WO2011059503A1 - Cells, vectors, and methods for treating a viral infection - Google Patents

Abstract

Disclosed herein are cells, pharmaceutical compositions vectors, nucleotide sequences, nucleic acids, and methods for reducing the viral load of a subject infected with a virus.

Description

CELLS, VECTORS, AND METHODS FOR TREATING A VIRAL INFECTION

BACKGROUND

[001] Acquired immune deficiency syndrome or acquired immunodeficiency syndrome (AIDS) is a disease of the human immune system. It is caused by the human immunodeficiency virus (HIV). Once an individual is infected with HIV, the virus progressively reduces the competence of the immune system by targeting and depleting immune cells. Infected individuals become susceptible to opportunistic infections and neoplastic growths.

[002] While a number of drugs have been approved for the treatment of AIDS, there is no vaccine or cure available for the disease. US Patent Number 7,462,485 to Glaser proposes administering modified erythrocytes, that include CD4 and at least one HIV coreceptor, to an HIV patient. These modified erythrocytes bind to the plasma virus and induce the injection of the HIV ribonucleoprotein complex into the cells. The entrapped viral content is thus either degraded or deactivated within the erythrocytes, or destroyed by erythrophagocytosis.

[003] However, since erythrocytes only live 100-120 days, this method would necessarily require frequent reinjection of the modified erythrocytes into an HIV- infected patient. Such reinjections would likely be expensive and burdensome to patients and the healthcare system. Similarly, they can lead to dangerous side effects, such as iron overload, a main cause of mortality due to frequent transfusions in patients with beta thalassemia. Thus, there is a need for improved therapies.

SUMMARY

[004] In one embodiment, provided herein is a cell comprising a recombinantly- produced nucleotide sequence including a first coding sequence encoding CD4 operably linked to a first erythroid-specific promoter with said first coding sequence, and a second coding sequence encoding an HIV co-receptor operably linked to a second erythroid-specific promoter. In one example, the HIV co- receptor is CCR5 or CXCR4. In another example, the HIV co-receptor is selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1, and CX3CR1. The first erythroid-specific promoter can be the same or different than the second erythroid-specific promoter. The cell is a hematopoietic stem cell, a hematopoietic progenitor cell, an embryonic stem cell, an adult stem cell, and/or a human cell. Also disclosed is a pharmaceutical composition comprising at least 0.5 x10⁶ recombinant cells described herein, and a pharmaceutically acceptable carrier.

[005] Further disclosed is a method of reducing the HIV viral load in a subject infected with HIV. The method includes administering to the subject a cell comprising a first coding sequence encoding CD4 operably linked to a first promoter, and a second coding sequence encoding an HIV co-receptor domain operably linked to a second promoter. The cell is a hematopoietic progenitor cell, a hematopoietic stem cell, an embryonic stem cell, an adult stem cell, and/or a human cell. In some examples, the first promoter is erythroid-specific. In some examples, he second promoter is erythroid-specific. Preferably, the subject is a human being. In one example, the HIV co-receptor is CCR5 or CXCR4. In another example, the HIV co-receptor is selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1 , and CX3CR1. In yet another example, the method further includes the step of removing a cell from the subject, and introducing into the cell a first coding sequence encoding CD4 operably linked to a first erythroid-specific promoter and a second coding sequence encoding an HIV co-receptor operably linked to a second promoter, wherein the cell is administered to the subject.

[006] Further disclosed is a nucleic acid molecule comprising a coding

sequence encoding one of a viral receptor and a viral co-receptor, and an erythroid-specific promoter, wherein said erythroid-specific promoter regulates transcription of the coding sequence when said nucleotide sequence is incorporated into a human cell and transcribed by the human cell, and wherein the erythroid-specific promoter is not natively associated with said coding sequence. In one example, the viral receptor is CD4, and the viral co-receptor is selected from the group consisting of CCR1, CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1 , and CX3CR1. Further disclosed is a plasmid comprising the nucleic acid molecule. Also disclosed is a viral vector comprising the nucleic acid molecule.

DETAILED DESCRIPTION

[007] All articles, patents and patent applications cited herein are hereby incorporated by reference in their entirety as if set forth herein.

Definitions

[008] As used herein, an element or step recited in the singular should be understood as not excluding plural said elements or steps, unless such exclusion is explicitly recited. Furthermore, references to "one embodiment" of the present invention are not intended to be interpreted as excluding the existence of additional embodiments that also incorporate the recited features. Elements or steps recited in the plural should be understood to not exclude singular said elements or steps unless expressly stated herein.

[009] As used herein, an "erythroid-specific promoter" is a promoter found in wildtype proteins that are transcribed during erythropoiesis or in cells within the hematopoietic lineage (e.g., hematopoietic stem cell, proerythroblast

(pronormoblast), basophilic erythroblast, polychromatic erythroblast,

orthochromatic erythroblast (normoblast), polychromatic erythrocyte

(reticulocyte), and an erythrocyte). [0010] As used herein, "erythropoietic" refers to a cell that has been committed to erythropoiesis, such as a hematopoietic stem cell, proerythroblast

(pronormoblast), basophilic erythroblast, polychromatic erythroblast,

orthochromatic erythroblast (normoblast), polychromatic erythrocyte

(reticulocyte), and an erythrocyte.

[0011] As used herein, the expression "operably linked" relates to the orientation of the promoter with respect to the sequence of an activatable coding sequence. The promoter is placed such that it is able to control or regulate the expression of said activatable coding sequence(s).

[0012] In some embodiments described herein, coding sequences are operably linked to the same erythroid-specific promoter. The term "same" does not refer to the same copy of an erythroid-specific promoter, but rather to the same type of promoter. For example, a cell including the coding sequence of CD4 operably linked to a first copy of the GYPA promoter, and the coding sequence of CXCR4 operably linked to a second copy of the GYPA promoter can be said to have two different coding sequences that are each operably linked to the same promoter.

[0013] The terms "treat", "treating", and "treatment" each refer to a reduction in viral load of a subject infected with a virus in certain embodiments. In other embodiments, each of the above three terms refer to the halting or modification of disease progression.

[0014] Provided herein are cells that include recombinant nucleotide sequences encoding a viral receptor and a viral co-receptor, each operably linked to an erythroid-specific promoter. In other embodiments, the coding sequences only encode the extracellular portion of the viral receptor or co-receptor. The cells can be any cells that can be differentiated or programmed in vivo or in vitro to undergo erythropoiesis. Examples include hematopoietic stem cells,

hematopoietic progenitor cells, embryonic hematopoietic stem cells, embryonic stem cells, placental hematopoietic stem cells or other adult stem cells. In certain embodiments, the cells are purified and isolated. Once administered to a subject suffering from a viral infection, such cells mature in vivo into erythrocytes expressing viral receptors and co-receptors that can entrap viral particles, thereby removing the viruses from the blood or other tissues that are accessible to the erythrocytes. Because erythrocytes lack nucleic acid synthesis machinery, an entrapped virus cannot replicate or otherwise initiate viral functions. As a result, the entrapped virus is either degraded or deactivated within the

erythrocytes, or destroyed by phagocytes during erythrophagocytosis.

Advantageously, the recombinant cells disclosed herein can be used to provide a long-term supply of recombinant erythrocytes that are capable of decreasing a subject's viral load.

[0015] For example, the virus can be HIV-1 or HIV-2. As used herein, HIV is used to refer to either or both HIV-1 and/or HIV-2, as would make sense to a person having skill in the art based on context. HIV is a member of the lentivirus family of retroviruses. Various strains having been identified for each type of HIV (HIV-1 and HIV-2). HIV uses a receptor-mediated pathway in the infection of host cells. HIV-1 requires contact with two cell-surface receptors to gain entry into cells and initiate infection. CD4 is the primary receptor. CXCR4 and CCR5, members of the chemokine receptor family of proteins, serve as secondary coreceptors for HIV- 1 strains that are tropic for T-cell lines or macrophages, respectively. Many HIV-2 strains also utilize CCR5 or CXCR4 to enter host cells.

[0016] CD4 (CD 4 antigen (p55)) is a cell-surface glycoprotein found on the mature helper T cells and immature thymocytes, as well as on monocytes and macrophages. Some cytotoxic T cells and natural killer cells also express CD4 protein. An exemplary human CD4 sequence is illustrated in U.S. Patent No. 7,462,485.

[0017] CCR5 (chemokine (C-C motif) receptor 5) is a member of the beta chemokine receptor family, which is predicted to have seven transmembrane domains similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be a co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. Expression of CCR5 was also detected in a promyeloblastic cell line. An exemplary human CCR5 sequence is illustrated in U.S. Patent No. 7,462,485.

[0018] CXCR4 (chemokine (C-X-C motif) receptor 4; also known as fusin) is a CXC chemokine receptor specific for stromal cell-derived factor-1. CXCR4 also has seven transmembrane regions. It acts with the CD4 protein to support HIV entry into cells. Alternate transcriptional splice variants encoding different CXCR4 isoforms have been identified. Two exemplary CXCR4 isoform sequences are illustrated in U.S. Patent No. 7,462,485.

[0019] Without limiting the present invention to any particular theory, it is believed that the interaction between the viral envelope glycoprotein gp120 and CD4 triggers the fusion between viral and host membranes. This interaction, which is also facilitated by cell surface glycosaminoglycans, leads to conformational changes in gp120, which results in the interaction between gp120 and a secondary coreceptor, mostly CCR5 or CXCR4. The double engagement of CD4 and a secondary coreceptor induces a sharp conformational change of a second viral envelope protein, gp41 , which acts as a fusogenic component leading to the fusion of viral and cell membranes required for the injection of the HIV

ribonucleoprotein complex into the host cell cytoplasm.

[0020] It has been reported that HIV-1 strains transmitted in vivo generally use CCR5. These viruses typically infect macrophages and primary CD4⁺

lymphocytes, and do not form syncytia in vitro. These viruses are said to be macrophage tropic (M-tropic or R5 strain). After primary HIV-1 infection, viral populations are usually characterized by molecular heterogeneity.

[0021] Years after chronic infection is established, strains using CXCR4 emerge in about 50% of infected individuals. CXCR4 strains not only infect primary T lymphocytes but also replicate in T-cell lines and induce syncytia. These viruses are said to be T-cell tropic (T-tropic or X4 strain). This difference in cell tropism correlates with disease progression. During HIV infection, strains isolated from individuals early in the course of their infection are usually M-tropic, while viruses isolated from approximately 50% of individuals with advanced immunodeficiency also include viruses that are T-tropic. This suggests that the ability of the viral envelope to interact with CXCR4 represents an important feature in the pathogenesis of immunodeficiency and the development of full blown acquired immunodeficiency syndrome.

[0022] Other HIV coreceptors have also been reported. These coreceptors include, but are not limited to, CCR1 , CCR2, CCR3, CCR4, CCR8, CXCR1 , CXCR2, CXCR3, CXCR6, GPR15, APJ, CMKLR1 , and CX3CR1.

[0023] CCR1 (chemokine (C-C motif) receptor 1) is a member of the beta chemokine receptor family, which is predicted to have seven transmembrane domains. Chemokines and their receptors mediate signal transductions that are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse CCR1 homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. The CCR1 gene and other chemokine receptor genes including CCR2, CCRL2, CCR3, CCR5 and CCXCR1 form a gene cluster on chromosome 3p. A non-limiting example of a human CCR1 sequence is illustrated in U.S. Patent No. 7,462,485.

[0024] CCR2 (chemokine (C-C motif) receptor 2; also known as CCR2b) is a receptor for monocyte chemoattractant protein-1 , a chemokine which specifically mediates monocyte chemotaxis. Monocyte chemoattractant protein-1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. CCR2 is capable of mediating agonist-dependent calcium mobilization and inhibition of adenylyl cyclase. At least two alternatively spliced CCR2 isoforms have been identified. Exemplary sequences for these two isoform sequences are illustrated in U.S. Patent No. 7,462,485.

[0025] CCR3 (chemokine (C-C motif) receptor 3) is receptor for C-C type chemokines. It belongs to family 1 of the G protein-coupled receptors. This receptor binds and responds to a variety of chemokines, including eotaxin

(CCL1 ), eotaxin-3 (CCL26), MCP-3 (CCL7), MCP-4 (CCL13), and RANTES (CCL5). It is highly expressed in eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. This receptor may contribute to the accumulation and activation of eosinophils and other

inflammatory cells in the allergic airway. At least two alternatively spliced transcript variants have been identified for CCR3. Both isoforms encode the same protein. An exemplary sequence for human CCR3 is illustrated in U.S. Patent No. 7,462,485.

[0026] CCR4 (chemokine (C-C motif) receptor 4) belongs to the G-protein- coupled receptor family. It is a receptor for the CC chemokine, including MIP-1 , RANTES, TARC and MCP-1. CCR4 is expressed with high frequency in adult T- cell leukemia and human T-cell leukemia virus type 1 -transformed T cells and in ATL skin lesions. An exemplary human CCR4 sequence is illustrated in U.S. Patent No. 7,462,485.

[0027] CCR8 (chemokine (C-C motif) receptor 8) is a member of the beta chemokine receptor family and predicted to have seven transmembrane domains. This receptor protein is preferentially expressed in the thymus. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. This receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and

specialized areas of lymphoid tissues. An exemplary human CCR8 sequence is illustrated in U.S. Patent No. 7,462,485.

[0028] CXCR1 (interleukin 8 receptor, alpha; or IL8RA) is a member of the G- protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. Knockout studies in mice suggested that this protein inhibits embryonic oligodendrocyte precursor migration in developing spinal cord. An exemplary human CXCR1 sequence is illustrated in U.S. Patent No. 7,462,485.

[0029] CXCR2 (interleukin 8 receptor, beta; or IL8RB) is also a member of the G- protein-coupled receptor family. Like CXCR1 , this protein is a receptor for interleukin 8 (IL8). CXCR2 binds to chemokine (C-X-C motif) ligand 1

(CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. CXCR2 mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by CXCR2. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. The genes encoding CXCR1 and CXCR2, as well as the IL8RBP gene, form a gene cluster in a region mapped to chromosome 2q33- q36. An exemplary human CXCR2 sequence is depicted in U.S. Patent No. 7,462,485.

[0030] CXCR3 (chemokine (C-X-C motif) receptor 3) is a G protein-coupled receptor with selectivity for three chemokines-namely, IP 10 (interferon-g- inducible 10 kDa protein), Mig (monokine induced by interferon-g), and l-TAC (interferon-inducible T cell a-chemoattractant). IP10, Mig and l-TAC belong to the structural subfamily of CXC chemokines, in which a single amino acid residue separates the first two of four highly conserved Cys residues. Binding of chemokines to CD183 induces cellular responses that are involved in leukocyte traffic, including integrin activation, cytoskeletal changes and chemotactic migration. Inhibition by Bordetella pertussis toxin suggests that heterotrimeric G protein of the Gi-subclass couple to CD183. A hallmark of CD183 is its prominent expression in vitro cultured effector/memory T cells, and in T cells present in many types of inflamed tissues. In addition, IP10, Mig and l-TAC are commonly produced by local cells in inflammatory lesion, suggesting that CD 183 and its chemokines participate in the recruitment of inflammatory cells. An exemplary human CXCR3 sequence is provided in U.S. Patent No. 7,462,485.

[0031] CXCR6 (chemokine (C-X-C motif) receptor 6; also known as STRL33) is predominantly localized in colorectal epithelial cells and some scattered stromal cells. It has been reported that HIV-2 isolates from aviremic and viremic individuals commonly use CCR5, GPR15, or CXCR6 as coreceptors, in combination with CD4. A non-limiting example of a human CXCR6 sequence is illustrated in U.S. Patent No. 7,462,485.

[0032] GPR15 (G protein-coupled receptor 15; also know as BOB) plays a role in HIV gp120 binding to intestinal epithelial cells and gp120-induced cytopathic effects. An exemplary human GRP15 sequence is provided in U.S. Patent No. 7,462,485.

[0033] APJ (angiotensin II receptor-like 1 or AGTRL1) mediates effects of angiotensin II. This gene is related to the AGTR1 gene by sequence similarity. It was cloned based on a conserved transmembrane domain found in members of the G protein-coupled receptor gene family. An exemplary human APJ sequence is illustrated in U.S. Patent No. 7,462,485.

[0034] CMKLR1 (chemokine-like receptor 1 ; also known as ChemR23) has been reported to mediate the Resolvin E1 signal to attenuate nuclear factor-.kappa.B. A non-limiting example of a human C KLR1 sequence is illustrated in U.S.

Patent No. 7,462,485.

[0035] CX3CR1 (chemokine (C-X3-C motif) receptor 1) is selectively expressed on various lineages of lymphocytes with high contents of intracellular perforin and granzyme B. The impact of CX3CR1 polymorphisms on HIV-1 pathogenesis and infection progression in children has been reported. A non-limiting example of a human CX3CR1 sequence is illustrated in U.S. Patent No. 7,462,485.

[0036] Thus, disclosed herein are recombinant cells that include nucleotide sequences including the coding sequence encoding CD4 operably linked to a first erythroid-specific promoter and the coding sequence of at least one HIV coreceptor (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different coreceptors) each operably linked to an erythroid-specific promoter. The co-receptors can each be linked to the same promoters, different promoters, or a combination of the two (i.e., some co-receptors are linked to the same promoters while others are not.) In embodiments where there are multiple co-receptors, they may each be operably linked to the same or different erythroid-specific promoter as other co- receptor coding sequences. In some embodiments, one or both of CD4 and the HIV coreceptor protein(s) employed are human proteins. In certain embodiments, the CD4 or HIV coreceptor proteins employed are identical to the corresponding endogenous proteins expressed in the subject to whom the recombinant mammalian cell is administered. The CD4 or HIV coreceptor proteins can also be modified to reduce or eliminate any potential graft-versus-host and host-versus- graft reactions including the use of endogenous proteins expressed in the subject to whom the recombinant mammalian cell is administered.

[0037] In one embodiment, the cells include the coding sequences of both CD4 and CCR5 each operably linked to an erythroid-specific promoter. These coding sequences are each operably linked to an erythroid-specific promoter. The cells may include additional HIV co-receptor(s) that are each operably linked to an erythroid-specific promoter, and are selected from CXCR4, CCR1 , CCR2, CCR3, CCR4, CCR8, CXCR1 , CXCR2, CXCR3, CXCR6, GPR15, APJ, CMKLR1 , or CX3CR1.

[0038] In another embodiment, the cells include the coding sequences encoding CD4 and CXCR4, each operably linked to an erythroid-specific promoter. The cells may further include coding sequences encoding one or more HIV coreceptor operably linked to an erythroid-specific promoter, the co-receptor selected from CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CCCR5, CXCR6, GPR15, APJ, CMKLR1 , or CX3CR1.

[0039] In another embodiment, the cells include coding sequences encoding CD4, CCR5, and CXCR4 each operably linked to an erythroid-specific promoter. The cells may include additional HIV co-receptor(s) that are each operably linked to an erythroid-specific promoter, and are selected from CCR1 , CCR2, CCR3, CCR4, CCR8, CXCR1 , CXCR2, CXCR3, CXCR6, GPR15, APJ, CMKLR1, or CX3CR1.

[0040] In another embodiment, the recombinant cells include a coding sequence encoding a co-receptor operably linked to an erythroid-specific promoter, but not CD4. The co-receptor is selected from CCR1, CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1 , or CX3CR1. [0041] HIV-1 infection of CD4-negative cells in vitro has been reported. This infection, however, is usually much less efficient than infection of cells that express CD4. It has also been reported that CD4-negative brain astrocytes can be infected by HIV-1 in vivo, particularly in pediatric AIDS patients. This virus appears to utilize CXCR4 to infect CD4-negative cells. Substitution of the V3 loop of the viral gp120 protein with that of an HIV R5 strain can produce viruses capable of CD4-independent infection via CCR5. Certain HIV-2 isolates have also been reported to infect CCR5* or CXCR4⁺ cells without CD4. The efficiency of CD4-independent infection by HIV-2 is often markedly higher than that of HIV- 1. As an example, the cells described herein include a coding sequence encoding one of. (a) CXCR4 but not CD4 (b) CCR5 but not CD4 (c) CXCR4 and CCR5 but not CD4. In the example described in the above sentence, the nucleotide sequences encoding these receptor and/or co-receptor protein are each operably linked to an erythroid-specific promoter. The cells may further include coding sequences encoding a co-receptor operably linked to an erythroid-specific promoter. The co-receptor is selected from the group consisting of CXCR4, CCR5, CCR1 , CCR2, CCR3, CCR4, CCR8, CXCR1, CXCR2, CXCR3, CXCR6, GPR15, APJ, CMKLR1 , or CX3CR1.

[0042] In various embodiments disclosed herein the cells include coding sequences encoding at least 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more HIV co- receptors, each operably linked to an erythroid-specific promoter. Each of the co-receptors is independently selected from CXCR4, CCR5, CCR1 , CCR2, CCR3, CCR4, CCR8, CXCR1 , CXCR2, CXCR3, CXCR6, GPR15, APJ,

CMKLR1 , or CX3CR1. In some of these embodiments, the cells may be transfected with an approximately equal number of copies of the receptor as of each co-receptor. In other embodiments, the cells may be transfected to include a significantly larger copy number of viral receptor under the control of an erythroid-specific promoter, as compared to one or more viral co-receptors that are under the control of an erythroid-specific promoter. For example, a cell may include CD4, CCR5 and CXCR4 in an approximate copy ratio of 2:1 :1 , 2.5:1 :1 or 3:1:1. [0043] Further disclosed herein are cells that comprise coding sequences encoding CD4 operably linked to an erythroid-specific promoter. These cells do not contain nucleotide sequences that encode other HIV coreceptors.

[0044] In some embodiments, the cells include nucleotide sequences that encode functional equivalents of naturally-occurring HIV receptor and/or coreceptor proteins (under the control of an erythroid-specific promoter), rather than or in addition to sequences coding naturally-occurring receptor or co-receptor proteins. Once expressed, these functional equivalents retain their abilities to interact with their respective viral proteins (e.g., gp120), and are capable of mediating HIV entry into host cells.

[0045] In certain embodiments, a functional equivalent of an HIV receptor and/or coreceptor has different transmembrane or intracellular domains as the natural protein. For example, the transmembrane or intracellular domains may be truncated or fully removed, so long as the remaining extracellular domain(s), when expressed by the host cell is able to interact with their respective viral protein(s) and mediating HIV entry into host cells. Methods suitable for preparing such a chimeric protein are well known in the art. Any HIV receptor and/or coreceptor described above can be so modified. The extracellular,

transmembrane, or intracellular domains of a naturally-occurring HIV receptor and/or coreceptor can be determined by using protein structure prediction programs such as TMHMM, or based on the annotations of Entrez or other available databases.

[0046] Functional equivalents also include biologically-active variants of HIV receptor and/or coreceptor proteins. A "variant" is a polypeptide which differs from the original protein by one or more amino acid substitutions, deletions, insertions, or other modifications. These modifications do not significantly change the biological activity of the original protein (e.g., the activity to mediate entry of HIV into host cells). In many cases, a variant retains at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the biological activity of original protein. The biological activity of a variant can also be higher than that of the original protein. A variant can be naturally-occurring, such as by allelic variation or polymorphism, or deliberately engineered.

[0047] The amino acid sequence of a variant is substantially identical to that of the original protein. In many embodiments, a variant shares at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99%, or more global sequence identity or similarity with the original protein. Sequence identity or similarity can be determined using various methods known in the art, such as Basic Local Alignment Tool (BLAST), dot matrix analysis, or the dynamic programming method. In one example, the sequence identity or similarity is determined by using the Genetics Computer Group (GCG) programs GAP (Needleman-Wunsch algorithm). Default values assigned by the programs can be employed, e.g., the penalty for opening a gap in one of the sequences is 11 and for extending the gap is 8. Similar amino acids can be defined by the BLOSU 62 substitution matrix. The amino acid

sequences of a variant and the original protein can be substantially identical in one or more regions, but divergent in other regions.

[0048] Any method known in the art may be used to prepare nucleotide sequences encoding the biologically-active variants of HIV receptor and/or coreceptor proteins. For instance, a variant protein can vary from an original protein by adding, deleting, substituting or modifying at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of the nucleic acids that encode the protein without significantly altering the biological activity of the protein. The amino acid changes can be conservative or non-conservative. Conservative amino acid substitutions can be introduced into a protein sequence without significantly changing the structure or biological activity of the protein. Conservative amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, or the amphipathic nature of the residues. For instance, conservative amino acid substitutions can be made among amino acids with basic side chains, such as lysine (Lys or K), arginine (Arg or R) and histidine (His or H); amino acids with acidic side chains, such as aspartic acid (Asp or D) and glutamic acid (Glu or E); amino acids with uncharged polar side chains, such as asparagine (Asn or N), glutamine (Gin or Q), serine (Ser or S), threonine (Thr or T), and tyrosine (Tyr or Y); or amino acids with nonpolar side chains, such as alanine (Ala or A), glycine (Gly or G), valine (Val or V), leucine (Leu or L), isoleucine (lie or I), proline (Pro or P), phenylalanine (Phe or F), methionine (Met or M), tryptophan (Trp or W) or cysteine (Cys or C). Examples of commonly used amino acid substitutions are illustrated in Table 1 of U.S. Patent No. 7,462,485.

[0049] The coding sequence of a receptor or co-receptor is also modifiable by attaching the coding sequence of an anchor protein to the 5' or 3' end of an exon encoding a cytoplasmic portion of the receptor or co-receptor, respectively.

Thus, when expressed, the cytoplasmic portion of the receptor or co-receptor is attached to an anchor protein which attaches directly or indirectly to the erythrocytic cytoskeleton, and the attached receptor or co-receptor is thus less likely to be lost during enucleation. Exemplary anchor genes (whose coding sequence can be attached to the 5' or 3' end of exons encoding receptor or co- receptor cytoplasmic domains include genes encoding proteins making up or attached directly or indirectly to the ankyrin complex and the 4.1R complex. Examples include ADD1 (also known as adducin 1 (alpha); RP11-520M5.1 ; ADDA; MGC3339; MGC44427), ADD2 (also known as adducin 2 (beta); ADDB), ADD3 (also known as adducin 3 (gamma), ANK1 (ankyrin 1, erythrocytic; ANK; SPH1 ; SPH2), EPB41 (also known as erythrocyte membrane protein band 4.1 , elliptocytosis 1 , RH-linked; HE; EL1 ; 4.1R), EPB42 (also known as erythrocyte membrane protein band 4.2; PA; SPH5; MGC116735; and MGC116737), EPB49 (also kown as erythrocyte membrane protein band 4.9 (dematin); DMT;

FLJ78462; and FLJ98848), PALLD (also known as palladin, cytoskeletal associated protein; PNCA1 ; SIH002; CGI-151 ; FLJ22190; FLJ38193; FLJ39139; KIAA0992), SPTA1 (also known as spectrin, alpha, erythrocytic 1 (elliptocytosis 2); EL2; HPP; HS3; SPH3; SPTA), SPTB (also known as spectrin, beta, erythrocytic; EL3; HS2; SPH2; HSpTBI), and TMOD1 (also known as

tropomodulin 1; TMOD; ETMOD; D9S57E). Other examples will be obvious to the skilled artisan. In one example, a nucleotide sequence encoding a domain of the anchor protein, rather than the entire protein is encoded at the 5' or 3' end of the cytoplasmic co-receptor coding sequence. The domain is chosen so that it associates or attaches to the erythrocytic cytoskeleton.

PROMOTERS

[0050] The recombinant cells, vectors, nucleotides, pharmaceutical preparation and other recombinant biological products described herein include coding sequences of viral receptors and/or co-receptors each operably linked to an erythroid-specific promoter. The promoter directs expression of the coding sequence to which it is operably linked. The erythroid-specific promoter is not natively associated with the coding sequence of the viral receptor or co-receptor whose expression it controls. In some embodiments, the biological products further include one or more viral receptors or co-receptors that are not under the control of an erythroid-specific promoter.

[0051] Promoters include a sequence of nucleic acids implicated and necessary in the initiation of transcription, which directs the expression of the activatable gene, and include the binding site of RNA polymerase. In some embodiments, the term "promoter" refers to other sites to which the transcription regulating proteins can bind, such as a functional fragment of a promoter. In other embodiments, the term "promoter" refers to the entire 5' regulatory sequence that is 5' of the ATG initiation site of the coding region.

[0052] In one example, the entire 5' regulatory sequence of the viral receptor or co-receptor is replaced with the entire 5' regulatory sequence of an erythroid- specific protein. In another example, a portion of the 5' regulatory region of an erythropoietic gene that is sufficient to initiate transcription is inserted into the native 5' regulatory region of the viral receptor or co-receptor. All or part of the protein native to the receptor or co-receptor coding sequence is removed. Other 5' regulatory elements of the erythroid-specific gene (e.g., enhancers) may also be inserted into the 5' regulatory sequence of the viral receptor or co-receptor. In each case, any insertions or deletions of nucleotides from the 5' regulatory region of the receptor or co-receptor do not alter the codons in the coding sequence.

[0053] Suitable erythroid-specific promoters are chosen based on whether they are active during erythropoiesis, strength of expression of the promoter during erythropoiesis, and the stage in erythropoiesis that the promoter is most active. Promoters can also be chosen based on size, since smaller promoters may be easier to manipulate in the laboratory than larger promoters.

[0054] The skilled artisan is familiar with techniques to determine whether and to what extent a protein is active in a particular set of erythropoietic cells. For example, methodologies for determining which proteins are expressed in erythropoietic cells are described in Southcott et al., The Expression of Human Blood Group Antigens During Erythropoiesis in a Cell Culture System, BLOOD: 1999: 4425-4435; Kakhniashvili et al., The Human Erythrocyte Proteome

Analysis by Ion Trap Mass Spectrometry, Molecular & Cellular Proteomics 3.5, p. 501-509 (2004); and Kabanova et al., Gene expression analysis of human red blood cells, International Journal of Medical Sciences, 2009:6(4): 156-159. It can be determined whether a promoter is active during erythropoiesis by isolating cells that are in the desired stage of erythropoiesis and determining which genes (and hence which promoters) are active. In one example, any promoter that is active in erythropoiesis can be used to control expression of the receptor or co- receptor(s), or extracellular domain thereof. Erythroid-specific promoters are those that natively control expression of erythropoietic proteins.

[0055] In another example, the coding sequence encoding the viral receptor is operably linked to an erythroid-specific promoter that is active at an earlier stage of erythropoiesis than the erythroid-specific promoter that controls the expression of the viral co-receptor coding sequence. The order of expression of these and other erythropoietic proteins, as well as procedures for determining such order, are disclosed in Southcott et al., The Expression of Human Blood Group

Antigens During Erythropoiesis in a Cell Culture System, BLOOD, 93:4425-4435 (1999).

[0056] In another embodiment, the coding sequence encoding the viral receptor is operably linked to an erythroid-specific promoter that is active at a later stage of erythropoiesis than the erythroid-specific promoter that controls the expression of the viral co-receptor coding sequence. For example, the coding sequence of the viral receptor may be under the control of the native GYPA promoter, while the viral co-receptor coding sequence may be under the control of an erythroid- specific promoter that is active earlier than the native GYPA promoter.

[0057] In another example, the viral receptor coding sequence is operably linked to a promoter that has peak activity during the Proerythroblast stage, while a viral co-receptor coding sequence is operably linked to a promoter having peak activity during one of the Basophilic Erythroblast or Polychromatophilic

Erythroblast phases. Thus, such cells will express a larger amount of receptor protein than the co-receptor protein assuming that the two promoters are approximately equal in their ability to cause expression of the protein whose expression they control. This and other embodiments may be useful for preventing or limiting the amount of time during which a nucleated erythroid cell is susceptible to viral infection.

[0058] Erythroid-specific promoters can also be chosen based on their relative strength of expression during erythropoiesis. For example, the viral receptor coding sequence can be operably linked to a first erythroid-specific promoter that results in approximately 1.5, 2, 2.5, 3, 3.5, or 4 times as much protein expression during erythropoiesis as a second promoter that is operably linked to a viral co- receptor coding sequence.

[0059] In another example, a biological product includes a coding sequence that encodes CD4 operably linked to a first erythroid-specific promoter, a coding sequence encoding CCR5 operably linked to a second erythroid-specific promoter and a coding sequence encoding CXCR4 operably linked to a third erythroid-specific promoter. The first, second and third erythroid-specific promoters may be chosen such that they result in protein expression in a ratio of approximately 2:1 :1 , respectively. The second and third promoter can be the same promoter or they can differ from each other. Such a cell will be a viable target to both M and T tropic HIV virus because CD4 will mediate entry of HIV with CCR5 or CXCR4, depending on the strain. In other embodiments, the first, second, and third promoter are chosen such that they cause expression of proteins whose expression they control in a ratio greater than approximately 2:1:1 , respectively. For example, the ratio may be approximately 2:1.5:1.5, 3:1 :1 , or 4:1 :1.

[0060] A number of erythroid-specific promoters are known in the art and others are likely to be characterized in the future. One example is the native promoter of GYPA (GenBank Accession Number NG 007470 a short form of this promoter is illustrated in SEQ ID NO: 1 and a long form of the GYPA promoter is illustrated in SEQ ID NO:2²), as reported in Lahlil et al., Molecular & Cellular Biology, Feb. 2004, vol. 24 no. 4, p1439-1452. Protocols for determining promoter sequences, such as those described in Lahlil, are well known. For example, the sequence of the gene Band 3 is provided in the Genbank accession number P02730, and parameters and primers for extracting, amplifying and sequencing its promoter region are found in von Kalckreuth, Promoter

Polymorphism of the Anion-Exchange Protein 1 Associated with Severe Malarial Anemia and Fatality, The Journal of Infectious Disease Society of America, 2006: 194:949-57. Another example of a known native erythroid-specific promoter is for the gene encoding protein 4.2 (GenBank accession number M60298; and a protocol for isolating and sequencing this promoter region is described in Remus

GCTTAACAACTTGCATCATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAG GAAGGTGGGCCTGGAAGATAACAGCTAGCAGGCTAAGGTCAGACACTGACACTTGCAGT TGTCTTTGGTAGTTTTTTTGCACTAACTTCAGGAACCAGCTCATGATCTCAGG

2 SEQ ID NO: 2:

GGGAGTCTTTCAGAACCTCAGAACACTCAAATGATTTAAATTTCTCAAATACATTCATTT

CACATATAGGAAGTCACTTTCATTTGGACCACTGGGTCTTGACATTAGAAATGAGAAGG

TCCATGGCTCCACAACAGCTACCTCAGCCTGGCACGTGCCCTGGCCTCAGAGATTCACAG

TCCAGTTCTTTGTCCAGTTGGGTGGCTCCTGTCTACCACCTTACCATGCCCACTTAACTG

ATGCAAAGTTAATATCACAAGTAGCAACCTGTTCCTTGCAGTGAAAATTTTACTTACCAC

TTTCATAGCCCCAAGATATCCATGTATCTTTATTAACAGGCGCTTAACAACTTGCATCAT

TTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCCTGGAAGAT

AACAGCTAGCAGGCTAAGGTCAGACACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTG

CACTAACTTCAGGAACCAGCTCATGATCTCAGG et al., DNA Methylation in Promoter Regions of Red Cell Membrane Protein Genes in Healthy Individuals and Patients with Hereditary Membrane Disorders. International Journal of Hematology, 81 (2005) 385-395. Yet another example, related to Duffy antigen/chemokine receptor gene (DARC) (GenBank accession number U01839); its promoter is described in Tournamille et al., Disruption of a GATA motif in the Duffy gene promoter abolishes erythroid gene expression in Duffy-negative individuals, Nature Genetics, volume 10, 224-228 (1995). A final example is the promoter for Hemoglobin beta (GenBank Accession Number J00173; a longer promoter is described in Ross et al., Differential requirement of a distal regulatory region for pre-initiation complex formation at globin gene promoters, Nucleic Acids Research 2009, 1-14, and a shorter promoter sequence is described in Hayakawa et al., Transient In Vivo β-Globin Production After Lentiviral Gene Transfer to Hematopoietic Stem Cells in the Nonhuman Primate, Human Gene Therapy 20: 563-572 (June 2009).

[0061] Further provided herein are pharmaceutical compositions suitable for administration to a human subject, including the recombinant cells described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition includes at least 0.5 x10⁶ recombinant cells per kg of subject's body weight. The phrase "pharmaceutically acceptable carrier" is used to mean any of the standard pharmaceutically acceptable carriers. Examples include, but are not limited to, phosphate buffered saline, physiological saline, and water.

Preparing Recombinant Cells

[0062] The recombinant cells described herein can be made by transfecting cells as further described herein. The cells are any cells that can be programmed or modified to become red blood cells in vivo or in vitro. For example, the cells can be hematopoietic stem cells, hematopoietic progenitor cells, embryonic

hematopoietic stem cells, embryonic stem cells or adult stem cells other than hematopoietic stem cell. The cells can be isolated from a mammal. The mammal can be a human being, a primate, a pig, a cow, a sheep, a rabbit, a horse, a mouse, or a rat. In some embodiments, the cells are isolated from the same subject as to whom they will be administered as further described herein.

[0063] Exemplary procedures suitable for isolating hematopoietic progenitor cells are described in Malik et al., BLOOD, 91 :2664-2671 (1998); Hanspal et al., BLOOD, 84:3494-3504 (1994); Wada et al., BLOOD, 75:505-511 (1990); and Fibach et al., BLOOD, 73:100-103 (1989). As another example, hematopoietic progenitor cells can be isolated and purified from placental cord blood as disclosed in Southcott et al., The Expression of Human Blood Group Antigens During Erythropoiesis in a Cell Culture System, BLOOD, 93:4425-4435 (1999).

[0064] In one example, hematopoietic progenitor cells are isolated from peripheral blood, bone marrow, or umbilical cord blood. These cells are typically CD34 positive and, therefore, can be purified using immunomagnetic beads coupled with anti-CD34 antibodies. The purified progenitor cells are transfected with expression vectors that encode viral receptor proteins under the control of an erythroid-specific promoter.

[0065] Exemplary procedures for isolating and culturing hematopoietic stem cells can be found in U.S. Patent No. 6,821 ,513, and U.S. published patent application numbers 20080057579 and 20070274965.

[0066] Exemplary procedures for isolating, culturing and enriching adult and embryonic stem cells are disclosed in U.S. Patent Publication Nos.

20090202564, 20090170193, 20080305085, 20070190042, 20070020759, 20070190042, and 20050095708.

[0067] Additional methods for isolating and manipulating bone marrow cells, including hematopoietic stem cells, from a bone marrow graft donor are known in the art. For example, they are described in U.S. Pat. Nos. 4,965,204, 5,035,994, 5,081 ,030, 5,130,144, 5,137,809, 6,068,836 and 6,200,606.

[0068] Cells can be transfected with expression vectors to make the recombinant cells described herein. These vectors including coding sequences encoding desired HIV receptor and/or coreceptor proteins, said coding sequences being operably linked to erythroid-specific promoters. They can be introduced into cells by transfection, transduction, electroporation, gene gun, or other gene transfer means.

[0069] Vectors include a coding sequence encoding one or more viral receptors or co-receptors operably linked to an erythroid-specific promoter. If the virus is HIV, the receptor is CD4 and the co-receptors are selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1 , and CX3CR1 , one or more of the coding sequences for the above proteins being operably linked to an erythroid-specific promoter. Vectors can, for example, encode the following:

(a) CD4

(b) CXCR4

(c) CCR5

(d) CD4 and CXCR4

(e) CD4 and CCR5

(f) CD4 and one or more co-receptors selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1, and CX3CR1.

(g) One or more co-receptors selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1 , and CX3CR1.

[0070] Thus, after a cell is transfected with the vector, the coding sequence encoding a receptor or co-receptor is transcribed under the control of an erythroid-specific promoter. [0071] Vectors include nucleic acid vectors, such as naked DNA and plasmids, and viral vectors, such as retroviral vectors, parvovirus-based vectors (e.g., adenoviral-based vectors and adeno-associated virus (AAV)-based vectors), lentiviral vectors (e.g., Herpes simplex (HSV)-based vectors), and hybrid or chimeric viral vectors, such as an adenoviral backbone with lentiviral components (see, e.g., Zheng et al., Nat. Biotech., 18(2), 176-80 (2000); International Patent Application WO 98/22143; International Patent Application WO 98/46778; and International Patent Application WO 00/17376) Vectors and vector construction are known in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d edition, Cold Spring Harbor Laboratory, NY (1989); and Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and John Wiley & Sons, New York, N.Y. (1994)).

[0072] Selection of cells that incorporate the genetic material from the vector is a matter of routine design within the level of ordinary skill in the art. In a non- limiting example, this is achieved by using selectable markers in the exogenous sequences. Markers suitable for this purpose include, but are not limited to, neomycin (G418), hygromycin, puromycin, zeocin, colchine, methotrexate, or methionine sulfoximine resistance genes. The transfected cells can then administered to a subject as described herein.

Methods of Treatment

[0073] While a graft-versus-host reaction is unlikely in a transplantation of stem cells or progenitor cells that do not contain reactive T-cells, host rejection of the donor cells remains probable. Host rejection of transplanted cells can occur with any non-matched allogenic graft. Therefore, it is necessary to suppress the host immune cells prior to cell transplantation. Bone marrow transplantation recipients are generally subjected to methods of immunosuppression such as

chemotherapy, radiation, or other methods of immunosuppression such as those listed in U.S. patent application publication 20090202496. Immunosuppresion is generally not required in cases where the subject's own cells are modified in vitro and then transplanted back into the subject.

[0074] The cells described herein may be transferred by any appropriate methods known in the art, such as peripherally; by intra-bone marrow injection (e.g., Castello et al., Intra-bone marrow injection of bone marrow and cord blood cells: An alternative way of transplantation associated with a higher seeding efficiency. Experimental Hematology 32: 782-787, 2004; by direct organ injection, or by other appropriate means. Combinations of different methods may be used for successive transplantations to increase the probability that the cells will become established in the recipient.

[0075] Serial transplantations will be performed to increase the likelihood that the transplanted cells will become established. In one embodiment, the cells described herein will be transplanted each day for three sequential days.

Different methods of transplantation may be employed on each day of

transplantation. For example, IBMI and peripheral transplantations may be performed on the same day. Subsequent transplantations may again be made one year later if necessary.

[0076] The number of transplantations and mode of administration of the cells described herein may be optimized for each recipient.

[0077] In one embodiment, when transplantation is made into the subject's bone marrow, the transplantation of cells described herein may be made each day for three successive days. At least one of the three transplantations of the cells described herein is into bone marrow. The recipient is anesthetized using both local infiltration and light general anesthesia/analgesia procedures. A bone marrow cannula is utilized to enter the bone marrow through the sternum or other bone marrow site. For example, approximately 4 x10⁵ to 1x10⁶ cells described herein in 1 ml of a solution of 95% PBS+5% DMSO are injected into the bone marrow.

[0078] The recombinant cells described herein can be administered to a subject having a viral infection. As used herein, "subject" refers to any of a human being, a primate, a mammal, a pig, a cow, a sheep, a rabbit, a horse, a mouse or a rat. [0079] The recombinant cells disclosed herein can be used alone or in

combination with other anti-viral drugs for the treatment or prevention of viral infections. For instance, where the infection being treated is HIV, they can be administered with one or more antiretroviral drugs selected from nonnucleoside reverse transcriptase inhibitors (such as delavirdine, Efavirenz, or evirapine); nucleoside reverse transcriptase inhibitors (such as Abacavir, Didanosine, Emtricitabine, Lamivudine, Stavudine, Tenofovir DF, Zalcitabine, or Zidovudine); protease inhibitors (such as Amprenavir, Atazanavir, Fosamprenavir, Indinavir, Lopinavir, Nelfinavir, Ritonavir, or Saquinavir); or fusion inhibitors (such as Enfuvirtide). They can also be used in conjunction with a HAART regimen.

[0080] One procedure for generating and expanding erythroid cells from hematopoietic stem cells is described in Shi-Jiang Lu, Biologic properties and enucleation of red blood cells from human embryonic stem cells, Blood, 1

December 2008, Vol. 112, No. 12, pp. 4475-4484, which is incorporated herein by reference in its entirety.

Treatment of viruses other than HIV

[0081] The above description focuses on recombinant cells, vectors, nucleotide sequences and methods for treating or preventing HIV infections. As appreciated by one of ordinary skill in the art, the same methodology can be readily adapted to making recombinant cells that include receptors or co-receptors for other viruses. These cells can be administered to a subject, such that they undergo erythropoiesis in vivo, to form modified erythrocytes that express viral receptors and/or co-receptors for the virus of interest. One or more of the nucleotide sequences encoding the receptors or co-receptors is operably linked to an erythroid-specific promoter. The receptors / co-receptors mediate entry of the corresponding viruses into the modified erythrocytes, thereby preventing the captured viruses from infecting other cells. The captured virions or their components are degraded or deactivated within the erythrocytes as time elapses, or are eventually destroyed by erythrophagocytosis.

[0082] Viruses amenable to the present invention include, but are not limited to, those whose infection involves injection of genetic materials into host cells upon binding to cell surface receptors. Other viruses whose infection is mediated by cell surface receptors can also be treated according to the present invention. Non-limiting examples of these viruses can be selected from Paramyxoviridae (e.g., pneumovirus, morbillivirus, metapneumovirus, respirovirus or rubulavirus), Adenoviridae (e.g., adenovirus), Arenaviridae (e.g., arenavirus such as

lymphocytic choriomeningitis virus), Arteriviridae (e.g., porcine respiratory and reproductive syndrome virus or equine arteritis virus), Bunyaviridae (e.g., phlebovirus or hantavirus), Caliciviridae (e.g., Norwalk virus), Coronaviridae (e.g., coronavirus or torovirus), Filoviridae (e.g., Ebola-like viruses), Flaviviridae (e.g., hepacivirus or flavivirus), Herpesviridae (e.g., simplexvirus, varicellovirus, cytomegalovirus, roseolovirus, or lymphocryptovirus), Orthomyxoviridae (e.g., influenza virus or thogotovirus), Parvoviridae (e.g., parvovirus), Picomaviridae (e.g., enterovirus or hepatovirus), Poxviridae (e.g., orthopoxvirus, avipoxvirus, or leporipoxvirus), Retroviridae (e.g., lentivirus or spumavirus), Reoviridae (e.g., rotavirus), Rhabdoviridae (e.g., lyssavirus, novirhabdovirus, or vesiculovirus), and Togaviridae (e.g., alphavirus or rubivirus). Specific examples of these viruses include human respiratory coronavirus, influenza viruses A-C, hepatitis viruses A to G, and herpes simplex viruses 1-9.

EXAMPLES

Plasmid DNA:

[0083] CD4 and CCR5 plasmid DNA (Human IMAGE 5226427 & 5186388) was obtained from ATCC (American Type Tissue Culture Collection; Manassas VA). GFP and RFP plasmid DNA was obtained from Open Biosystems (Huntsville, AL). EcoRI and BamHI restriction sites where added to the 5 and 3 ends, respectfully, of CD4 and CCR5 by using the following PCR primers obtained from Invitorgen (CARLSBAD, CA):

CD4:

5'- GAATTCGCCACAATGAACCGGGGAGTC-3' (SEQ ID NO: 3)

5'-GGATCCTCAAATGGGGCTACATGTC-3' (SEQ ID NO: 4)

CCR5:

5'- GAATTCAACAAGATGGATTATCAAG-3' (SEQ ID NO: 5)

5'- GGATCCTCACAAGCCCACAGATATT-3' (SEQ ID NO: 6)

[0084] PCR Conditions (94°C for 5min; 30 cycles of 94°C for 30 sec, X°C for 30 sec, 72°C for 1:30 min; ending with 4°C∞) Where X, the annealing temp, was set for 73°C for CD4 and 59°C for CCR5. PCR reaction was complete with PCR Platinum Blue SuperMix from Invitrogen (Catalog number 12580015). PCR product was inserted into a plasmid vector by the TOPO TA Cloning Kit for Sequencing (Invitrogen, Catalog number K457501). Plasmids with inserts were chemically inserted into TOP10 Chemically Competent E. Coli obtained with the above kit by protocols provided by Invitrogen.

[0085] The short GPA Promoter sequence (SEQ ID NO: 1), with restriction sites (Clal at the 5' and Xhol at the 3' end), was ordered from IDT (Integrated DNA Technologies; Coralville, Iowa). The sequence of the 184 bp insert is:

5'ATCGATgcttaacaacttgcatcatttaaaatgcctcccctgcctatcagctgatgatggccGCAGGAA GGTGGGCCTGGAAGATAACAGCTAGCAGGCTAAGGTCAGACACTGACACTT GCAGTTGTCTTTGGTAG I I I I I I I GCACTAACTTCAGGAACCAGCTCATGAT CTCAGGCTCGAG-3' (SEQ ID NO: 7)

[0086] The pLVX-Puro Vector (Catalog number 632159) for the creation of lentivirus used to transduce mammalian cells and the Lenti-X HT Packaging System (Catalog number 632160) was obtained from Clontech (Mountain View, CA). The pLVX-Puro vector and appropriate plasmids were digested using restriction enzymes from New England Biomedical Laboratories (NEB; Ipswich, MA). Ligation of DNA targets into the pLVX-Puro Vector were completed with the Quick Ligation Kit (Catalog number M2200L) obtained from NEB.

Lentiviral Production:

[0087] Lenivirus will be produced with pLVX-Puro vector modified to express CD4 or CCR5 under control of the GPA short promoter (SEQ ID NO: 1) with the Lenti- X HT Packaging System. Virus will be grown in cell culture using 293T

packaging cells obtained from Clonetech. Levels of activity will be visually monitored with the use of green or red fluorescent protein. Lentiviral particles will be collected from media.

[0088] K562 cells will be obtained and grown in appropriate media for activation of Glycophorin A expression using Epo and other growth factors. Using lentiviral product from above K562 cells will be transduced and expression of CD4 and CCR5 under control of the GPA short promoter (SEQ ID NO: 1) will be

monitored. CD4 and CCR5 expression will be tested by western blot.

16 Day 2-Phase Liquid Culture Growth:

[0089] The protocol of Dorn et al, a 16 Day 2-Phase Liquid Culture protocol for the maturation of GSF-mobilized CD34+ cells from PB to RBCs, will be tested in the lab. (Transfusion. 2008 Jun;48(6):1122-32. Epub 2008 Feb 22). Media will be obtained. GSF-mobilized PB CD34+ cells will also be obtained. GSF- mobilized PB CD34+ cells will be transduced with lentivirus and grown in neutral culture. Cells positive for double fluoresce will be sorted by flow cytometry and grown according to protocol of Dorn et al. After sixteen days cells will be sorted by flow cytometry for double positives expressing CD4 and CCR5 by antibody labeling. CD4 and CCR5 expression will be tested by western blot. HIV M-tropic infection of mRBC:

[0090] Modified Red Blood Cells expressing CD4 and CCR5 will be exposed to samples of M-tropic HIV. mRBC's will be lysed and levels of HIV RNA and proteins will be measured against a control.

SAMPLE SEQUENCES

CD4 Consensus coding sequence:

httpJ/vvww.ncbi.nlm.nih.gov/CCDS CcdsBrowse.cgi?REOUEST=GENEID&DATA=920 (CCDS number 8562.1)

ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCGCTCCTCCCAGCAGCCACTCA GGGAAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACCTGTACAGCTTCCCAGAAGAAGA GCATACAATTCCACTGGAAAAACTCCAACCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAA GGTCCATCCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGAAACTTTCCCCTGAT CATCAAGAATCTTAAGATAGAAGACTCAGATACTTACATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGC AATTGCTAGTGTTCGGATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACCCTGACC TTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAGTCCAAGGGGTAAAAACATACAGGGGGG GAAGACCCTCTCCGTGTCTCAGCTGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACC AGAAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGCCTCCAGCATAGTCTATAAG AAAGAGGGGGAACAGGTGGAGTTCTCCTTCCCACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGA GCTGTGGTGGCAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAAGAACAAGGAAG TGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGATGGGCAAGAAGCTCCCGCTCCACCTCACCCTG CCCCAGGCCTTGCCTCAGTATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAAGTT GCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAGAAAAATTTGACCTGTGAGGTGTGGG GACCCACCTCCCCTAAGCTGATGCTGAGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAG AAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAGTGACTCGGGACAGGTCCT GCTGGAATCCAACATCAAGGTTCTGCCCACATGGTCCACCCCGGTGCAGCCAATGGCCCTGATTGTGCTGG GGGGCGTCGCCGGCCTCCTGCTTTTCATTGGGCTAGGCATCTTCTTCTGTGTCAGGTGCCGGCACCGAAGG CGCCAAGCAGAGCGGATGTCTCAGATCAAGAGACTCCTCAGTGAGAAGAAGACCTGCCAGTGCCCTCACCG GTTTCAGAAGACATGTAGCCCCATTTGA

[0091] CCR5 Consensus Coding Sequence :

http://vww.ncbi.nlm.nih.gov/CCDS/CcdsBrow.se.cgi?REQUEST=GENElD&DATA=1234 (CCD number

2739.1)

ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCAA TGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGGCA ACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAAC CTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGA CTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCA TCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGGACGGTC ACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTT TACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCT GGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGC TACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTAT CTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCC AGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACT CTTGGGATGACGCACTGCTGCATC CCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCT CTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTC CCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

CXCR4 Consensus Coding Sequence:

ht tp : / /www . ncbi , nlm . nih . gov/CCDS/CcdsBrowse . cgi ?REQUEST=CCDS S DATA^33295 sBUILDS=CURRENTBUI LDS

CCDS number 33295.1

ATGTCCATTCCTTTGCCTCTTTTGCAGATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGGG ACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTCAATAAAATCTTCCTGCCCAC CATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAATGGATTGGTCATCCTGGTCATGGGTTACCAG AAGAAACTGAGAAGCATGACGGACAAGTACAGGCTGCACCTGTCAGTGGCCGACCTCCTCTTTGTCATCA CGCTTCCCTTCTGGGCAGTTGATGCCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCA TGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTG GCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCG TCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAG ATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTT GGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCA AGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCT GCCTTACTACATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCATCAAGCAAGGGTGTGAGTTT GAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCACTGTTGTCTGAACCCCA TCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCACCTCTGTGAGCAGAGG GTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCCACTGAGTCTGAGTCT TCAAGTTTTCACTCCAGCTAA

GPA Promoter in two forms

SCL assembles a multifactorial complex that determines glycophorin A expression, Lahlil R, Lecuyer E, Herblot S, Hoang T., Mol Cell Biol. 2004 Feb;24(4):1439-52.

Post-transcriptional regulation of the cell surface expression of glycophorins A, B, and E., Rahuel C, Elouet JF, Cartron JP., J Biol Chem. 1994 Dec 30;269(52):32752-8.

512 base-pair "Full" promoter:

GGGAGTCTTTCAGAACCTCAGAACACTCAAATGATTTAAATTTCTCAAATACATTCATTTCACATATAGGAAGTCACTTTCATTTGGAC CACTGGGTCTTGACATTAGAAATGAGAAGGTCCATGGCTCCACAACAGCTACCTCAGCCTGGCACGTGCCCTGGCCTCAGAGATTCACA GTCCAGTTCTTTGTCCAGTTGGGTGGCTCCTGTCTACCACCTTACCATGCCCACTTAACTGATGCAAAGTTAATATCACAAGTAGCAAC CTGTTCCTTGCAGTGAAAATTTTACTTACCACTTTCATAGCCCCAAGATATCCATGTATCTTTATTAACAGGCGCTTAACAACTTGCAT CATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCCTGGAAGATAACAGCTAGCAGGCTAAGGTCAGACA CTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCACTAACTTCAGGAACCAGCTCATGATCTCAGG

172 base-pair "Shortened" promoter:

GCTTAACAACTTGCATCATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCCTGGAAGATAACAGCTAGC AGGCTAAGGTCAGACACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCACTAACTTCAGGAACCAGCTCATGATCTCAGG

CD4 coding sequences under control of Shortened and Full GPA Promoters

CD4 coding sequence under the control of 512 base-pair "Full" promoter:

GGGAGTCTTTCAGAACCTCAGAACACTCAAATGATTTAAATTTCTCAAATACATTCATTTCACATATAGGA AGTCACTTTCATTTGGACCACTGGGTCTTGACATTAGAAATGAGAAGGTCCATGGCTCCACAACAGCTACC TCAGCCTGGCACGTGCCCTGGCCTCAGAGATTCACAGTCCAGTTCTTTGTCCAGTTGGGTGGCTCCTGTCT ACCACCTTACCATGCCCACTTAACTGATGCAAAGTTAATATCACAAGTAGCAACCTGTTCCTTGCAGTGAA AATTTTACTTACCACTTTCATAGCCCCAAGATATCCATGTATCTTTATTAACAGGCGCTTAACAACTTGCA TCATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCCTGGAAGATAACAGCT AGCAGGCTAAGGTCAGACACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCACTAACTTCAGGAACCA GCTCATGATCTCAGGATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCGCTCCT CCCAGCAGCCACTCAGGGAAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACCTGTACAG CTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAACCAGATAAAGATTCTGGGAAATCAGGGC TCCTTCTTAACTAAAGGTCCATCCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGG AAACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTACATCTGTGAAGTGGAGGACC AGAAGGAGGAGGTGCAATTGCTAGTGTTCGGATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAG AGCCTGACCCTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAGTCCAAGGGGTAA AAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGCTGGAGCTCCAGGATAGTGGCACCTGGACATGCA CTGTCTTGCAGAACCAGAAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGCCTCC AGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCCCACTCGCCTTTACAGTTGAAAAGCT GACGGGCAGTGGCGAGCTGTGGTGGCAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACC TGAAGAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGATGGGCAAGAAGCTCCCG CTCCACCTCACCCTGCCCCAGGCCTTGCCTCAGTATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGC GAAAACAGGAAAGTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAGAAAAATTTGA CCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTGAGCTTGAAACTGGAGAACAAGGAGGCAAAG GTCTCGAAGCGGGAGAAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAGTGA CTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGGTCCACCCCGGTGCAGCCAATGG CCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGCTTTTCATTGGGCTAGGCATCTTCTTCTGTGTCAGG TGCCGGCACCGAAGGCGCCAAGCAGAGCGGATGTCTCAGATCAAGAGACTCCTCAGTGAGAAGAAGACCTG CCAGTGCCCTCACCGGTTTCAGAAGACATGTAGCCCCATTTGA

CD4 coding sequence under the control of 172 base-pair "Shortened" promoter:

GCTTAACAACTTGCATCATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCcGCAGGAAGGTGGGCC TGGAAGATAACAGCTAGCAGGCTAAGGTCAGACACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCAC TAACTTCAGGAACCAGCTCATGATCTCAGGATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCT GCAACTGGCGCTCCTCCCAGCAGCCACTCAGGGAAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGG AACTGACCTGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAACCAGATAAAGATT CTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCATCCAAGCTGAATGATCGCGCTGACTCAAGAAGAAG CCTTTGGGACCAAGGAAACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTACATCT GTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCGGATTGACTGCCAACTCTGACACCCAC CTGCTTCAGGGGCAGAGCCTGACCCTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAG GAGTCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGCTGGAGCTCCAGGATAGTG GCACCTGGACATGCACTGTCTTGCAGAACCAGAAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCT TTCCAGAAGGCCTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCCCACTCGCCTT TACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGGCAGGCGGAGAGGGCTTCCTCCTCCAAGTCTT GGATCACCTTTGACCTGAAGAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGATG GGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAGTATGCTGGCTCTGGAAACCTCAC CCTGGCCCTTGAAGCGAAAACAGGAAAGTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGC TCCAGAAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTGAGCTTGAAACTGGAG AACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCA GTGTCTGCTGAGTGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGGTCCACCC CGGTGCAGCCAATGGCCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGCTTTTCATTGGGCTAGGCATC TTCTTCTGTGTCAGGTGCCGGCACCGAAGGCGCCAAGCAGAGCGGATGTCTCAGATCAAGAGACTCCTCAG TGAGAAGAAGACCTGCCAGTGCCCTCACCGGTTTCAGAAGACATGTAGCCCCATTTGA

CCR5 coding sequence under control of Short and Long GPA Promoters

CCR5 coding sequence under control of the 512 base-pair "Full" promoter:

GGGAGTCTTTCAGAACCTCAGAACACTCAAATGATTTAAATTTCTCAAATACATTCATTTCACATATAGGA AGTCACTTTCATTTGGACCACTGGGTCTTGACATTAGAAATGAGAAGGTCCATGGCTCCACAACAGCTACC TCAGCCTGGCACGTGCCCTGGCCTCAGAGATTCACAGTCCAGTTCTTTGTCCAGTTGGGTGGCTCCTGTCT ACCACCTTACCATGCCCACTTAACTGATGCAAAGTTAATATCACMGTAGC CCTGTTCCTTGCAGTGAA AATTTTACTTACCACTTTCATAGCCCCAAGATATCCATGTATCTTTATTAACAGGCGCTTAACAACTTGCA TCATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCCTGGAAGATAACAGCT AGCAGGCTAAGGTCAGACACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCACTAACTTCAGGAACCA GCTCATGATCTCAGGATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCC CTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCT TTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGAC ATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGC TGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCT CTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTA AAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCT CCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACA GTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTT GTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAG GGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTC TCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATG CAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAA GTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTT TCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTG GGCTTGTGA

CCR5 coding sequence under the control of the 172 base-pair "Shortened" promoter:

GCTTAACAACTTGCATCATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCC TGGAAGATAACAGCTAGCAGGCTAAGGTCAGACACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCAC TAACTTCAGGAACCAGCTCATGATCTCAGGATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTA TTATACATCGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACT CACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTG AAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTT CTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATT TTATAGGCTTCTTCTCTGGAATCTTCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCAT GCTGTGTTTGCTTTAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGC TGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCT CTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTG GTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGA GAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCT ACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGG TTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGC CTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCA AATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAG CAGGAAATATCTGTGGGCTTGTGA

CXCR4 coding sequence under control of Short and Long GPA Promoters

CXCR4 coding sequence under the control of 512 base-pair "Full" promoter:

GGGAGTCTTTCAGAACCTCAGAACACTCAAATGATTTAAATTTCTCAAATACATTCATTTCACATATAGGAAGT CACTTTCATTTGGACCACTGGGTCTTGACATTAGAAATGAGAAGGTCCATGGCTCCACAACAGCTACCTCAGCC TGGCACGTGCCCTGGCCTCAGAGATTCACAGTCCAGTTCTTTGTCCAGTTGGGTGGCTCCTGTCTACCACCTTA CCATGCCCACTTAACTGATGCAAAGTTAATATCACAAGTAGCAACCTGTTCCTTGCAGTGAAAATTTTACTTAC CACTTTCATAGCCCCAAGATATCCATGTATCTTTATTAACAGGCGCTTAACAACTTGCATCATTTAAAATGCCT CCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCCTGGAAGATAACAGCTAGCAGGCTAAGGTCAGAC ACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCACTAACTTCAGGAACCAGCTCATGATCTCAGGATGTCC ATTCCTTTGCCTCTTTTGCAGATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGGGACTATGACTC CATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTCAATAAAATCTTCCTGCCCACCATCTACTCCATCA TCTTCTTAACTGGCATTGTGGGCAATGGATTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATG ACGGACAAGTACAGGCTGCACCTGTCAGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTTGA TGCCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACA GCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGG CCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGA CTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGG TGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGC ATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCAT CCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCA TCAAGCAAGGGTGTGAGTTTGAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCAC TGTTGTCTGAACCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCACCTC TGTGAGCAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCCACTGAGT CTGAGTCTTCAAGTTTTCACTCCAGCTAA

CXCR4 coding sequence under the control of 172 base-pair "Shortened" promoter:

GCTTAACAACTTGCATCATTTAAAATGCCTCCCCTGCCTATCAGCTGATGATGGCCGCAGGAAGGTGGGCC TGGAAGATAACAGCTAGCAGGCTAAGGTCAGACACTGACACTTGCAGTTGTCTTTGGTAGTTTTTTTGCAC TAACTTCAGGAACCAGCTCATGATCTCAGGATGTCCATTCCTTTGCCTCTTTTGCAGATATACACTTCAGA TAACTACACCGAGGAAATGGGCTCAGGGGACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATG CTAATTTCAATAAAATCTTCCTGCCCACCATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAATGGA TTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTACAGGCTGCACCTGTC AGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTTGATGCCGTGGCAAACTGGTACTTTG GGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCC TTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGC TGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCA ACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTC CAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCAT CTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGG CTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCATC AAGCAAGGGTGTGAGTTTGAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCA CTGTTGTCTGAACCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCA CCTCTGTGAGCAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTCC ACTGAGTCTGAGTCTTCAAGTTTTCACTCCAGCTAA

[0092] The foregoing description of the present invention provides illustration and description, but is not intended to be exhaustive or to limit the invention to the precise one disclosed. Modifications and variations consistent with the above teachings may be acquired from practice of the invention. Thus, it is noted that the scope of the invention is defined by the claims and their equivalents.

Claims

CLAIMS What is claimed is:

1. A cell comprising a recombinantly-produced nucleotide sequence including a first coding sequence encoding CD4 operably linked to a first erythroid- specific promoter, and a second coding sequence encoding an HIV co- receptor operably linked to a second erythroid-specific promoter.

2. The cell of claim 1 , wherein the HIV co-receptor is CCR5 or CXCR4.

3. The cell of claim 1 , wherein the HIV co-receptor is selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1 , and CX3CR1.

4. The cell of claim 1 , wherein the first erythroid-specific promoter is the same as the second erythroid-specific promoter.

5. The cell of claim 1 , wherein said cell is a hematopoietic stem cell.

6. The cell of claim 1 , wherein said cell is a hematopoietic progenitor cell.

7. The cell of claim 1 , wherein said cell is an embryonic stem cell.

8. The cell of claim 1 , wherein said cell is an adult stem cell.

9. The cell of claim 1 , wherein the cell is a human cell.

10. A method of reducing the HIV viral load in a subject infected with HIV,

comprising administering to the subject a cell comprising a first coding sequence encoding CD4 operably linked to a first promoter that is not natively associated with said first coding sequence, and a second coding sequence encoding an HIV co-receptor operably linked to a second promoter that is not natively associated with said second coding sequence.

11. The method of claim 9, wherein the cell is a hematopoietic progenitor cell.

12. The method of claim 9, wherein the cell is a hematopoietic stem cell.

13. The method of claim 9, wherein the cell is an embryonic stem cell.

14. The method of claim 9, wherein the cell is an adult stem cell.

15. The method of claim 9, wherein the cell is a human cell.

16. The method of claim 9, wherein the first promoter is erythroid-specific.

17. The method of claim 9, wherein the second promoter is erythroid-specific.

18. The method of claim 9, wherein the subject is a human being.

19. The method of claim 9, wherein the HIV co-receptor is CCR5 or CXCR4.

20. The method of claim 9, wherein the HIV co-receptor is selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR5, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLR1, and CX3CR1.

21. The method of claim 9, further comprising removing a cell from the subject, and introducing into the cell a first coding sequence encoding CD4 operably linked to a first erythroid-specific promoter and a second coding sequence encoding an HIV co-receptor operably linked to a second promoter, wherein the cell is administered to the subject.

22. A nucleic acid molecule comprising a coding sequence encoding one of a viral receptor, a viral co-receptor, and an erythroid-specific promoter, wherein said erythroid-specific promoter regulates transcription of the coding sequence when said nucleotide sequence is incorporated into a human cell and transcribed by the human cell.

23. The nucleic acid molecule of claim 22, wherein the viral receptor is CD4, and the viral co-receptor is selected from the group consisting of CCR1 , CCR2, CCR3, CCR4, CCR8, CXCR1 , CXCR2, CXCR3, CXCR4, CXCR6, GPR15, APJ, CMKLRI . and CX3CR1.

24. A plasmid comprising the nucleic acid molecule of claim 23.

25. A viral vector comprising the nucleic acid molecule of claim 23.

26. A pharmaceutical composition comprising at least 0.5 x10⁶ cells of claim 1 and a pharmaceutically acceptable carrier.