WO2011059824A2 - Méthodes et matériels pour des régimes thérapeutiques contre l'hépatite c optimisés - Google Patents

Méthodes et matériels pour des régimes thérapeutiques contre l'hépatite c optimisés Download PDF

Info

Publication number
WO2011059824A2
WO2011059824A2 PCT/US2010/054755 US2010054755W WO2011059824A2 WO 2011059824 A2 WO2011059824 A2 WO 2011059824A2 US 2010054755 W US2010054755 W US 2010054755W WO 2011059824 A2 WO2011059824 A2 WO 2011059824A2
Authority
WO
WIPO (PCT)
Prior art keywords
interferon
patient
exogenous
serum
concentrations
Prior art date
Application number
PCT/US2010/054755
Other languages
English (en)
Other versions
WO2011059824A3 (fr
Inventor
William P. Van Antwerp
Robert C. Hamlen
Eric A. Grovender
Original Assignee
Medtronic, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medtronic, Inc. filed Critical Medtronic, Inc.
Publication of WO2011059824A2 publication Critical patent/WO2011059824A2/fr
Publication of WO2011059824A3 publication Critical patent/WO2011059824A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/21—Interferons [IFN]
    • A61K38/212—IFN-alpha
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
    • G16B25/10—Gene or protein expression profiling; Expression-ratio estimation or normalisation
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B99/00—Subject matter not provided for in other groups of this subclass
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
    • G16H20/00—ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance
    • G16H20/10—ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to drugs or medications, e.g. for ensuring correct administration to patients
    • G16H20/17—ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to drugs or medications, e.g. for ensuring correct administration to patients delivered via infusion or injection

Definitions

  • This invention relates to methods and systems used in the treatment of Hepatitis C virus infections. More particularly, it is related to methods and systems for designing patient-specific Hepatitis C drug delivery profiles.
  • Hepatitis C virus the most deadly type of hepatitis virus, is characterized by liver inflammation and may lead to chronic liver diseases, such as liver cirrhosis and cancer.
  • chronic liver diseases account for about 25,000 deaths annually making it the tenth leading cause of death among adults in the United States. About 40% of these deaths are related to Hepatitis C.
  • the ultimate goal of any antiviral therapy is complete eradication of the virus from the patient. Since the early days of the HIV/ AIDS therapy development, it has been clear that the pharmacokinetics of drugs is critical to achieving this goal (see, e.g. Perelson et al., Science 1996;271 (5255):1582-6). This is particularly true where viral replication rates are high, as is the case with HCV infection.
  • the history of interferon- based therapy for HCV reflects efforts to improve the pharmacokinetics of interferon (IFN) delivery while maintaining tolerability of the therapy.
  • the first interferon a-based therapy regimens consisted of subcutaneous injections 3 times weekly of fully biopotent interferon.
  • the current standard of care for chronic HCV infection is a combined medication regimen consisting of once-weekly subcutaneous injections of a pegylated interferon (e.g. PEGINTRON® or PEGASYS®) plus daily oral ribavirin.
  • Pegylated interferons were developed to improve pharmacokinetics, reduce immunogenicity, and potentially improve compliance by allowing for less frequent injections.
  • Pegylation was initially envisioned to decrease clearance, resulting in a longer plasma half-life that would, in turn, increase exposure of the HCV virus to the drug.
  • pegylation also decreases both biological potency and volume of distribution of the interferons.
  • HCV is known to be present and to replicate in a variety of non-hepatic as well as hepatic tissues. Therefore, increased volume of distribution of interferons is believed to be important for sustained viral clearance.
  • Hepatitis C virus is a positively stranded RNA virus that exists in at least six genetically distinct genotypes. HCV genotype 1 infection is the most difficult viral genotype to treat. Even with current standard-of-care pegylated interferon a-based therapies, efficacy rates for treatment of this genotype remain between 40% and 45% (as measured by SVR) in controlled clinical trials (see, e.g., Manns et al., Lancet 2001;358(9286):958-65).
  • current interferon therapies for treatment of HCV appear limited by one or more of the following: 1) fluctuating blood levels of drug, which preclude continuous drug pressure on the virus; 2) limited biological potency; 3) limited systemic distribution of the drug; and/or 4) short half-lives relative to once- weekly dosing regimens (see, e.g., Caliceti et al., Digestive and Liver Disease 2004;36 (Supplement 3):S334).
  • interferon therapies carry a risk of side effects, including neutropenia, thrombocytopenia, serious depression, and systemic flu-like symptoms. Interferon therapies can also exacerbate or induce fatigue in patients with chronic HCV infection and compromise quality of life. Clinical evidence suggests that the incidence and/or severity of certain AEs (adverse events) associated with interferon therapies correlate with peak blood levels or with rapidly changing blood levels of interferon (see, e.g., Arimura et al., J Neurovirol 2007;13(4):364-72, Bonnem et al., J Biol Response Mod 1984;3(6):580-98 and Budd et al., Cancer Chemother Pharmacol 1984;12(l):39-42).
  • nonpegylated, fully biopotent interferon- ⁇ e.g. INTRON A®
  • an external pump infusion system e.g. the Medtronic MiniMed Paradigm® Insulin Infusion System
  • near-constant blood levels combined with the maximal levels of penetration of the drug into non-hepatic and hepatic tissues achieved by nonpegylated interferons can improve efficacy by exposing the HCV to continuous, physiologically effective interferon- ⁇ levels in as many tissues as feasible.
  • relatively stable blood interferon- ⁇ levels appear to allow patients to tolerate relatively high doses of interferon that can provide improved therapeutic efficacy (SVR rates).
  • SVR rates therapeutic efficacy
  • results from pharmacokinetic analyses on patients in a clinical trial for HCV infected individuals demonstrate that it is now possible to predict a concentration of exogenous interferon- ⁇ in the serum of a patient that will result from administering the interferon- ⁇ to the patient via a continuous administration regimen.
  • Embodiments of the invention disclosed herein address important needs in this technology and, for example, allow medical personnel to administer optimized interferon- ⁇ dosing regimens, including those designed to address the unique parameters of an individual patient's physiology.
  • One embodiment of the invention is a method of predicting a concentration of exogenous interferon-a in serum of a patient that will result from administering exogenous interferon- ⁇ to the patient via a continuous administration regimen.
  • the method comprises administering exogenous interferon- ⁇ to the patient; observing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient so as to obtain information on how concentrations of exogenous interferon- ⁇ present in the serum change over a period of time; using information on how concentrations of exogenous interferon- ⁇ present in the serum change over the period of time to estimate a rate of exogenous interferon-a clearance in the patient; and then using the estimate of the rate of exogenous interferon-a clearance in the patient to predict a concentration of exogenous interferon- ⁇ in the serum of the patient that will result from administering exogenous interferon- ⁇ to the patient via the continuous administration regimen.
  • the exogenous interferon- ⁇ is first administered to the patient in a bolus comprising from 1 MIU to 100 MIU of interferon- ⁇ (e.g. 12 MIU as shown in the Example below).
  • the exogenous interferon-a used in an embodiment of the invention is not conjugated to a polyol.
  • the exogenous interferon- ⁇ used in an embodiment of the invention is conjugated to a polyol.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are sampled for a period of time comprising at least 24 or 36 or 48 hours.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are sampled for a period of time comprising not more than 24 or 36 or 48 hours.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are observed by obtaining at least 2, 3, 4, 5 or 6 different samples from the patient over the period of time (e.g. samples taken from serum, plasma or whole blood).
  • the concentrations of exogenous interferon- ⁇ in the serum of a patient that result from administering exogenous interferon-a to the patient via a continuous administration regimen are estimated by employing a compartmental pharmacokinetic model for subcutaneous interferon-a administration.
  • this method further comprises the use of a correction factor which, without being bound by a specific scientific theory or principle, may address, for example, model under prediction of serum interferon- ⁇ concentrations that may result from the continuous administration of interferon- ⁇ .
  • the compartmental pharmacokinetic model for subcutaneous interferon- ⁇ administration includes analyses using the following equations:
  • D is the total interferon- ⁇ content at the injection site in IU; C is the interferon- ⁇ concentration in serum in IU/mL; V d is the apparent volume of distribution of interferon- ⁇ in mL; Q is the subcutaneous infusion rate of interferon- ⁇ in IU/hour; an CL is the clearance in mL/hr; and k a is the rate constant for interferon- ⁇ absorption per hour.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are sampled at at least one time point comprising 0, 2, 4, 8, 12, 16 or 24 hours.
  • the changing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are analyzed by a methodology comprising an area- under-the-curve measurement (e.g. one comprising a compartmental, or alternatively a non-compartmental ( CA) model analyses).
  • a methodology comprising an area- under-the-curve measurement (e.g. one comprising a compartmental, or alternatively a non-compartmental ( CA) model analyses).
  • Embodiments of the invention can further use the predictions on the concentrations of exogenous interferon- ⁇ in the serum of a patient that will result from administering exogenous interferon-a to the patient via the continuous administration regimen to design (and optionally administer) a patient-specific continuous administration regimen for the patient, for example one that is sufficient to maintain circulating levels of the interferon- ⁇ in the patient above a mean steady state concentration of at least 100, 200, 300, 400, 500, 600 or 700 pg/mL.
  • Embodiments of the invention can also include the further steps of observing at least one patient-specific factor such as a patient's prior medical treatment history, a presence or degree of a side effect that results from administering exogenous interferon- ⁇ to the patient, or a polynucleotide sequence of the patient, wherein the polynucleotide sequence comprises a single nucleotide polymorphism (SNP) designated rsl2979860, rsl2980275, rs8099917, rsl2972991, rs8109886, rs4803223, rs8103142, rs28416813, rs4803219, rs4803217, rs581930, rs8105790, rsl 1881222, rs7248668 or rsl2980602.
  • Embodiments of the invention can also include the further step of observing a genotype or quasispecies of a hepatitis
  • Another embodiment of the invention is a method of administering interferon-a to a patient suffering from a Hepatitis C infection, the method comprising administering a bolus of exogenous interferon- ⁇ to the patient; observing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient so as to obtain information on how concentrations of exogenous interferon- ⁇ present in the serum change over a period of time; using information on how concentrations of exogenous interferon- ⁇ present in the serum change over the period of time to estimate a rate of exogenous interferon-a clearance in the patient; and using the estimate of the rate of exogenous interferon-a clearance in the patient to predict concentrations of exogenous interferon- ⁇ in the serum of the patient that will result from administering exogenous interferon- ⁇ to the patient via the continuous administration regimen; using the predicted concentrations of exogenous interferon- ⁇ in the serum of the patient that
  • the controller is programmed so that the continuous infusion pump administers interferon- ⁇ in a manner that modulates interferon- ⁇ concentrations in the patient so that the patient is administered different interferon dosing regimens during different phases of hepatitis C viral load decline.
  • the controller is programmed so that the continuous infusion pump administers interferon- ⁇ in a manner that modulates interferon- ⁇ concentrations in the patient so as to reduce adverse side effects observed during the administration of interferon-a.
  • the exogenous interferon- ⁇ in the bolus is not conjugated to a polyol.
  • the bolus of exogenous interferon- ⁇ administered to the patient comprises from 1 MIU to 100 MIU of interferon- ⁇ .
  • the concentrations of exogenous interferon-a present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient are sampled for a period of time comprising at least 24 or 36 or 48 hours.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering the bolus of exogenous interferon-a to the patient are observed by obtaining at least 2, 3, 4, 5 or 6 different samples from the patient over the period of time (e.g. samples taken from serum, plasma or whole blood).
  • the concentrations of exogenous interferon-a in the serum of a patient that result from administering the bolus of exogenous interferon- ⁇ to the patient via a continuous administration regimen are estimated by employing a compartmental pharmacokinetic model for subcutaneous interferon-a administration, wherein the estimate obtained from the compartmental pharmacokinetic model for subcutaneous interferon- ⁇ administration further comprises a correction factor to address model under prediction of serum interferon- ⁇ concentrations that will result from the continuous administration of interferon-a.
  • the controller is programmed so that the continuous infusion pump administers interferon- ⁇ at a dose and for a period of time selected to maintain a plasma interferon- ⁇ concentration above a set-point for the period of time.
  • the controller is programmed so that the patient-specific therapeutic regimen is sufficient to maintain circulating levels of the interferon- ⁇ in the patient above a mean steady state concentration of at least 100, 200, 300, 400, 500, 600 or 700 pg/mL.
  • the patient-specific therapeutic regimen further comprises administering a nucleoside analog that interferes with Hepatitis C viral replication.
  • a related embodiment of the invention is a system for administering interferon to a patient having a hepatitis C infection, the system comprising a continuous infusion pump having a medication reservoir comprising interferon- ⁇ ; a processor operably connected to the continuous infusion pump and comprising a set of instructions that causes the continuous infusion pump to administer the interferon- ⁇ to the patient according to a patient-specific therapeutic regimen made by administering a bolus of exogenous interferon- ⁇ to the patient; observing concentrations of exogenous interferon- a present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient so as to obtain information on how concentrations of exogenous interferon- ⁇ present in the serum change over a period of time; using information on how concentrations of exogenous interferon- ⁇ present in the serum change over the period of time to estimate a rate of exogenous interferon- ⁇ clearance in the patient; using the estimate of the rate of exogenous interferon- ⁇
  • the continuous infusion pump has dimensions smaller than 15 x 15 centimeters and is operably coupled to an interface that facilitates the patient's movements while using the continuous infusion pump, wherein the interface comprises a clip, a strap, a clamp or tape.
  • Yet another embodiment of the invention is a program code storage device comprising a computer-readable medium; a computer-readable program code, stored on the computer-readable medium, the computer-readable program code having instructions, which when executed cause a controller operably coupled to a medication infusion pump to administer the interferon-a to a patient infected with the hepatitis C virus according to a patient-specific therapeutic regimen made by administering a bolus of exogenous interferon-a to the patient; observing concentrations of exogenous interferon-a present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient so as to obtain information on how concentrations of exogenous interferon- ⁇ present in the serum change over a period of time; using information on how concentrations of exogenous interferon- ⁇ present in the serum change over the period of time to estimate a rate of exogenous interferon-a clearance in the patient; using the estimate of the rate of exogenous interferon-a clearance in the patient to
  • FIG. 1 provides a diagram of PK/PD substudy inpatient facility timelines which shows that several different time bases are used for describing the PK/PD substudy.
  • Study Time 3 Days is defined as 3 days after initiation of continuous INTRON A treatment. This corresponds to Study Day 3 in the COPE-HCV study protocol.
  • Study Day 0 is defined as the time period, up to 36 hours, prior to administration of the first dose of randomized treatment (PEGINTRON or continuous INTRON A).
  • Day 0 includes admission to the inpatient facility, urine pregnancy test, Baseline blood draws, administration of the 12 MIU bolus INTRON A dose, and 24-hour post-dose monitoring.
  • Study Day 1 begins when the first dose of randomized treatment is given (PEGINTRON or continuous INTRON A infusion).
  • Inpatient Time is the measurement of time relative to the time at which the bolus of INTRON A bolus was administered (Study Time ⁇ -24 hours).
  • In-Clinic Time is equivalent to Inpatient Time.
  • Nominal Inpatient Time is defined as the scheduled collection time, per the COPE-HCV Study protocol.
  • FIG. 2 shows a graph of anticipated Serum IFN Levels Following Dosing with SC Bolus INTRON A and SC Continuous INTRON A Infusion. Diamond marks indicate blood draw timepoints.
  • FIG. 3 shows a graph that provides an estimation of the elimination rate constant for Intron A using the PhoenixTM WinNonlin® PK/PD Software, Version 6.x (Pharsight®, Cary, NC), (non-compartmental analysis) operational object.
  • Concentration vs. time data is the average of 12 healthy male volunteers who received a 5xl0 6 IU/m 2 subcutaneous bolus of INTRON A (see, e.g., Radwanski et al., J Clin Pharmacol 1987; 27(5):432-5).
  • FIG. 4 shows a single-compartment pharmacokinetic model for subcutaneous injection. Complete bioavailability and first order rates of absorption and elimination are assumed. Previous studies reporting the PK profiles of un-pegylated IFN-alphas, such as INTRON A, via subcutaneous administration indicate that the pharmacokinetics are suitably modeled using a traditional 1 -compartment model with a depot at the administration site (see, e.g., Glue et al., Clin Pharmacol Ther 2000b;68(5):556-67 and Radwanski et al., J Clin Pharmacol 1987;27(5):432-5).
  • FIG. 5 shows a graph that provides an example of a compartmental PK analysis performed by the PhoenixTM Model object.
  • concentration vs. time data is the same as presented in Figure 3 and is the average of 12 healthy male volunteers who received a 5x10 6 IU/m 2 subcutaneous bolus of INTRON A (see, e.g., Radwanski et al., J Clin Pharmacol 1987;27(5):432-5). Only the nominal timepoints in the COPE-HCV Study are included.
  • FIG. 6 provides a graph showing how AUC calculations for the first two weeks of continuous INTRON A infusion can be performed. Anticipated serum IFN levels are the same as those presented in Figure 2.
  • FIG. 7 provides a graph of an IFN Concentration time course predicted by the compartmental model and PK parameters.
  • the PK parameters were estimated using the Compartmental Model (Equations 3-4) and the IFN concentration data for the 24-hour period following the INTRON A bolus. This observed data is the same as presented in Figures 3 and 5 (see, e.g., Radwanski et al., J Clin Pharmacol 1987;27(5):432-5).
  • FIG. 8 provides a graph of a comparison of IFN concentrations predicted by the compartmental model for continuous INTRON A with contrived "observed” data.
  • the compartmental model PK parameters were estimated using non-linear regression and the concentration data for the 24-hour period following the INTRON A bolus. This data is the same as presented in Figures 3 and 5 (see, e.g., Radwanski et al., J Clin Pharmacol 1987;27(5):432-5).
  • the magnitude, sign and/ or distribution of the residual errors between the "observed” vs. model-predicted IFN concentrations are not indented to be predictive of actual study outcomes.
  • FIG. 9 provides a comparison of IFN concentrations predicted by the compartmental model for continuous INTRON A with contrived "observed” data.
  • the compartmental model PK parameters were estimated using non-linear regression and the concentration data for the 24-hour period following the INTRON A bolus. This data is the same as presented in Figure 5.
  • the magnitude, sign and/ or distribution of the residual errors between the "observed” vs. model-predicted IFN concentrations are not intended to necessarily be predictive of actual study outcomes.
  • FIG. lOA-lOC provide a compartmental PK analysis of individual subject response to a 12 MIU subcutaneous bolus of INTRON A.
  • the pre- dose baseline concentration was below the reported range of the assay (5 IU/mL); therefore, a substitution value of 0 IU/ mL was used.
  • FIG. 11A-11C provide a comparison of IFN concentrations predicted by the compartmental model for continuous INTRON A with actual observed IFN concentrations.
  • INTRON A dosing arm assignments for Subjects A, B and C were 80, 120 and 160 klU/kg/day, respectively.
  • Individual PK parameters were estimated through non-linear regression of the compartmental model (Equations 3-4) and the observed response to the 12 MIU bolus of INTRON (data points only). The model curve was calculated using the compartment model, individual PK parameters estimated from the bolus response and individual dosing information.
  • FIG. 12A presents an exemplary generalized computer system 202 that can be used to implement elements of the present invention.
  • FIG. 12B presents one embodiment of a specific illustrative computer system embodiment that can be used with embodiments of the invention in the treatment of Hepatitis C virus infection. DETAILED DESCRIPTION OF THE INVENTION
  • pharmacokinetics is used according to its art accepted meaning and refers to the study of the action of drugs in the body, for example the effect and duration of drug action, the rate at they are absorbed, distributed, metabolized, and eliminated by the body etc. (e.g. the study of a concentration of interferon-a in the serum of the patient following its administration via a specific dose or therapeutic regimen).
  • pharmacodynamics is used according to its art accepted meaning and refers to the study of the biochemical and physiological effects of drugs on the body or on microorganisms or parasites within or on the body, the mechanisms of drug action and the relationship between drug concentration and effect etc. (e.g.
  • pharmacodynamic models and “pharmacodynamic parameters” as used herein include interferon and/or viral kinetic models and interferon and/or viral kinetic parameters (e.g. in vivo concentration).
  • Various models to estimate parameters associates with Hepatitis C infection have been developed, and may be adapted for use with methods described herein.
  • viral kinetic models include, but are not limited to, models disclosed in the following references: International Application Number PCT/US2009/038617, the contents of which are incorporated by reference; Alan S. Perelson, et al. (2005).
  • continuous administration e.g. as in a “continuous administration regimen”
  • continuous infusion e.g. as in a “continuous infusion regimen”
  • continuous infusion regimen exclude administration or infusion of an agent via a bolus, and mean delivery of an agent such as interferon-a in a manner that, for example, avoids significant fluctuations in the in vivo concentrations of the agent throughout the course of a treatment period (e.g. as occur when administering an agent such as interferon-a via one or more boluses spaced over a periods of time such as 12 hours, 1 or 2 days).
  • interferon- ⁇ typically with a continuous infusion pump device
  • continuous interferon- ⁇ may be administered according to art accepted methods, for example via subcutaneous or intravenous injection at appropriate intervals, e.g. at least hourly, for an appropriate period of time in an amount which will facilitate or promote in vivo inactivation of hepatitis C virus.
  • continuous infusion system refers to a device for continuously administering a fluid to a patient parenterally for an extended period of time or for intermittently administering a fluid to a patient parenterally over an extended period of time without having to establish a new site of administration each time the fluid is administered.
  • the fluid typically contains a therapeutic agent or agents.
  • the device typically has one or more reservoir(s) for storing the fluid(s) before it is infused, a pump, a catheter, cannula, or other tubing for connecting the reservoir to the administration site via the pump, and control elements to regulate the pump.
  • the device may be constructed for implantation, usually subcutaneously. In such a case, the reservoir will usually be adapted for percutaneous refilling.
  • An exemplary "continuous infusion system” is the Medtronic MiniMed Paradigm® Insulin Infusion System.
  • administer means to introduce a therapeutic agent into the body of a patient in need thereof to treat a disease or condition.
  • treating and/or “treatment” refers to the management and care of a patient having a pathology such as a viral infection or other condition for which administration of one or more therapeutic compounds is indicated for the purpose of combating or alleviating symptoms and complications of those conditions. Treating includes administering one or more formulations of the present invention to prevent the onset of the symptoms or complications, alleviating the symptoms or complications, or eliminating the disease, condition, or disorder.
  • treatment or “therapy” refer to both therapeutic treatment and prophylactic or preventative measures.
  • treating does not require complete alleviation of signs or symptoms, does not require a cure, and specifically includes protocols which have only a marginal effect on the patient.
  • terapéuticaally effective amount refers to an amount of an agent (e.g. a cytokine such as interferon-a or small molecule inhibitors such as ribavirin) effective to treat at least one sign or symptom of a disease or disorder in a human.
  • Amounts of an agent for administration may vary based upon the desired activity, the diseased state of the patient being treated, the dosage form, method of administration, patient factors such as the patient's sex, genotype, weight and age, the underlying causes of the condition or disease to be treated, the route of administration and bioavailability, the persistence of the administered agent in the body, the formulation, and the potency of the agent. It is recognized that a therapeutically effective amount is provided in a broad range of concentrations. Such range can be determined based on in vitro and/ or in vivo assays.
  • therapeutic regimen refers to, for example, a part of treatment plan for an individual suffering from a pathological condition (e.g. chronic hepatitis C infection) that specifies factors such as the agent or agents to be administered to the patient, the doses of such agent(s), the schedule and duration of the treatment etc.
  • Therapeutic regimens include, for example, a bolus (e.g. a single dose of interferon-a usually injected over a short period of time) administered according to embodiments of the invention.
  • Therapeutic regimens also include, for example, the continuous administration of interferon-a according to embodiments of the invention.
  • profile is used according to its art accepted meaning and refers to the collection of results of one or more analyses or examinations of: (1) the presence of; or (2) extent to which an observed phenomenon exhibits various characteristics.
  • Illustrative profiles typically include the results from a series of observations which, in combination, offer information on factors such as, for example, the presence and/or levels and/or characteristics of one or more agents infecting a patient (e.g. the hepatitis C virus), as well as the pharmacokinetic and/or pharmacodynamic characteristics of one or more therapeutic agents administered to a patient as part of a treatment regimen (e.g. interferon- ⁇ ), as well as the physiological status or functional capacity of one or more organs or organ systems in a patient (e.g. the liver), as well as the genotype of one or more single nucleotide polymorphisms in a patient etc.
  • agents infecting a patient e.g. the hepatitis C virus
  • no detectable HCV-RNA in the context of the present invention means that there are fewer than 500 and typically fewer than 50 copies of HCV-RNA per milliliter of serum of the patient as measured by quantitative, multi-cycle reverse transcriptase PCR methodology.
  • HCV-RNA is typically measured in the present invention by research-based RT-PCR methodology well known to the skilled clinician. This methodology is referred to herein as HCV-RNA/ qPCR.
  • HCV-RNA/ qPCR As is known in the art, the lower limit of detection of HCV-RNA can depend upon the specific assay used.
  • patients or humans having hepatitis C infections means any patient-including a pediatric patient-having hepatitis C and includes treatment- naive patients having hepatitis C infections and treatment-experienced patients having hepatitis C infections as well as those pediatric, treatment-naive, and treatment- experienced patients having chronic hepatitis C infections.
  • These patients having chronic hepatitis C include those who are infected with multiple HCV genotypes including type 1 as well as those infected with, for example, HCV genotype 2 and/ or 3 and/ or 4 etc.
  • treatment-naive patients having hepatitis C infections means patients with hepatitis C who have never been treated with ribavirin and/ or any interferon-a, including but not limited to interferon-a, or pegylated interferon-a.
  • treatment-experienced patients having hepatitis C infections means patients with hepatitis C who have been treated with ribavirin and/or any interferon- ⁇ , including but not limited to interferon-a, or pegylated interferon-a, including relapsers and non-responders.
  • patients having chronic hepatitis C infections means any patient having chronic hepatitis C and includes “treatment-naive patients” and “treatment-experienced patients” having chronic hepatitis C infections, including but not limited to relapsers and non-responders.
  • relapsers as used herein means treatment-experienced patients with hepatitis C who have relapsed after initial response to a conventional course of HCV therapy, e.g. 3-5 MIU pegylated interferon-a administered, for example, in thrice weekly or daily boluses, typically in combination with ribavirin for at least 12 weeks.
  • non-responders means treatment-experienced patients with hepatitis C who have not responded to a conventional course of HCV therapy, e.g. e.g. 3-5 MIU pegylated interferon-a administered, for example, in thrice weekly or daily boluses, typically in combination with ribavirin for at least 12 weeks.
  • a conventional course of HCV therapy e.g. e.g. 3-5 MIU pegylated interferon-a administered, for example, in thrice weekly or daily boluses, typically in combination with ribavirin for at least 12 weeks.
  • HCV therapy see the National Institutes of Health Consensus Development Conference Statement: Management of hepatitis C 2002 (June 10-12, 2002), Gastroenterology 2002; 123(6):2082-2099.
  • Hepatitis C virus is a positively stranded RNA virus that exists in at least six genetically distinct genotypes. These genotypes are designated Type 1, 2, 3, 4, 5 and 6, and their full length genomes have been reported (see, e.g. Genbank/EMBL accession numbers Type la: M62321, AF009606, AF011753, Type lb: AF054250, D13558, L38318, U45476, D85516; Type 2b: D10988; Type 2c: D50409; Type 3a: AF046866; Type 3b: D49374; Type 4: WC-G6, WC-G11, WG29 (Li-Zhe Xu et al, J. Gen.
  • viruses in each genotype exist as differing "quasispecies" that exhibit minor genetic differences.
  • the vast majority of infected individuals are infected with genotype 1, 2 or 3 HCV.
  • HCV infection affects approximately 1.8% of the population in the USA and 3% of the population of the world. In over 85% of infected people, HCV causes a lifelong infection characterized by chronic hepatitis that varies in severity between individuals.
  • interferon-a typically in combination with ribavirin.
  • Such combination therapy can be highly effective for example in the treatment of HCV infection in patients previously treated with interferon alone and in patients never previously treated with interferon (see, e.g. Davis et al, NEJM, (1998), 339(21): 1493-99; Poynard et al, Lancet (1998) 352(9138): 1426-32, the contents of which are incorporated by reference).
  • pegylated interferon-a is typically administered weekly (QW), twice a week (BIW) or three times a week (TIW).
  • aspects of the invention disclosed herein relate to and are part of a clinical trial designed to compare the safety and efficacy of the continuous infusion of interferon with the current standard of care for chronic hepatitis C infection.
  • This study is termed the "COPE-HCV" clinical trial, see, e.g. CUnicalTrials.gov: Identifier: NCT00919633.
  • This study includes patients who are diagnosed with chronic hepatitis C genotype 1 infection and who have received no previous interferon or other anti-HCV treatment.
  • the safety objective in this study is to determine the tolerability and safety of continuous interferon infusion versus the standard of care, at the standard-of-care dose regimen when given with oral weight-based ribavirin.
  • the efficacy objective in this study is to determine the virologic response to continuous interferon infusion in subjects with hepatitis C genotype 1 infection, and to test a selected continuous interferon dose against standard treatment.
  • FIG. 13 shows a diagram of aspects of the study design.
  • Intron A® interferon alfa-2b, recombinant
  • Peglntron® peginterferon alfa-2b
  • the interferon-a is continuously administered via the MiniMed Paradigm® Insulin Infusion System, Medtronic, Inc.
  • PK/PD marker blood levels measured from Baseline through Week 72: interferon alpha, neopterin, 2', 5'- oligoadenylate synthetase ("OAS") and HCV RNA.
  • the instant disclosure provides data obtained from an analysis of a subset of PK/PD data obtained from COPE-HCV Study Subjects.
  • the data collected for PK/PD analysis consists of interferon-alpha, HCV RNA, neopterin, OAS and glucose level measurements obtained from blood or interstitial fluid.
  • Example 1 it has been discovered that certain methods useful in PK/PD analyses of patients infected with HCV (e.g. those in the COPE-HCV trails) can be used to predict a concentration of exogenous interferon- ⁇ in serum of a patient that will result from administering exogenous interferon- ⁇ to the patient via a continuous administration regimen.
  • embodiments of the methods disclosed herein disclosed herein address an unresolved need, specifically the need for optimized interferon- ⁇ dosing regimens, in particular those that take into account aspects of a patient's unique physiology in order to optimize efficacy while minimizing any associated adverse reactions.
  • One embodiment of the invention is a method of predicting a concentration of exogenous interferon- ⁇ in serum of a patient that will result from administering exogenous interferon- ⁇ to the patient via a continuous administration regimen.
  • the method comprises administering exogenous interferon- ⁇ to the patient (typically, but not necessarily, in a bolus); observing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient so as to obtain information on how concentrations of exogenous interferon-a present in the serum change over a period of time; using information on how concentrations of exogenous interferon- ⁇ present in the serum change over the period of time to estimate a rate of exogenous interferon- ⁇ clearance in the patient; and then using the estimate of the rate of exogenous interferon- ⁇ clearance in the patient to predict a concentration of exogenous interferon- ⁇ in the serum of the patient that will result from administering exogenous interferon- ⁇ to the patient via the continuous administration regimen.
  • the method comprises administering exogenous interferon- ⁇ to the patient; observing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient so as to obtain information on the steady-state concentrations of exogenous interferon- ⁇ present in the serum; then using this information on steady- state concentrations of exogenous interferon- ⁇ present in the serum to estimate a rate of exogenous interferon- ⁇ clearance in the patient; and then using the estimate of the rate of exogenous interferon- ⁇ clearance in the patient to predict a concentration of exogenous interferon- ⁇ in the serum of the patient that will result from administering exogenous interferon- ⁇ to the patient via the continuous administration regimen.
  • the exogenous interferon-a is administered to the patient in a bolus comprising from 1 MIU to 100 MIU of interferon- a.
  • the exogenous interferon- ⁇ used in an embodiment of the invention is not conjugated to a polyol.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are sampled for a period of time comprising at least (or alternatively not more than) 24 or 36 or 48 hours.
  • the concentrations of exogenous interferon-a present in the serum of the patient that result from administering exogenous interferon-a to the patient are sampled for a period of time equal to a number of biological 1 ⁇ 2 lives of the interferon- ⁇ species administered to the patient (e.g. pegylated or non-pegylated interferon- ⁇ ), for example for a period of time equal to between 3-20 e.g. 5, 10, 15, or 20) 1 ⁇ 2 lives of the interferon- ⁇ species administered to the patient.
  • the interferon- ⁇ species administered to the patient e.g. pegylated or non-pegylated interferon- ⁇
  • one could start a patient on an initial dose of continuous interferon- ⁇ , wait approx 1-4 days for the subject to approach steady-state, and then calculate the AUC or Cavg (time-averaged interferon concentration) over a few days towards the end of the week (7 days). Based on this AUC value, one can then calculate the clearance [CL and then use this clearance parameter to determine and/ or set the new interferon- ⁇ infusion rate [Q] .
  • the concentrations of exogenous interferon- ⁇ in the serum of a patient that result from administering exogenous interferon- ⁇ to the patient via a continuous administration regimen are estimated by employing a compartmental pharmacokinetic model for subcutaneous interferon-a administration.
  • a compartmental pharmacokinetic model for subcutaneous interferon-a administration.
  • other models or analysis methods can be used in embodiments of the invention in order to, for example, obtain estimates on the clearance of an interferon- ⁇ species in a patient.
  • a variety of "Compartmental Models" and “non-compartmental analysis” techniques e.g.
  • non- compartmental analysis involves using the trapezoidal rule or similar numerical methods etc.
  • pharmacokinetic analysis which can be adapted for use with embodiments of the invention.
  • a number of different illustrative models that can be adapted for use with embodiments of the invention are described in PHARMACOKINETIC & PHARMACODYNAMIC DATA ANALYSIS: CONCEPTS & APPLICATIONS. 4th edition.
  • embodiments of the invention such as the methods noted above further comprise the use of what is termed herein a "correction factor" which, without being bound by a specific scientific theory or principle, may address, for example, model under prediction of serum interferon- ⁇ concentrations that may result from the continuous administration of interferon-a.
  • the correction factor may be useful to address what may be compartmental model under prediction of serum interferon- ⁇ levels that results from the continuous administration of interferon- ⁇ is between 1.5 and 2.5 (e.g. 2 as shown in the Example below). This assumes that a reason for utilizing the correction factor is that continuous PK is different than bolus PK.
  • the clearance may be a function of the duration of exposure to interferon- ⁇ .
  • clearance is a function of time on interferon- ⁇ therapy, not changing from bolus administration to continuous.
  • the "correction factor" accumulate ratio
  • the correction factor is useful to address/be a function of both the duration of therapy as well as the mode of interferon- ⁇ administration (i.e. bolus vs. continuous administration).
  • compartmental pharmacokinetic model for subcutaneous interferon- ⁇ administration includes analyses using the following equations:
  • D is the total interferon-a content at the injection site in IU; C is the interferon-a concentration in serum in IU/ mL; V d is the apparent volume of distribution of interferon- ⁇ in mL;j2 is the subcutaneous infusion rate of interferon- ⁇ in IU/hour; an CL ⁇ is the clearance in mL/hr; and k a is the rate constant for interferon- ⁇ absorption per hour.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are sampled at at least one time point comprising 0, 2, 4, 8, 12, 16 or 24 hours.
  • the changing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering exogenous interferon- ⁇ to the patient are analyzed by a methodology comprising an area- under- the-curve measurement (e.g. one comprising compartmental, or alternatively, non- compartmental ( CA) modeling analyses).
  • a methodology comprising an area- under- the-curve measurement (e.g. one comprising compartmental, or alternatively, non- compartmental ( CA) modeling analyses).
  • Embodiments of the invention can further use the predictions on the concentrations of exogenous interferon- ⁇ in the serum of a patient that will result from administering exogenous interferon- ⁇ to the patient via the continuous administration regimen to design (and optionally administer) a patient- specific continuous administration regimen for the patient, for example one that is sufficient to maintain circulating levels of the interferon- ⁇ in the patient above a mean steady state concentration of at least 100, 200, 300, 400, 500, 600 or 700 pg/mL.
  • the units "pg/mL” are used as merely one example and alternatives ways to characterize these levels such as IU/ mL are considered.
  • interferon-a e.g. 2.6 x 10 8 IU/mg for INTRON® A
  • IU per volume e.g. mL
  • Embodiments of the invention can also include the further steps of observing at least one patient-specific factor such as a patient's prior medical treatment history, a presence or degree of a side effect that results from administering exogenous interferon- ⁇ to the patient, or a polynucleotide sequence of the patient, wherein the polynucleotide sequence comprises a single nucleotide polymorphism (SNP) designated rsl2979860, rsl2980275, rs8099917, rsl2972991, rs8109886, rs4803223, rs8103142, rs28416813, rs4803219, rs4803217, rs581930, rs8105790, rsll881222, rs7248668 or rsl2980602.
  • Embodiments of the invention can also include the further step of observing a genotype or quasispecies of a hepatitis
  • Another embodiment of the invention is a method of administering interferon-a to a patient suffering from a Hepatitis C infection, the method comprising administering a bolus of exogenous interferon- ⁇ to the patient; observing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient so as to obtain information on how concentrations of exogenous interferon- ⁇ present in the serum change over a period of time; using information on how concentrations of exogenous interferon- ⁇ present in the serum change over the period of time to estimate a rate of exogenous interferon-a clearance in the patient; and using the estimate of the rate of exogenous interferon-a clearance in the patient to predict concentrations of exogenous interferon- ⁇ in the serum of the patient that will result from administering exogenous interferon- ⁇ to the patient via the continuous administration regimen; using the predicted concentrations of exogenous interferon- ⁇ in the serum of the patient that
  • the controller is programmed so that the continuous infusion pump administers interferon- ⁇ in a manner that modulates interferon- ⁇ concentrations in the patient so that the patient is administered different interferon dosing regimens during different phases of hepatitis C viral load decline.
  • the controller is programmed so that the continuous infusion pump administers interferon-a in a manner that modulates interferon-a concentrations in the patient so as to reduce adverse side effects observed during the administration of interferon-a.
  • the exogenous interferon- ⁇ in the bolus is not conjugated to a polyol.
  • the bolus of exogenous interferon- ⁇ administered to the patient comprises from 1 MIU to 100 MIU of interferon- ⁇ .
  • the concentrations of exogenous interferon-a present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient are sampled for a period of time comprising at least 24 or 36 or 48 hours.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering the bolus of exogenous interferon-a to the patient are observed by obtaining at least 2, 3, 4, 5 or 6 different samples from the patient over the period of time (e.g. samples taken from serum, plasma or whole blood).
  • the concentrations of exogenous interferon-a in the serum of a patient that result from administering the bolus of exogenous interferon- ⁇ to the patient via a continuous administration regimen are estimated by employing a compartmental pharmacokinetic model for subcutaneous interferon-a administration, wherein the estimate obtained from the compartmental pharmacokinetic model for subcutaneous interferon- ⁇ administration further comprises a correction factor to address model under prediction of serum interferon- ⁇ concentrations that will result from the continuous administration of interferon-a.
  • the concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering the bolus of exogenous interferon-a to the patient are sampled at at least one time point comprising 0, 2, 4, 8, 12, 16 or 24 hours.
  • the changing concentrations of exogenous interferon- ⁇ present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient are analyzed by a methodology comprising an area-under-the-curve measurement (e.g. one comprising a non- compartmental ( CA) analyses).
  • the compartmental pharmacokinetic model for subcutaneous interferon- ⁇ administration includes analyses using the following equations:
  • the correction factor used to address compartmental model under prediction of serum interferon- ⁇ that results from the continuous administration of interferon- ⁇ is between 1.5 and 2.5 (e.g. 1.5, 1.75, 2.0, 2.25 or 2.5). Illustrating this, a correction factor of 2 is appropriate for the embodiments of the invention shown in the Example below (e.g. using a bolus of interferon-a).
  • the controller is programmed so that the continuous infusion pump administers interferon- ⁇ at a dose and for a period of time selected to maintain a plasma interferon- ⁇ concentration above a set-point for the period of time.
  • the controlled is programmed so that the patient-specific therapeutic regimen is sufficient to maintain circulating levels of the interferon- ⁇ in the patient above a mean steady state concentration of at least 100, 200, 300, 400, 500, 600 or 700 pg/mL.
  • the patient-specific therapeutic regimen further comprises administering a nucleoside analog that interferes with Hepatitis C viral replication.
  • a related embodiment of the invention is a system for administering interferon to a patient having a hepatitis C infection, the system comprising a continuous infusion pump having a medication reservoir comprising interferon-a; a processor operably connected to the continuous infusion pump and comprising a set of instructions that causes the continuous infusion pump to administer the interferon- ⁇ to the patient according to a patient-specific therapeutic regimen made by administering a bolus of exogenous interferon- ⁇ to the patient; observing concentrations of exogenous interferon- a present in the serum of the patient that result from administering the bolus of exogenous interferon- ⁇ to the patient so as to obtain information on how concentrations of exogenous interferon- ⁇ present in the serum change over a period of time; using information on how concentrations of exogenous interferon- ⁇ present in the serum change over the period of time to estimate a rate of exogenous interferon- ⁇ clearance in the patient; using the estimate of the rate of exogenous interferon- ⁇
  • the continuous infusion pump has dimensions smaller than 15 x 15 centimeters and is operably coupled to an interface that facilitates the patient's movements while using the continuous infusion pump, wherein the interface comprises a clip, a strap, a clamp or a tape.
  • illustrative embodiments of the invention include methods of using a patient-specific regimen responsiveness profile obtained from a patient infected with hepatitis C virus (HCV) to design a patient-specific therapeutic regimen.
  • a patient-specific regimen responsiveness profile simply means an individual's unique response to a specific therapeutic regimen (e.g. a specific dose of interferon-a) and a “patient- specific therapeutic regimen” simply means a therapeutic regimen designed in accordance with a patient's unique physiological characteristics (e.g. how quickly their body is able to clear a specific dose of interferon-a).
  • the method comprises administering at least one therapeutic agent to the patient following a first therapeutic regimen and then obtaining pharmacokinetic or pharmacodynamic parameters from the patient in order to observe a patient-specific response to the first therapeutic regimen.
  • pharmacokinetic or pharmacodynamic parameters observed comprise a concentration of the therapeutic agent in the blood of the patient that results from the first therapeutic regimen.
  • practitioners can then use the pharmacokinetic or pharmacodynamic parameters observed in the patient in response to the first therapeutic regimen to obtain a patient-specific regimen responsiveness profile.
  • This patient-specific regimen responsiveness profile is based upon an HCV infected patient's individualized physiology and necessarily takes into account patient specific factors that can influence a patients' response to treatment such as the patient's genetic profile (e.g. the presence or absence of a SNP disclosed herein), the HCV genotype(s) infecting the patient, and/ or a patient's weight, treatment history, health status (e.g. if they suffer from diabetes), individual rate of exogenous interferon-a clearance, and the like.
  • This patient-specific regimen responsiveness profile is then used to design a patient-specific therapeutic regimen.
  • Another related embodiment of the invention is a system for administering interferon to a patient having a hepatitis C infection, the system comprising: a continuous infusion pump having a medication reservoir comprising interferon- ⁇ ; and a processor operably connected to the continuous infusion pump that comprises a set of instructions that causes the continuous infusion pump to administer the interferon- ⁇ to the patient according to a patient-specific therapeutic regimen made by administering interferon-a to the patient following a first therapeutic regimen; obtaining pharmacokinetic or pharmacodynamic parameters from the patient so as to observe a patient- specific response to the first therapeutic regimen wherein the pharmacokinetic or pharmacodynamic parameters comprise a concentration of interferon-a in the blood of the patient that results from the first therapeutic regimen; using the pharmacokinetic or pharmacodynamic parameters observed in the patient in response to the first therapeutic regimen to obtain a patient-specific regimen responsiveness profile; and then using the patient-specific regimen responsiveness profile to make the patient-specific therapeutic regimen.
  • the continuous infusion pump has dimensions smaller than 15 x 15 centimeters; and/or is operably coupled to an interface that facilitates the patient's movements while using the continuous infusion pump, wherein the interface comprises a clip, a strap, a clamp or a tape.
  • the interferon-a delivered by this continuous infusion pump is not conjugated to a polyol.
  • Illustrative non-pegylated and pegylated interferons for use in embodiments of the invention include interferon a-2b (e.g. Intron A) (which is not pegylated) and pegylated interferon a-2b (e.g. Peglntron).
  • interferon a-2b e.g. Intron A
  • pegylated interferon a-2b e.g. Peglntron
  • Embodiments of the invention can include bolus doses of a nonpegylated interferon- ⁇ such as Intron A, for example those that range from about 1-15 million IU (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 million IU).
  • Embodiments of the invention can include weight based bolus doses of a nonpegylated interferon- ⁇ such as Intron A, for example those that range from about 50,000 IU/kg - 200,000 IU/kg (e.g. 80,000 IU/kg, 120,000 IU/kg or 160,000 IU/kg).
  • Continuous SC delivery of a nonpegylated interferon- ⁇ such as Intron A can be achieved via the Medtronic MiniMed Paradigm infusion system for 24, 26, 48 60, 72 etc. weeks of HCV therapy.
  • Doses of interferon- ⁇ used in such continuous delivery schemes can be weight based, for example the continuous delivery of 80,000 IU/kg/day, 120,000 IU/kg/day, 160,000 IU/kg/day etc.
  • patients can receive a defined amount, for example 3, 6, 9, or 12 million IU/day.
  • patients will also receive 1000-1600 mg/day oral ribavirin by mouth daily based upon weight (e.g. 1000 mg/day if weight ⁇ 75 kg; 1200 mg/day if weight >75 kg etc.).
  • Individuals in such studies can include those infected with various HCV genotypes and having various treatment histories, for example patients with HCV genotype 1 infection who have had no previous interferon treatment.
  • Embodiments of the invention involve the continuous subcutaneous administration of interferon-a in order to maintain in vivo concentrations of this therapeutic agent above a critical efficacy threshold in vivo for a sustained period of time.
  • illustrative embodiments of the invention involve the continuous subcutaneous administration of interferon-a in order to maintain in vivo concentrations of this therapeutic agent above at least 100-700 pg/mL (e.g. 300 pg/mL) for at least 1 to at least 48 weeks (a 48-week course of therapy is conventionally recommended for patients infected with HCV genotype 1).
  • interferon- ⁇ By the term “at least 100-700 pg/mL" of interferon- ⁇ it is understood that values such as at least 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675 or 700 pg/mL can be used to create any specific range of values.
  • the interferon- ⁇ concentrations (e.g. 100-700 pg/mL) refer to non-pegylated embodiments of interferon- ⁇ 2a or interferon-a 2b (e.g. INTRON®A made by the Schering Corporation).
  • the interferon-a can be pegylated.
  • equivalent concentrations can be calculated using art accepted methodologies, for example by calculating the ratio of specific activities and/or molecular weights of: 1) non-pegylated interferon- ⁇ such as INTRON®A and 2) pegylated interferon- ⁇ such as Peglntron® and then using correlations from such analysis to determine appropriate concentrations of, for example, a pegylated interferon-a.
  • embodiments of the invention consider additional factors such as a patient's genetic profile and/or physiology (e.g. Body Mass Index). Illustrating this, a number of genetic polymorphisms near the IL28B gene on chromosome 19 are observed to provide information on HCV infected individuals' response to therapeutic regimens comprising interferon- ⁇ and ribavirin (see, e.g. Ge et al., Nature 2009, 461(7262):399-401; Tanaka et al., Nat Genet.
  • a patient's genetic profile and/or physiology e.g. Body Mass Index
  • databases such as the Entrez Global Query Cross- Database Search System provide search engines that allow users to search databases at the National Center for Biotechnology Information (NCBI) website.
  • NCBI National Center for Biotechnology Information
  • the Entrez SNP database provides a library of single nucleotide polymorphisms such as those disclosed in Ge et al., Nature. 2009; 461(7262): 399-401.
  • the sequences of various polymorphism are cataloged with a SNP designation (e.g. rsl2979860).
  • Illustrative SNPs are shown in Table 9.
  • the presence or absence of specific polymorphic variants of the IL28B gene can be used to assess the likelihood of HCV viral clearance following a therapeutic regimen comprising a tailored dose of interferon- ⁇ and ribavirin as well as to predict the speed of the response to these therapeutic agents.
  • Certain methods of the invention comprise the steps of determining a polynucleotide sequence of a region within 17 kilobases of the IL28B gene on chromosome 19 in the patient (e.g.
  • interferon-a not conjugated to a polyol to the patient subcutaneously using a continuous infusion apparatus, wherein the interferon- ⁇ is administered to the patient using a therapeutic regimen sufficient to maintain circulating levels of the interferon-a in the serum of the patient above a steady state concentration (e.g. at least 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675 or 700 pg/mL).
  • a steady state concentration e.g. at least 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675 or 700 pg/mL.
  • this therapeutic regimen is sufficient to maintain circulating levels of the interferon-a in the serum of the patient above a steady state concentration for at least 1 week to at least 48 weeks.
  • information on the SNP genotype is used in methods of determining the duration of interferon- ⁇ administration (e.g. more than 48 weeks, less than 48 weeks etc.).
  • information on the SNP genotype is used in methods of determining the dose of interferon- ⁇ to be administered to the patient.
  • information on the SNP genotype is used in methods of determining a target steady state concentration of interferon- ⁇ to be maintained in a patient's serum.
  • the SNP is rsl2979860 and the method comprises determining if the patient comprises a CC genotype, a TT genotype or a CT genotype.
  • the methods are performed on a plurality of patients infected with hepatitis C virus; and the genotype information obtained from the patients is used to stratify patients into different treatment groups (e.g. groups having different IFN dose or regimen duration parameters).
  • SNP analysis methods include hybridization-based approaches (see, e.g., J. G. Hacia, Nature Genet, 1999, 21: 42-47), allele-specific polymerase chain reaction (R. K. Saiki et al., Proc. Natl. Acad. Sci. USA, 1989, 86: 6230-6234; W. M. Howell et al., Nature Biotechnol., 1999, 17: 87-88), primer extension (see, e.g., A. C.
  • oligonucleotide ligation see, e.g., U. Landegren et al., Science, 1988, 24: 1077-1080
  • enzyme-based methods such as restriction fragment length polymorphism and flap endonuclease digestion (see, e.g., V. Lyamichev et al., Nature Biotechnol., 1999, 17: 292-296).
  • One common analysis method includes an initial target amplification step using polymerase chain reaction (PCR) in order to generate a PCR product (see, e.g. R. K.
  • RNA sequencing typically one that includes nucleic acid hybridization to or sequencing of the PCR product.
  • analysis to determine a person's SNP genotype can be performed for example by real-time polymerase chain reaction (RT-PCR); using Taqman custom designed SNP specific probes (Applied Biosystems) on an ABI HT-7900 instrument using commercially available reagents from Applied Biosystems.
  • Embodiments of the invention include systems for administering interferon- ⁇ to a patient having a hepatitis C infection.
  • the system can comprise for example: a continuous infusion pump having a medication reservoir comprising interferon- ⁇ ; a processor operably connected to the continuous infusion pump and comprising a set of instructions that causes the continuous infusion pump to administer the interferon- ⁇ to the patient according to a therapeutic regimen comprising administering interferon- ⁇ to the patient subcutaneously; wherein the therapeutic regimen is sufficient to maintain circulating levels of interferon-a in the serum of the patient above a steady state concentration of at least 100-700 pg/ mL for at least 1 week to at least 48 weeks.
  • the therapeutic regimen is administered for a duration of at least 7, 14, 21 or 28 days, while time periods of at least 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 24, 28, 32, 36, 40, 44, 48, 52, 54, 58, 62, 66, 70, 72 or more weeks can also be selected.
  • the therapeutic regimen is administered for a duration of at least 6, 8 or 10 weeks to at least 48 weeks.
  • the therapeutic regimen is administered for a duration of at least 6 weeks to at least 32, 36, 40 or 44 weeks.
  • the therapeutic regimen is administered for a duration of at least 6 weeks to at least 52, 54, 58, 62, 66, 70, 72 or more weeks.
  • FIG. 12A illustrates an exemplary generalized computer system 202 that can be used to implement elements the present invention, including the user computer 102, servers 112, 122, and 142 and the databases 114, 124, and 144.
  • the computer 202 typically comprises a general purpose hardware processor 204A and/or a special purpose hardware processor 204B (hereinafter alternatively collectively referred to as processor 204) and a memory 206, such as random access memory (RAM).
  • the computer 202 may be coupled to other devices, including input/ output ( ⁇ / O) devices such as a keyboard 214, a mouse device 216 and a printer 228.
  • ⁇ / O input/ output
  • the computer 202 operates by the general purpose processor 204A performing instructions defined by the computer program 210 under control of an operating system 208.
  • the computer program 210 and/ or the operating system 208 may be stored in the memory 206 and may interface with the user 132 and/ or other devices to accept input and commands and, based on such input and commands and the instructions defined by the computer program 210 and operating system 208 to provide output and results.
  • Output/ results may be presented on the display 222 or provided to another device for presentation or further processing or action.
  • the display 222 comprises a liquid crystal display (LCD) having a plurality of separately addressable liquid crystals.
  • LCD liquid crystal display
  • Each liquid crystal of the display 222 changes to an opaque or translucent state to form a part of the image on the display in response to the data or information generated by the processor 204 from the application of the instructions of the computer program 210 and/or operating system 208 to the input and commands.
  • the image may be provided through a graphical user interface (GUI) module 218A.
  • GUI graphical user interface
  • the instructions performing the GUI functions can be resident or distributed in the operating system 208, the computer program 210, or implemented with special purpose memory and processors.
  • Some or all of the operations performed by the computer 202 according to the computer program 110 instructions may be implemented in a special purpose processor 204B.
  • the some or all of the computer program 210 instructions may be implemented via firmware instructions stored in a read only memory (ROM), a programmable read only memory (PROM) or flash memory in within the special purpose processor 204B or in memory 206.
  • the special purpose processor 204B may also be hardwired through circuit design to perform some or all of the operations to implement the present invention.
  • the special purpose processor 204B may be a hybrid processor, which includes dedicated circuitry for performing a subset of functions, and other circuits for performing more general functions such as responding to computer program instructions.
  • the special purpose processor is an application specific integrated circuit (ASIC).
  • the computer 202 may also implement a compiler 212 which allows an application program 210 written in a programming language such as COBOL, C++, FORTRAN, or other language to be translated into processor 204 readable code. After completion, the application or computer program 210 accesses and manipulates data accepted from 1/ O devices and stored in the memory 206 of the computer 202 using the relationships and logic that was generated using the compiler 212.
  • the computer 202 also optionally comprises an external communication device such as a modem, satellite link, Ethernet card, or other device for accepting input from and providing output to other computers.
  • instructions implementing the operating system 208, the computer program 210, and the compiler 212 are tangibly embodied in a computer- readable medium, e.g., data storage device 220, which could include one or more fixed or removable data storage devices, such as a zip drive, floppy disc drive 224, hard drive, CD-ROM drive, tape drive, etc.
  • the operating system 208 and the computer program 210 are comprised of computer program instructions which, when accessed, read and executed by the computer 202, causes the computer 202 to perform the steps necessary to implement and/or use the present invention or to load the program of instructions into a memory, thus creating a special purpose data structure causing the computer to operate as a specially programmed computer executing the method steps described herein.
  • Computer program 210 and/or operating instructions may also be tangibly embodied in memory 206 and/or data communications devices 230, thereby making a computer program product or article of manufacture according to the invention.
  • article of manufacture “program storage device” and “computer program product” as used herein are intended to encompass a computer program accessible from any computer readable device or media.
  • a user computer 102 may include portable devices such as medication infusion pumps, analyte sensing apparatuses, cellphones, notebook computers, pocket computers, or any other device with suitable processing, communication, and input/ output capability.
  • Fig. 12B presents a specific illustrative embodiment system 10 for performing methods disclosed herein.
  • the interferon-a may be administered at a dosing rate Q(t) 12 from an infusion device 11 including, but not limited to, a pump, a depot, an infusion bag, or the like.
  • the interferon-a serum concentration 14, represented as C(t) may be determined by sampling a patient's blood by assay or sensor 16, and communicated to a controller 18, as represented by a concentration feedback loop 20.
  • the system 10 may also include a viral load feedback loop 22.
  • patient's viral load 24, represented as V(t) may be determined by sampling patient's blood by assay or sensor 26 and may be communicated to the controller 18. Based on C(t), V(t) or both, controller 18 may calculate the dosing rate 12, which may then be adjusted if necessary either automatically by the controller or manually by an individual administering the therapy. In addition, patient-specific pK parameters 13 and pD parameters 15 may be determined from this data.
  • the controller 18 may be a conventional process controller such as a PID controller, one can also utilize an adaptive model predictive process controller or model reference adaptive control.
  • a model predictive controller may be programmed with mathematical models of a "process" to predict "process" response to proposed changes in the inputs. These predictions are then used to calculate appropriate control actions. In response to control actions, the model predictions are continuously updated with measured information from the "process" to provide a feedback mechanism for the controller.
  • the mathematical models may be continuously optimized to match the performance of the "process.”
  • the controller 18 may be programmed with patient-specific pK or pD parameters, population or subpopulation averages, or a combination thereof together with pharmacokinetic and pharmacodynamic models to calculate the dosing rate necessary to achieve desired clinical outcome.
  • the controller continuously processes the data received from the feedback loops to optimize the dosing rate based on a patient's response to the therapy.
  • the controller 18 may also manipulate the pharmacokinetic and pharmacodynamic parameters, as well as the mathematical models based on concentration and viral load data to adopt or customize the models for individual patients and specific conditions.
  • the controller 18 may use patient-specific pharmacokinetic or pharmacodynamic parameters, population or subpopulation averages, or combination thereof together with pharmacokinetic, pharmacodynamic, or viral kinetic models to calculate the dosing rate for desired efficacy based on C(t), V(t) or both.
  • pK refers to the physical pharmacokinetic system of a real patient.
  • the parameter pK' 19 refers to the pharmacokinetic model and parameter values used by the controller to describe pK, and which may be drawn from the real patient, population, or subpopulation averages. Similar notation is used for pD, C, V and Q.
  • a given patient is assumed to have a set of individual pharmacokinetic parameters, represented as pK, and thus actual efficacy may be represented as a function of concentration, which is a function of the dosing rate Q(t).
  • the controller 18 may use pharmacokinetic and pharmacodynamic models to calculate the suitable dosing rate for desired efficacy based on the concentration or other physiological characteristic data. Such models are known and are disclosed in, for example, Bonate, P.L. (2006). Pharmacokinetic- Pharmacodynamic Modeling and Simulation. New York, Springer Science&Business Media; Andrew H Talal, et al. (2006).
  • embodiments of the invention are designed to maintain circulating levels of interferon-a in the serum of the patient above a target steady state concentration (e.g. at least 100-700 pg/mL) so as to increase the efficacy of this polypeptide.
  • a target steady state concentration e.g. at least 100-700 pg/mL
  • steady state is used herein to describe situations in which a variable (e.g. the concentration of circulating interferon- ⁇ that results from a therapeutic regimen) remains above a set threshold and/ or essentially constant in spite of ongoing processes that strive to change them (e.g. in vivo clearance of exogenous interferon- ⁇ by the liver and kidneys).
  • a steady state is typically reached when the rate of elimination approximates the rate of administration.
  • a related embodiment of the invention is a method of administering an interferon- ⁇ to a patient infected with hepatitis C virus, the method comprising administering interferon- ⁇ to the patient subcutaneously using a continuous infusion apparatus, wherein the therapeutic regimen is sufficient to maintain circulating levels of interferon- ⁇ in the serum of the patient above a target concentration (e.g. 100-700 pg/mL).
  • a target concentration e.g. 100-700 pg/mL
  • Such embodiments of the invention can be used, for example, to administer interferon- ⁇ for a period of at least 1 week to at least 48 weeks.
  • Some embodiments of the invention include methods for obtaining patient- specific regimen responsiveness profiles based upon individualized patient factors such as infection parameters (e.g. hepatitis C viral load) and therapeutic agent responsiveness parameters (e.g. in vivo concentrations of interferon- ⁇ that result from its administration to the patient) and then using the regimen responsiveness profiles to design optimized therapeutic regimens for patients suffering from pathological conditions (e.g. Hepatitis C infections).
  • such methods comprise determining patient- specific pharmacokinetic (pK) and pharmacodynamic (pD) parameters (e.g. the concentration of circulating of interferon-a in vivo that results from a specific dose being administered to that patient) and then utilizing these parameters to design new therapeutic regimens.
  • the invention provides a computer implemented system for: (1) delivering interferon- ⁇ according to an initial dosing parameter (e.g. a 12 MIU bolus); and/or (2) constructing patient-specific regimen responsiveness profiles based upon a patient's response to the initial dosing parameters; and/or (3) delivering therapeutic agent(s) using optimized therapeutic regimens designed in response to such profiles (e.g. regimens that comprise variations of initial dosing parameters).
  • an initial dosing parameter e.g. a 12 MIU bolus
  • optimized therapeutic regimens designed in response to such profiles e.g. regimens that comprise variations of initial dosing parameters.
  • Embodiments of the invention can also examine for example, levels of beta-2- microglobulin, levels of neopterin, levels of 2',5' oligo-adenylate synthetase in a patient as well as the other markers disclosed herein and/or known in the art.
  • embodiments of the invention can also examine, a level of alanine transaminase or aspartate transaminase in plasma of the patient; a genotype or quasispecies of the hepatitis C virus; a patient's prior medical treatment history; and/ or a presence or degree of a side effect that results from the first therapeutic regimen.
  • the therapeutic agent comprises interferon- ⁇
  • PK/PD markers identified herein can be assesses by a wide variety of methodologies known in the art, including the illustrative methods discussed below. INTERFERON-a
  • In vivo samples may be assayed for interferon-a concentrations using a variety of different methods known and used in the art.
  • One suitable example is an electrochemiluminescence-based assay and an ORIGEN analyzer (IGEN International, Inc. Gaithersburg, MD) as disclosed for example in Obenauer-Kutner et al., Journal of Immunological Methods, Volume 206, Issues 1-2, 7 August 1997, Pages 25-33.
  • Other methods used in the art include those disclosed for example in Niewold et al., Genes Immun.
  • ELISA kits designed to provide quantitative assays of interferon-a concentrations in serum (e.g.
  • 100-700 pg/mL are commercially available from vendors, including for example the Human IFN-alpha Platinum ELISA CE available from Bender MedSystems (e.g. Product # BMS216CE) and The Human IFN alpha colorimetric ELISA Kit (Serum Samples) available from Thermo Scientific Life Science Research Products (e.g. Product # 411101).
  • Bender MedSystems e.g. Product # BMS216CE
  • Human IFN alpha colorimetric ELISA Kit serum Samples
  • Thermo Scientific Life Science Research Products e.g. Product # 411101
  • interferon-a concentrations in human serum samples can be quantified using a ligand-binding assay that can be developed and validated for the COPE-HCV Study using current regulatory standards for quantitative bioanalysis of proteins (see, e.g., Desil et al., Pharm Res 2003;20(l l):1885-900). 2', 5'- OLIGOADENYLATE SYNTHETASE
  • OAS 2', 5'- oligoadenylate synthetase
  • PD secondary pharmacodynamic
  • OAS expression levels can be measured, for example, using a radioimmunoassay (RIA) kit commercially available from the Eiken Chemical Company (Japan).
  • Neopterin is a biosynthetic precursor of a factor secreted by stimulated macrophages (see, e.g., Quiroga et al., Dig Dis Sci 1994;39(ll):2485-96) and its levels can be measured in serum samples as a secondary PD marker. Neopterin levels can be measured using an EIA (enzyme immunoassay) kit available from B.R.A.H.M.S. (Germany) and distributed in the U.S. by ALPCO.
  • EIA enzyme immunoassay
  • interstitial fluid glucose levels of PK/PD Substudy subjects can be monitored during the first 72 hours of INTRON A therapy (inpatient hours 0-72) using the Medtronic iPROTM Continuous Glucose Monitoring System (CGMS®).
  • CGMS glucose sensor is a tiny electrode inserted just under the skin of the abdomen. It measures glucose levels in the interstitial fluid (fluid between the body's cells).
  • the sensor is connected to a recorder, which stores a glucose reading every 5 minutes.
  • the sensor is calibrated using less frequent blood glucose measurements obtained from finger-stick samples and a blood glucose meter.
  • a primary measure of pharmacodynamic effect can be the HCV RNA level following INTRON A treatment.
  • the pharmacodynamic assessment of the data will attempt to correlate serum interferon levels with viral decay rates (or viral kinetics) using pharmacodynamic models similar or identical to those published by Dr. Alan Perelson and colleagues (see, e.g., Dahari et al., Hepatology 2007a;46(l):16-21, Neumann A et al., Science 1998;282(5386):103-7, and Talal et al., Hepatology 2006;43(5):943-53).
  • HCV RNA levels can be measured using assays based on RT-PCR such as the FDA-approved in vitro diagnostic test from Roche: the COBAS® AmpliPrep / COBAS® TaqMan® HCV Test ("CAP/CTM” assay).
  • This assay has a lower limit of quantification (LLOQ) of 43 IU/ mL and an overall lower limit of detection (LLOD) of 18 IU/mL (ROCHE MOLECULAR SYSTEMS. COBAS® AmpUPrep / COBAS® TaqMan® HCV Test Package Insert. 2008).
  • HCV RNA levels can be used to calculate the viral decay as function of time for all COPE-HCV study subjects, including those in the PEGINTRON arm.
  • Viral decay is Viral decay, defined as change from baseline in loglO HCV RNA, can be analyzed using a repeated measures model accounting for the following factors: age, gender, race (African American/Hispanic or not), BMI, baseline viral load, and treatment and by Equation 1.
  • VD t log w (V 0 ) -log l0 (V t ) [1]
  • V t is the viral load
  • V 0 is the viral load [IU HCV / mL] at pre- dose Baseline
  • VD f is the viral decay [dimensionless].
  • Baseline characteristics of PK/PD subjects can be reported in the form of descriptive summary statistics, grouped by dosing arm, following the procedures described herein. The following baseline characteristics can be reported: sex, race, age, weight, baseline HCV RNA level (log 10 IU/mL), hepatitis C genotype (subtype la, lb, or not identified), IL-28B genotype (e.g. SNP rsl2979860 C/C, C/T, T/T, or NA [not available]). Baseline characteristics can be compared between treatment groups using Fisher's exact test (for categorical variables) and ANOVA or Kruskal-Wallis tests (for continuous variables).
  • the purpose of the single 12 MIU SC bolus injection of INTRON A at the beginning of the first 24-hour period in the inpatient facility is to determine each subject's individual PK parameters, including average concentration, T ma personally C ma touch-lives, clearance rates, and volume of distribution of serum interferon during the first 24 hours.
  • the data collected over the 24— 72 -hour period during the continuous INTRON A treatment phase of the PK/PD substudy along with the data collected through study Week 2 can be used to confirm that relatively stable serum interferon levels can be obtained using a subcutaneous continuous infusion system, and that serum IFN levels can be predicted by knowing individual PK parameters and the infusion rate of INTRON A
  • FIG. 1 provides an illustration of the PK/PD substudy sampling times compared with serum interferon (IFN) concentrations predicted by a pharmacokinetic model.
  • Serum IFN concentrations were calculated using a single-compartment pharmacokinetic model and parameters for INTRON A taken from the literature (see, e.g., INTRON A. (Interferon-alfa-2b, recombinant) for Injection Product Insert. Schering-Plough; 2008, Zeuzem et al., Pharmacokinetics of Peginterferons.
  • the individual PK parameters for each PK/PD Substudy subject can be estimated using IFN serum concentration vs. actual inpatient time data from samples drawn at Baseline and the 24-hour nominal time period following the INTRON A bolus, prior to the initiation of continuous INTRON A. Per the COPE-HCV Study protocol, this data is to be drawn at Baseline and at inpatient hours: 2, 4, 8, 12, 16 and 24.
  • Initial estimates for the clearance (CL) and apparent volume of distribution (V) can be obtained using Non-Compartmental Analysis (NCA). These initial parameter estimates can be used for the final estimation of individual PK parameters using Compartmental Modeling (CM).
  • the PhoenixTM NCA operational object (see, e.g., Pharsight Chapter 10: Noncompartmental Analysis. User's Guide: PhoenixTM WinNonlin(R) 6.1. 2009a. p 251- 302) can be used to provide initial estimates for the clearance (CL * ) and the apparent volume of distribution (V ). Generating initial estimates for these two parameters by NCA will require that initial estimates for two additional parameters are also generated: area-under-the-curve ( A UC bolus ) and the terminal slope (k e ). Table 5 summarizes the initial parameter estimates that can be generated via NCA.
  • Area-under-the-curve can be estimated using the Plasma model with the linear Trapezoidal Linear Interpolation method. The same integration method can be used for all subjects.
  • the terminal slope (k of each log- trans formed data set can be estimated using the "best fit" option in the NCA operational object, which requires at least 3 points and will not include C ⁇ ° ax ⁇ Figure 3 provides an illustrative example of what these fits may look like.
  • Initial estimates for the clearance (CL * ) and the apparent volume of distribution (V ) for each subject can be calculated from A UC bolus and f using
  • D 0 is the dose of the subcutaneous INTRON A bolus (12 x 10 6 IU).
  • Median values for CL and V d can be calculated using all available estimates for individual subjects. These median values for CL and V d can be used as the initial estimates for subjects for which individual estimates are not available (i.e. the "best fit" option in the NCA operational object is not able to estimate k .
  • Compartmental Modeling can be used to provide the final estimates of the individual PK parameters for the IFN levels that result from the 12 MIU INTRON A bolus (Baseline and at inpatient hours: 2, 4, 8, 12, 16 and 24).
  • the a priori plan is to perform this analysis using the standard 1 -compartment PK model for subcutaneous drug administration with first-order rates of absorption and elimination (see, e.g., Shargel et al., Applied Biopharmaceutics and pharmacokinetics. Norwalk, Connecticut: Appleton & Lange; 1992). This model is illustrated by Figure 4 and defined by Equations 4 and 5.
  • D is the total IFN content at the depot (i.e. the injection site)
  • C is the IFN concentration in serum [IU/mL]
  • Q is the subcutaneous infusion rate of INTRON A [IU/mL]
  • CL is the clearance [mL/hr]
  • k a is the rate constant for IFN absorption [hr 4 ].
  • the bio availability parameter, F is lumped into CL and V d because it cannot be estimated from the COPE- HCV study data.
  • the elimination-rate constant, k tun does not appear in Equations 4 and 5, but can be readily calculated as a secondary parameter using Equation 6.
  • the PhoenixTM Model object can be used to estimate the PK model parameters CL, V d , and k a for each subject through non-linear regression, using the "Clearance Parameterization" option setting.
  • the PK parameter estimates obtained in this fashion are denoted herein with a prime symbol: " ' ".
  • Figure 5 provides an illustrative example of what these fits may look like.
  • Initial parameter estimates for V and CL' can be derived from the NCA results.
  • the initial estimate for k a can be 0.2 hr "1 , which is derived from a literature survey of published PK parameters for INTRON A (see Table 4).
  • Table 6 summarizes the primary (CL', V , k ) and secondary individual PK parameters (e.g. k ') that can be estimated and reported for the response to the 12 MIU INTRON A bolus.
  • the PhoenixTM NCA object can be used to characterize the IFN levels that are observed during the 2 weeks following the initiation of continuous INTRON A therapy. This analysis will calculate the values of several parameters, including those listed in Table 7.
  • the serum interferon AUC for each subject can be calculated over 0 hour -14 day nominal study time interval.
  • the Linear Trapezoidal linear Interpolation method can be used to calculate these AUC parameters.
  • Figure 6 provides a graphical representation of how these calculations can be performed, neglecting errors in sampling and the IFN assay.
  • IFN concentration vs. nominal study time data can be used to calculate AUC without interpolation.
  • the AUC value will reported as "missing" for a given subject and time interval if either of the following criteria are met: 1) one or both of the integration time interval concentration measurements are missing, or 2) there are less than 3 measured concentrations within the integration time interval (including end-points).
  • t and t 2 are the beginning and the end of the integration time interval, respectively [hr] .
  • illustrative time intervals and AUC calculation methods that can be employed for this analysis are described herein.
  • the maximum observed concentration over a time interval ⁇ [ max ] ; 2 can be determined using the NCA operational object. Illustrative time intervals that can be employed for this analysis are described herein.
  • the percent fluctuation (PF ⁇ ), as defined by Equation 8, can be calculated for the 24 hour-14 day nominal study time interval.
  • C° ⁇ J and C° . ⁇ J are the maximum and minimum observed IFN concentrations over the time interval from t x to t 2 .
  • Methods that can be used for calculating the ⁇ ⁇ J parameter values are described herein.
  • IFN concentration vs. nominal study time data can be used to calculate PF 2Ah (and y C c °schreib nt J 243 ⁇ 4 ), without interpolation.
  • the minimum observed concentration over a time interval can be
  • the PK parameters estimated from the response to the INTRON A bolus can be used along with individual dosing information and the Compartmental Model to predict the IFN concentration vs. time profile that is expected to result from continuous INTRON A infusion.
  • the 12 MIU bolus administered at -24 Study hours may also be modeled to account for a short wash-out period.
  • the PhoenixTM Model object can be used to calculate predicted IFN concentration vs. time profiles.
  • Figure 2 provides an illustration of what these IFN concentration profiles may look like.
  • Table 8 summarizes the parameters that can be used to describe the IFN concentrations that are predicted to result from continuous INTRON A Infusion.
  • Equation 10 The steady-state analytical solution for the compartmental PK model with continuous drug infusion is provided as Equation 10, where C'ss is the steady state IFN concentration.
  • the Phoenix NCA object can be used to calculate the AUC of the predicted response to continuous INTRON A for each subject 0 hour-14 day nominal study time interval.
  • the calculation of these AUC parameters is analogous to that presented by Figure 6.
  • These A UC parameters can be converted to average concentrations using Equation 11.
  • the IFN concentrations predicted for each subject can be compared to the observed IFN concentrations that result from the first two weeks of continuous INTRON A therapy.
  • the Compartmental Model can be used to predict the transient as well as the steady-state IFN concentrations that result from continuous INTRON A [C'(t)].
  • An illustrative comparison of IFN concentrations predicted by the compartmental model with contrived "observed" data is provided by Figure 8.
  • Weighted residuals for each subject's predicted vs. observed IFN concentration profile can be calculated, as described by Equation 12, and plotted vs. time for exploratory purposes.
  • the ability of the PK model and individual PK parameters to predict the average serum IFN concentration during continuous INTRON A therapy over a specified time interval can be quantified by calculating the percent relative error, as described by Equation 13.
  • EXAMPLE 1 ILLUSTRATIVE METHODS USING INTERFERON-oc BOLUS PK TO PREDICT INTERFERON-oc CONTINUOUS PK
  • PK pharmacokinetic
  • a treatment phase of the PK/PD substudy along with the data collected through study Week 2 can be used to confirm that relatively stable serum interferon levels can be obtained using a subcutaneous continuous infusion system, and that serum IFN levels can be predicted by knowing individual PK parameters and the infusion rate of INTRON A pu/day].
  • Figure 2 provides an illustration of the PK/PD substudy sampling times compared with serum interferon (IFN) concentrations predicted by a pharmacokinetic model.
  • Serum IFN concentrations were calculated using a single-compartment pharmacokinetic model and parameters for INTRON A known in the art.
  • Table 4 summarizes the ranges of selected PK parameters reported in the literature for INTRON A and PEGINTRON.
  • D 0 is the dose of the subcutaneous INTRON A bolus (12 x 10 6 IU).
  • V d ⁇ k a D- CL x C [4]
  • D is the total IFN content at the depot (i.e. the injection site) [IU]
  • C is the IFN concentration in serum [IU/mL]
  • V j is the apparent volume of distribution of IFN [mL]
  • Q is the subcutaneous infusion rate of INTRON A [IU/mL]
  • CL is the clearance [mL/hr]
  • k a is the rate constant for IFN absorption [hr ].
  • the bio availability parameter, F is lumped into CL and V d because it cannot be estimated from the COPE- HCV study data.
  • the elimination-rate constant, k e does not appear in Equations 3 and 4 but was readily calculated as a secondary parameter using Equation 5.
  • the Phoenix Model object was used to estimate the PK model parameters CL, V d , and k a for each subject through non-linear regression, using the "Clearance Parameterization” and "Multiplicative Residual Error” option settings.
  • the PK parameter estimates obtained in this fashion are denoted herein with a prime symbol: " ' ".
  • Figure 5 provides an illustrative example of what these fits were predicted to look like using data from the literature.
  • Initial parameter estimates for VJ and CL' were derived from the NCA results.
  • the initial estimate for k a was 0.2 hr 1 , which was derived from a literature survey of published PK parameters for INTRON A (see Table 4).
  • Table 6 summarizes the primary (CL', VJ, kj) and secondary individual PK parameters (e.g. k ') that were estimated for the response to the 12 MIU INTRON A bolus.
  • the PhoenixTM NCA object was used to characterize the IFN levels that were observed during the 2 (nominal) weeks following the initiation of continuous INTRON A therapy. This analysis calculated the values of the exposure variables listed in Table 7. Area Under the Curve
  • the serum interferon AUC for each subject was calculated over a time interval corresponding to the first 2 (nominal) weeks of continuous INTRON A therapy.
  • the Linear Trapezoidal Linear Interpolation method was used to calculate these AUC parameters.
  • Figure 6 provides a graphical representation of how these calculations were to be performed, neglecting errors in sampling and the IFN assay.
  • IFN concentration vs. actual study time data was used to calculate AUC.
  • the integration period began (3 ⁇ 4) with the actual pump dosing time (or the actual time at which continuous INTRON A therapy was initiated) and ended (3 ⁇ 4) with the actual time at which the Week 2 IFN blood sample was collected.
  • the first measured IFN concentration with an actual collection time > was used for the IFN concentration at
  • t and t 2 are the beginning and the end of the integration time interval, respectively [hr]. Time intervals and AUC calculation methods that were employed for this analysis are described above.
  • the percent fluctuation (PF ⁇ ), as defined by Equation 7, were calculated for the 24 hour- 14 day nominal study time interval.
  • C° ⁇ 2 and C°* ⁇ 2 are the maximum and minimum observed IFN concentrations over the time interval from t to t z .
  • the minimum observed concentration over a time interval ⁇ [ m - B ] ; 2 was determined using the NCA operational object.
  • the PK parameters estimated from the response to the INTRON A bolus were used along with individual dosing information and the Compartmental Model to predict the IFN concentration vs. time profile that was expected to result from continuous INTRON A infusion.
  • the 12 MIU bolus administered at approximately -24 Study hours was also modeled to account for a relatively short wash-out period.
  • the PhoenixTM Model object was used to calculate predicted IFN concentration vs. time profiles.
  • Figure 7 provides an illustration of what these IFN concentration profiles were predicted to look like using data from the literature.
  • Table 8 summarizes the exposure variables that were used to describe the IFN concentrations that were predicted to result from continuous INTRON A Infusion.
  • Equation 8 The steady-state analytical solution for the compartmental PK model with continuous drug infusion is provided as Equation 8, where C' ss is the steady state IFN concentration.
  • the Phoenix NCA object was used to calculate the AUC of the predicted response to continuous INTRON A for each subject 0 hour- 14 day nominal study time interval. The calculation of these AUC parameters is analogous to that presented by Figure 6. These A UC parameters were converted to average concentrations using Equation 9.
  • the IFN concentrations predicted for each subject were compared to the observed IFN concentrations that result from the first two weeks of continuous INTRON A therapy.
  • RE ⁇ 2 is the percent relative error of the average IFN concentration predicted over the time interval t x to t z .
  • Serum interferon concentration vs. time data was analyzed from 3 PK/PD subjects randomly selected from the data that was available at the time of this preliminary analysis.
  • the INTRON A dosing arm assignments and baseline body weights for these 3 subjects are provided in Table 10.
  • numeric subject identification codes used in the COPE-HCV Study have been replaced with surrogate alphabetic identification codes.
  • the observed serum IFN concentrations from the first 2 (nominal) weeks of INTRON A exposure are presented in Figure 11 along with the concentration vs. time profiles that are predicted for each subject using individual PK parameters estimated from the bolus response and individual dosing information (actual time of 12 MIU bolus, actual start time of continuous INTRON A, baseline subject body weight, and dosing arm assignment).
  • the observed and predicted exposure variables calculated for the first two weeks of pump therapy are summarized by Table 13 and Table 14.
  • PK assessments were only performed during Weeks 1 and 4 of therapy, so it is not known if the accumulation of INTRON A occurred gradually over a few weeks or if it was immediate.
  • the results of the preliminary PK/PD analysis presented in this report suggest that the accumulation is immediate, as the mean accumulation ratio for the first two weeks of continuous INTRON A vs. the initial bolus ( Rjj"" ⁇ ) is 2.0 (see Table 15).
  • Table 4 Pharmacokinetic Parameter Values for INTRON A and PEGINTRON. Reported values were obtained via single-bolus administration to patients with normal renal function. Values for k a and k e were calculated using the formula:
  • PF Percent fluctuation
  • Table 5 Initial Parameter Estimates to be Generated by NCA Analysis.
  • Table 6 Parameter Estimates to be Generated by Compartmental Modeling of the res onse to the 12 MIU bolus of INTRON A. Compartmental Modeling.
  • Table 8 Parameters that can be used to describe the IFN concentrations that are
  • rsl2979860 as a query are provided in Table 9.
  • Table 9 the polymorphic nucleotide in these SNP sequences is bracketed (nucleotide position 27).
  • CTGAGAGAAGTCAAATTCCTAGAAAC [A/G] GACGTGTCTAAATATTTGCCGGGGT (SEQ ID NO 2 )
  • CTGAGCTCCATGGGGCAGCTTTTATC [C/T ] CTGACAGAAGGGCAGTCCCAGCTGA ( SEQ ID NO: 10)
  • Table 11 PK parameters from the compartmental modeling of the bolus response. All quantities are reported to 2 significant figures.
  • Table 14 Predicted exposure variables for continuous INTRON A. Exposure variables were calculated using the compartmental model and individual PK parameters estimated from the 12 MIU INTRON A bolus. All quantities are reported to 2 significant figures.
  • Table 15 Comparison of the predicted vs. observed time-averaged IFN concentrations that result from the first 2 weeks of continuous INTRON A. All quantities are reported to 2 significant figures.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Medical Informatics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Biotechnology (AREA)
  • Evolutionary Biology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Theoretical Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention a pour objet des méthodologies concernant le traitement des infections à l'hépatite C. Dans un mode de réalisation, un bolus d'interféron est administré à un patient, et les niveaux sériques d'interféron exogène résultants sont ensuite observés pendant une période de 24 à 72 heures. Les données obtenues pendant cette période de temps sont ensuite utilisées pour prédire la concentration de l'interféron-α exogène dans le sérum d'un patient qui résultera de l'administration d'un dosage d'interféron-α exogène par l'intermédiaire d'un régime d'administration continu. Ces informations peuvent ensuite être utilisées pour mettre au point des régimes thérapeutiques spécifiques d'un patient optimisés.
PCT/US2010/054755 2009-10-29 2010-10-29 Méthodes et matériels pour des régimes thérapeutiques contre l'hépatite c optimisés WO2011059824A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US25599209P 2009-10-29 2009-10-29
US61/255,992 2009-10-29

Publications (2)

Publication Number Publication Date
WO2011059824A2 true WO2011059824A2 (fr) 2011-05-19
WO2011059824A3 WO2011059824A3 (fr) 2011-07-21

Family

ID=43827648

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/054755 WO2011059824A2 (fr) 2009-10-29 2010-10-29 Méthodes et matériels pour des régimes thérapeutiques contre l'hépatite c optimisés

Country Status (1)

Country Link
WO (1) WO2011059824A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012116370A1 (fr) 2011-02-25 2012-08-30 Medtronic, Inc. Procédés et systèmes utilisant des profils pharmacocinétiques et pharmacodynamiques dans régimes thérapeutiques d'interféron-alpha
WO2013062959A2 (fr) * 2011-10-26 2013-05-02 Medtronic, Inc. Administration continue sous-cutanée d'interféron alpha à des patients infectés par le virus de l'hépatite b
WO2016164665A1 (fr) * 2015-04-09 2016-10-13 Mould Diane R Systèmes et procédés de dosage spécifique au patient
US10083400B2 (en) 2012-10-05 2018-09-25 Diane R. MOULD System and method for providing patient-specific dosing as a function of mathematical models updated to account for an observed patient response

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080078843A1 (en) 2006-09-19 2008-04-03 Wolf-Dieter Wichmann Dosing pump, spraying device for spraying sprays and method for operating such a spraying device
US20090038617A1 (en) 1997-11-07 2009-02-12 Michael Berthon-Jones Administration of cpap treatment in presence of apnea
US20090060121A1 (en) 2006-03-16 2009-03-05 Koninklijke Philips Electronics N. V. Computed tomography data acquisition apparatus and method
WO2009046369A2 (fr) 2007-10-05 2009-04-09 Medtronic, Inc. Contrôle pharmacocinétique pour l'administration optimisée d'interféron
WO2009120991A2 (fr) 2008-03-27 2009-10-01 Medtronic, Inc. Outils pharmacocinétiques et pharmacodynamiques destinés à définir des régimes thérapeutiques spécifiques à un patient
US20100044146A1 (en) 2005-10-21 2010-02-25 Toyota Jidosha Kabushiki Kaisha Electric power steering device
WO2010047974A1 (fr) 2008-10-23 2010-04-29 Medtronic, Inc. Système automatique de commande de dose pour le traitement de l'hépatite c en utilisant des pompes d'infusion

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090038617A1 (en) 1997-11-07 2009-02-12 Michael Berthon-Jones Administration of cpap treatment in presence of apnea
US20100044146A1 (en) 2005-10-21 2010-02-25 Toyota Jidosha Kabushiki Kaisha Electric power steering device
US20090060121A1 (en) 2006-03-16 2009-03-05 Koninklijke Philips Electronics N. V. Computed tomography data acquisition apparatus and method
US20080078843A1 (en) 2006-09-19 2008-04-03 Wolf-Dieter Wichmann Dosing pump, spraying device for spraying sprays and method for operating such a spraying device
WO2009046369A2 (fr) 2007-10-05 2009-04-09 Medtronic, Inc. Contrôle pharmacocinétique pour l'administration optimisée d'interféron
WO2009120991A2 (fr) 2008-03-27 2009-10-01 Medtronic, Inc. Outils pharmacocinétiques et pharmacodynamiques destinés à définir des régimes thérapeutiques spécifiques à un patient
WO2010047974A1 (fr) 2008-10-23 2010-04-29 Medtronic, Inc. Système automatique de commande de dose pour le traitement de l'hépatite c en utilisant des pompes d'infusion

Non-Patent Citations (75)

* Cited by examiner, † Cited by third party
Title
"National Institutes of Health Consensus Development Conference Statement: Management of hepatitis C", GASTROENTEROLOGY, vol. 123, no. 6, 10 June 2002 (2002-06-10), pages 2082 - 2099
A. C. SYVANEN ET AL., GENOMICS, vol. 8, 1990, pages 684 - 692
ALAN S. PERELSON ET AL.: "New kinetic models for the hepatitis C virus", HEPATOLOGY, vol. 42, no. 4, 2005, pages 749 - 754
ANDREW H TALAL ET AL.: "Pharmacodynamics of PEG-IFN a Differentiate HIV/HCV Coinfected Sustained Virological Responders from Nonresponders", HEPATOLOGY, vol. 43, no. 5, 2006, pages 943 - 953, XP002632822, DOI: doi:10.1002/HEP.21136
ARIMURA ET AL., J NEUROVIROL, vol. 13, no. 4, 2007, pages 364 - 72
BONATE, P.L.: "Pharmacokinetic-Pharmacodynamic Modeling and Simulation", 2006, SPRINGER SCIENCE&BUSINESS MEDIA
BONATE, P.T.: "Pharmacokinetic-Pharmacodynamic Modeling and Simulation", 2006, SPRINGER SCIENCE&BUSINESS MEDIA
BONNEM ET AL., J BIOL RESPONSE MOD, vol. 3, no. 6, 1984, pages 580 - 98
BUDD ET AL., CANCER CHCMOTHCR PHARMACOL, vol. 12, no. 1, 1984, pages 39 - 42
CALICETI ET AL., DIGESTIVE AND LIVER DISEASE, vol. 36, no. 3, 2004, pages S334
CHRISTEFF ET AL., EUROPEAN JOURNAL OF CLINICAL INVESTIGATION, vol. 32, no. 1, January 2002 (2002-01-01), pages 43 - 50
DAHARI ET AL., HEPATOLOGY, vol. 46, no. 1, 2007, pages 16 - 21
DAHARI, H.; A. LO ET AL.: "Modeling hepatitis C virus dynamics: liver regeneration and critical drug efficacy", J THEOR BIOL, vol. 247, no. 2, 2007, pages 371 - 81, XP022103604, DOI: doi:10.1016/j.jtbi.2007.03.006
DAHARI, II.; R. M. RIHEIRO ET AL.: "Triphasic decline of hepatitis C virus RNA during antiviral therapy", HEPATOLOGY, vol. 46, no. 1, 2007, pages 16 - 21
DAVIS ET AL., NEJM, vol. 339, no. 21, 1998, pages 1493 - 99
DESIL, PHARM RES, vol. 20, no. 11, 2003, pages 1885 - 900
DIXIT, N. M.; J. E. LAYDEN-ALMER ET AL.: "Modelling how ribavirin improves interferon response rates in hepatitis C virus infection", NATURE, vol. 432, no. 7019, 2004, pages 922
FELD ET AL., NATURE, vol. 436, no. 7053, 2005, pages 967 - 72
FERNANDEZ ET AL., J CLIN GASTROENTEROL., vol. 30, no. 2, 2000, pages 181 - 6
G. T- DAVIS, N. ENGL. J. MED., vol. 339, pages 1493 - 1499
GABRIELSSON, J.; D. WEINER: "Pharmacokinetic and Pharmacodynamic Data Analysis: Concepts and Applications", 2000, SWEDISH PHARMACEUTICAL PRESS
GE ET AL., NATURE, vol. 461, no. 7262, 2009, pages 399 - 401
GE, NATURE, vol. 461, no. 7262, 2009, pages 399 - 401
GLUE ET AL., CLIN PHARMACOL THER, no. 5, 2000, pages 556 - 67
GLUE ET AL., CLIN PHARMACOL THER, vol. 68, no. 5, 2000, pages 556 - 67
GLUE, CLIN PHARMACOL THCR, vol. 68, no. 5, 2000, pages 556 - 67
GLUE, CLIN PHARMACOL THER, vol. 68, no. 5, 2000, pages 556 - 67
J. G. HACIA, NATURE GENET., vol. 21, 1999, pages 42 - 47
J. G. MCIIUTCHINSON ET AL., N. ENGL. J. MED., vol. 339, 1998, pages 1485 - 1492
JOHAN GARBIELSSON; DAN WEINER: "PHARMACOKINETIC & PHARMACODYNAMIC DATA ANALYSIS: CONCEPTS & APPLICATIONS", 2000, SWEDISH PHARMACEUTICAL PRESS, pages: 161 - 177
KEATING ET AL., DRUGS, vol. 63, no. 7, 2003, pages 701 - 30
KOSKINAS ET AL., MED VIROL., vol. 81, no. 5, 24 March 2009 (2009-03-24), pages 848 - 852
LAM ET AL., DIGESTIVE DISEASES AND SCIENCES, vol. 42, no. 1, 1997, pages 178 - 85
LEEVY CB.: "Consensus Tnterferon and Ribavirin in Patients with Chronic Hepatitis C Who Were Nonresponders to Pegylated Interferon alfa-2b and Ribavirin", DIGESTIVE DISEASES AND SCIENCES, 2008
LI-ZHE XU ET AL., J. GEN. VIROL., vol. 75, 1994, pages 2393 - 98
MALAQUARNERA, EUR J GASTROENTEROL HEPATOL., vol. 12, no. 8, August 2000 (2000-08-01), pages 937 - 9
MANNS ET AL., LANCET, vol. 358, no. 9286, 2001, pages 958 - 65
MCCARTHY ET AL., GASTROENTEROLOGY, vol. 138, no. 7, 2010, pages 2307 - 14
MCCARTHY ET AL., GASTROENTEROLOGY, vol. 138, no. 7, June 2010 (2010-06-01), pages 2307 - 14
NEUMANN A ET AL., SCIENCE, vol. 282, no. 5386, 1998, pages 103 - 7
NEUMANN, A. U.; N. P. LAM ET AL.: "Hepatitis C viral dynamics in vivo and the antiviral efficacy of interferon-alpha therapy", SCIENCE, vol. 282, no. 5386, 1998, pages 103 - 7
NIEWOLD ET AL., GENES IMMUN., vol. 8, 2007, pages 492 - 502
OBENAUER-KUTNER ET AL., JOURNAL OF IMMUNOLOGICAL METHODS, vol. 206, no. 1-2, 7 August 1997 (1997-08-07), pages 25 - 33
PERELSON ET AL., SCIENCE, vol. 271, no. 5255, 1996, pages 1582 - 6
PHARSIGHT: "Noncompartmental Analysis. User's Guide: Phoenix™ WinNonlin", vol. 6.1., 2009, pages: 251 - 302
PHARSIGHT: "Noncompartmental Analysis. User's Guide: Phoenix™ WinNonlin(R)", vol. 6.1, 2009, pages: 251 - 302
PIRISI ET AL., DIGESTIVE DISEASES AND SCIENCES, vol. 42, no. 4, 1997, pages 767 - 7771
PODEVIN ET AL., J HEPATOL., no. 2, 1997, pages 265 - 71
POWERS ET AL.: "Modeling viral and drug kinetics: hepatitis C virus treatment with pegylated interferon alfa-2b", SCMIN LIVER DIS, vol. 23, no. 1, 2003, pages 13 - 18
POWERS, K. A.; R. M. RIBCIRO: "Kinetics of hepatitis C virus reinfection after liver transplantation", LIVER TRANSPL, vol. 12, no. 2, 2006, pages 207 - 16
POYNARD ET AL., LANCET, vol. 352, no. 9138, 1998, pages 1426 - 32
QUIROGA ET AL., DIG DIS SCI, vol. 39, no. 11, 1994, pages 2485 - 96
R. K. SAIKI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6230 - 6234
R. K. SAIKI ET AL., SCIENCE, 1988
RADWANSKI ET AL., CLIN PHARMACOL, vol. 27, no. 5, 1987, pages 432 - 5
RADWANSKI ET AL., J CLIN PHARMACOL, vol. 27, no. 5, 1987, pages 432 - 5
RADWANSKI, J CLIN PHARMACOL, vol. 27, no. 5, 1987, pages 432 - 5
RAUCH ET AL., GASTROENTEROLOGY, vol. 138, no. 4, 2010, pages 1338 - 45
RAUCH ET AL., GASTROENTEROLOGY, vol. 138, no. 4, April 2010 (2010-04-01), pages 1338 - 45
ROMERO-GOMEZ ET AL., J HEPATOL, vol. 48, no. 5, 2008, pages 721 - 7
ROSTAING ET AL., J AM SOC NEPHROL, vol. 9, no. 12, 1908, pages 2344 - 8
SHARGEL ET AL.: "Applied Biopharmaceutics and pharmacokinetics", 1992, APPLETON & LANGE
SHARGEL L; YU ABC, APPLIED BIOPHARMACEUTICS AND PHARMACOKINETICS, 1992
SHUDO ET AL., J VIRAL HEPAT, vol. 15, no. 5, 2008, pages 379 - 82
SIBBITT ET AL., ARTHRITIS & RHEUMATISM, vol. 28, no. 6, 2005, pages 624 - 629
SIMMONDS ET AL., J. GEN. VIROL., vol. 74, 1994, pages 661 - 668
STERLING ET AL., DIG DIS SCI., vol. 53, no. 5, May 2008 (2008-05-01), pages 1375 - 82
TALAL ET AL., HEPATOLOGY, vol. 43, no. 5, 2006, pages 943 - 53
TANAKA ET AL., NAT GENET., vol. 41, no. 10, 2009, pages 1105 - 9
THOMAS ET AL., NATURE, vol. 461, no. 7265, 2009, pages 798 - 801
TSUBOTA ET AL., BR J CLIN PHARMACOL, vol. 55, no. 4, 2003, pages 360 - 7
U. LANDEGREN ET AL., SCIENCE, vol. 24, 1988, pages 1077 - 1080
V. LYAMICHCV, NATURE BIOTCCHNOL., vol. 17, 1999, pages 292 - 296
W. M. HOWELL ET AL., NATURE BIOTECHNOL., vol. 17, 1999, pages 87 - 88
ZEUZEM ET AL.: "Pharmacokinetics of Peginterferons", SEMINARS IN LIVER DISEASE, 2003, pages 023

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012116370A1 (fr) 2011-02-25 2012-08-30 Medtronic, Inc. Procédés et systèmes utilisant des profils pharmacocinétiques et pharmacodynamiques dans régimes thérapeutiques d'interféron-alpha
WO2013062959A2 (fr) * 2011-10-26 2013-05-02 Medtronic, Inc. Administration continue sous-cutanée d'interféron alpha à des patients infectés par le virus de l'hépatite b
WO2013062959A3 (fr) * 2011-10-26 2013-07-11 Medtronic, Inc. Administration continue sous-cutanée d'interféron alpha à des patients infectés par le virus de l'hépatite b
US10083400B2 (en) 2012-10-05 2018-09-25 Diane R. MOULD System and method for providing patient-specific dosing as a function of mathematical models updated to account for an observed patient response
US10268966B2 (en) 2012-10-05 2019-04-23 Diane R. MOULD System and method for providing patient-specific dosing as a function of mathematical models updated to account for an observed patient response
US10706364B2 (en) 2012-10-05 2020-07-07 Diane R. MOULD System and method for providing patient-specific dosing as a function of mathematical models updated to account for an observed patient response
US10740687B2 (en) 2012-10-05 2020-08-11 Diane R. MOULD System and method for providing patient-specific dosing as a function of mathematical models updated to account for an observed patient response
US11373743B2 (en) 2012-10-05 2022-06-28 Diane R. MOULD System and method for providing patient-specific dosing as a function of mathematical models updated to account for an observed patient response
WO2016164665A1 (fr) * 2015-04-09 2016-10-13 Mould Diane R Systèmes et procédés de dosage spécifique au patient
US11501863B2 (en) 2015-04-09 2022-11-15 Diane R. MOULD Systems and methods for patient-specific dosing

Also Published As

Publication number Publication date
WO2011059824A3 (fr) 2011-07-21

Similar Documents

Publication Publication Date Title
Lawitz et al. Antiviral effects and safety of telaprevir, peginterferon alfa-2a, and ribavirin for 28 days in hepatitis C patients
Ascione et al. Peginterferon alfa-2a plus ribavirin is more effective than peginterferon alfa-2b plus ribavirin for treating chronic hepatitis C virus infection
Jensen et al. Re-treatment of patients with chronic hepatitis C who do not respond to peginterferon-α2b: a randomized trial
McHutchison et al. Adherence to combination therapy enhances sustained response in genotype-1–infected patients with chronic hepatitis C
Lo Re III et al. Relationship between adherence to hepatitis C virus therapy and virologic outcomes: a cohort study
Muir et al. Daclatasvir in combination with asunaprevir and beclabuvir for hepatitis C virus genotype 1 infection with compensated cirrhosis
US20110184379A1 (en) Method and system to define patient specific therapeutic regimens by means of pharmacokinetic and pharmacodynamic tools
Younossi et al. Effects of sofosbuvir-based treatment, with and without interferon, on outcome and productivity of patients with chronic hepatitis C
Schwarz et al. The combination of ribavirin and peginterferon is superior to peginterferon and placebo for children and adolescents with chronic hepatitis C
Osinusi et al. Sofosbuvir and ribavirin for hepatitis C genotype 1 in patients with unfavorable treatment characteristics: a randomized clinical trial
McHutchison et al. Current therapy for hepatitis C: pegylated interferon and ribavirin
Mira et al. Efficacy of pegylated interferon plus ribavirin treatment in HIV/hepatitis C virus co-infected patients receiving abacavir plus lamivudine or tenofovir plus either lamivudine or emtricitabine as nucleoside analogue backbone
Larrey et al. Education by a nurse increases response of patients with chronic hepatitis C to therapy with peginterferon-α2a and ribavirin
Ioannou et al. Similar effectiveness of boceprevir and telaprevir treatment regimens for hepatitis C virus infection on the basis of a nationwide study of veterans
Carrión et al. A multidisciplinary support programme increases the efficiency of pegylated interferon alfa-2a and ribavirin in hepatitis C
Weiss et al. adherence to medication for chronic hepatitis C–building on the model of human immunodeficiency virus antiretroviral adherence research
Mauss et al. Estimating the likelihood of sustained virological response in chronic hepatitis C therapy
Reddy et al. Induction pegylated interferon alfa-2a and high dose ribavirin do not increase SVR in heavy patients with HCV genotype 1 and high viral loads
Beste et al. Predictors of early treatment discontinuation among patients with genotype 1 hepatitis C and implications for viral eradication
US20110027229A1 (en) Continuous subcutaneous administration of interferon-alpha to hepatitis c infected patients
Witthöft et al. Efficacy and tolerability of peginterferon alfa‐2a or alfa‐2b plus ribavirin in the daily routine treatment of patients with chronic hepatitis C in Germany: The PRACTICE Study
Kamal et al. Enhanced efficacy of pegylated interferon alpha‐2a over pegylated interferon and ribavirin in chronic hepatitis C genotype 4A randomized trial and quality of life analysis
Macías et al. Changes in liver stiffness in patients with chronic hepatitis C with and without HIV co-infection treated with pegylated interferon plus ribavirin
Pineda et al. Influence of concomitant antiretroviral therapy on the rate of sustained virological response to pegylated interferon plus ribavirin in hepatitis C virus/HIV-coinfected patients
Litwin et al. Successful treatment of chronic hepatitis C with triple therapy in an opioid agonist treatment program

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10776027

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10776027

Country of ref document: EP

Kind code of ref document: A2