlorophene, iodophors, chloroxylenol (PCMX), quaternary ammonium compounds, or triclosan.

[00069] In one embodiment, the medicament may be a growth factor such as epidermal growth factor (EGF), transforming growth factor-a (TGF-a), platelet derived growth factor (PDGF), fibroblast growth factors (FGFs) including acidic fibroblast growth factor (a-FGF) and basic fibroblast growth factor (β-FGF), transforming growth factor-β (TGF-β) and insulin like growth factors (IGF-1 and IGF-2), or any combination thereof.

[00070] In one embodiment, the medicament may be a local anesthetic agent. In one embodiment, local anesthetic agents include, but are not limited to benzocaine, chloroprocaine, cocaine, procaine, bupivacaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, or ropivacaine. In one embodiment, the medicament may be a general anaesthetic agent. In one embodiment, general anesthetic agents include, but are not limited to, esflurane, sevoflurane, isoflurane, halothane, enflurane, methoxyflurane, xenon, propofol, etomidate, methohexital, midazolam, diazepamor, ketamine, thiopentone/thiopental, or lidocaine/prilocaine.

[00071] In one embodiment, the medicament may be an analgesic agent. In some embodiments, analgesic agents include, but are not limited to, paracetamol or non-steroidal antiinflammatory agent. In some embodiments, analgesic agents include opiates or morphinomimetics such as morphine, pethidine, oxycodone, hydrocodone, diamorphine, tramadol, or buprenorphine. In some embodiments, a combination of two or more analgesics is desired.

[00072] In one embodiment, the medicament may be a sedative agent. In one embodiment, the sedative agent is an antidepressant agent such as mirtazapine or trazodone. In one embodiment, the sedative agent is a barbiturate such as secobarbital, pentobarbital, or amobarbital. In one embodiment, the sedative agent is a benzodiazepine such as diazepam, clonazepam, alprazolam, temazepam, chlordiazepoxide, flunitrazepam, lorazepam, or clorazepate. In one embodiment, the sedative agent is an imidazopyridines such as Zolpidem or alpidem. In one embodiment, the sedative agent is a pyrazolopyrimidine such as zaleplon. In one embodiment, the sedative agent is an antihistamine such as diphenhydramine, dimenhydrinate, or doxylamine. In one embodiment, the sedative agent is an antipsychotic agent such as ziprasidone, risperidone, quetiapine, clozapine, prochlorperazine, perphenazine, loxapine, trifluoperazine, thiothixene, haloperidol, or fluphenazine. In one embodiment, the sedative agent is an herbal sedative such as valerian plant mandrake, or kava. In some embodiments, the sedative agent is eszopiclone, ramelteon, methaqualone, ethchlorvynol, chloral hydrate, meprobamate, glutethimide, methyprylon, gamma-hydroxybutyrate, ethyl alcohol, methyl trichloride, zopiclone, or diethyl ether.

[00073] In one embodiment, the medicament is an agent for treating a wasting disease. In some embodiments, agents treating a wasting disease include, but are not limited to, corticosteroids, anabolic steroids, cannabinoids, metoclopramid, cisapride, medroxyprogesterone acetate, megestrol acetate, cyproheptadine, hydrazine sulfate, pentoxifylline, thalidomide, anticytokine antibodies, cytokine inhibitors, eicosapentaenoic acid, indomethacin, ibuprofen, melatonin, insulin, growth hormone, clenbuterol, porcine pancreas extract, IGF-1, IGF-1 analogue and secretagogue, myostatin analogue, proteasome inhibitor, testosterone, oxandrolone, enbrel, melanocortin 4 receptor agonist, or a combination thereof.

[00074] In one embodiment, the medicaments are anti-inflammatory agents. In one embodiment, the anti-inflammatory agent is a non-steroidal anti-inflammatory agent. In one embodiment, the non-steroidal anti-inflammatory agent is a cox-1 inhibitor. In one embodiment, the non-steroidal anti-inflammatory agent is a cox-2 inhibitor. In one embodiment, the nonsteroidal anti-inflammatory agent is a cox-1 and cox-2 inhibitor. In some embodiments, nonsteroidal anti-inflammatory agents include but are not limited to aspirin, salsalate, diflunisal, ibuprofen, fenoprofen, flubiprofen, fenamate, ketoprofen, nabumetone, piroxicam, naproxen, diclofenac, indomethacin, sulindac, tolmetin, etodolac, ketorolac, oxaprozin, or celecoxib. In one embodiment, the anti-inflammatory agent is a steroidal anti-inflammatory agent. In one embodiment, the steroidal anti-inflammatory agent is a corticosteroid. In some embodiments, the compositions/medicaments of this invention may further comprise an anti viral agent such as an anti influenza agent, for example, Oseltamivir (Tamiflu), Zanamivir (marketed as Relenza), which in some embodiments, is particularly useful in treating S. pneumoniae infection following prior or during co infection with another virus, for example, influenza virus.

[00075] In one embodiment, the route of administration may be parenteral, or a combination thereof. In another embodiment, the route may be intravenous, intra-arterial, transmucosal, intravascular, intraventricular, intracranial, inhalation (aerosol), nasal aspiration (spray), intranasal (drops), sublingual, oral, aerosol or suppository or a combination thereof. In one embodiment, the dosage regimen will be determined by skilled clinicians, based on factors such as exact nature of the condition being treated, the severity of the condition, the age and general physical condition of the patient, body weight, and response of the individual patient, etc. In one embodiment, the dosing regimen will comprise a series of applications of the formulationwhere a sustained response is achieved by providing for multiple exposures.

[00076] Synthetic peptides [00077] The PTS, ABC and/or ATCase polypeptides and/or fragments thereof for use in accordance with the methods of the present invention may be synthesized chemically using methods known in the art for synthesis of peptides and polypeptides. These methods generally rely on the known principles of peptide synthesis; most conveniently, the procedures can be performed according to the known principles of solid phase peptide synthesis.

[00078] As used herein "peptide" indicates a sequence of amino acids linked by peptide bonds. A polypeptide is generally a peptide of about 30 and more amino acids.

[00079] Polypeptide analogs and peptidomimetics are also included within the scope of the invention as well as salts and esters of the polypeptides of the invention are encompassed. A polypeptide analog according to the present invention may optionally comprise at least one non- natural amino acid and/or at least one blocking group at either the C terminus or N terminus. Salts of the peptides of the invention are physiologically acceptable organic and inorganic salts. The design of appropriate "analogs" may be computer assisted.

[00080] The term "polypeptidomimetic" means that a polypeptide according to the invention is modified in such a way that it includes at least one non-peptidic bond such as, for example, urea bond, carbamate bond, sulfonamide bond, hydrazine bond, or any other covalent bond. The design of appropriate "polypeptidomimetic" may be computer assisted.

[00081] Salts and esters of the peptides of the invention are encompassed within the scope of the invention. Salts of the polypeptides of the invention are physiologically acceptable organic and inorganic salts. Functional derivatives of the polypeptides of the invention covers derivatives which may be prepared from the functional groups which occur as side chains on the residues or the N- or C-terminal groups, by means known in the art, and are included in the invention as long as they remain pharmaceutically acceptable, i.e., they do not destroy the activity of the polypeptide and do not confer toxic properties on compositions containing it. These derivatives may, for example, include aliphatic esters of the carboxyl groups, amides of the carboxyl groups produced by reaction with ammonia or with primary or secondary amines, N-acyl derivatives of free amino groups of the amino acid residues formed by reaction with acyl moieties (e.g., alkanoyl or carbocyclic aroyl groups) or O-acyl derivatives of free hydroxyl group (for example that of seryl or threonyl residues) formed by reaction with acyl moieties.

[00082] The term "amino acid" refers to compounds, which have an amino group and a carboxylic acid group, preferably in a 1,2- 1,3-, or 1,4- substitution pattern on a carbon backbone. a-Amino acids are most preferred, and include the 20 natural amino acids (which are L-amino acids except for glycine) which are found in proteins, the corresponding D-amino acids, the corresponding N-methyl amino acids, side chain modified amino acids, the biosynthetically available amino acids which are not found in proteins (e.g., 4-hydroxy-proline, 5-hydroxy-lysine, citrulline, ornithine, canavanine, djenkolic acid, β-cyanolanine), and synthetically derived a-amino acids, such as amino-isobutyric acid, norleucine, norvaline, homocysteine and homoserine. β-Alanine and γ-amino butyric acid are examples of 1,3 and 1,4- amino acids, respectively, and many others are well known to the art. Statine-like isosteres (a dipeptide comprising two amino acids wherein the CONH linkage is replaced by a CHOH), hydroxyethylene isosteres (a dipeptide comprising two amino acids wherein the CONH linkage is replaced by a CHOHCH₂), reduced amide isosteres (a dipeptide comprising two amino acids wherein the CONH linkage is replaced by a CH₂NH linkage) and thioamide isosteres (a dipeptide comprising two amino acids wherein the CONH linkage is replaced by a CSNH linkage) are also useful residues for this invention.

[00083] The amino acids used in this invention are those, which are available commercially or are available by routine synthetic methods. Certain residues may require special methods for incorporation into the polypeptide, and sequential, divergent or convergent synthetic approaches to the peptide sequence are useful in this invention. Natural coded amino acids and their derivatives are represented by three-letter codes according to IUPAC conventions. When there is no indication, the L isomer was used.

[00084] Conservative substitutions of amino acids as known to those skilled in the art are within the scope of the present invention, as long as antigenicity is preserved in the substituted polypeptide. Conservative amino acid substitutions includes replacement of one amino acid with another having the same type of functional group or side chain e.g. aliphatic, aromatic, positively charged, negatively charged. These substitutions may enhance oral bioavailability, penetration into the central nervous system, targeting to specific cell populations and the like. One of skill will recognize that individual substitutions, deletions or additions to peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art.

[00085] The following six groups each contain amino acids that are conservative substitutions for one another:

1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E);

3) Asparagine (N), Glutamine (Q);

4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and

6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

[00086] In one embodiment, the polypeptides for use in accordance with the methods of this invention include any polypeptide as herein described, any polypeptide which is homologous thereto, or in some embodiments, any polypeptide which specifically interacts with a polypeptide as herein described, which inhibits S. pneumoniae adhesion to and/or spread and penetration to the host or of host cells.

[00087] In some embodiments, a polypeptide for use in accordance with the methods of this invention comprises an 5. pneumoniae or fragment thereof, which is involved in bacterial adhesion and or invasion of a host cell, which in some embodiments is accomplished via interaction of a host cell protein or fragment, representing in some embodiments, a cognate binding pair, necessary for adhesion to and/or invasion of the host cell. In some embodiments, a polypeptide for use in accordance with the methods of this invention comprises a host cell protein or a fragment thereof, which interacts with S. pneumoniae, which is involved in bacterial adhesion and or invasion of the host cell. In some embodiments, a polypeptide for use in accordance with the methods of this invention interferes with the interaction, or in some embodiments, a polypeptide for use in accordance with a method of this invention competes for binding to either member, or in some embodiments, both members of the cognate binding pair.

[00088] In some embodiments, this invention surprisingly has shown that S. pneumoniae adhesion specifically to epithelial cells of the respiratory system involves the PTS, ABC and/or ATCase polypeptide and/or fragment thereof and that inhibition of this adhesion may be mediated by the isolated polypeptides as described herein, including polypeptides corresponding to the PTS, ABC and/or ATCase polypeptides specifically described, or fragments thereof, or in some embodiments, polypeptides homologous thereto. Such inhibition of adhesion may be particularly useful in treating sepsis mediated by 5. pneumoniae. Moreover, the inhibition of adhesion by the polypeptides of this invention, in particular polypeptides corresponding to the PTS, ABC and/or ATCase polypeptides or homologues thereof, or fragments thereof, is not species specific. In some embodiments, this invention unexpectedly provides for the treatment of infection, for example, and in some embodiments, treating latter stages of infection, or in some embodiments, early stages of infection, or in some embodiments, treating sepsis, by administering a PTS, ABC and/or ATCase protein, or a homologue thereof, or a fragment thereof, derived from a first species of 5. pneumoniae, whereas the subject may be infected with a different species of S. pneumonia.

[00089] In some embodiments of this invention, inhibition of 5. pneumoniae adhesion specifically to epithelial cells of the respiratory system may be mediated by any isolated polypeptide which is described herein, or fragments or homologues thereof.

[00090] In one embodiment, polypeptides for use in accordance with the methods of the present invention are administered in combination. In one embodiment, treatments are administered to patients. In some embodiments, the PTS, ABC and/or ATCase polypeptide and/or fragment thereof and compositions comprising the same and vectors or polynucleotides encoding the same are administered to a subject infected with S. pneumoniae, wherein the subject has only recently become symptomatic, thereby being a treatment of early stages of infection in the subject. In some embodiments, the PTS, ABC and/or ATCase polypeptide and/or fragment thereof and compositions comprising the same are administered to a subject exhibiting upper or lower respiratory clinical disease symptoms or early stage S. pneumoniae clinical symptoms, which in some embodiments, is distinguished from nasopharyngeal carriage, which is a form of asymptomatic infection. In some embodiments, the peptides, vectors, polynucleotides and compositions as herein described are administered during latter stages of infection, where fulminant pneumonia is present. In some embodiments, the peptides, vectors, polynucleotides and compositions as herein described are administered during latter stages of infection, when sepsis has occurred. The peptides, vectors, polynucleotides and compositions as herein described are administered during latter stages of infection, when multiple foci within a lung lobe are discerned, or in some embodiments, multiple lobes of the lung are affected. It is to be understood that the therapeutic compositions, proteins and peptides as herein described are administered at any point during infection with 5. pneumoniae and are to be considered as part of this invention.

[00091] In some embodiments, administration of the compounds of this invention is intended to reduce the severity of a pathologic condition. By the term "reduce the severity of the pathologic condition", it is to be understood that any reduction via the methods, compounds and compositions disclosed herein, is to be considered encompassed by the invention. Reduction in severity may, in one embodiment comprise enhancement of survival, or in another embodiment, halting disease progression, or in another embodiment, delay in disease progression or in another embodiment, amelioration of symptoms.

[00092] In some embodiments, administration of the compounds of this invention is intended to treat sepsis associated with S. pneumoniae infection. In one embodiment, treatments of this invention include the administration of a polypeptide, vector, nucleic acid, composition as herein described, administered to patients, whereby administration reduces the incidence, severity, or symptomatology associated with sepsis. In one embodiment, treatment of sepsis or latter stages of infection in a subject may be accomplished by the administration of any polypeptide of this invention, as herein described. In some embodiments, treatment of sepsis or latter stages of infection in a subject may be accomplished by the administration of a PTS, ABC and/or ATCase polypeptide and/or fragment thereof as herein described.

[00093] In some embodiments, the compositions of this invention will consist essentially of a polypeptide as herein described. In some embodiments, the term "consisting essentially of refers to a composition whose only active ingredient of a particular class of agents, is the indicated active ingredient, however, other compounds may be included which are involved directly in the therapeutic effect of the indicated active ingredient. In some embodiments, the term "consisting essentially of refers to a composition whose only active ingredient of targeting a particular mechanism, or acting via a particular pathway, is the indicated active ingredient, however, other compounds may be included which are involved directly in the therapeutic effect of the indicated active ingredient, which for example have a mechanism of action related to but not directly to that of the indicated agent. In some embodiments, the term "consisting essentially of refers to a composition whose only active ingredient is the indicated active ingredient, however, other compounds may be included which are for stabilizing, preserving, etc. the formulation, but are not involved directly in the therapeutic effect of the indicated active ingredient. In some embodiments, the term "consisting essentially of may refer to components which facilitate the release of the active ingredient. In some embodiments, the term "consisting" refers to a composition, which contains the active ingredient and a pharmaceutically acceptable carrier or excipient.

[00094] In one embodiment, "preventing, or treating" refers to any one or more of the following: delaying the onset of symptoms, reducing the severity of symptoms, reducing the severity of an acute episode, reducing the number of symptoms, reducing the incidence of disease-related symptoms, reducing the latency of symptoms, ameliorating symptoms, reducing secondary symptoms, reducing secondary infections, prolonging patient survival, preventing relapse to a disease, decreasing the number or frequency of relapse episodes, increasing latency between symptomatic episodes, increasing time to sustained progression, expediting remission, inducing remission, augmenting remission, speeding recovery, or increasing efficacy of or decreasing resistance to alternative therapeutics. In one embodiment, "treating" refers to therapeutic treatment, wherein the object is to lessen the targeted pathologic condition or disorder as described hereinabove. [00095] In another embodiment, "symptoms" may be any manifestation of a disease or pathological condition as described hereinabove.

[00096] In one embodiment, the subject for treatment is a mammal. In another embodiment the subject is human. In another embodiment, the subject is defined as elderly human. In one embodiment the definition of "elderly human" is a person over 65 years of age. In one embodiment, the subject for treatment is a child, whereby the definition of a "child" is a human under 4 years of age.

[00097] In one embodiment, the compositions described herein are aimed at treating sepsis caused by S. pneumonia infection in an individual. "Sepsis" is defined by the presence of bacteria (bacteremia) or other infectious organisms or their toxins in the blood (septicemia) or in other tissue of the body. Sepsis may be associated with clinical symptoms of systemic illness, such as fever, chills, malaise, low blood pressure, and mental status changes.

[00098] It is to be understood that any method of this invention may make use of the polypeptides as described herein, including fusion polypeptides comprising the PTS, ABC and/or ATCase polypeptides fused to a targeting moiety and/or a second therapeutic protein. It is to be understood that any method of this invention may make use of any composition as described herein, including compositions, liposomes, etc., comprising a PTS, ABC and/or ATCase polypeptide as described herein, and any form thereof, or a vector or nucleic acid comprising the same, for the treatment of S. pneumoniae infection, for the treatment of sepsis caused by S. pneumoniae infection, or for the prevention of S. pneumoniae adhesion to respiratory cells.

[00099] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.

EXAMPLES

Example 1. Inhibition ofS. pneumoniae adhesion by PTS and ABC protein

[000100] ABC and PTS cloning and expression is shown in Figure 1 and Figure 2, respectively. The ability of recombinant PTS, ABC and ATCase proteins to inhibit bacterial adhesion to host cells was studied in vitro using A549 Human lung adenocarcinoma cells (Figures 3A and 3B, respectively). Null mutant bacteria were created. S. pneumoniae (serotype 3 strain WU2 and serotype 2 strain R6 were treated with competence stimulating peptide and transformed with a gene that contained the upstream and down stream sequences for these genes and an antibiotic resistance. It is assumed that under these conditions reciprocal homologous recombination of the PTS and ABC locus will occur substituting them with antibiotic resistance genes. The mutated bacteria were selected in the presence of the antibiotic. A549 cells were incubated with the WT and null mutants serotype 3 strain WU2 cells, and reduced adhesion of the bacteria, in which the gene for ABC or PTS was substituted with an antibiotic resistance gene, is demonstrated (Figure 4). In addition, mice were inoculated with a sublethal challenge of either the wild type (WT) WU2 or R6 strains and compared in terms of bacterial load with that of animals administered null mutants for the ABC protein in a WU2 or R6 background in the nasopharynx (Figures Figure 5) and the lungs (Figure 6) Sublethal intranasal inoculation with the mutated bacteria demonstrated a significantly reduced bacterial load in the nasopharynx and lungs. The virulence of PTS-null bacterium was significantly reduced in comparison to that of the parental bacterium following a lethal intranasal challenge Figure 7).

Example 2. Inhibition of S. pneumoniae adhesion by ATCase protein

[000101] ATCase cloning and expression is shown in Figure 8. The ability of recombinant ATCase proteins to inhibit bacterial adhesion to host cells was studied in vitro using A549 Human lung adenocarcinoma cells, as well. A549 type II epithelial lung carcinoma cells were incubated in the presence of ATCase, and cultured with several different strains of 5. pneumoniae. Following removal of excess bacteria adherent cells were trypsinized and plated onto blood agar plate for quantifying colony number. ATCase was found to significantly inhibit the adhesion of 3 pairs of encapsulated and unencapsulated pneumococcal strains to A549 cells (Figure 9).

[000102] While the present invention has been particularly described, persons skilled in the art will appreciate that many variations and modifications can be made. Therefore, the invention is not to be construed as restricted to the particularly described embodiments, and the scope and concept of the invention will be more readily understood by reference to the claims, which follow.

Claims

[000103] WHAT IS CLAIMED IS:

1. A method of inhibiting adhesion of S. pneumoniae to cells of the respiratory tract, said method comprising contacting cells of a respiratory tract with a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (S. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate -binding protein (ABC) of SEQ ID NO: 2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, wherein said synthetic or recombinant polypeptide prevents adhesion of S. pneumoniae to cells of said respiratory tract.

2. The method of claim 1 wherein said synthetic or recombinant polypeptide shares less than 30% identity or homology with the human PTS, ABC or ATCase protein sequence

3. The method of claim 1 wherein said synthetic or recombinant polypeptide shares less than 10% identity or homology with the human PTS, ABC or ATCase protein sequence.

4. The method of claim 1, further comprising the step of contacting cells of a respiratory tract with a composition comprising said synthetic or recombinant polypeptide.

5. The method of claim 1, wherein said composition comprises two or more synthetic or recombinant polypeptides.

6. Use of a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (5. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate -binding protein (ABC) of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, in the preparation of a medicament for use in preventing adhesion of S. pneumoniae to cells of a respiratory tract in a subject.

7. The use of claim 6, wherein said synthetic or recombinant polypeptide shares less than 30% identity or homology with the human PTS, ABC or ATCase protein sequence.

8. The use of claim 6, wherein said synthetic or recombinant polypeptide shares less than 10% identity or homology with the human PTS, ABC or ATCase protein sequence.

9. The use of claim 6, wherein said wherein said composition comprises two or more synthetic or recombinant polypeptides.

10. A method of treating a subject infected with S. pneumoniae, said method comprising administering to said subject a synthetic or recombinant polypeptide a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (5. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate-binding protein (ABC) of SEQ ID NO: 2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, wherein said synthetic or recombinant polypeptide prevents adhesion of 5. pneumoniae to cells of said respiratory tract.

11. The method of claim 10 wherein said synthetic or recombinant polypeptide shares less than 30% identity or homology with the human PTS, ABC or ATCase protein sequence.

12. The method of claim 10 wherein said synthetic or recombinant polypeptide shares less than 10% identity or homology with the human PTS, ABC or ATCase protein sequence.

13. The method of claim 10, further comprising the step of administering an isolated polynucleotide sequence encoding said recombinant polypeptide to said subject, wherein said polypeptide is capable of being expressed in said subject.

14. The method of claim 10, further comprising the step of administering a composition comprising said synthetic or recombinant polypeptide to said subject.

15. The method of claim 10, wherein said composition comprises two or more synthetic or recombinant polypeptides.

16. The method of claim 10, wherein said subject is afflicted with sepsis.

17. Use of a synthetic or recombinant polypeptide derived from the sequence of Streptococcus pneumonia (S. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate -binding protein (ABC) of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, in the preparation of a medicament for use in treating a subject infected with S. pneumoniae.

18. The use of claim 17, wherein said synthetic or recombinant polypeptide shares less than 30% identity or homology with the human PTS, ABC or ATCase protein sequence.

19. The use of claim 17, wherein said synthetic or recombinant polypeptide shares less than 10% identity or homology with the human PTS, ABC or ATCase protein sequence.

20. The use of claim 17, wherein said wherein said composition comprises two or more synthetic or recombinant polypeptides.

21. The use of an isolated polynucleotide sequence encoding a polypeptide derived from the sequence of Streptococcus pneumonia (S. pneumoniae) PTS system, mannose-specific IIAB components (PTS) of SEQ ID NO:l, ABC transporter substrate -binding protein (ABC) of SEQ ID NO:2 or Aspartate Carbamoyltransferase catalytic subunit (ATCase) of SEQ ID NO: 3, or variants and analogs thereof, and combinations thereof, in the preparation of a medicament for use in treating a subject infected with 5. pneumoniae.