WO2011054998A2 - Alteration of the expression of the orthologous della-u protein in order to alter the growth pattern of plants and the metabolite content of the fruit - Google Patents

Abstract

Alteration of the expression of the orthologous DELLA-u protein in order to alter the growth pattern of plants and the metabolite content of the fruit. The present invention describes novel functions of the SIDELLA gene of Solanum lycopersicum and also the uses thereof and mutant versions of the gene associated with novel phenotypes, requiring the modification of the growth habit and of the metabolism of the plants carrying said alterations, as a certain influence on the metabolite content of the fruit of the tomato plant.

Description

 ALTERATION IN THE EXPRESSION OF PROTEINA DELLA OR ORTOLOGA TO ALTER THE PLANNING GROWTH OF PLANTS AND THE METABOLITES CONTENT OF FRUIT

TECHNICAL SECTOR OF THE INVENTION

The present invention describes new functions of the SIDELLA gene of Solanum lycopersicum as well as its uses and mutant versions of the gene associated with new phenotypes that involve the modification of the growth habit and metabolism of the plants that carry these alterations resulting in an alteration in the meta bo lites content of tomato fruit.

BACKGROUND OF THE INVENTION

In general the final architecture of a plant depends on the number, size and size of the constituent elements (leaves, internodes, flowers and fruits) and the way in which they are inserted into the general body of the plant. Even more important than the above is the growth habit.

The productivity of a plant is affected by genetic, physiological and environmental factors, but the architecture and growth habit are key determinants. The tomato plant (Solanum lycopersicum) is from the Solanaceae family

(Solanaceae) native to America and cultivated throughout the world for its edible fruit, which is a berry colored in shades that range from yellowish to red, due to the presence of penic and carotene pigments. It has a slightly acidic taste and is produced and consumed worldwide both fresh and processed in different ways. By the growth habit, which will be given by the type of ramifications of the plants, two large groups of varieties are recognized, those of indeterminate growth and those of determined growth. The first group is characterized by having a vegetative apex with dominance, which gives continuous growth to the stem or main axis. They are easily recognized as they have a floral cluster every three leaves and a broad radial growth. In the varieties of growth determined the buds they always end in an inflorescence, therefore the upper axillary bud should always be left to lead as undetermined. This group of varieties, which are also called "shrubs", do not require support during their growth. The dwarf shrub varieties are a subgroup within the determined varieties characterized by their smaller size and for producing fruits of the "cherry" or "cherry" type.

Taking care of the tomato flavor is not an easy task. The intensity of the flavor properties of tomato fruit is determined by the amount of sugar (mainly fructose and glucose), by the content of organic acids (mainly citric and malic) and the composition of volatile compounds. The difference in flavors between varieties is explained by the difference in the quantitative proportions of volatile substances, many of which develop during ripening.

Patent application ES 2235335 T3 describes a method of manipulating the aroma of tomato products, which consists of incubating tomato pieces with an enzyme with alcohol dehydrogenase activity and an alcohol dehydrogenase cofactor; as well as the products obtained by this procedure.

Sympodial growth plants have a peculiar lateral growth type in which the apical meristem ends (aborts or differs into an inflorescent flower / meristem) but the plant continues to grow from the axillary meristem normally located below the upper leaf, which is repeated after a few leaf nodes, causing continued apical growth.

Tomato plants exhibit a sympodial growth pattern characterized by alternating buds of vegetative and reproductive organs. This pattern is established after an initial period in which only vegetative organs are produced (stems / between nodes and leaves in the aerial part) which in the case of tomato involves the production of about 5 to 20 leaf nodes that ends the formation , in the apical meristem of the main outbreak, of an inflorescent meristem that supposes the termination of said main symposium. The growth of the plant does not stop there, but continues from the axillary bud located in the axilla of the leaf closest to that new inflorescence. In all wild tomato species and most of the fresh consumption, the growth habit that continues from here is the production of symposiums each consisting of about 2 or 3 leaves and an inflorescence in which the new symposium It is produced again from the axilla of the last leaf below the new inflorescence. This produces a high-growth plant that continuously produces fruits along the main axis, with fruits from different stages of maturation at any time of post flowering growth. This growth habit is called "undetermined" in this case.

On the contrary, tomato plants that carry the recessive mutation self-pruning sp (sp / sp) in homozigosis only produce two or three sympodial shoots after the first inflorescence, each consisting of 2 or 3 leaves and an inflorescence, after which they produce 2 inflorescences in a row and growth ceases. This mutation confers a "determined" growth habit that, in addition to affecting the size of the plant, results in fruit ripening and ripening more concentrated over time than occurs in indeterminate growth plants (Stevens and Rick, 1986; Yeager , 1927).

The self-pruning locus (SP) has been cloned (Pnueli et ai, 1998) and proven to be an ortholog of the Centroradialis (CEN) genes of Antirrhinum and Terminal Flower (TFL1) of Arabidopsis. The family of genes named from these three "CETS" (from CEN, IFL1 and SP), are conserved among different plant species where they affect flowering and determination / indetermination (Pnueli et al., 2001, Foucher et al., 2003).

In the case of tomato, SP belongs to a small gene family of six members (SP, SP21, SP3D, SP5G, SP6A, and SP9D) distributed in five chromosomes (Carme l-Goren et al., 2003), although the cause of the sp mutation that is on chromosome six is the only one that can control the passage between determined and indeterminate growth habit. The other SP paralogs in tomato are not very characterized but they seem to affect the expression of the determined phenotype by modifying the moment at which the plant is determined (case of intrusions of SP9D and SP5G of pennelli in M82 (Carmel-Goren et al., 2003 ; Eshed and Zamír, 1995; Jones et al., 2007) The self-pruning mutation has been introduced in most of the industry tomato varieties, since it favors mechanical harvesting (Hanna et ai, 1966; Friedland and Barton, 1975; Stevens and Rick, 1986; Yeager, 1927) and there are no alternative methods or that modulate the expression of SP.

On the other hand, DELLA proteins have been described as key elements that would integrate both external and mediated signals by hormones, adapting plant growth to environmental needs and conditions. DELLA proteins are members of a GRAS subfamily of regulators that appear to act at the nuclear level as repressors of development and growth processes. According to the current model, elaborated mainly from the work done in Arabidopsis and rice, the blockade in the growth exerted by DELLA proteins (a family of five members in Arabidopsis, but only one in rice) and in most of the crops, including tomato, would be eliminated by targeted degradation of the DELLA protein (Dill et al., 2001; Dill and Sun, 2001; Lee et al., 2002; Peng et al., 1997; Richards et al., 2001; Wen and Chang, 2002). The mechanism of action underlying the effect of inducing the growth of phytohormones gibberellins (GA) would be based on the fact that after the union of GA to the GID receptor, a conformational change of the protein would take place that would favor its interaction with DELLA and increase its affinity to be degraded by the 26S proteasome. (Murase et al, 2007; Ueguchi-Tanaka et al, 2007; 2008).

With regard to growth and development programs, it seems that the DELLA route integrates the floral transition in response to light, ethylene and auxins among others and would act affecting the stability of DELLA proteins, their transcription or indirectly affecting the levels of GAs (Achard et al., 2006; Achard et al., 2003; Fu and Harberd, 2003; Oh et al., 2007).

There are mutants in two DELLA genes from Arabidopsis (gai and rga) that are altered in the height of the plant, mainly due to the length of internodes and flowering time (Koornneer et al., 1985; Peng and Harberd, 1999, 1993; Peng at al., 1997; Silverstone et al., 1998; Wilson and Somerville, 1995). The modulation of the levels of the only DELLA gene in tomatoes, SIDELLA, causes alterations in the reproductive structures and in the size of the plant (Marti et al. 2007). All the alterations described in the bearing of the plant have to do with the length of the internodes and with the flowering time in monopodial plants (they grow producing vegetative tissue until producing the terminal flower and stop their growth there).

It would be necessary and desirable to have other mechanisms to control the growth habit of crop plants, for example in tomato, alternative to self-pruning or to modulate the activity of self-pruning producing plants with different degrees of determination, and consequently with different size and number of flowers and fruits. OBJECT OF THE INVENTION

The present invention provides genetically modified plants with the expression of DELLA proteins or altered orthologue thus producing an inhibition in the repression of the development and growth of plants in comparison to corresponding plants not genetically modified. Due to the alteration in the expression of DELLA, by silencing or mutation, genetically modified plants will see their sypodial growth pattern and / or the content of metabolites and / or volatile substances in the fruit altered. The present invention also relates to the fruits and seeds of genetically modified plants as well as the method used to obtain said plants.

The expression of DELLA is regulated by the described SIDELLA gene and has been used by the authors of the present application (Marti ef al. 2007), however the regulation of its expression to alter the growth pattern and / or to alter the content of the metabolites of the fruits are new functions, as well as their applications.

An orthologous gene is known (similar to belonging to two species that have a common ancestor) of the SIDELLA gene, more specifically it is the GAI Arabidopsis tomato gene (Solanum lycopersicum). In US 6,307,126 and its continuation US 6,830,930, it is described that the GAI gene has been cloned and mutated and the expression of such genes in plants affects their growth, specifically achieving dwarf plants that are useful for reducing the losses that They take place during harvest storage.

The authors of this Application have observed that the SIDELLA gene in tomatoes is important in determining the number of symposium repeats, and therefore the size and number of flowers / fruits on the main axis. This should affect the total productivity (number and size of fruits produced). On the other hand, modifications in this gene affect the metabolic content of the fruits as exemplified by the content of volatile compounds associated with the aroma of the fruit.

According to what is described in the state of the art, it would be simply expected that the modifications in SIDELLA or orthologous genes would affect the height of the plant and the distance of the internodes, without affecting the number of these except for that produced by a modification in flowering time. The functions described for the GAI gene have to do with growth and flowering time and is supported by the phenotypes observed in Arabidopsis and cereals. Many plants such as tomatoes are "neutral day" and bloom regardless of the duration of the day.

A new function described here is relevant in plants whose main axis growth stops with the first flower to continue growing from the axillary bud (called a simpodial) below the new flower. The new function has been revealed by the authors of the present application in studies with the SIDELLA gene. In tomato plants affected in the expression levels of the SIDELLA gene, the expected growth phenotype that is reflected in the length of internodes is observed. The important thing about the present invention is that tomato plants that carry the sp mutation and therefore have a certain growth, that is to say, the growth of the main axis stops after a small number of 2 or 3 simpodial repetitions (metamer consisting for example in 2 leaves and one inflorescence) after the first flower, increase the number of sypodia or even become undetermined when the expression of SIDELLA in transgenic plants is blocked with different efficiency. This occurs without significantly modifying the flowering time and suggests an alternative way to sp to alter the growth habit of the tomato and by extension of other plants of similar growth (i.e. simpodial).

So far the only way to alter the growth habit in tomatoes has been through the self-pruning gene. The introduction of that gene to alter the pattern of tomato growth from indeterminate to determined meant a revolution in the cultivation of tomato industry and allowed the mechanization of harvesting. Currently this recessive mutation of the self-pruning gene has been introduced in most of the tomato varieties of industry that are therefore sp / sp. Apart from a few allelic forms of genes of the self-pruning family, no method of altering the growth pattern has been proposed or available.

In the present invention, the architecture of the plant and the growth habit are modified by acting at the DELLA level (or at the level of orthologous proteins) ie by transgenesis by altering the level of SIDELLA (or orthologous gene) or by introducing mutations in the SIDELLA gene (or orthologous gene) that alter the growth pattern. Also object of the present invention is the production and identification of mutant versions in that gene (or orthologous gene) that provide various intensities of the phenotype of interest. The results of the present application have been obtained using tomato (Solanum lycopersicum) as an example, but they may be useful for other plants of specific or non-sypodial growth.

A method to associate the character with the mutations is also described, thus opening the possibility of identifying new mutants in the gene that give different versions of the phenotype that can adapt to what the producer needs.

The character conferred by silencing and mutations is of commercial and / or agronomic interest. It can be very important for those interested in altering the number of symposia buds in plants with that type of growth, including but not limited to solaneaceae, cucurbitaceae such as melon, woody, trees, and obviously ornamental as orchids, among other plants of interest. .

It is of interest to have mechanisms to confer the growth habit that suits a particular type of plant, crop or ornamental. Thus, it may be interesting to confer the determined character to a kind of indeterminate growth, with the purpose of limiting its growth (aesthetic reasons, availability of space, etc.), or to concentrate as a result the production and maturation of fruits in weather.

On the other hand, it is interesting to increase the number of symposium buds of a given growth plant, in order to increase the production and sun exposure of the fruits, even to make it undetermined.

The availability of ways to modify the metabolic content of fruits is also important from an organoleptic and nutritional point of view. Thus, in another aspect of the present invention, the regulation of the content of the metabolites and / or volatile substances associated with the aroma of fruits that can be used in all types of plants, as a second new function of the SIDELLA gene or ortholog is described simpodial growth or not.

The first object of the invention relates to genetically modified plants with the altered expression of the DELLA protein or ortholog characterized in that the alteration in the expression of the DELLA protein or ortholog produces an inhibition in the repression of the development and growth of the plants in comparison to corresponding plants not genetically modified. The alteration in the expression of DELLA of the object of the invention is obtained by silencing the SIDELLA or ortholog gene or by mutation of the SIDELLA or ortholog gene.

In a particular embodiment, silencing of the SIDELLA or ortholog gene is obtained by employing a gene construct that is based on an antisense copy of the SIDELLA or ortholog gene controlled by the 2XCaMV35S promoter.

In another particular embodiment, the mutation in the genetic sequence of SIDELLA is due to the addition and / or insertion and / or deletion and / or substitution of one or more nucleotides of the SIDELLA or orthologous gene, namely, the mutation consists of the nucleotide replacement guanine with adenine in nucleotide 458, called the TILLING 1 mutation (SEQ ID No.3) or the replacement of the guanine nucleotide with adenine in nucleotide 1498, called the TILLING 2 mutation (SEQ ID No.5) or the replacement of the cytosine nucleotide with thymine in nucleotide 994, called the TILLING 3 mutation (SEQ ID No.7) or the replacement of the cytosine nucleotide with thymine in nucleotide 661, called the TILLING 4 mutation (SEQ ID No.9). In another particular embodiment, the genetically modified plants of the present object of the invention exhibit a sypodial growth pattern, specifically a determined symposium growth pattern that is modified to indeterminate or semi-determined.

In another particular embodiment, genetically modified plants with the altered expression of the DELLA protein or ortholog of the present object of the invention are characterized in that the content of metabolites and / or volatile substances associated with the aroma of the fruits is increased and / or decreased with respect to to corresponding plants not genetically modified. Specifically, the increase in metabolite content refers in a particular embodiment to the increase in sucrose, tyrosine, asparagine, isoleucine, threonine, proline, pyroglutamic acid and myo-inositol of an order of 100-400%, and / or that of fructose and glucose in the order of 10-30%, and / or that of volatile substances associated with the aroma of the fruits Ε-2-hexenal, 1-pente-3-one and P. damascenone of an order of 100-200 %, and / or that of volatile substances not associated with the aroma of the fruits 3-methylbutanoic acid, E, E-2,4-decadienal and Ε-2-octenal in an order of 100-200% with respect to corresponding plants not genetically modified In another particular embodiment the decrease in the content of volatile substances associated with the aroma of the fruits refers to a decrease in 3- methylbutanol, 1-nitro-2-phenylethane, 2-phenylethanol, phenylacetaldehyde and 2-isobutylthiazole in an order of 80-90%, and / or that of volatile substances not associated with the aroma of fruits geranylacetone, terpineol, linalool, benzyl alcohol, eugenol, benzylnitrile, 2-methyl-1-butanol and 2-methyl-1-propanol in an order of 50-100% with respect to corresponding plants not genetically modified.

The genetically modified plants of the present object of the invention are plants with a commercial and / or agricultural interest and are selected from the group of Solanaceae, Cucurbitaceae, Orchids, Woody, among other plants of interest. In a particular embodiment the plants of the invention belong to the Solanaceae family, being specifically a Solanum lycopersicum tomato plant.

A second object of the invention relates to the fruits obtained from genetically modified plants according to the previous object of the invention with a content of certain metabolites and / or volatile substances associated with the increased aroma and / or the content of other meta balls and / or substances volatile associated with the diminished aroma with respect to the fruits of corresponding plants not genetically modified. The increase in the metabolite content refers in a particular embodiment to the increase in sucrose, tyrosine, asparagine, isoleucine, threonine, proline, pyroglutamic acid and myo-inositol of an order of 100-400%, and / or that of fructose and glucose in the order of 10-30%, and / or that of the volatile substances associated with the aroma of the fruits Ε-2-hexenal, 1-penten-3- one and P. damascenone of an order of 100-200% , and / or that of volatile substances not associated with the aroma of the fruits 3-methylbutanoic acid, E, E-2,4-decadienal and Ε-2-octenal in an order of 100-200% with respect to corresponding unmodified plants genetically In another particular embodiment the decrease in the content of volatile substances associated with the aroma of the fruits refers to a decrease in 3- methylbutanol, 1-nitro-2-phenylethane, 2-phenylethanol, phenylacetaldehyde and 2-isobutylthiazole in an order of 80-90%, and / or that of volatile substances not associated with the aroma of geranilacetone, terpineol, linalool, benzyl alcohol, eugenol, benzylnitrile, 2-methyl-1-butanol and 2-methyl-1-propanol in a order of! 50-100% with respect to corresponding plants not genetically modified.

Another object of the invention relates to the seeds of genetically modified plants according to the first object of the invention, in which the expression of the proteins D E L L A u o rtó I og a is found in Ite rad a.

Another object of the invention relates to the method of obtaining genetically modified plants with the altered expression of the DELLA or orthologous protein comprising the following steps: a) transform the genome of a plant cell, regenerate the plant from the cell of stage a), obtain seeds of the transformed plant containing the modified genome and, grow at least one of the seeds of stage c ) to obtain one that contains the altered expression of the DELLA protein or ortholog.

In a particular embodiment, step a) of the present object of the invention consists of a directed mutagenesis whose realization is obtained by silencing the SIDELLA gene using the asDELLA gene construct that is based on an antisense copy of the SIDELLA gene controlled by the 2XCaMV35S promoter. In another particular embodiment step a) of the present object of the invention consists of a directed mutagenesis whose embodiment consists in modifying the native sequence of the SIDELLA gene to the sequence of the mutated SIDELLA gene selected from the group of mutations called TILLING 1 (SEQ ID No 3 ), TILLING 2 (SEQ ID No 5), TILLING 3 (SEQ ID No 7) and / or TILLING 4 (SEQ ID No 9).

In another particular embodiment, of the present object of the invention, step b) is optional and in another embodiment said transformation is mediated by Agrobacterium.

In another particular embodiment, step a) consists of an non-directed mutagenesis comprising the following stages: i. expose the plant to a mutagenic agent, preferably the tilmetanesulfonato extract the DNA from each of the families and combine following a 3D strategy, track the SIDELLA gene in each family by nested PCR and universal primers,

IV. detect the mutants of SIDELLA by sequencing and deconvulution. From step (iv) of the present embodiment, 4 allelic forms of SIDELLA were selected, namely those named: TILLING 1 (SEQ ID No 3), TILLING 2 (SEQ ID No 5), TILLING 3 (SEQ ID No 7) , TILLING 4 (SEQ ID No 9) ..

BRIEF DESCRIPTION OF THE FIGURES

Figure 1: Structure of the gene construct introduced in tomato to decrease the levels of SIDELLA in transgenic plants. Scheme of the structure of T-DNA: 2x35S: 35SCaMV promoter (tobacco mosaic virus) duplicated. CaMV poly (A) ⁺ : CaMV polyadenylation sequence. Nptll: gene that confers resistance to kanamycin, with the promoter and terminator of nopaiin synthetase (pnos and tnos).

Figure 2; Effect of the strategy on SIDELLA levels in asDELLA transgenic plants. Analysis of the expression levels of asSIDELLA and SIDELLA in internodes of transgenic and wild plants by semi-Peruvian RT-PCR. The figure confirms the expression of asSIDELLA in the transgenic lines (lines 5A, 24B and 7G). At the same time the decrease of the endogenous levels of SIDELLA in these same lines is checked in comparison with a wild plant (wt). As a load control, the RT-PCR reaction for actin was used.

Figure 3: Effect of the strategy on the growth and production of sympodial outbreaks in asDELLA transgenic plants. (A) Effect on the total height of the plants measured after 90 days. (B) Effect on growth, number of internodes and their size over 120 days. These graphs show the greater height reached by the transgenic plants compared to the wild ones, as well as that this greater height is due both to an increase in the number of internodes and their length. In transgenic plants the growth of the symposium bud stops later or even acquires undetermined growth. The values correspond to the average of 4 plants. The bar indicates the standard error, wt: wild plant. 5A, 24B, 7C: independent asDELLA transgenic lines. EN: internode

Figures 4-7: (A) Nucleotide sequences and (B) primary structure of the proteins corresponding to the mutated forms of SIDELLA identified by TILLING: Mutante TILLING 1 (figure 4), Muía ni e TILLING 2 (figure 5), Muiáíe TILLING 3 (figure 6) and Muía ni e TUILLING 4 (figure 7), where the muted nucleolides and amino acids are marked in boldness and underlined by the sequence of culinary SIDELLA determined M82. Figure 4 In the TILLING 1 mutant (A) at the nucleotide level there is a substitution of guanine for adenine (at nucleotide 458) and (B) at the amino acid level there is a substitution of alanine for threonine (at amino acid 153). Figure 5 In the TILLING 2 mutant (A) at the nucleotide level there is a substitution of guanine for adenine (in nucleotide 1498) and (B) at the amino acid level there is a substitution of glutamine for lysine (at amino acid 500). Figure 6 In the MILLING TILLING 3 (A) at the nucleotide level there is a substitution of cytosine for you mine (at nucleotide 994) and (B) at the amino acid level there is a substitution of leucine for phenylalanine (at amino acid 332). Figure 7 In the MILLING TILLING 4 (A) at the nucleotide level there is a substitution of cytosine for imimine (in nucleotide 661) and (B) at the amino acid level there is a substitution of leucine for phenylalanine (at amino acid 221).

Figures 8-11: Stacking of the different TILLING mutants characterized and location of the mutation in the primary structure of the protein compared to other DELLA proteins of other plants to see the conservation degree of the affected amino acid. Except in the TILLING 1 mutant, all mutations occur in highly conserved regions of the protein. (SIDELLA of Solanum licopersicum of the particular cultivar M82; StGAl of Solanum tuberosum; GhGAl of Gosipium hirsutum; AtGAl, AtRGA, AtRGL1; AtRGL2 and AtRGL of Arabidopsis thaliana; VvGAl of Vitis vinifera; ZmGAl of Zea mary Oisga of Osga; Triticum aestivum) The alignment was performed using the "ClustalW" algorithm of the EBI (www2.ebi.ac.uk/clustalw/). The DELLA protein sequences used to perform these stacks can be consulted in public databases such as GenBank (http://www.ncbi.nlm.nih.gov/Genbank/).

Figure 12: M 82 wild plant phenotype compared to TILLING plants with point mutation in homozigosis or heíerozigosis in SIDELLA. An increase in the height of the mutant plants is observed, which present greater biomass and greater number of fruits.

DETAILED DESCRIPTION OF THE INVENTION In the present invention the term "sypodial index" is the number of nodes (leaves) on the main bud until the inflorescence. The "growth habit" (plant ha bit), also called growth pattern, according to the present invention is that presented by plants due to the composition, branching pattern, development and texture as well as the arrangement in space of the modular units consisting of leaves, internodes and flowers (fruits).

The "simpodial growth" is that presented by plants such as tomatoes, cantaloupe, many cucurbitaceae, legumes and orchids, etc., and which is characterized in that the growth of the main axis of the plant stops with the formation of the first inflorescence, to continue growing by differentiation and elongation from the differentiation of the bud corresponding to the bud located on the leaf just below that inflorescence. That axillary bud produces a number of leaves and a new terminal flower, to resume growth from the axillary bud below that new inflorescence and so on.

Among the sypodial growth plants are the Solanaceae, Cucurbitaceae, Orchids, Woody, among other interest groups.

"Determined growth", for the purposes of this patent, is the growth habit characterized by the production of a limited number of sypodial shoots on the main axis, after the first flower, resulting in a plant of smaller height. In the case of tomato, it is achieved by mutation in the self-pruning gene in homozigosis.

Likewise, "semi-determined growth" is the habit that plants with certain growth have, in which they produce a larger number of symposia buds than the reference genotype under certain conditions.

And the "indeterminate growth" is the one presented by many species (all wild ones related to tomato and many cultivated) of tomato and typical of all the "vineyards", it is characterized by a simpodial growth, which is repeated indefinitely on the main axis producing new shoots with each new terminal inflorescence.

It is also considered that "transgenesis", in the present invention, is the process by which a DNA sequence containing at least one region not present in the genome of the initial organism is introduced.

"Genetically modified plant" (transgenic plant) refers, in the present invention, to plants whose genetic material has been deliberately modified in order to modify the expression of the DELLA protein or ortholog. The genetic modification can be carried out both by means of a directed mutagenesis and through non-directed mutations. In the present invention, "directed mutagenesis" refers to a specific genetic modification, in which a nucleotide chain in the genome of a plant cell is specifically modified. "Non-directed mutagenesis" refers to the mutagenesis of the cellular genome without directing the mutation, that is, it is not known in advance what mutation is going to be generated, where or the effect that said mutation will have on the cell and / or plant.

The term "corresponding non-genetically modified plant" (wild plant) refers in the present invention to plants whose genetic material has not been modified.

"Orthologous gene" in the present invention refers to homologous genes in different species that encode "orthologous proteins" that catalyze the same reaction (ie, with the same function) in plants. In the present invention new functions and uses of the SIDELLA gene of Soíanum lycopersicum are described together with mutant versions of the gene associated with the new phenotypes. These new genotypic characters include the modification of growth habit and metabolism. Genetically modified plants in SIDELLA or allelic mutant forms of this protein can be used to increase the number of sypodial repeats in a given genetic background with the corresponding increase in the number of inflorescences and fruits, and on the other hand produce fruits with a metabolic content. Modified ico, including that of the volatiles associated with the aroma.

The present invention is related to the genetic control of growth and more specifically to the growth habit that determines the determined or non-determined growth of a plant. More specifically, this invention is related to the use of the SIDELLA gene to modify that aspect of development through genetic engineering and TILLING strategies followed by marker-assisted improvement using the mutant forms of this gene.

A first aspect of this invention is based on the identification of a new function of the DELLA protein not previously described and which provides a way to alter the determined growth habit of plants (in our case, tomato plants carrying the mutation sp / sp). This way of altering the growth habit in tomato is to use an asDELLA construction to decrease levels endogenous to the SIDELLA regulator in transgenic plants. The transgenic plants thus produced have a semi-determined to indeterminate plant phenotype with a greater production of flowers and fruits on the main axis, without significantly altering the flowering time. Another aspect of the present invention, and since DELLA proteins degrade after treatment with the gibberellin hormone GAs (Dill et al. 2001; 2004; Gubler et al. 2002; Itoh et al. 2002; Silverstone et al., 2001 ), is based on another method of varying the level of determination (number and composition of the simpodial repetitions after the first flower) consisting of the treatment of the plant with concentrations of GAs. Another aspect of this invention, and given that there are forms of DELLA insensitive to GAs, is to alter the number and composition of the simpodial repeats after the first flower independently of GAs and confer a function gain phenotype by using a version DELLA mutated.

The new SIDELLA function can be conferred by transgenesis analogously to that resulting from the use of an asDELLA strategy as described in example 1 or by over-expression of mutated versions, including those of function gain (gai type suppression in asDELLA or related).

In another aspect of the present invention a method is proposed to identify mutants, derivatives, variants and alleles of that protein from mutagenized plants and that result in new functional characteristics that modify in different degree the number and composition of the simpodial repeats, thus producing plants. with a number of flowers and size adapted to the needs. The changes in the protein may be one or more of the following: addition, insertion, deletion or substitution of one or more nucleotides that results in changes in the amino acid sequence or not. The present invention also provides the nucleoacidic construct or vector comprising a promoter from which the SIDELLA sequence is expressed in antisense orientation. The construction or vector is designed for expression in a cell, especially plant type. Said plant cell expressing that antisense construct is also included in this invention. This construction when inserted into the genome of the plant directs the expression of the complementary mRNA chain of SIDELLA causing the reduction of the levels of the endogenously expressed coding chain. This decrease can also be obtained by other methods such as RNAi, micro R NA, etc. Said construction or vector containing the SIDELLA in antisense, RNAi, etc., will generally contain a promoter or other regulatory sequence.

The person skilled in the art knows methods for making said constructions that contain the signals and elements necessary for their expression in plants and obtain transgenic plants carrying said constructions and that express the gene in a constitutive or induced way. For more details you can see, for example: "Molecular Cloníng: a Laboratory Manual" 2nd edition, Sambrook et al, 1989, Cold Spring Harbor Laboratory Press. "Protocole in Molecular Biology", Second Edition, Ausubel et al. ed., John Wiley & Sons, 1992. "Specific procedures and vectors previously used with wide success upon plants" are described by Bevan, Nucí. Acids Res. (1984) 12, 8711-8721), and Guerineau and Mullineaux, (1993); "Plant transformation and expression vectors", In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148.

The present invention can be carried out in any plant, especially of simpodial growth, apart from tomato (ie cucurbitaceae or orchids, etc.) in which the SIDELLA ortholog can be isolated and identified by PCR with preserved oligos and carrying out a similar approach. Alternatively, nucleic acid libraries can be tracked with heterologous probes. People skilled in the art can carry out these procedures without problems and carry out genetic constructions and transformation in a similar way to obtain an alteration of the phenotype described in those plants.

In another aspect of the present invention, mutant sequences of SIDELLA are presented that confer alterations in the new function described and that result in tomato plants with a greater number of symposia than the variety provided by the genetic background and with a greater number of inflorescences and alteration of the symposium composition.

In another aspect of the invention there is provided the way to produce and identify new versions of DELLA (or orthologous protein) that are affected in this new function and that are of interest. Acting on DELLA (or orthologous protein) we can alter not only the length of the entrails but also the number of sypodial shoots on the main axis and, consequently, the number of inflorescences and associated fruits. Specifically, it allows in the case of tomato plants of certain growth (sp / sp) to make it undetermined. In another aspect of the present invention, the alteration of SIDELLA (or orthologous gene) causes in the fruit changes in the substantial content thereof that will affect its nutritional and organoleptic characteristics. The organoleptic, nutritional and health characteristics of the fruits are a direct consequence of the content in a series of molecules present in it. Specifically, the flavor and aroma of tomato is related to the concentration and relative amounts of sugars (mainly glucose and fructose) and organic acids (malic, citric) and volatile compounds that contribute to the aroma (at least 14 volatile compounds). The flavor and aroma are characters often forgotten in the most recent improvement programs, where the emphasis has been on productivity, long life of the fruits, etc., with the consequent social demand for fruits with better or different flavors. In the present patent it is shown that it is possible to modify the relative content of volatile compounds, sugars and amino acids in tomato fruit acting at the level of SIDELLA. The method consists of using natural or generated variability through mutagens and identifying mutated variants by TILLING or similar. TILLING (Targeting Induced Local Lesions In Genomes) is a technology aimed at identifying mutants in a gene of interest of known sequence and is applied to all types of organisms, from plants to animals or bacteria (McCallum et al., 2000; Till et al, 2004; Slade et al., 2005). This technology provides a way to obtain mutants in a gene and in our case it was used to find mutants in SIDELLA, since we knew that TILLING combines mutagenesis protocols with POR and a method for detecting DNA polymorphisms.

This results in the identification of mutated forms such as those presented in Figures 4 through 11. Some of the mutations are silent, but others result in notable changes in the number of sypodia and their composition, including a greater number of flowers per symposium. Although we do not know exactly what are the most important residues for the new function of interest, it is generally understood that those mutations that cause conservative changes, that is to say cause an amino acid change of for example a hydrophobic amino acid for another hydrophobic, or one acidic for another Acid often does not result in substantial changes in protein activity. On the other hand, non-conservative changes such as an acidic amino acid by a basic or a polar amino acid by a hydrophobic one significantly alter the function. Of special importance is that it affects the new function by altering to a lesser extent other functions already described such as internode length or fertility. The Description of new mutations may allow us to better define the most relevant amino acids for each case.

In another aspect of the present invention, specific mutations are provided (see Figures Table 3, 4 and Figure 12) that provide changes in the number and composition of the symposia by only slightly altering the length of internodes or other aspects of the phenotype.

It is possible, through the use of a TILLING technique similar to that used here, to identify new alleles that provide intensities of alteration of the number of symposia and their composition (including the number of flowers) that best suits the needs or breeder's wishes, tracking a sufficient number of mutants and characterizing said collection.

Other mutants in DELLA affected in this new function are also objects of the present invention.

They also represent an aspect of the present intention, any cell, especially plant, that contains the construction directed to modify the levels of expression of DELLA or that contains specific mutants in DELLA affected in this new function.

The present invention also comprises the plant comprising said carrier cell of the construction or mutation in SIDELLA. In addition to the plant, the present invention provides any clone of said plant, self-fertilizing or hybrid seed and its descendants and any part thereof as cuttings, seeds, etc. that can be used to propagate such material.

The present invention also provides a method for influencing said new phenotype, such as treatment with GAs or activators or inhibitors of its synthesis or mechanism of action.

The present invention also provides a method for using function gain mutations in DELLA (deletions in the gal mutant type protein) to alter the phenotype in the opposite direction (decrease the number of sypodia or flowers by simpodial repetition). Of particular relevance is that a method is provided to increase the number of symposia by maintaining (specific mutants or higher levels of repression) or not (high level of repression or null mutants) the determined character and the number of flowers per symposium, which affects in the number of fruits. It should be possible for anyone experienced in the art of introducing variations in this strategy in which the decrease in DELLA levels or the expression of mutated forms of DELLA were made induciblely or by specific promoters. For example, constructions such as those indicated above or mutated versions such as those described controlled by a specific or inducible promoter. This would affect the number of symposia and the composition of the fruits in a more directed way,

There are specific promoters, as well as inducible ones, that can be very useful to carry out these new applications and transformation procedures for most of the crop plants and many ornamentals.

EXAMPLES

Example 1: Increase in the number of simpodial repetitions by inhibiting the expression levels of the SIDELLA gene in transgenic tomato plants.

The coding sequence of the SIDELLA gene (SEQ ID No. 1 and 2) was placed in antisense orientation under the control of the constitutive 35S promoter of the cauliflower mosaic virus (CaMV) (see scheme Figure 1) (The SIDELLA cDNA sequence It has already been published and used in this construction), and introduced into tomato plants (Solanum lycopersicum UC82 sp / sp) by Agrobacferium-mediated transformation following established procedures (Ellul et al. 2003). Homozygous plants were selected for the transgene and the size of the plant was evaluated over time, the number of internodes and their length, the number of leaves until the first inflorescence, and the composition of the sypodial metaphor, and the results They are shown in Figures 3, Tables 1 and 2.

The UC82 (sp / sp) plants that carry the self-pruning mutation in homozigosis have the characteristic determined habit, forming the first inflorescence after about 10 leaves and finishing their growth after producing 3 metamers. sypodial, The transgenic lines of tomato UC82 (sp / sp) carrying the asDELLA construction show decreased levels in SIDELLA (Figure 2) and an altered bearing (growth habit) (Figure 3, tables 1 and 2). Not only are the plants taller for longer internodes, but because the growth of the main shoot does not stop as in UC82 (sp / sp) after three symposium metameres, but continues to grow by adding new units that depend on the transgenic line, from 8 symposia (line asDELLA 24B) to even acquire indeterminate growth (lines asDELLA 5A and 7C)

TABLE 1: Effect of the decrease in the expression of SIDELLA in transgenic plants on their height, number and length of internodes, flowering time and composition of metamers. A: data related to 5 wild plants (wt). B: Data related to 4 asDELLA plants, line 5A and C: Data related to 3 asDELLA plants, line 24B.

B.

C.

Table 1 shows the highest height of transgenic plants in relation to wild plants, as well as an increase in the number and length of their internodes. On the other hand it is verified that the flowering time, measured as number of leaves until the appearance of the first inflorescence, is only delayed somewhat in the 5A plants. As for the composition of the metameres, it is observed that in wild plants the inflorescences appear in consecutive leaves and the growth of the plants stops after three inflorescences, while in the asDELLA the inflorescence appears every 2 or 3 leaves and continues to form additional metamers indefinitely when the wild ones have stopped growing.

TABLE 2: Effect of the decrease in the expression of SIDELLA on the growth habit of transgenic plants. The data correspond to the average of 4 plants per genotype. The variation in the composition of the metameres of the asDELLA lines and the change in the type of growth in them from determined to indeterminate or semi-determined (more than 10 symposia repetitions) are observed.

 The cDNA corresponding to SIDELLA (SEQ. ID. No. 1 and 2) was isolated from a lambda ZAP expression library of tomato ovaries (Solanum lycopersícum L. ve Rutgeή emasculated one day before the anthesis. The SIDELLA gene was screened from the colonies obtained (40,000) from the expression library using as a probe the complete coding region (cDNA) (1750 bp) of the gaidel mutated gene of Arabidopsis thalíana (Atgaldet). Hybridization of nitrocellulose filters obtained from the Lysis plates were performed at 46 ° C for 6 h.The nitrocellulose filters were washed twice with 2 x SSC, 0.1% SDS at room temperature for 5 min and once with 0.1 x SSC, 0.1% SDS at 46 ° C for 22 minutes, 15 positive clones corresponding to the same gene were obtained, isolating and sequencing the longest of them (2389 bp.) This clone contained an ORF of 1764 bp capable of synthesizing a protein of 588 amino acids with a molecular weight of 64, 45 KDa and one pu theoretical isoelectric number of 5.07. The comparison of the deduced protein sequence with those existing in the databases, showed that the isolated clone was a tomato ortholog of the DELLA genes

Subsequently, the gene was cloned in the antisense direction in plasmid pBINJIT60 under the control of the 35S promoter of the tobacco mosaic virus (35S :: SIDELLAas). The binary plasmid, pBINJIT60, was used to obtain transgenic Lycorpersicon esculentum plants by transformation with Agrobacterium tumefaciens. This plasmid is constructed from the "cassette" of plasmid pJIT60, which provides the 35S promoter of cauliflower mosaic virus (CaMV) with the duplicated "enhancer" (2x35S), the multiple cloning site of pUC9 and the sequence of polyadenylation of the CaMV, [CaMV poly (A) +] (Guerineau et al., 1992), extracted as a Kpnl and Xhol fragment, and subcloned into the Kpnl and I left sites of the binary plasmid pBIN19. PBIN19 contains the NPTII gene, which confers resistance to kanamycin, fused to the promoter and the nopaline synthetase terminator (pnos and tnos), included in the T-DNA (Bevan, 1984). The resulting vector pBINJIT is approximately 13.2 kb in size and presents as unique cloning sites Salí, BamHI and Smal. To clone asDELLA antisense in this vector was amplified by PCR using the complete genome sequence of TGxC7 oligonucleotides (5 ^{'-CCAGCACTTGTCATTCTTACC-3'} SEQ. ID. No. 13) and TGxCS (5-CATCTCTCTCATTGTCTCTTCC-3 ^'SEQ. ID No. 14). The 1800pb product was digested with EcoRV and subcloned into the pBSK vector, choosing those clones in which SIDELLA had been cloned in antisense to subclone it into the binary vector pBINJIT60 using the Sma I / Sal I sites in order to reduce the levels Endogenous to SIDELLA, this construction was introduced in the strain LBA4404 of Agrobacteríum tumefaciens by electroporation for later use in the transformation of tomato from cotyledon explants (Ellul et al., 2003). Homozygous plants were selected for the transgene and it was verified, by semi-quantitative RT-PCR, that they effectively showed a decrease in the level of endogenous SIDELLA expression (Figure 2). In these same plants, their height, the number of internodes and the length of these, the number of leaves until the first inflorescence, and the composition of the sypodial metamer were evaluated over time. The results are shown in Figures 3 and tables 1 and 2.

Example 2: Obtaining and identifying tomato SIDELLA alleles in M82 (sp / sp).

In order to identify mutated alleles in the SIDELLA gene that could provide different intensities of the new phenotype, a TILLING strategy was used.

TILLING (Targeting Induced Local Lesions In Genomes) is a technology aimed at identifying mutants in a gene of interest of known sequence and is applied to all types of organisms from plants to animals or bacteria (McCallum et al., 2000; Till et al., 2004; Slade et al., 2005). This technology provides a way to obtain mutants in a gene and in our case it was used to find mutants in SIDELLA since we knew that TILLING combines mutagenesis protocols with PCR and a method for detecting DNA polymorphisms. There are many ways to mutagenize populations and different ways to identify point mutants in a set of materials (Mccollum et al., 2004; Gady et al., 2009) In our case the TILLING method combines the induction of a large number of point mutations by chance caused by the Ethyl Methane Sulfonate (EMS) that produced a population of 12,000 2 families in the tomato variety determined M82 (Menda et al., 2004). The DA was extracted from each of the families and combined following a 3D strategy to decrease the number of PCR reactions to be performed. For TILLING tracking, the SIDELLA locus of interest was amplified from each of the pools by means of a nested PCR and universal primers. The first PCR amplification is a standard PCR reaction that uses specific primers of the SIDELLA target gene as indicated in (Qiu et al., 2004). For the specific reaction the following oligonucleotides were used: SIDELLA-ext-F1 5'cattctctaatggtgctgttttcttc3 '(SEQ. ID. No. 15); SIDELLA-ext-R1: 5'aggtagctataagtggccgtgtatg3 '(SEQ. ID. No. 16); SIDELLA-F1: 5'gaaaagtaagatttgggaagaaga3 '(SEQ. ID. No. 17); SIDELLA-R1 5'ctaaaagcatggaagcttgtttgaa3 '(SEQ. ID. No. 18). The amplification conditions were 1 min at 94 ° C and 30 cycles of (1 Os at 94 ° C, 20 s at 63 ° C, 1 min at 72 ° C) and 5 min at 72 ° C when SIDELLA oligonucleotides were used -ext-R1 and SIDELLA-ext-F1. A microliter of the first PCR was used as a template for a second nested PCR amplification reaction, using a mixture of specific internal oligonucleotides bearing a universal M13 tail, combining with the universal M13 d primers. M13F70Q (CACGACGTTGTAAAACGAC; SEQ. ID. No. 19) and M13R800 (GG ATAAC AATTTC AC AC AGG; SEQ. ID. No. 20), marked at the 5 'end with fluorescent markings IRD700 and IRD800 (LI-COR®, Lincoln , Nebraska, USA), respectively. This PCR reaction was carried out using each primer at the concentration of 0.1 μΜ, and the following two-step cycle program: 94 ° C for 2 min, 10 cycles at 94 ° C for 15 s, a banding temperature of specific primers for 30 S and 72 ° C for 1 min, followed by 25 cycles at 94 ° C for 15 s, 50 ° C for 30 s and 72 ° C for 1 min, and finally an extension of 5 min at 72 ° C .

The detection of mutations in unpurified PCR products was carried out as indicated in Triques et al., 2007, except that the enzyme extract was used at a dilution of 1 to 10 000 and 0.6 μΐ of digestion products were loaded with ENDOI in the sequencing gel. The mutants were evidenced by occupying a different position in the sequencing gel, and by deconvolution of the different lines mixed in the pool. The mutant present in the pool was confirmed individually and the mutation was sequenced following standard procedures.

Only those identified mutations that involve a change in the amino acid sequence of the protein are presented, highlighting those that give change not conserved in the corresponding amino acid (Le. acid by basic or proline by another, etc.) and that is to be expected therefore that they result in an alteration in the new phenotype described mediated by SIDELLA.

In this way, a series of mutants were identified that, after sequencing, showed alterations with respect to the SIDELLA sequence of the particular M82 cultivar (SEQ. ID. No. 11 and 12) called TILLING 1 mutants (SEQ. ID. No. 3 and 4), TILLING 2 (SEQ. ID. No. 5 and 6), TILLING 3 (SEQ. ID. No. 7 and 8), and TILLING 4 (SEQ. ID. No. 9 and 10) shown in Figures 4 to 7.

In the TILLING 1 mutant at the nucleotide level (SEQ. ID. No. 3) there is a substitution of guanine for adenine (at nucleotide 458) and at the amino acid level (SEQ. ID. No. 4) there is a substitution of alanine for threonine ( in amino acid 153).

In the TILLING 2 mutant at the nucleotide level (SEQ. ID. No. 5) there is a substitution of guanine for adenine (in nucleotide 1498) and at the amino acid level (SEQ. ID. No. 6) there is a substitution of glutamine for Usine ( in amino acid 500). In the TILLING 3 mutant at the nucleotide level (SEQ. ID. No. 7) there is a substitution of cytosine for thymine (in nucleotide 994) and at the amino acid level (SEQ. ID. No. 8) there is a substitution of leucine for phenylalanine ( in amino acid 332).

In the TILLING 4 mutant at the nucleotide level (SEQ. ID. No. 9) there is a substitution of cytosine for thymine (in nucleotide 661) and at the amino acid level (SEQ. ID. No. 10) there is a substitution of leucine for phenylalanine ( in amino acid 221)

A stacking of the primary structure of the SIDELLA protein was also made for each of the mutations together with other DELLA proteins of other plant species in order to see the degree of conservation of the mutated amino acid and in which region of the protein this was produced. (Figures 8 to 1 1). Except in the TILLING 1 mutant, all mutations occur in highly conserved regions of the protein. Example 3: Alteration in the growth habit in plants that carry SIDELLA mutated alleles.

To carry out a study of the effect on the phenotype caused by the new mutations obtained in SIDELLA, a small "mini breeding" was made. For this, the carrier lines of the different mutations TILLING 1 (SEQ. ID. No. 3 and 4), TILLING 2 (SEQ. ID. No. 5 and 6), TILLING 3 (SEQ. ID. No. 7 and 8) and TILLING 4 (SEQ. ID. No. 9 and 10) were self-fertilized and descendant plants were selected that were carriers of the mutation in homozigosis, heterozygosis or azigotics. These materials were characterized below. The growth habit of these plants was monitored and summarized in Tables 3 and 4. These tables show that the DELLA mutations indicated in the table produce a plant phenotype of greater height and semi-determined growth compared to its wild bottom that is determined.

In Figure 12 you can see the general appearance of plants that carry point mutations in SIDELLA identified by TILLING. Most noteworthy is that lines have a phenotype that is basically that of the unmodified wild fund UC82 except in the greatest number of sypodial repetitions obtained from the first inflorescence, resulting in a greater number of leaves and inflorescences before stop growth, which implies, as can be seen, plants of greater size and, consequently, greater biomass and number of fruits.

TABLE 3: Summary of changes caused by TILLING mutations at the nucleotide and amino acid level, environment of amino acid change, type of mutation and effect on the growth habit of the mutation carrier plant. The effect of these point mutations in SIDELLA is the change in the growth habit of the plant, going from being of a determined to semi-determined type, being nt: nucleotide; aa: amino acid; wt: wild; mt: mutation.

TABLE 4: Effect of point mutations in SIDELLA on different growth parameters: height, total number of internodes and their length, number of leaves until the first inflorescence, composition of sympodial metameres. The mutant plants have a greater height, greater number and length of internodes, as well as an increase in the number of metameres with respect to the wild type that gives the plant a semi-determined growth.

 Once both the genetic and amino acid sequences of the TILLING mutants (SEQ. ID No 3-9) have been known, it would be easy for one skilled in the art to generate transgenic plants containing said mutations using techniques known in the state of the art.

Example 4: Alteration in the content of metabolites in the fruit as a result of the modification in SIDELLA.

A preliminary observation of the fruits of the asDELLA plants indicated that the total soluble solids content had increased in relation to the fruits of unmodified plants. In order to find out if the asSJDELLA fruits had altered the metabolic composition, the content of volatile compounds and primary metabolites of mature fruits of the asDELLA lines, both parthenocarpic and seeds, were analyzed and compared with two groups of wild ones, a group of wild ones untreated and the other group of wild animals that had been spray treated with a 10uM solution of GA1 +3.

The metabolites analyzed have a determining effect on the organoleptic and nutritive qualities of tomatoes, since volatile compounds are responsible for the aroma, while some of the primary metabolites analyzed, including glucose and fructose sugars, organic acids Citric, malic and succinic, and several amino acids, have a decisive contribution on the flavor and nutritional content of the fruits.

The results indicate a change in the content of both primary metabolites and aromas in asDELLA samples, which can be mimicked by treating wild fruits with GAs, as shown below. This new function of SIDELLA and the GAs in changing the metabolic profile of the fruit is of interest to alter the organoleptic properties of the fruit. In addition, it was analyzed whether or not containing seeds altered the metabolite content of asDELLA fruits.

Analysis of volatile profile: The analysis of volatile compounds was basically performed using the protocol described in Zanor et al., 2009, which is detailed below. For this, tomato fruits were collected in the ripe red stage. Pieces of the pericarp were taken and immediately frozen with liquid nitrogen. The frozen samples were crushed with a coffee grinder (Moulinex de Luxe) and stored at -80 ° C until analysis. This same material was used both for the analysis of volatile compounds and primary metabolites.

Prior to analysis, 0.5 g of material were weighed into a 7 ml vial and incubated in a 37 ° C water bath for 5 minutes, with the vial closed. Subsequently, 0.5 ml of a 100mM EDTA solution at pH 7.5 and 1.1 g of CaCl2.2H20 were added. The vial was immediately closed again, vigorously shaken and sonic for 5 minutes. Finally, 1 ml of this extract was taken to a 10 ml headspace vial, on which the analysis was performed. Volatiles were captured in the headspace by solid phase microextraction (SPME). The fiber used has a 65 μηη coating of polydimethylsiloxane-divinylbenzene (PDMS / DVB) (SUPELCO). The vials were tempered at 50 ° C for 10 minutes and, subsequently, the fiber was exposed to the head space for 20 minutes at the same temperature. The acquisition of volatiles in the fiber and subsequent desorption was performed automatically with a CombiPAL (CTG Analytics).

For ero-matographic separation and the detection of volatiles adsorbed to PDMS / DVB fiber, these were desorbed at the 250 ° C injection port of an Agilent 6890N gas chromatograph for 1 minute. The conditions of matographs are described below. Carrier gas: helium, 1.2 ml / min. Column: DB-5mS (60m, 0.25mm, 1μπη) (J&W Scientific). Temperature: 40 ° C for 2 min, 5 ⁰ C / min ramp up to 260 ° C and then 260 ° C for 5 min. The detection was carried out using an Agilent 5975 B mass spectrometer in the Sean mode, in the range of m / z 35-220, at 7 scans / s, ionization source temperature 230 ° C and ionization energy 70eV. The chromatograms were processed with the MSD ChemStation Enhanced Data Analysis software (Agilent Technologies).

The results (as can be seen in Table 5) indicate a change in volatile content in asDELLA samples that can also be mimicked by treating wild fruits with GAs. The changes observed in asDELLA are detected both in fruits with seeds (same size as Wild) and without seeds (smaller size). Specifically, there is a significant increase in volatiles that contribute to the following aroma: beta-dama scenona, 1-penten-3-one and (E) -2-hexenal, which have values of at least double in the asDELLA or in the treated. Other compounds such as 3-methylbutanol, 1-nitro-2-phenylethane, 2-phenylethanol, phenylacetaldehyde and 2-isobutyl thiazole decreased significantly in modified fruits. The olfactory descriptors associated with each of these compounds individually can be seen in Table 6.

TABLE 5: Modification on the pattern of volatiles that contribute to the aroma of tomato. AsDELLA fruits, both parthenocarpic and pollinated, have increased levels of some of them, and decreased levels of others. The treatment with GAs produces similar effects. Bold compounds appear whose differences from WT have statistical significance (p <0.05). Pl: WT plants sprayed twice a week with a solution of gibberellins GA1 +3 10uM; AS C: transgenic asSIDELLA without treatment; AS Pol: transgenic asSIDELLA whose flowers were pollinated (and whose fruits have seeds); WT: UC82 wild control plants.

Other volatile compounds that do not seem to contribute to the aroma of the fruit but that may have other functions, including communication with other organisms, are found at different levels and in a statistically significant way in both modified fruits asDELLA (with or without seeds) and those treated with GAs (table 7). The most affected in this case are 2-metii-1-butanol and 2-metiM-propanol, which have much lower levels. The importance of such changes in adaptation to environmental conditions, etc. It is about to clarify, but it most likely affects the attraction or repulsion of different organisms towards the fruit.

TABLE 7: Modification on the pattern of volatiles that do not contribute to the aroma of tomato. The asDELLA fruits, both parthenocarpic and pollinated, have increased levels of some of them, and decreased levels of others. The treatment with GAs produces similar effects. Bold compounds appear whose differences from WT have statistical significance (p <0.05). Pl: WT plants sprayed twice a week with a solution of gibberellins GA1 +3 I OUM; being AS C: transgenic asSIDELLA without treatment; AS Pol: transgenic asSIDELLA whose flowers were pollinated (and whose fruits have seeds); WT; UC82 wild control plants.

Analysis of primary metabolites:

The primary metabolite analysis was basically performed using the protocol described in Roessner-Tunali et al, 2003, which is detailed below, using the same plant material described above for the analysis of volatile elements.

To carry out the analysis, the metabolites were extracted first. Approximately 250 mg of plant material was weighed, 3 ml of methanol and 120 μΙ of a solution of the internal ribitol standard (0.2 mg / ml in water) were added, and vortexed vigorously for 20 s. It was transferred to a 5 ml glass vial, closed and incubated in a 70 ° C water bath for 15 min. Subsequently, 1.5 ml of water was added, vortexed, and centrifuged at 4000 rpm for 15 min. 50 μΙ of the supernatant was taken, taken to a 1.5 ml polypropylene tube and dried in a speed-vac for 12 hours, at room temperature.

Then, the extracted metabolites were derivatized as follows. 60 μΙ of a solution of O-methylhydroxylamine hydrochloride (30 mg / ml in pyridine) was added, and kept at 37 ° C with stirring for 2 hours. After a centrifugation pulse, 120 μΙ of N-methyl-N- (trimethylsilyl) trifluoroacetamide (STFA) and 12 μΙ of a mixture of several fatty acid methyl esters (800 ng / ml each in chloroform), and kept at 37 ° C, under stirring, for 30 min. Finally, it was transferred to a 2 ml GC vial with 200 μΙ insert, from which the injection was made.

To perform chromatographic separation and detection, 1 μΙ of the extract was injected into the 230 ° C injection port of an Agilent 6890 N gas chromatograph. Two injections of each extract were made: one with split 1; 20 for determination of the most abundant metabolites (fructose and glucose), and another splitless for the rest of the metabolites. Chromatographic conditions are described below. Carrier gas: helium, 2 ml / min. BPX35 column (30 m, 0.32mm, 0.25μιη) (SGE). Temperature: 85 ° C for 2 min, ramp from 15 ° C / min up to 360 ° C. Detection was carried out using a PEGASUS 4D mass spectrometer

(LEGO), in the range of m / z 40-600, at 6.25 scans / s, ionization source temperature 200 ° C and ionization energy 70eV. A solvent delay of 150 s was applied,

To analyze the data, the chromatograms were processed with the GhromaTOF-GC v3.32 (LECO) software. The areas obtained for each compound are corrected with respect to the internal standard and the exact fresh weight of each sample.

The results (as can be seen in Table 8) indicate that asDELLA fruits, both parthenocarpics and those with seeds, contain increased levels of sucrose, as well as the amino acids tyrosine, asparagine, isoleucine, threonine and proline, among others. metabolites The effect on the accumulation of these compounds in asDELLA fruits can be obtained in part by treatment with 10uM GA1 +3.

TABLE 8: Increase in the levels of various metabolites with effects on the organoleptic qualities of tomato. AsDELLA fruits, both parthenocarpic and pollinated, have higher levels of various metabolites, especially some sugars and amino acids. The treatment with GAs produces similar effects. Bold compounds appear whose differences from WT have statistical significance (p <0.05). Pl: WT plants sprayed twice a week with a solution of gibberellins GA1 +3 10uM; AS C: transgenic asSIDELLA without treatment; AS Pol: transgenic asSIDELLA whose flowers were pollinated (and whose fruits have seeds); WT: UC82 wild control plants.

This new function of SIDELLA and the GAs, which consists in altering the meta-war profile of the fruit, is of interest, since it allows the organoleptic and nutritional properties of the fruit to be modified. REFERENCES

• Achard P. Vriezen W.H. Van Der Straeten D. and Harberd N.P. (2003) Ethylene regulates Arabidopsis development via the modulation of DELLA protein growth repressor function. Plant Ce // 15: 2816-2825. · Achard P. Cheng, H. De Grauwe L. Decat J. Schoutteten H. Moritz T. Van der Straeten D. Peng J.R. and Harberd N.P. (2006) Integration of plant responses to environmentally activated phytohormonal signáis. Science 31 1: 91-94.

• Bevan M. (1984). Binarv Agrobacterium vectors for plant transformation. Nucleic Acids Res. 12: 871 1-21 · Carmel-Goren L. Liu Y. S. Lifschitz E. Zamir D (2003) The SELF-PRUNING gene family in tomato Plant Molecular Biology 52: 1215-1222.

• Gubler F. Chandler P.M. White R.G. Llewellyn D.J. Jacobsen J.V. (2002) Gibbereílin signaling in barley aleurone cells. Control of SLN1 and GAMYB expression. Plant Physioi 129: 191-200

Dill A. Jung H.S. and Sun T.P. (2001) The DELLA motif is essential for gibberellin-induced degradation of RGA. Proc, Nati Acad. Sci. USA 98: 14162-14167.

• Dill, A., Thomas, S.G., Hu, J., Steber, C.M., and Sun, T.-P. (2004). The Arabidopsis F-box protein SLEEPY1 targets gibbereílin signaling repressors for gibberellin-induced degradation. Plant Cell 16: 1392-1405.

· Doebley J. (2006). Unfallen grains: how ancient farmers turned weeds into crops.

 Science 312: 1318-1319.

• Ellul P. Garcia-Sogo B. Pineda B. Ríos G. Roig L. and Moreno V. (2003) The ploidy level of transgenic plants in Agrobacteriummediated transformation of tomato cotyledons (Lycopersicon esculentum Mili.) Is genotype and procedure dependent. Theor Appl. Genet 06, 231-238

 • Eshed Y. Zamir D. (1995). An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the Identification and fine mapping of yield-associated QTL. Genetics 141: 1 147-1 162.

• Foucher F. Morin J. Courtiade J. Cadioux S. Ellis N. Banfield M, J. Rameau C. (2003), DETERMINATE and LATE FLOWERING are two TERMINAL FLOWER1 / CENTRORADIALIS homologs that control two distinct phases of flowering initiation and develo pment in pea. Plant Cell 15: 2742-2754.

• Friedland W. H. Barton A. (1975). Destalking the wily tomato: a case study in social consequences in California agricultural research. Research Monograph No. 15, Dept. of Applied Behavioral Sciences, University of California, Da vis, California, USA.

• Fu X.D. and Harberd N.P. (2003) Auxin promotes Arabidopsis root growth by modulating gibberellin response. No. 421: 740-743.

• Antoine LF Gady, Freddy WK Hermans, Marión HBJ Van de Wal, Eibertus N van Loo, Richard GF Visser and Christian WB Bachem (2009) .lmplementation of two high through-put techniques in a novel application: detecting point mutations in large EMS mutated plant populations. Plant Methods 5Λ 3 doi: 10.1 186 / 1746-4811 -5-13

• Guerineau F, Lucy A, Mullineaux P. (1992). Effect of two consensus seque nces preceding the translation initiator codon on gene expression in plant protoplasts. Plant MoI Biol. 18: 815-8.

· Hanna G. C. Gentle A. Smith P. G. Lippe L. F. Da vis G. N. McCoy D. N. (1964).

 Recently developed vegetables aid mechanical cultivation. California Agriculture 18: 8-10.

• Itoh, H., Ueguchi-Tanaka, M., Sato, Y., Ashikari, M. and Matsuoka, M. (2002) The gibberellin signaling pathway is regulated by the appearance and disappearance of SLENDER RICE1 in nuclei. Plant Cell, 14, 57-70.

• Carl M. Jones, Charles M. Rick, Dawn Adams, Judy Jernstedt and Roger T. Chetelat (2007). Genealogy and fine mapping of obscura venosa, a gene affecting the distribution of chloroplasts in leaf veins, and evidence of selection during breeding of tomatoes (Lycopérsicon esculentum; Solanaceaé), Am. J. BotanySA: 935-947. · Koornneef M. Elgersma A. Hanhart C.J. van Loenen-Martinez E.P. van Ring L. and Zeevaart JAD. (1985). A gibberellin insensitive mutant of Arabidopsis thalíana. Physiol Plant 65: 33-39.

• Krebs AV (2005). The Cause: the word was made flesh. Website htto: // www. farmworker vement. org / essa vs / essa vs / KREBS% 20MANUSCRIPT% 20L A% 20CAUSA.pdf Read SG Cheng H. King KE Wang WF He YW Hussain A. Lo J. Harberd NP and Peng, JR (2002) Gibberellin regulates Arabidopsis seed germination via RGL2, to GAI / RGA-like gene whose expression is up-regulated following imbibition. Genes Dev. 16: 646-658.

 Cristina Marti, Diego Orzáez, Philippe Ellul, Vicente Moreno, Juan Carbonell and Antonio Granell, (2007). Silencing of DELLA induces facultative parthenocarpy in tomato fruits. The Plant Journal 52: 865-876.

McCallum CM, Comai L, Greene EA, Henikoff S: Targeting induced local lesions IN genomes (TILLING) for plant functional genomics (2000). Plant Physiol 123 (2): 439-

442

Menda N, Semel Y, Peled D, Eshed Y, Zamir D, (2004) In silico screening of a saturated mutation library of tomato. Plant J. Jun; 38 (5): 861-72.

 Murase K. Hirano Y. Sun t-P. and Hakoshima T. (2008). Gibberellin-induced DELLA recognition by the gibberellin GID1 receptor. Nature 456: 459-464.

Oh E, Yamaguchi S, Hu J, Yusuke J, Jung B, Paik I, Lee HS, Sun TP, Kamiya Y, Choi G. (2007) PIL5, a phytochrome-interacting bHLH protein, regulates gibberellin responsiveness by binding directly to the GAI and RGA pro mote rs in Arabidopsis seeds. Plant Cell 19: 1 192-1208.

 Peng J. and Harberd P. (1993). Derivative alleles of the Arabidopsis gibberellin- insensitive (gal) mutation confer a wild-type phenotipe. Plant Céll. 5: 351-360

Peng J. Richard D.E. Hartley N.M. Murphy G.P. Devos K.M. Flitntham J.E. et al. (1999). "Green Revolution" genes encode mutant gibberellin response modulators. Nature 400: 256-261.

Peng J.R. Carol P. Richards D.E. King K.E. Cowling R.J. Murphy G.P. and Harberd N.P. (1997) The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses. Genes Dev. 1 1: 3194-3205.

Pnueli L. Carmel-Goren L. Ha re ven D. Gutfinger T. Alvarez J. Ganal M. Zamir D. Lifschitz E. (1998). The SELF-PRUNING gene of tomato regulates vegetative to reproductive switching of sympodial meristems and is the ortholog of CEN and TFL1. Devetopment 125: 1979-1989. Pnueli L. Gutfinger T. Hareven D, Ben-Naim O. Ron N. Adir N. Lifschttz E. (2001). Tomato SP-interacting proteins define an eonserved signaling system that regulates shoot architecture and flowering. Plant Ce // 13: 2687-2702.

Qiu P. Shandilya H. D'Alessio JM. O'Connor K. Durocher J. Gerard GF. (2004) Mutation detection using Surveyor nuclease. Biotechniques 36 (4): 702-707.

Richards D.E., King K.E., Ait-ali T., and Nichoias P Harberd. (2001). How gibberellin regulates plant growth and development: A Molecular Genetic Analysis of Gibberellin Signaling. Rev. Plant Physiol. Plant Mol. Biol. 52: 67-88

Roessner-Tunali U, Hegemann B, Lytovchenko A, Carrari F, Bruedigam C, Granot D and Fernie AR. (2003). Metabolic Profiling of Transgenic Tomato Plañís Overexpressing Hexokinase Reveal That the Influence of Hexose Phosphorylation Diminishes during Fruit Development. Plant Physiology 133: 84-99.

Silverstone A.L. Ciampaglio Ch.N. Sun T.-p. (1998). The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway. Plant Cell, 10: 155-169

Silverstone, A.L., Jung, H-S., Dill, A., Kawaide, H., Kamiya, Y., and Sun, T-p. (2001). Repressing a repressor: Gibberellin-induced rapid reduction of the RGA protein in Arabidopsis. Plant Cell 13: 1555-1565.

Slade AJ, Knauf VC: TILLING moves beyond functional genomics into crop improvement. (2005). Transgenic Res. 14 (2): 109.-115.

Smith B. (1998) Foreword, Livingsto and the tomato. Ohio State University Press, Columbus, Ohio, USA.

Stevens M. A. Rick C. M. (1986). Genetics and breeding. In J. G. Atherton, J. Rudich [eds.] The tomato crop: a scienfífic basís for improvement, 35-105. Chapman and Hall, New York, New York, USA.

Szymkowiak E. J. Irish E. E. (2006). JO I NT LES S suppresses sympodial identity in inflorescence meristems of tomato. Floor 223: 646-658.

Till BJ, Reynolds SH, Weil C, Springer N, Burtner C, Young K, Bowers E, Codorno CA, Enns LC, Odden AR. (2004). Discovery of induced point mutations in maize genes by TILLING. BMC Plant Biol 4 (1): 12. Triques K, Sturbois Β, Gallais S, Dalmais M, Chauvin S, Clepet C, Aubourg S, Rameau C, Caboche M, Bendahmane A. (2007). Characterization of Arabidopsis thaliana mismatch specific endonucleases: application to mutation discovery by TILLING ¡n pea. Plant J, 51 (6): 1116-1 125.

Ueguchi-Tanaka, M., Nakajima, M., Motoyuki, A., and Matsuoka, M. (2007). Gibberellin receptor and its role in gibberellin signaling in plants. Annu, Rev, Plant Biol. 58: 183-198.

Ueguchi-Tanaka M. Hirano K. Hasegawa Y. Kitano H. and Matsuoka .M. (2008). Release of the repressive activity of rice DELLA protein SLR1 by gibberellin does not require SLR1 degradationn in the gid2 mutant. Plant Ce // 20: 2437-2446.

Wen C.K. and Chang C. (2002) Arabidopsis RGL1 encodes a negative regulator of gibberellin responses. Plant Ce // 14: 87-100.

 Wilson R.N. and Chris R. Somerville (1995) Phenotypic Suppression of the Gibberellin-lnsensitive Mutant (gal) of Arabidopsis' Plant Physiol. (1995) 108: 495-502 Yeager A. F. (1927). Determine growth in the tomato. Journal of Heredíty 2B: 263-265.

Zanor MI, Rambla JL, Chaib J, Steppa A, Medina A, Granell A, Fernie AR, Causse M., (2009). Metabolic characterization of loci affecting sensory attributes in tomato allows an assessment of the influence of the levels of primary metabolites and volatile organic contents. Journal of Experimental Botany 60: 2139-2154.

Claims

one . Genetically modified plant with the altered expression of the DELLA protein or orthologue characterized in that the alteration in the expression of the DELLA protein produces an inhibition in the repression of the development and growth of the plants in comparison to corresponding plants not genetically modified.

2. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 1, characterized in that said alteration is obtained by siting the SIDELLA gene or ortholog.

3. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 2, characterized in that the silencing is obtained using a gene construct based on an antisense copy of the SIDELLA gene controlled by the 2XCaMV35S promoter.

4. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 1, characterized in that said alteration is obtained by mutation of the SIDELLA gene or ortholog.

5. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 4, characterized in that the mutation in the genetic sequence of SIDELLA is due to addition and / or insertion and / or deletion and / or substitution of one or more nucleotides SIDELLA gene or ortholog.

6. A genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 5, characterized in that the mutation consists in the replacement of the guanine nucleotide with the adenine nucleotide in nucleotide 458.

7. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 6, characterized in that the mutation in the genetic sequence of SIDELLA is called TILLING 1 (SEQ ID No 3).

8. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 5, characterized in that the mutation consists in the replacement of the guanine nucleotide with the adenine nucleotide in nucleotide 1498,

9. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 8, characterized in that the mutation in the genetic sequence of SIDELLA is called TILLING 2 (SEQ ID No.5).

10. Genetically modified plant with the altered expression of the DELLA or orthologous protein according to claim 5, characterized in that the mutation consists in the substitution of the cytosine nucleotide with thymine in nucleotide 994.

eleven . Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 10, characterized in that the mutation in the genetic sequence of SIDELLA is called TILLING 3 (SEQ ID No.7).

12. Genetically modified plant with the altered expression of the DELLA or orthologous protein according to claim 5, characterized in that the mutation consists in the replacement of the cytosine nucleotide with thymine in nucleotide 661.

13. Genetically modified plant with the altered expression of the DELLA protein or ortholog according to claim 12, characterized in that the mutation in the genetic sequence of SIDELLA is called TILLING 4 (SEQ ID No.9).

14. Genetically modified plant with the altered expression of the DELLA or orthologous protein according to claims 1 to 13 characterized in that the plant exhibits a symposium growth pattern.

15. Genetically modified plant with the altered expression of the DELLA or orthologous protein according to claims 1 to 14 characterized in that the determined sypodial growth pattern is modified to undetermined.

16. Genetically modified path with the altered expression of the DELLA or orthologous protein according to claims 1 to 14 characterized in that the determined sypodial growth pattern is modified to semi-determined.

17. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claims 1 to 13, characterized in that the content of metabolites and / or some volatile substances and / or not associated with the aroma of the fruits is increased with respect to corresponding plants not genetically modified.

18. Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claims 1 to 13 characterized in that the content of some volatile substances associated and / or not associated with the aroma of the fruits is reduced compared to corresponding plants not genetically modified.

Genetically modified plant with the altered expression of the DELLA or orthologous protein according to claim 17 characterized in that the increase in the content of the metabolites sucrose, tyrosine, asparagine, isoleucine, threonine, proline, pyroglutamic acid and myo-inositol is of the order of 100- 400%, and / or that of fructose and glucose is of the order of 10-30%, and / or that of volatile substances associated with the aroma of the fruits Ε-2-hexenal, 1-penten-3-one and p. Damascenone is of the order of 100-200%, and / or that of volatile substances not associated with the aroma of the fruits 3- methylbutanoic acid, E, E-2,4-decadienal and Ε-2-octenal is of the order of 100 -200% compared to corresponding plants not genetically modified

Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 18 characterized in that the decrease in the content of volatile substances associated with the aroma of the fruits 3- methylbutanol, l-nitro-2-phenylethane, 2-phenylethanol, phenylacetaldehyde and 2-isobutyl thiazole is of the order of 80-90%, and / or that of volatile substances not associated with the aroma of geranilacetone, terpineol, linalool, benzyl alcohol, eugenol, benzylnitrile, 2- methyl-1-butane! and 2-methyl-1-propanol is of the order of 50-100% with respect to corresponding plants not genetically modified.

Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claims 1 to 20 characterized in that the plant has a commercial and / or agricultural interest.

Genetically modified plant with the altered expression of the DELLA or orthologous protein according to claim 21, characterized in that said plant is selected from the group of solanaceae, cucurbits, orchids and / or woody.

Genetically modified plant with the altered expression of the DELLA or orthologous protein according to claim 22 characterized in that the plant belongs to the Solanaceae family.

Genetically modified plant with the altered expression of the DELLA protein or orthologue according to claim 23 characterized in that the genetically modified plant is a tomato plant, Sotanum lycopersicum.

Fruit of the genetically modified plant according to claims 1 to 24 characterized in that the content of metabolites and / or associated volatile substances and / or not associated to the aroma of the fruits is increased with respect to the fruits of corresponding plants not genetically modified.

26. Fruit of the genetically modified plant according to claims 1 to 24 characterized in that the content of some volatile substances associated and / or not associated with the aroma of the fruits is reduced with respect to the fruits of corresponding plants not genetically modified.

27. Fruit of the genetically modified plant according to claim 25, characterized in that the increase in the content of sucrose, tyrosine, asparagine, isoleucine, threonine, proline, pyroglutamic acid and myo-inositol metabolites is of the order of 100-400%, and / or of Fructose and glucose is of the order of 10-30%, and / or that of volatile substances associated with the aroma of the fruits Ε-2-hexenal, 1-penten-3-one and P. damascenone is of the order of 100-200 %, and / or that of volatile substances not associated with the aroma of the fruits 3-methylbutanoic acid, E, E-2,4-decadienal and E-2- octenal is of the order of 100-200% with respect to the fruits of corresponding plants not genetically modified

28. Fruit of the genetically modified plant as claimed in 26 characterized in that the decrease in volatile substances associated with the aroma of the fruits 3- methylbutanol, 1-nitro-2-phenylethane, 2-phenylethanol, phenylacetaldehyde and 2-isobutylthiazole is of the order 80-90%, and / or that of volatile substances not associated with the aroma of geranilacetone, terpineol, linalool, benzyl alcohol, eugenol, benzylnitrile, 2- methyl-1-butanol and 2-methyl-1-propanol is of the order of 50-100% with respect to the fruits of corresponding plants not genetically modified

29. Fruit according to claims 25-28 characterized in that the fruit is tomato.

30. Genetically modified plant seed according to claims 1 to 29 characterized in that the expression of the DELLA protein is altered.

31. Procedure for obtaining genetically modified plants with the altered expression of the DELLA protein or orthologue characterized in that it comprises the following stages: a) transforming the genome of a plant cell, b) regenerating the plant from the cell of stage a ), c) obtain seeds of the transformed plant that contain the modified genome and, d) grow at least one of the seeds of step c) to obtain a plant that contains the altered expression of the DELLA protein or ortholog,

5 32. Method according to claim 31 characterized in that step a) consists of a directed mutagenesis.

33. Method according to claim 32 characterized in that the directed mutagenesis consists in silencing the SIDELLA gene.

34. Method according to claim 33 characterized in that for the silencing 10 of stage a) the asDELLA gene construct is used.

35. Method according to claim 34 characterized in that the gene construct is based on an antisense copy of the SIDELLA gene controlled by the 2XCaMV35S promoter.

36. The method according to claim 32, characterized in that the directed mutagenesis of step a) consists in modifying the native sequence of the SIDELLA gene to the sequence of the mutated SIDELLA gene selected from the group of mutations called TILLING 1 (SEQ ID No 3), TILLING 2 (SEQ ID No 5), TILLING 3 (SEQ ID No 7), or TILLING 4 (SEQ ID No 9).

37. Method according to claim 31 characterized in that step b) is optional

Method according to claim 37, characterized in that step b) is carried out by Agrobacterium-mediated transformation.

39. Method according to claim 31, characterized in that step a) consists of an non-directed mutagenesis comprising the following stages: i. expose the plant to a mutagenic agent,

25 ii. extract the DNA of each of the families and combine following a 3D strategy, iii. track the SIDELLA gene in each family using nested PCR and specific and universal primers, iv. detect the mutants of SIDELLA by sequencing and deconvolution.

40. Method according to claim 39, characterized in that the mutagenic agent of step i) is ethylmethanesutfonate.

5 41. Method according to claim 39 characterized in that in step (iv) 4 allelic forms of SIDELLA were selected.

42. Method according to claims 39 to 41, characterized in that in step (iv) one of the 4 allelic forms of SIDELLA is called TILLING 1 (SEQ ID No.3).

10 43. Method according to claims 39 to 41, characterized in that in the step

 (iv) one of the 4 allelic forms of SIDELLA is called TILLING 2 (SEQ ID No.5).

44. Method according to claims 39 to 41, characterized in that in step (iv) one of the 4 allelic forms of SIDELLA is called TILLING 3 (SEQ ID

13 No.7).

45. Method according to claims 39 to 41, characterized in that in step (iv) one of the 4 allelic forms of SIDELLA is called TILLING 4 (SEQ ID

No.9).