WO2011051489A2 - Albumin variants - Google Patents

Albumin variants Download PDF

Info

Publication number
WO2011051489A2
WO2011051489A2 PCT/EP2010/066572 EP2010066572W WO2011051489A2 WO 2011051489 A2 WO2011051489 A2 WO 2011051489A2 EP 2010066572 W EP2010066572 W EP 2010066572W WO 2011051489 A2 WO2011051489 A2 WO 2011051489A2
Authority
WO
WIPO (PCT)
Prior art keywords
albumin
variant
fragment
hsa
seq
Prior art date
Application number
PCT/EP2010/066572
Other languages
French (fr)
Other versions
WO2011051489A3 (en
Inventor
Andrew Plumridge
Darrell Sleep
Jason Cameron
Inger Sandlie
Jan Terje Andersen
Esben Peter Friis
Original Assignee
Novozymes Biopharma Dk A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2010311332A priority Critical patent/AU2010311332B2/en
Priority to EP18188293.7A priority patent/EP3421491A3/en
Priority to US13/504,326 priority patent/US8748380B2/en
Priority to EP10771471.9A priority patent/EP2493921B1/en
Priority to MX2014010841A priority patent/MX367177B/en
Priority to CN201080060322.5A priority patent/CN102741280B/en
Priority to BR112012009450A priority patent/BR112012009450A2/en
Priority to GB1209553.5A priority patent/GB2488077A/en
Priority to RU2012122173A priority patent/RU2607374C2/en
Priority to MX2012004793A priority patent/MX2012004793A/en
Application filed by Novozymes Biopharma Dk A/S filed Critical Novozymes Biopharma Dk A/S
Priority to JP2012535864A priority patent/JP2013509170A/en
Priority to ES10771471T priority patent/ES2700230T3/en
Priority to KR1020127013398A priority patent/KR101874834B1/en
Priority to CA2776241A priority patent/CA2776241A1/en
Publication of WO2011051489A2 publication Critical patent/WO2011051489A2/en
Publication of WO2011051489A3 publication Critical patent/WO2011051489A3/en
Priority to US13/882,653 priority patent/US20130225496A1/en
Priority to EP11778866.1A priority patent/EP2635598A1/en
Priority to CN2011800638125A priority patent/CN103347893A/en
Priority to PCT/EP2011/069188 priority patent/WO2012059486A1/en
Priority to IL218858A priority patent/IL218858B/en
Priority to US14/262,244 priority patent/US20140234311A1/en
Priority to US14/863,868 priority patent/US20160075763A1/en
Priority to US14/863,780 priority patent/US20160075761A1/en
Priority to US14/863,655 priority patent/US20160075757A1/en
Priority to US14/863,719 priority patent/US20160075759A1/en
Priority to US14/863,597 priority patent/US20160075756A1/en
Priority to US14/863,685 priority patent/US20160075758A1/en
Priority to US14/863,628 priority patent/US20160009787A1/en
Priority to US14/863,836 priority patent/US20160075762A1/en
Priority to US14/863,752 priority patent/US20160075760A1/en
Priority to US15/709,227 priority patent/US20180072792A1/en
Priority to US15/709,169 priority patent/US20180105576A1/en
Priority to US15/709,263 priority patent/US20180105578A1/en
Priority to US15/709,261 priority patent/US20180105577A1/en
Priority to US15/870,349 priority patent/US20180162925A1/en
Priority to US15/870,376 priority patent/US20180222963A1/en
Priority to US15/979,319 priority patent/US10696732B2/en
Priority to US16/882,019 priority patent/US20200385442A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76Albumins
    • C07K14/765Serum albumin, e.g. HSA
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/31Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin

Definitions

  • the present invention relates to variants of albumin or fragments thereof or fusion polypeptides comprising variant albumin or fragments thereof having a change in half-life compared to the albumin, fragment thereof or fusion polypeptide comprising albumin or a fragment thereof.
  • Albumin is a protein naturally found in the blood plasma of mammals where it is the most abundant protein. It has important roles in maintaining the desired osmotic pressure of the blood and also in transport of various substances in the blood stream.
  • Albumins have been characterized from many species including human, pig, mouse, rat, rabbit and goat and they share a high degree of sequence and structural homology.
  • FcRn neonatal Fc receptor
  • BrambeH neonatal Fc receptor
  • FcRn is a membrane bound protein, expressed in many cell and tissue types. FcRn has been found to salvage albumin from intracellular degradation (Roopenian D. C. and Akilesh, S. (2007), Nat. Rev. Immunol 7, 715-725.). FcRn is a bifunctional molecule that contributes to maintaining a high level of IgGs and albumin in serum in mammals such as human beings.
  • HSA Human serum albumin
  • the plasma half-life of HSA has been found to be approximately 19 days.
  • a natural variant having lower plasma half-life has been identified (Peach, R. J. and Brennan, S. 0.,(1991 ) Biochim Biophys Acta.1097:49-54) having the substitution D494N.
  • This substitution generated an N- glycosylation site in this variant, which is not present in the wild-type albumin. It is not known whether the glycosylation or the amino acid change is responsible for the change in plasma half- life.
  • Albumin has a long plasma half-life and because of this property it has been suggested for use in drug delivery.
  • Albumin has been conjugated to pharmaceutically beneficial compounds (WO 2000/69902A), and it was found that the conjugate - maintained the long plasma half-life of albumin.
  • the resulting plasma half-life of the conjugate was generally considerably longer than the plasma half-life of the beneficial therapeutic compound alone.
  • albumin has been fused to therapeutically beneficial peptides (WO 2001/79271 A and WO 2003/59934 A) with the typical result that the fusion has the activity of the therapeutically beneficial peptide and a considerably longer plasma half-life than the plasma half-life of the therapeutically beneficial peptides alone.
  • Galliano et al (1993) Biochim. Biophys.Acta 1225, 27-32 discloses a natural variant E505K.
  • Minchiotti et a/.(1990) discloses a natural variant K536E.
  • Minchiotti et al (1987) Biochim. Biophys. Acta 916, 41 1 -418 discloses a natural variant K574N.
  • Takahashi et al (1987) Proc. Natl. Acad. Sci. USA 84, 4413-4417 discloses a natural variant D550G. Carlson et al (1992).
  • Proc.Nat.Acad.Sci.USA 89, 8225- 8229 discloses a natural variant D550A.
  • Albumin has the ability to bind a number of ligands and these become associated (associates) with albumin. This property has been utilized to extend the plasma half-life of drugs having the ability to noncovalently bind to albumin. This can also be achieved by binding a pharmaceutical beneficial compound, which has little or no albumin binding properties, to a moiety having albumin binding properties. See review article and reference therein, Kratz (2008). Journal of Controlled Release 132, 171 -183.
  • Albumin is used in preparations of pharmaceutically beneficial compounds, in which such a preparation maybe for example, but not limited to, a nano particle or micro particle of albumin.
  • delivery of a pharmaceutically beneficial compound or mixture of compounds may benefit from alteration in the albumins affinity to its receptor where the beneficial compound has been shown to associate with albumin for the means of delivery.
  • the present invention provides variants of a parent albumin with improved properties compared to its parent.
  • the invention provides variants of a parent albumin having altered plasma half-life compare to its parent.
  • the present invention relates to isolated variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof, of a parent albumin, comprising an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of the mature polypeptide of SEQ I D NO: 2, wherein the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501 K, K541 E, D550GA K573E or K574N.
  • the alteration at one or more position may independently be selected among substitutions, insertions and deletions, where substitution are preferred.
  • the present invention also relates to isolated polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of producing the variants.
  • the present invention also relates to conjugates or associates comprising the variant albumin or fragment thereof according to the invention and a beneficial therapeutic moiety or to a fusion polypeptide comprising a variant albumin or fragment thereof of the invention and a fusion partner polypeptide.
  • the invention further relates to compositions comprising the variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment thereof, according to the invention or associates comprising the variant albumin or fragment thereof, according to the invention.
  • the compositions are preferably pharmaceutical compositions.
  • the invention further relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment thereof, or associates comprising the variant albumin or fragment thereof, wherein said variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment or associates of variant albumin or fragment thereof has altered plasma half-life compared to the corresponding plasma half-life of the HSA or fragment thereof, fusion polypeptide comprising HSA or fragment thereof or conjugates or associates of HSA or, fragment thereof, comprising HSA or fragment thereof.
  • Figure 1 shows a restriction map of the expression plasmid pDB4082.
  • Figure 2 shows a restriction map of the expression plasmid pDB2305
  • Figure 3 shows a restriction map of the expression plasmid pDB4005
  • Figure 5 shows ELISA binding of shFcRn-GST to human serum albumin (HSA) variants (100-0.045 ⁇ / ⁇ ). Binding of WT, D494N, D494Q and D494A pH 6.0 and pH 7.4. Binding of WT, D494N, D494N/T496A and T496A at pH 6.0 and pH 7.4. Binding of WT, E495Q and E495A at pH 6.0 and pH 7.4.
  • HSA human serum albumin
  • Figure 6 shows representative sensorgrams of binding of 0.2 ⁇ of HSA variants to immobilized shFcRn (-4600 RU). WT, D494N, D494Q, D494A, D494N/T496A and T496A.
  • Figure 7 shows representative sensorgrams of binding of 1 ⁇ of HSA variants to immobilized shFcRn (-1400 RU). WT, D494N, D494Q, D494A, D494N/T496A and T496A.
  • Figure 8 shows relative binding of the HSA variants compared to WT based on two independent SPR experiments as shown (A) Figure 6 and (B) Figure 7.
  • Figure 9 shows ELISA: (A) binding of shFcRn to albumins from human, donkey, bovine, sheep, goat and rabbit at pH 6.0. (B) binding of shFcRn to albumin from guinea pig, hamster, rat and chicken at pH 6.0. (C) binding of shFcRn to albumin from human, donkey, bovine, sheep, goat and rabbit at pH 7.4. (D) binding of shFcRn to albumin from guinea pig, hamster, rat and chicken at pH 7.4. (E) relative binding of the different albumins. Relative binding of human albumin to shFcRn is defined as 1.0. The ELISA values represent the mean of duplicates.
  • Figure 10 shows SPR: Binding of shFcRn-GST to albumin from several species at pH 6.0 and pH 7.4. Representative sensorgrams showing binding of 5.0 ⁇ of albumin from different species; (A) human, (B) donkey, (C) bovine, (D) goat, (E) sheep, (F) rabbit, (G) dog, (H) guinea pig, (I) hamster, (J) rat, (K) mouse and (L) chicken. The albumin variants were injected over immobilized GST-tagged shFcRn (-2100 RU). Injections were performed at 25°C at a rate of 40 ⁇ /min.
  • Figure 11 shows SPR sensorgrams of selected HSA mutants compared with wild-type HSA. 20 ⁇ of (A) WT and P499A (B) WT and K500A, (C) WT and K536A, (D) WT and P537A and (E) WT and K538A and (F) WT and K537A were injected over immobilized shFcRn at pH 6.0 (-1500 RU)
  • Figure 12 shows SPR sensorgrams of HSA mutants compared with WT HSA. 10 ⁇ of (A)
  • WT and K573A B) WT and K573C, (C) WT and K573F, (D) WT and K573G and (E) WT and K573L and (F) WT and K573M, (G) WT and K573Q, (H) WT and K573R and (I) WT and K573T and (J) WT and K573V injected over immobilized shFcRn at pH 5.5 and pH7.4. Injections were performed at 25°C at a flow rate of 80 ⁇ /min.
  • Figure 13 shows SPR sensorgrams of HSA mutants compared with wild-type HSA. 10 ⁇ of (A) WT and K573D (B) WT and K573E, (C) WT and K573H, (D) WT and K573I and (E) WT and K573N and (F) WT and K573P, (G) WT and K573S, (H) WT and K573 * and (I) WT and K573W and (J) WT and K573Y injected over immobilized shFcRn at pH 5.5 and pH7.4. Injections were performed at 25°C at a flow rate of 80 ⁇ /min.
  • Figure 14 shows SPR sensorgrams of HSA mutants compared with wild-type HSA. 20 ⁇ of (A) WT and E492G+K538H+K541 N+E542D (B) WT and E492T+N503K+K541A, (C) WT and
  • Figure 15 shows SPR sensorgrams of HSA mutants compared with wild-type HSA. Twenty ⁇ of (A) WT, (B) H440Q, (C) H464Q and (D) H535Q injected over immobilized shFcRn at pH 6.0.
  • Injections were performed at 25°C at a flow rate of 80 ⁇ /min.
  • Figure 16 shows SPR sensorgrams of HSA mutant K500E compared with wild-type HSA.
  • Figure 17 shows a restriction map of the expression plasmid pDB3017
  • Figure 18 shows a restriction map of the expression plasmid pDB3021
  • Figure 19 shows a restriction map of the expression plasmid pDB3056
  • Figure 20 shows a restriction map of the expression plasmid pDB3165
  • Figure 21 shows a restriction map of the expression plasmid pDB4172
  • Figure 22 shows a restriction map of the expression plasmid pDB4267
  • Figure 23 shows a restriction map of the expression plasmid pDB4285
  • Figure 24 shows a GP-H P LC chromatogram of WT HSA and m utant K573 P H RP conjugates for shFcRn analysis. Injections of 25 ⁇ _ were made onto a TSK G3000SWXL column
  • Figure 25 shows SDS PAGE separation followed by both visual (A) and ultraviolet (B) detection of the Fluorescein conjugated albumin.
  • HSA::F5M Limaizes a monomer
  • K573P::F5M Limaizes a monomer
  • rHA standard Limaizes a monomer
  • Figure 26 shows shFcRn binding properties of HSA variants. 10 ⁇ ⁇ of WT rHA and
  • Figure 27 shows shFcRn binding properties of HSA variants. 10 ⁇ of WT rHA and
  • K541 A(l) and WT rHA and K541 N(J) were injected over immobilised shFcRn at pH5.5.
  • Figure 28 shows competitive binding of K573A and K573P measured by injecting shFcRn
  • FIG. 29 shows competitive binding of HSA-FLAG variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSA-FLAG variants over immobilized HSA (-2500 RU) at pH6.0.
  • Figure 30 shows competitive binding of HSA-IL1 Ra variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSA-IL1 Ra variants over immobilized HSA (-2500 RU) at pH6.0
  • Figure 31 shows competitive binding of scFv-fused HSA variants measured by injecting shFcRn (100 nM) alone or together with different amounts of (A) scFv-HSA-FLAG variants or (B) HSA-scFv-FLAG variants over immobilized HSA (-2500 RU) at pH6.0.
  • Figure 32 shows binding of HSA, single, double and triple mutant variants to shFcRn.
  • the present invention relates to isolated variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof, of a parent albumin, comprising an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of the mature polypeptide of SEQ ID NO: 2, wherein the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501 K, K541 E, D550G,A, K573E or K574N..
  • the alteration at one or more position may independently be selected among substitutions, insertions and deletions, where substitution are preferred.
  • variant means a polypeptide derived from a parent albumin by one or more alteration(s), i.e., a substitution, insertion, and/or deletion, at one or more (several) positions.
  • a substitution means a replacement of an amino acid occupying a position with a different amino acid;
  • a deletion means removal of an amino acid occupying a position; and
  • an insertion means adding 1 or more, preferably 1 -3 amino acids immediately adjacent to an amino acid occupying a position.
  • Mutant means a polynucleotide encoding a variant.
  • Wild-Type Albumin means albumin having the same amino acid sequence as naturally found in an animal or in a human being.
  • Parent or Parent albumin means an albumin to which an alteration is made by the hand of man to produce the albumin variants of the present invention.
  • the parent may be a naturally occurring (wild-type) polypeptide or an allele thereof, or even a variant thereof.
  • FcRn and shFcRn The term “FcRn” means the human neonatal Fc receptor (FcRn). shFcRn is a soluble recombinant form of FcRn.
  • smFcRn is a soluble recombinant form of the mouse neonatal Fc
  • Isolated variant means a variant that is modified by the hand of man and separated completely or partially from at least one component with which it naturally occurs.
  • the variant is at least 1 % pure, e.g., at least 5% pure, at least 10% pure, at least 20% pure, at least 40% pure, at least 60% pure, at least 80% pure, and at least 90% pure, as determined by SDS-PAGE or GP-HPLC.
  • substantially pure variant means a preparation that contains at most 10%, at most 8%, at most 6%, at most 5%, at most 4%, at most 3%, at most 2%, at most 1 %, and at most 0.5% by weight of other polypeptide material with which it is natively or recombinantly associated.
  • the variant is at least 92% pure, e.g., at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99%, at least 99.5% pure, and 100% pure by weight of the total polypeptide material present in the preparation.
  • the variants of the present invention are preferably in a substantially pure form. This can be accomplished, for example, by preparing the variant by well known recombinant methods and by purification methods.
  • Mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc.
  • the mature polypeptide is amino acids 1 to 585 of SEQ ID NO: 2, with the inclusion of any post-translational modifications.
  • Mature polypeptide coding sequence means a polynucleotide that encodes a mature albumin polypeptide.
  • the mature polypeptide coding sequence is nucleotides 1 to 1758 of SEQ ID NO: 1 .
  • Sequence Identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity”.
  • the degree of sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et ai, 2000, Trends Genet. 16: 276-277), preferably version 3.0.0 or later.
  • the optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSU M62 (EMBOSS version of BLOSU M62) substitution matrix.
  • the output of Needle labelled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
  • the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later.
  • the optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
  • the output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
  • fragment means a polypeptide having one or more (several) amino acids deleted from the amino and/or carboxyl terminus of an albumin and/or an internal region of albumin that has retained the ability to bind to FcRn. Fragments may consist of one uninterrupted sequence derived from HSA or it may comprise two or more sequences derived from HSA.
  • the fragments according to the invention have a size of more than approximately 20 amino acid residues, preferably more than 30 amino acid residues, more preferred more than 40 amino acid residues, more preferred more than 50 amino acid residues, more preferred more than 75 amino acid residues, more preferred more than 100 amino acid residues, more preferred more than 200 amino acid residues, more preferred more than 300 amino acid residues, even more preferred more than 400 amino acid residues and most preferred more than 500 amino acid residues.
  • allelic variant means any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences.
  • An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
  • Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of its translated polypeptide product.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG, and TGA.
  • the coding sequence may be a DNA, cDNA, synthetic, or recombinant polynucleotide.
  • cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA.
  • the initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
  • nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic.
  • nucleic acid construct is synonymous with the term “expression cassette” when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
  • control sequences means all components necessary for the expression of a polynucleotide encoding a variant of the present invention.
  • Each control sequence may be native or foreign to the polynucleotide encoding the variant or native or foreign to each other.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences within the coding region of the polynucleotide encoding a variant.
  • operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.
  • expression includes any step involved in the production of the variant including, but not limited to, transcription, post-transcriptional modification, translation, post- translational modification, and secretion.
  • Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to additional nucleotides that provide for its expression.
  • host cell means any cell type that is susceptible to transformation, transfection, transduction, and the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
  • host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
  • Plasma half-life is ideally determined in vivo in suitable individuals. However, since it is time consuming and expensive and there inevitable are ethical concerns connected with doing experiments in animals or man it is desirable to use an in vitro assay for determining whether plasma half-life is extended or reduced. It is known that the binding of albumin to its receptor FcRn is important for plasma half-life and the correlation between receptor binding and plasma half-life is that a higher affinity of albumin to its receptor leads to longer plasma half-life. Thus for the present invention a higher affinity of albumin to FcRn is considered indicative of an increased plasma half-life and a lower affinity of albumin to its receptor is considered indicative of a reduced plasma half-life.
  • a longer plasma half-life with respect to a variant albumin of the invention means that the variant has longer plasma half-life than the corresponding albumin having the same sequences except for the alteration(s) in positions corresponding to 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2.
  • the mature polypeptide disclosed in SEQ ID NO: 2 is used to determine the corresponding amino acid residue in another albumin.
  • the amino acid sequence of another albumin is aligned with the mature polypeptide disclosed in SEQ ID NO: 2, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide disclosed in SEQ ID NO: 2 is determined using the Needleman- Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 3.0.0 or later.
  • EMBOSS European Molecular Biology Open Software Suite
  • proteins of known structure For proteins of known structure, several tools and resources are available for retrieving and generating structural alignments. For example the SCOP superfamilies of proteins have been structurally aligned, and those alignments are accessible and downloadable.
  • Two or more protein structures can be aligned using a variety of algorithms such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11 : 739-747), and implementations of these algorithms can additionally be utilized to query structure databases with a structure of interest in order to discover possible structural homologs (e.g., Holm and Park, 2000, Bioinformatics 16: 566-567).
  • albumin variants of the present invention the nomenclature described below is adapted for ease of reference.
  • the accepted lUPAC single letter or three letter amino acid abbreviation is employed.
  • An insertion of multiple amino acids is designated [Original amino acid, position, original amino acid, inserted amino acid #1 , inserted amino acid #2; etc.].
  • the insertion of lysine and alanine after glycine at position 195 is indicated as "Gly195Glyl_ysAla” or "G195GKA”.
  • the inserted amino acid residue(s) are numbered by the addition of lower case letters to the position number of the amino acid residue preceding the inserted amino acid residue(s).
  • the sequence would thus be:
  • variants comprising multiple alterations are separated by addition marks ("+"), e.g., "Arg170Tyr+Gly195Glu” or "R1 70Y+G 195E” representing a substitution of tyrosine and glutamic acid for arginine and glycine at positions 170 and 195, respectively.
  • Albumins are proteins and constitute the most abundant protein in plasma in mammals and albumins from a long number of mammals have been characterized by biochemical methods and/or by sequence information.
  • albumins e.g., human serum albumin (HSA)
  • HSA human serum albumin
  • HSA is a preferred albumin according to the invention and is a protein consisting of 585 amino acid residues and has a molecular weight of 67 kDa. In its natural form it is not glycosylated.
  • the amino acid sequence of HSA is shown in SEQ ID NO: 2.
  • natural alleles may exist having essentially the same properties as HSA but having one or more amino acid changes compared to SEQ ID NO: 2, and the inventors also contemplate the use of such natural alleles as parent albumin according to the invention.
  • Albumins have generally a long plasma half-life of approximately 20 days or longer, e.g., HSA has a plasma half-life of 19 days. It is known that the long plasma half-life of HSA is mediated via interaction with its receptor FcRn, however, an understanding or knowledge of the exact mechanism behind the long half-life of HSA is not essential for the present invention.
  • albumin means a protein having the same, or very similar three dimensional structure as HSA and having a long plasma half-life.
  • albumin proteins can be mentioned human serum albumin, primate serum albumin, (such as chimpanzee serum albumin, gorilla serum albumin), rodent serum albumin (such as hamster serum albumin, guinea pig serum albumin, mouse albumin and rat serum albumin), bovine serum albumin, equine serum albumin, donkey serum albumin, rabbit serum albumin, goat serum albumin, sheep serum albumin, dog serum albumin, chicken serum albumin and pig serum albumin.
  • HSA as disclosed in SEQ ID NO: 2 or any naturally occurring allele thereof, is the preferred albumin according to the invention.
  • the parent albumin, a fragment thereof, or albumin part of a fusion polypeptide comprising albumin or a fragment thereof according to the invention has generally a sequence identity to the sequence of HSA shown in SEQ ID NO: 2 of at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 86%, preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%, preferably at least 91 %, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95%, more preferred at least 96%, more preferred at least 97%, more preferred at least 98% and most preferred at least 99%.
  • the parent preferably comprises or consists of the amino acid sequence of SEQ ID NO: 2. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2.
  • the parent is an allelic variant of the mature polypeptide of SEQ ID NO: 2.
  • the parent is encoded by a polynucleotide that hybridizes under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , (ii) the mature polypeptide coding sequence of SEQ ID NO: 1 , or (iii) the full-length complementary strand of (i) or (ii) (J. Sambrook, E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
  • the polynucleotide of SEQ ID NO: 1 or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or a fragment thereof, may be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to methods well known in the art.
  • probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein.
  • Such probes can be considerably shorter than the entire sequence, but should be at least 14, e.g., at least 25, at least 35, or at least 70 nucleotides in length.
  • the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length.
  • Both DNA and RNA probes can be used.
  • the probes are typically labelled for detecting the corresponding gene (for example, with 32 P, 3 H, 35 S, biotin, or avidin). Such probes are encompassed by the present invention.
  • a genomic DNA or cDNA library prepared from such other organisms may be screened for DNA that hybridizes with the probes described above and encodes a parent.
  • Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques.
  • DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material.
  • the carrier material is used in a Southern blot.
  • hybridization indicates that the polynucleotide hybridizes to a labelled nucleotide probe corresponding to the polynucleotide shown in SEQ ID NO: 1 , its complementary strand, or a subsequence thereof, under low to very high stringency conditions.
  • Molecules to which the probe hybridizes can be detected using, for example, X-ray film or any other detection means known in the art.
  • the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 1. In another aspect, the nucleic acid probe is nucleotides 1 to 1785 of SEQ ID NO: 1 . In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2 or a fragment thereof. In another aspect, the nucleic acid probe is SEQ ID NO: 1 .
  • very low to very high stringency conditions are defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formam ide for maxim m and maxim m-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally.
  • the carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45°C (very low stringency), 50°C (low stringency), 55°C (medium stringency), 60°C (medium-high stringency), 65°C (high stringency), or 70°C (very high stringency).
  • stringency conditions are defined as prehybridization and hybridization at about 5°C to about 10°C below the calculated T m using the calculation according to Bolton and McCarthy (1962, Proc. Natl. Acad. Sci.
  • the parent is encoded by a polynucleotide with a sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1 of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which encodes a polypeptide which is able to function as an albumin.
  • the parent is encoded by a polynucleotide comprising or consisting of SEQ ID NO: 1.
  • the invention relates to a method for preparing a variant albumin, fragment thereof, or fusion polypeptide comprising variant albumin or a fragment thereof comprising the steps of:
  • the identification of one or more amino acid residue positions being important for the binding of albumin to FcRn, in albumin, fragment thereof or the albumin part of a fusion polypeptide can be done in several ways including, but not limited to, random mutagenesis followed by analysis of the generated mutants and comparison with the non-mutated parent molecule, and identification based on structural considerations optionally followed by generation of variants having the identified alterations and comparison with the non-mutated patent molecule.
  • a preferred method for identification of one or more amino acid residue positions to be changed to in order to prepare a variant HSA having an altered binding to FcRn compared with natural HSA comprises the following steps:
  • step iv) Optionally preparing variants of HSA at the positions identified in step iii) and confirming that the prepared variants have altered binding to FcRn compared with
  • Step i) above may be done using the SPR assay described below.
  • SPR assay described below.
  • other methods may be used to identify non-human albumins having different binding properties to FcRn than HSA, and that the method is not dependent on how the non- human albumin, having different binding properties to FcRn, has been identified.
  • the identified non-human albumin has a stronger binding to FcRn than HSA.
  • non-human albumins having stronger binding to FcRn than HSA include donkey serum albumin, rabbit serum albumin, dog serum albumin, hamster serum albumin, guinea pig serum albumin, mouse serum albumin and rat serum albumin.
  • Step ii) may be accomplished by considering the structure of FcRn, HSA and the binding complex of these two. In the absence of an available structure of the binding complex it is possible to use a model where the HSA structure is docked into the structure of the FcRn structure and thereby identify amino acid residues of HSA interacting with FcRn.
  • the identified non-human albumin has a weaker binding to FcRn than HSA.
  • non-human albumins having weaker binding to FcRn than HSA include bovine serum albumin, goat serum albumin, sheep serum albumin and chicken serum albumin.
  • Step ii) may be accomplished by considering the structure of FcRn, HSA and the binding complex of these two. In absence of an available structure of the binding complex it is possible to use a model where the HSA structure is docked into the structure of the FcRn structure and thereby identify residues of HSA interacting with FcRn.
  • an amino acid residues of HSA interacting with FcRn is considered any amino acid residues of HSA being located less than l OA from an amino acid in the FcRn or any amino acid residue that is involved in a hydrogen bond, a salt bridge or a polar or nonpolar interaction with an amino acid residue that is located less than l OA from an amino acid in the FcRn.
  • the amino acid in HSA residues are located less than l OA from amino acids in the FcRn, more preferred less than 6A from amino acids in the FcRn and most preferred less than 3A from amino acids in the FcRn.
  • Step iii) and iv) can be done using techniques well known to the skilled person.
  • the present invention also relates to methods for obtaining a variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof, or associates of variant albumin or fragment thereof comprising: (a) introducing into a parent albumin or fragments thereof, or fusion polypeptides comprising the parent albumin or fragments thereof an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of the mature polypeptide of SEQ I D NO: 2; and (b) recovering the variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof.
  • the variants can be prepared by those skilled persons using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.
  • Site-directed mutagenesis is a technique in which one or more (several) mutations are created at one or more defined sites in a polynucleotide encoding the parent.
  • Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests at the plasmid and the oligonucleotide is the same, permitting ligation of the plasmid and insert to one another. See, e.g., Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76: 4949- 4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.
  • Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004/0171 154; Storici et al., 2001 , Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16. Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.
  • Synthetic gene construction entails in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed utilizing a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies wherein olgionucleotides are synthesized and assembled upon photo-programable microfluidic chips.
  • Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625.
  • Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).
  • Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
  • Semi-synthetic gene construction is accomplished by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling.
  • Semisynthetic constuction is typified by a process utilizing polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes may th us be synthesized de novo, while other regions may be amplified using site-specific mutagenic primers, while yet other regions may be subjected to error-prone PCR or non-error prone PCR amplification. Polynucleotide sub sequences may then be shuffled. Variants
  • the present invention also provides variant albumins or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof, of a parent albumin, comprising an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2, wherein each alteration is independently a substitution, insertion or deletion with the provision that the and the variant is not SEQ ID NO: 2 having the substitution D494N, E501 K, K541 E, D550GA K573E or K574N..
  • the variant albumin, a fragment thereof, or albumin part of a fusion polypeptide comprising variant albumin or a fragment thereof according to the invention has generally a sequence identity the sequence of HSA shown in SEQ ID NO: 2 of at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90 %, more preferred at least 95%, more preferred at least 96%, more preferred at least 97%, more preferred at least 98% and most preferred at least 99%.
  • the number of alterations in the variants of the present invention is 1 -20, e.g.,
  • 1 -10 and 1 -5 such as 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 alterations.
  • the variant albumin, a fragment thereof or fusion polypeptide comprising the variant albumin or fragment thereof has altered plasma half-life compared with the corresponding parent albumin, fragment thereof, or fusion polypeptide comprising the variant albumin or fragment thereof.
  • the parent albumin is HSA and the variant albumin, a fragment thereof or fusion polypeptide comprising the variant albumin or fragment thereof has altered plasma half-life compared with the HSA, the corresponding fragment or fusion polypeptide comprising HSA or fragment thereof.
  • transgenic mouse having the natural mouse FcRn replaced with human FcRn has a higher serum albumin level than normal mouse; see (J Exp Med. (2003) 197(3):315-22).
  • human FcRn has a higher affinity to mouse serum albumin than mouse FcRn has to mouse serum albumin and, therefore, the observed increase in serum albumin in the transgenic mice corresponds with a higher affinity between serum albumin and its receptor, confirming the correlation between albumin binding to FcRn and plasma half-life.
  • variants of albumin that have little or no binding to FcRn have been shown to have reduced half-life in a mouse model, Kenanova et al (2009) J. Nucl. Med.; 50 (Supplement 2):1582).
  • variant albumins having a KD that is lower than the KD for natural HSA is considered to have a higher plasma half-life than HSA and variant albumins having a KD that is higher than the KD for natural HSA is considered to have a lower plasma half-life than HSA.
  • the variants of albumin or fragments thereof or fusion polypeptides comprising albumin or fragments thereof comprise one or more alterations, such as substitutions, deletions or insertions at one or more (several) positions corresponding to the positions in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584.
  • the substitution may be any substitution where the amino acid in the natural albumin sequence is substituted with a different amino acid selected among the remaining 19 natural occurring amino acids.
  • a variant comprises an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2.
  • a variant comprises an alteration at two positions corresponding to any of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2.
  • a variant comprises an alteration at three positions corresponding to any of positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2.
  • a variant comprises an alteration at each position corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2.
  • the variant comprises the substitution Q417A,H of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution H440Q of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution H464Q of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution A490D of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution E492G, ⁇ , ⁇ , ⁇ of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution V493P,L of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution D494N,Q,A,E,P of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution E495Q,A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution T496A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution P499A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution K500E,G,D,A,S,C,P,H,F,N,W,T,M,Y,V,Q,L,I,R of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution E501 A,P,Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution N503K,D,H of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A504E of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E505K, D of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution T506F, S of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution H510Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution H535Q of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution K536A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution P537A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution K538A,H of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution T540S of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution K541A,D,G,N,E of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution E542P,D of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution D550N of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution K574N of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution L575F of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution A577T,E of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution A578R,S of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution S579C,T of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution A581 D of the mature polypeptide of SEQ I D NO: 2.
  • the variant comprises the substitution A582T of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises the substitution G584A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 417.
  • the amino acid at a position corresponding to position 417 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala or His.
  • the variant comprises the substitution Q417A, H of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 440.
  • the amino acid at a position corresponding to position 440 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution H440Q of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 464.
  • the amino acid at a position corresponding to position 464 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution H464Q of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 490
  • the amino acid at a position corresponding to position 490 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val.
  • the variant comprises the substitution A490G of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 492.
  • the amino acid at a position corresponding to position 492 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly.
  • the variant comprises the substitution E492G of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 493.
  • the amino acid at a position corresponding to position 493 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Pro.
  • the variant comprises the substitution V493P of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 494.
  • the amino acid at a position corresponding to position 494 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn, Gin or Ala.
  • the variant comprises the substitution D494N,Q, A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 495.
  • the amino acid at a position corresponding to position 495 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gin or Ala.
  • the variant comprises the substitution E495Q or A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 496.
  • the amino acid at a position corresponding to position 496 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution T496A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 499.
  • the amino acid at a position corresponding to position 499 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution P499A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 500.
  • the amino acid at a position corresponding to position 500 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution K500E,G,D,A,S,C,P,H,F,N,W,T,M,Y,V,Q,L,I,R of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 501 .
  • the amino acid at a position corresponding to position 501 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala or Gin to reduce affinity and Pro to increase affinity.
  • the variant comprises the substitution E501A, Q, P of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 503.
  • the amino acid at a position corresponding to position 503 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp or Lys or His.
  • the variant comprises the substitution N503D, K, H of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 504.
  • the amino acid at a position corresponding to position 504 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val.
  • the variant comprises the substitution A504 of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 505.
  • the amino acid at a position corresponding to position 505 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val.
  • the variant comprises the substitution E505D of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 506.
  • the amino acid at a position corresponding to position 506 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val.
  • the variant comprises the substitution T506S,F of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 510.
  • the amino acid at a position corresponding to position 510 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gin.
  • the variant comprises the substitution H510Q of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 535.
  • the amino acid at a position corresponding to position 535 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gin.
  • the variant comprises the substitution H535Q of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 536.
  • the amino acid at a position corresponding to position 536 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution K536A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 537.
  • the amino acid at a position corresponding to position 537 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution P537A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 538.
  • the amino acid at a position corresponding to position 538 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution K538H, A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 540.
  • the amino acid at a position corresponding to position 540 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val.
  • the variant comprises the substitution T540S of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 541 .
  • the amino acid at a position corresponding to position 541 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly, Asp or Ala.
  • the variant comprises the substitution K541 G, D A, N of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 542.
  • the amino acid at a position corresponding to position 542 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp or Pro.
  • the variant comprises the substitution E542D, P of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 550.
  • the amino acid at a position corresponding to position 550 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn to reduce affinity, preferably with Glu to increase affinity.
  • the variant comprises an alteration at a position corresponding to position 573.
  • the amino acid at a position corresponding to position 573 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Tyr, Trp, Pro, His. Phe, Val, lie, Thr, Asn, Ser, Gly, Met, Cys, Ala, Glu, Gin, Arg, Leu, Asp.
  • the variant comprises the substitution K573Y,W,P,H,F,V,I,T,N,S,G,M,C,A,E,Q,R,L,D of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 574.
  • the amino acid at a position corresponding to position 574 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn.
  • the variant comprises the substitution K574N of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 575.
  • the amino acid at a position corresponding to position 575 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Phe.
  • the variant comprises the substitution L575F of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 577.
  • the amino acid at a position corresponding to position 577 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Thr or Glu.
  • the variant comprises the substitution A577TE of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 578.
  • the amino acid at a position corresponding to position 578 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg or Ser.
  • the variant comprises the substitution A578R,S of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 579.
  • the amino acid at a position corresponding to position 579 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Cys or Thr.
  • the variant comprises the substitution S579C,T of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 580.
  • the amino acid at a position corresponding to position 580 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Lys.
  • the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 581 .
  • the amino acid at a position corresponding to position 581 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp.
  • the variant comprises the substitution A581 D of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 582.
  • the amino acid at a position corresponding to position 582 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Thr.
  • the variant comprises the substitution A582T of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at a position corresponding to position 584.
  • the amino acid at a position corresponding to position 584 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
  • the variant comprises the substitution G584A of the mature polypeptide of SEQ ID NO: 2.
  • the variant comprises an alteration at positions corresponding to positions 494 and 496 in SEQ ID NO: 2, such as those described above. In another aspect, the variant comprises alterations at positions corresponding to positions 492 and 493 in SEQ ID NO: 2, such as those described above.
  • the variant comprises alterations at positions corresponding to positions 494 and 417 in SEQ ID NO: 2, such as those described above.
  • the variant comprises alterations at positions corresponding to positions
  • the variant comprises alterations at positions corresponding to positions 492 and 573 in SEQ ID NO: 2, such as those described above.
  • the variant comprises alterations at positions corresponding to positions 492, 503, and 573 in SEQ ID NO: 2, such as those described above.
  • the variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof according to the invention contains one substitution at a position corresponding to a position in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2 provided that the variant albumin is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501 K, K541 E, D550G,A, K573E or K574N.
  • the variant albumin, fragment thereof or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention may comprise additional substitutions, insertions or deletions
  • the variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention contains two, three, four, five , six, seven, eight, nine, ten, eleven, twelve , thirteen, fourteen fifteen, sixteen, seventeen, eighteen, nineteen twenty or even more substitutions at positions corresponding to positions in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of SEQ ID NO: 2.
  • the variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention may comprise additional substitutions, insertions or deletions at positions corresponding to other positions in HSA.
  • variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention have a plasma half-life that is longer than the plasma half-life of the parent albumin fragment thereof or fusion polypeptide comprising the parent albumin or a fragment thereof.
  • examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof comprising a substitution in the position corresponding to 492, 503, 542, 550, 573, 574, 580, 581 , 582 or 584 in SEQ ID NO: 2.
  • Preferred substitutions according to this embodiment of the invention include the substitution of the amino acid residue in the position corresponding to 492 in SEQ ID NO: 2 with a G residue, substitution of the amino acid residue in the position corresponding to 503 in SEQ I D NO: 2 with a H or a K residue, substitution of the amino acid residue in the position corresponding to 550 in SEQ ID NO: 2 with an E residue, the substitution of the amino acid residue in a position corresponding to 573 in SEQ ID NO: 2 with an Y,W,P,H,F,V,I,T,N,S,G,M,C,A,E,Q,R,L or a D, the substitution of the amino acid residue in a position corresponding to 574 in SEQ ID NO: 2 with an N residue, or the substitution of the amino acid residue in the position corresponding to 580 in SEQ I D NO: 2 with an K residue.
  • Other preferred variants have a substitution in the position corresponding to 492 in SEQ ID NO: 2 with a G residue and a substitution in the position corresponding to 573 in SEQ ID NO: 2 with an A or a P residue.
  • Other preferred variant has a number of substitutions corresponding to position 492 in SEQ ID NO: 2 with an H residue in position 503 in SEQ ID NO: 2.
  • the variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention have a plasma half-life that is shorter than the plasma half-life of the parent albumin fragment thereof or fusion polypeptide comprising the parent albumin or a fragment thereof.
  • examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof comprising a substitution in the position corresponding to 417, 440, 494, 495, 496, 499, 500, 501 , 536, 537, 538, 541 , 494+496 or 492+493 in SEQ I D NO: 2.
  • substitutions include the substitutions corresponding to Q417A, H440Q, D494E+Q417H, D494N,Q,A, E495Q,A, T496A, D494N+T496A or, P499A, K500A, E501A , E501 Q, K536A, P537A , K538A, K541 G, K541A K541 D or D550N in SEQ ID NO: 2.
  • variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention have lost their ability to bind FcRn.
  • variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof is considered to have lost the ability to bind FcRn if the measured resonance units for the variant in the SPR assay described below is less than 10% of the measured resonance units for the corresponding parent albumin or fragment thereof.
  • examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof comprising a substitution at a position corresponding to 464, 500, 510 or 535 in SEQ ID NO: 2.
  • Preferred substitutions include the substitutions corresponding to H464Q, K500A,P,C,S,A,D.G H510Q or H535Q in SEQ ID NO: 2.
  • the variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention may contain additional substitutions, deletions or insertions in other positions of the molecules.
  • Such additional substitutions, deletions or insertions may be useful in order to alter other properties of the molecules such as but not limited to altered glycosylation; introduction of reactive groups of the surface such a thiol groups, removing/generating a carbamoylation site; etc.
  • Residues that might be altered in order to provide reactive residues on the surface and which advantageously could be applied to the present invention has been disclosed in the unpublished patent application WO 2010/092135 (Included by reference).
  • Particular preferred residues include the positions corresponding to positions in SEQ ID NO: 2 .
  • the present invention also relates to isolated polynucleotides that encode any of the variants of the present invention.
  • the present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • a polynucleotide may be manipulated in a variety of ways to provide for expression of a variant. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be a promoter sequence, which is recognized by a host cell for expression of the polynucleotide.
  • the promoter sequence contains transcriptional control sequences that mediate the expression of the variant.
  • the promoter may be any nucleic acid sequence that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1 ), Saccharomyces cerevisiae protease A (PRA1 ), Saccharomyces cerevisiae protease B (PRB1 ), Saccharomyces cerevisiae translation elongation factor (TEF1 ), Saccharomyces cerevisiae translation elongation factor (TEF2), Saccharomyces cerevisiae galactokinase (GAL1 ), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde- 3-phosphate dehydrogenase (ADH1 , ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1 ), and Saccharomyces cerevisiae 3-phosphoglycerate
  • ENO-1 Sac
  • the control sequence may also be a suitable transcription terminator sequence, which is recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3'-terminus of the polynucleotide encoding the variant. Any terminator that is functional in the host cell may be used.
  • Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1 ), Saccharomyces cerevisiae alcohol dehydrogenase (ADH1 ) and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.
  • CYC1 Saccharomyces cerevisiae cytochrome C
  • ADH1 Saccharomyces cerevisiae alcohol dehydrogenase
  • Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
  • the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA that is important for translation by the host cell.
  • the leader sequence is operably linked to the 5'-terminus of the polynucleotide encoding the variant. Any leader sequence that is functional in the host cell may be used.
  • Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1 ), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
  • ENO-1 Saccharomyces cerevisiae enolase
  • Saccharomyces cerevisiae 3-phosphoglycerate kinase Saccharomyces cerevisiae alpha-factor
  • Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase ADH2/GAP
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the variant-encoding sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
  • the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant into the cell's secretory pathway.
  • the 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the variant.
  • the 5'-end of the coding sequence may contain a signal peptide coding region that is foreign to the coding sequence.
  • the foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region.
  • the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the variant.
  • any signal peptide coding region that directs the expressed variant into the secretory pathway of a host cell may be used.
  • Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.
  • the propeptide region is positioned next to the N-terminus of the variant and the signal peptide region is positioned next to the N-terminus of the propeptide region.
  • the variants of the present invention can be prepared using techniques well known to the skilled person.
  • One convenient way is by cloning nucleic acid encoding the parent albumin or a fragment thereof or fusion polypeptide comprising albumin or a fragment thereof, modifying said nucleic acid to introduce the desired substitution(s) at one or more (several) positions corresponding to positions 417, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574 and 580 in SEQ ID NO: 2, where the variant is not the variant consisting of SEQ ID NO:2 with the substitution D494N, E501 K, K541 E, D550G,A, K573E or K574N., preparing a suitable genetic construct where the modified nucleic acid is placed in operative connection with suitable regulatory genetic elements, such as promoter,
  • the variant polypeptide of the invention may also be connected to a signal sequence in order to have the variant polypeptide secreted into the growth medium during culturing of the transformed host organism. It is generally advantageous to have the variant polypeptide secreted into the growth medium in order to ease recovery and purification.
  • Albumins have been successfully expressed as recombinant proteins in a range of hosts including fungi (including but not limited to Aspergillus (WO06066595), Kluyveromyces (Fleer 1991 , Bio/technology 9, 968-975), Pichia (Kobayashi 1998 Therapeutic Apheresis 2, 257-262) and Saccharomyces (Sleep 1990, Bio/technology 8, 42-46)), bacteria (Pandjaitab 2000, J. Allergy Clin. Immunol. 105, 279-285)), animals (Barash 1993, Transgenic Research 2, 266-276) and plants (including but not limited to potato and tobacco (Sijmons 1990, Bio/technology 8, 217 and Farran 2002, Transgenic Research 11 , 337-346).
  • fungi including but not limited to Aspergillus (WO06066595), Kluyveromyces (Fleer 1991 , Bio/technology 9, 968-975), Pichia (Kobayashi 1998 Therapeutic Apheresis 2, 257-
  • the variant polypeptide of the invention is preferably produced recombinantly in a suitable host cell.
  • a suitable host cell capable of producing a polypeptide in suitable amounts may be used and it is within the skills of the average practitioner to select a suitable host cell according to the invention.
  • a preferred host organism is yeast, preferably selected among Saccharomycacae, more preferred Saccharomyces cerevisiae.
  • variant polypeptides of the invention may be recovered and purified from the growth medium using a combination of known separation techniques such as filtration, centrifugation, chromatography, and affinity separation techniques etc. It is within the skills of the average practitioner to purify the variants of the invention using a particular combination of such known separation steps.
  • purification techniques that may be applied to the variants of the present invention can be mentioned the teaching of WO0044772.
  • the variant polypeptides of the invention may be used for delivering a therapeutically beneficial compound to an animal or a human individual in need thereof.
  • therapeutically beneficial compounds include, but are not limited, to labels and readily detectable compounds for use in diagnostics, such as various imaging techniques; pharmaceutical active compounds such as drugs, or specifically binding moieties such as antibodies.
  • the variants of the invention may even be connected to two or more different therapeutically beneficial compounds, e.g., an antibody and a drug, which gives the combined molecule the ability to bind specifically to a desired target and thereby provide a high concentration of the connected drug at that particular target.
  • the variants of albumin or fragments thereof according to the invention may also be fused with a non-albumin polypeptide fusion partner.
  • the fusion partner may in principle be any polypeptide but generally it is preferred that the fusion partner is a polypeptide having therapeutic or diagnostic properties.
  • Fusion polypeptides comprising albumin or fragments thereof are known in the art. It has been found that such fusion polypeptide comprising albumin or a fragment thereof and a fusion partner polypeptide have a longer plasma half-life compared to the unfused fusion partner polypeptide. According to the invention it is possible to alter the plasma half-life of the fusion polypeptides according to the invention compared to the corresponding fusion polypeptides of the prior art.
  • One or more therapeutic polypeptides may be fused to the N-terminus, the C-terminus of albumin, inserted into a loop in the albumin structure or any combination thereof. It may or it may not comprise linker sequences separating the various components of the fusion polypeptide.
  • WO 2001/79271 A and WO 2003/59934 A also contain examples of therapeutic polypeptides that may be fused to albumin or fragments thereof, and these examples apply also to the present invention.
  • the variants of albumin or fragments thereof according to the invention may be conjugated to a second molecule using techniques known within the art.
  • Said second molecule may comprise a diagnostic moiety, and in this embodiment the conjugate may be useful as a diagnostic tool such as in imaging; or the second molecule may be a therapeutic compound and in this embodiment the conjugate may be used for therapeutic purposes where the conjugate will have the therapeutic properties of the therapeutic compound as well as the long plasma half-life of the albumin.
  • Conjugates of albumin and a therapeutic molecule are known in the art and it has been verified that such conjugates have long plasma half-life compared with the non-conjugated, free therapeutic molecule as such.
  • the conjugates may conveniently be linked via a free thio group present on the surface of HSA (amino acid residue 34 of mature HSA) using well known chemistry.
  • the variant albumin or fragment thereof is conjugated to a beneficial therapeutic compound and the conjugate is used for treatment of a condition in a patient in need thereof, which condition is responsive to the particular selected therapeutic compound.
  • Techniques for conjugating such a therapeutically compound to the variant albumin or fragment thereof are known in the art.
  • WO 2009/019314 discloses examples of techniques suitable for conjugating a therapeutically compound to a polypeptide which techniques can also be applied to the present invention.
  • WO 2009/019314 discloses examples of compounds and moieties that may be conjugated to substituted transferrin and these examples may also be applied to the present invention. The teaching of WO 2009/019314 is included herein by reference.
  • HSA contains in its natural form one free thiol group that conveniently may be used for conjugation.
  • the variant albumin or fragment thereof may comprise further modifications provided to generate additional free thiol groups on the surface. This has the benefit that the payload of the variant albumin or fragment thereof is increased so that more than one molecule of the therapeutic compound can be conjugated to each molecule of variant albumin or fragment thereof, or two or more different therapeutic compounds may be conjugated to each molecule of variant albumin or fragment thereof, e.g., a compound having targeting properties such as an antibody specific for example a tumour; and a cytotoxic drug conjugated to the variant albumin or fragment thereof thereby creating a highly specific drug against a tumour.
  • teaching of particular residues that may be modified to provide for further free thiol groups on the surface can be found in copending patent application WO 2010/092135, which is incorporated by reference.
  • the variants of albumin or fragments thereof may further be used in form of "associates".
  • the term "associate” is intended to mean a compound comprising a variant of albumin or a fragment thereof and another compound bound or associated to the variant albumin or fragment thereof by non-covalent binding.
  • an associate consisting variant albumin and a lipid associated to albumin by a hydrophobic interaction.
  • Such associates are known in the art and they may be prepared using well known techniques.
  • an associate comprising variant albumin and paclitaxel.
  • variant albumin or fragments thereof or fusion polypeptides comprising variant albumin or fragments thereof according to the invention have the benefit that their plasma half-life is altered compared to the parent albumin or fragments thereof or fusion polypeptides comprising parent albumin or fragments thereof.
  • This has the advantage that the plasma half-life of conjugates comprising variant albumin or a fragment thereof or fusion polypeptide comprising variant albumin or a fragment thereof, or an associate comprising variant albumin or a fragment thereof according to the invention can be selected in accordance with the particular therapeutic purpose.
  • a conjugate, associate or fusion polypeptide used for imaging purposes in animals or human beings where the imaging moiety has an very short half-life and a conjugate or a fusion polypeptide comprising HSA has a plasma half-life that is far longer than needed for the imaging purposes it would be advantageous to use a variant albumin or fragment thereof of the invention having a shorter plasma half-life than the parent albumin or fragment thereof, to provide conjugates of fusion polypeptides having a plasma half-life that is sufficiently long for the imaging purpose but sufficiently short to be cleared form the body of the particular patient on which it is applied.
  • an associate or fusion polypeptide comprising a therapeutic compound effective to treat or alleviate a particular condition in a patient in need for such a treatment it would be advantageous to use the variant albumin or fragment thereof having a longer plasma half-life than the parent albumin or fragment thereof, to provide associates or conjugates or fusion polypeptides having longer plasma half-lives which would have the benefit that the administration of the associate or conjugate or fusion polypeptide of the invention would be needed less frequently or reduced dose with less side affects compared to the situation where the parent albumin or associates thereof or fragment thereof was used.
  • compositions comprising the variant albumin, associates thereof or fragment thereof, variant albumin fragment or associates thereof or fusion polypeptide comprising variant albumin or fragment thereof according to the invention.
  • the compositions are preferably pharmaceutical compositions.
  • the composition may be prepared using techniques known in the area such as disclosed in recognized handbooks within the pharmaceutical field.
  • compositions comprise a variant albumin or a fragment thereof according to the invention and a compound comprising a pharmaceutically beneficial moiety and an albumin binding domain (ABD).
  • ABD means a site, moiety or domain capable of binding to circulating albumin in vivo and thereby conferring transport in the circulation of the ABD and any compound or moiety bound to said ABD.
  • ABD's are known in the art and have been shown to bind very tight to albumin so a compound comprising an ABD bound to albumin will to a certain extent behave as a single molecule.
  • the inventors have realized by using the variant albumin or fragment thereof according to the invention together with a compound comprising a pharmaceutically beneficial moiety and an ABD makes it possible to alter the plasma half-life of the compound comprising a pharmaceutically beneficial moiety and an ABD compared to the situation where said compound were injected as such in a patient having need thereof or administered in a formulation comprising natural albumin or a fragment thereof.
  • the variant albumin or fragments thereof, conjugates comprising variant albumin or a fragment thereof or fusion polypeptide comprising variant albumin or a fragment thereof, or an associate comprising variant albumin or a fragment thereof according to the invention may also be incorporated into nano- or microparticles using techniques well known within the art. A preferred method for preparing nano- or microparticles that may be applied to the variant albumins or fragments thereof according to the invention is disclosed in WO 2004/071536, which is incorporated herein by reference.
  • the present invention is also directed to the use of a variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, or a conjugate comprising a variant of albumin or a fragment thereof, or an associate comprising a variant of albumin or a fragment thereof for the manufacture of a pharmaceutical composition, where in the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, or a conjugate comprising a variant of albumin or a fragment thereof, or an associate comprising a variant of albumin or a fragment thereof has an altered plasma half-life compared with HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof or conjugate comprising HSA.
  • the corresponding fragment of HSA is intended to mean a fragment of HSA that aligns with and has same number of amino acids as the fragment of the variant albumin with which it is compared.
  • the corresponding fusion polypeptide comprising HSA or conjugate comprising HSA is intended to mean molecules having same size and amino acid sequence as the fusion polypeptide of conjugate comprising variant albumin, with which it is compared.
  • the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof has a plasma half-life that is higher than the plasma half-life of HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof.
  • this may be expressed as the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof has a KD to FcRn that is lower that the corresponding KD for HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof.
  • the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof is preferably the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof according to the invention.
  • Wells were coated with wild-type HSA or variants diluted in phosphate buffered saline (PBS) to stated concentrations, incubated overnight at 4 C and then blocked with 4% skimmed milk (Acumedia) for 1 hour at room temperature. The wells were then washed four times with PBS/0.005% TWEEN® 20 (PBS/T) pH 6.0 before glutathione-S-transferase (GST) -fused ()shFcRn (0.5 ⁇ / ⁇ ) as described in FEBS J. 2008 Aug;275(16):4097-1 10.
  • PBS phosphate buffered saline
  • HRP horseradish peroxidase
  • PBS/T horseradish peroxidase pH 6.0
  • TMB substrate tetramethylbenzidine
  • HBS-EP buffer (0.01 M HEPES, 0.15M NaCI, 3mM EDTA, 0.005% surfactant P20
  • pH 7.4 0.05 M HEPES, 0.15M NaCI, 3mM EDTA, 0.005% surfactant P20
  • 1.0-0.5 ⁇ of each HSA variant was injected over the surface at constant flow rate (40 ⁇ /ml) at 25 C.
  • flow rate 40 ⁇ /ml
  • HSA HSA
  • WT HSA rHA
  • RECOMBUMIN available from Novozymes Biopharma UK Ltd, Nottingham UK was used for the examples.
  • Serum albumin from other species The albumins were recombinant wheres stated, produced using sequences provided from publicly available databases. Or purchased from commercial suppliers.
  • FcRn Expression and purification of soluble Human (shFcRn) and Mouse (smFcRn) FcRn Methods for the generation of shFcRn and smFcRn expression plasmids, expression and purification of each heterodimer can be found in Berntzen et al. (2005) J. Immunol. Methods 298:93-104).AIternatively shFcRn FcRn heterodimer was produced by GeneArt AG (Germany). Sequences for the two sub units of the heterodimer can be found in SEQ ID NO: 3 and SEQ ID NO: 4. The soluble receptor was expressed in HEK293 cells and purified from culture supernatant using Ni-HiTrap chromatography columns. Example 1. Preparation of variants
  • HSA mutant variants and HSA fusion variants were produced using several techniques. Standard molecular biology techniques were employed throughout such as described in Sambrook, J. and D. W. Russell, 2001 . Molecular Cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • Synthetic DNA Nco ⁇ /Sac ⁇ fragments (859 bp) were generated by gene assembly (GeneArt AG, Germany) containing point mutations within the HSA-encoding gene (SEQ ID NO: 1 ) to introduce the desired amino acid substitution in the translated protein.
  • Table 2 details the codons used to introduce the amino acid substitutions into the HSA-encoding gene.
  • the nucleotide sequence of the synthetic fragment encoding unchanged amino acids was identical to that in pDB2243 (described in WO 00/44772).
  • pDB3876 - pDB3886 The synthetic nucleotide fragments were ligated into ⁇ /col/Sacl-digested pDB2243 to produce plasmids pDB3876 - pDB3886 (Table 1 ).
  • pDB3876 - pDB3886 (see Table 1 ) were each digested with ⁇ / ⁇ and Pvu ⁇ , the DNA fragments were separated through a 0.7% (w/v) TAE gel, and 2992bp fragments (' ⁇ / ⁇ cassettes' including PRB1 promoter, DNA encoding the fusion leader (FL) sequence (disclosed in WO 2010/092135), nucleotide sequence encoding HSA and ADH1 terminator; see Figure 1 ) were purified from the agarose gel using a Qiagen Gel Extraction Kit following the manufacturer's instructions.
  • Disintegration plasmids pDB3887 - pDB3897 and pDB2244 were used to transform S. cerevisiae BXP10cir° (as previously described WO/2001/079480 as described below.
  • pDB3897 HSA E492H n/a Not applicable.
  • pDB3876-pDB3886 are sub-cloning plasmids. Table 2: Codons used to introduce amino acid substitutions into HSA
  • Oligonucleotide pairs xAP094 (SEQ ID NO: 5)/xAP095 (SEQ ID NO: 6) and xAP096 (SEQ ID NO: 7)/xAP097 (SEQ ID NO: 8) were used to generate two HSA variants (D494N+E495Q+T496A and E495Q+T496A, respectively).
  • Plasmid pDB3927 (disclosed in WO 2010/092135) was used as template DNA and the methodology recommended by the manufacturer of the kit was followed.
  • pDB3995 and pDB3996 were digested with SsfEII/SsrBI and the linearised DNA molecules were purified using standard techniques.
  • SsfEII/SsrBI digested DNA purified using a Qiagen PCR-Purification kit following the manufacturer's instructions, was mixed individually with 100ng / ⁇ cc65l/SamHI-digested pDB3936) (disclosed in WO 2010/092135) and used to directly transform S. cerevisiae BXP10cir° using the Sigma Yeast Transformation kit described below.
  • Plasmid pDB3927 (disclosed in WO 2010/092135) (containing an identical nucleotide sequence encoding HSA as in pDB2243) was manipulated to amino acid substitutions within the mature HSA protein.
  • Synthetic DNA fragments were generated (GeneArt AG, Germany or DNA2.0 Inc, USA) (Nco ⁇ /Bsu36 ⁇ , AvA ⁇ ISph ⁇ or Sac ⁇ /Sph ⁇ fragments), containing point mutations within the HSA-encoding gene to introduce the desired amino acid substitution(s) into the translated protein sequence.
  • Table 2 details the codons used to introduce the amino acid substitutions into the HSA- encoding gene.
  • the nucleotide sequence of the synthetic fragment encoding unchanged amino acids i.e.
  • Bam ⁇ /Sal ⁇ fragments containing point mutations in the nucleotide sequence encoding HSA were generated by gene assembly (DNA2.0 Inc, USA) and ligated into Bam ⁇ /Sal ⁇ - digested pDB3964 (described in WO 2010/092135) to produce plasmids pDB3986-pDB3989 (Table 3).
  • Plasmids pDB3883 (Table 1 ), pDB4094 and pDB4095 (Table 3) were digested with Ncol/Sacl and 857bp fragments from each digest were purified before being ligated into Ncol/Sacl- digested pDB4006 or pDB41 10 (8.688kb) (Table 3) to produce pDB4156-pDB4161.
  • Expression plasmids were generated in vivo (i.e. via homologous recombination in S. cerevisiae; a technique referred to as gap repair or in vivo cloning- see Orr-Weaver & Szostak. 1983. Proc. Natl. Acad. Sci. USA. 80:4417-4421 ). Modified plasmids listed in Table 3 were digested with SsfEII/SsrBI and the linearised DNA molecules were purified using standard techniques.
  • XAP223 (SEQ ID NO: 21 ) lie ATT
  • XAP194 (SEQ ID NO: 41 ) lie ATT
  • XAP201 (SEQ ID NO: 48) Ser TCT ATAAG C CTAAG G C AG CTTG ACTTG CAG CAACAAG 1 1 1 ACCCTCCTCG
  • PCR was used to produce two permutation libraries in which the codons encoding amino acid 500 or 573 of mature HSA were changed (mutated) to alternative non-wild type amino acids and a termination codons (K5XXSTOP).
  • Mutagenic oligonucletides (Table 4 and Table 5), were designed to amplify HSA- encoding DNA and incorporate the desired changes. That is, for the changes at position 500, pDB4082 ( Figure 1 ) was used as a template DNA.
  • pDB4082 is a derivative of pDB2305 (disclosed in EP1788084) and was produced as follows.
  • pDB2305 ( Figure 2) was digested with Nsi ⁇ /Spe ⁇ and the yielded 8.779kb ⁇ /s/ ' l fragment was self-ligated to produce pDB4005 ( Figure 3).
  • a synthetic DNA fragment (Bsa ⁇ ISph ⁇ ) was generated by gene assembly (DNA2.0 Inc, USA) (SEQ ID NO: 1 ) (containing 3' region of the PRB1 promoter, modified fusion leader sequence, nucleotide sequence encoding HSA and 5' region of the modified ADH ⁇ terminator), and ligated into /-//ndlll/Spftl-digested pDB4005 ( Figure 3) to produce pDB4082.
  • the Hind ⁇ ⁇ site in PRB ⁇ promoter site has been removed and a Sacl l site within the nucleotide sequence encoding HSA has been introduced.
  • the nucleotide sequence encoding HSA corresponding to that between the Sa/I / Hind ⁇ sites was generated using the New England Biolabs Phusion kit (Table 6) and oligonucleotides listed in Table 4.
  • Table 7 describes the PCR method employed.
  • the permutation library at amino acid position 573 in HSA was generated using pDB3927 as template DNA and involved amplifying the albumin-encoding DNA corresponding to that between the Nco ⁇ and Bsu3Q ⁇ sites using oligonucleotides detailed in Table 5.
  • each PCR-product was purified using a Qiagen PCR-clean up kit (according to the manufactures instructions), digested with Sal ⁇ /Hind ⁇ (position 500 library) or Nco ⁇ /Bsu36 ⁇ (position 573 library). The digested DNAs were then purified using a Qiagen PCR-clean up kit and ligated into Sa/I/ Hind ⁇ - or Nco ⁇ /Bsu36 ⁇ - digested pDB4082 or pDB3927, respectively, replacing the equivalent native sequence. Ligations were transformed into E.
  • coli DH5a subsequent plasmids isolated from transformants using a Qiagen miniprep kit (according to the manufacturer's instructions) and the correct constructs identified by restriction analysis.
  • the specific changes in each plasmid were confirmed by sequencing.
  • the resultants plasmids were used to generate expression plasmids and albumin fusion producing yeast by in vivo cloning as described above. That is, S. cerevisiae was transformed using the Sigma Yeast Transformation kit (described below), using a mixture of a 100 ng SsiEII/esrBI-digeste HSA variant containing plasmid and 100 ng Acc65 ⁇ /Bam ⁇ digested pDB3936.
  • S. cerevisiae BXP10 cir° (as previously described WO/2001 /079480) or Strain A cir° (described in WO/2005/061718) was streaked on to YEPD plates (1 % (w/v) yeast extract, 2% (w/v) Bactopeptone, 2% (w/v) glucose), 1 .5% agar) and allowed to grow for 4 days at 30°C prior to transformation.
  • YEPD plates (1 % (w/v) yeast extract, 2% (w/v) Bactopeptone, 2% (w/v) glucose), 1 .5% agar
  • BMMD BMMD agar plates
  • the composition of BMMD is described by Sleep et al., (2001 ), Yeast, 18, 403. Plates were incubated at 30°C for 4 days before individual colonies were patched on to fresh BMMD plates. Yeast strain numbers are detailed in Table 1 .
  • BMMD broth was inoculated with a heavy loop of each yeast patch and grown for 24h at 30°C with orbital shaking at 200rpm.
  • Cells were harvested by centrifugation at 1 900 ⁇ g for 5 min in a Sorval RT600 centrifuge, 15ml_ supernatant was removed and replaced by trehalose 40% (w/v). The cells were resuspended and transferred to cyrovials (1 mL) for storage at -80°C.
  • BMMD (recipe 0.17% (w/v) yeast nitrogen base without amino acid and ammonium sulphate (Difco), 37.8mM ammonium sulphate, 29mM citric acid, 142mM disodium hydrogen orthophosphate dehydrate pH6.5, 2% (w/v) glucose) media (10ml_) was inoculated with each yeast strain and grown for 12h at 30°C with orbital shaking at 200rpm. An aliquot of each starter culture (4ml_) was used to inoculate 2 200ml_ BMMD media and grown for 36h at 30°C with orbital shaking at 200rpm. Cells were harvested by filtration through 0.2 ⁇ vacuum filter membranes (Stericup, Millipore) including a GF-D prefilter (Whatman) and the supernatant retained for purification. Primary concentration
  • Retained culture supernatant was concentrated using Tangential Flow Filtration using a Pall Filtron LV system fitted with a Omega 10KD (0.093sq.m2) filter (LV CentramateTM cassette, Pall Filtron) with a transmembrane pressure of 20psi and a recirculation rate of 180ml_.min "1 .
  • a Pall Filtron LV system fitted with a Omega 10KD (0.093sq.m2) filter (LV CentramateTM cassette, Pall Filtron) with a transmembrane pressure of 20psi and a recirculation rate of 180ml_.min "1 .
  • Sucrose was kept at growth-limiting concentrations by controlling the rate of feed to a set nominal growth rate.
  • the feed consisted of fermentation media containing 50% (w/v) sucrose, all essentially as described by Collins. (Collins, S.H., (1990) Production of secreted proteins in yeast, in: T.J.R. Harris (Ed.) Protein production by biotechnology, Elsevier, London, pp. 61 -77).
  • GP-HPLC quantitation Purified albumin variants, fusions and conjugates were analysed by GP-H PLC and quantification as follows. Injections of 25 ⁇ _ were made onto a 7.8mm id x 300mm length TSK G3000SWXL column (Tosoh Bioscience), with a 6.0mm id x 40mm length TSK SW guard column (Tosoh Bioscience).
  • Samples were chromatographed in 25mM sodium phosphate, 100mM sodium sulphate, 0.05% (w/v) sodium azide, pH 7.0 at 1 mL/min, Samples were quantified by UV detection at 280nm, by peak area, relative to a recombinant human albumin standard of known concentration (10mg/ml_) and corrected for their relative extinction coefficients.
  • Albumin variants were purified from shake flask (either culture supernatant or concentrated culture supernatant) using a single chromatographic step using an albumin affinity matrix (AlbuPureTM - ProMetic Biosciences, Inc.). Chromatography was performed at a constant linear velocity of 240cm/h throughout. Culture supernatant was applied to a 6cm bed height, 2.0ml_ packed bed pre-equilibrated with 50mM sodium acetate pH5.3. Following load the column was washed with 10 column volume (CV) of equilibration buffer, then 50mM ammonium acetate pH8.0 (10CV).
  • CV column volume
  • Albumin-fusion variants were purified from shake flask culture supernatant using a single chromatographic step using an albumin affinity matrix (AlbuPureTM - ProMetic Biosciences, Inc.). Chromatography was performed at a constant linear velocity of 240cm/h throughout. Culture supernatant or concentrated culture supernatant was applied to a 6cm bed height, 2.0ml_ packed bed pre-equilibrated with 50mM sodium acetate pH5.3. Following load the column was washed with 10 column volume (cv) equilibration buffer then 50mM ammonium acetate pH8.0 (10cv).
  • Albumin variants were purified from high cell density fed batch fermentation supernatants after separation by centrifugation, using a Sorvall RC 3C centrifuge (DuPont). Culture supernatant was chromatographed through an 1 1 cm bed height column 8.6ml_ packed bed packed with a custom synthesised albumin affinity matrix (AlbuPureTM - ProMetic Biosciences, Inc.) as described above. Product was eluted using elution buffers describe above at a flow rate of 120cm/h. The eluate fraction(s) was analysed by GP-HPLC.
  • HSA Essentially fatty acid-free HSA (Sigma-Aldrich) was further purified by size exclusion chromatography as described in Andersen et al (2010). J.Biol.Chem. 285, (7),4826-4836. Ten ⁇ of monomeric HSA and rHA were analysed using SPR as described above and the data presented in Figure 4.
  • the variants were analysed using ELISA at pH 6.0 and pH 7.4. Results are disclosed in Figure 5. The ELISA values represent the mean of duplicates. The variants were analysed using SPR analysis at pH 6.0 and pH 7.4. Results are disclosed for a representative number of variants in Figure 6 using a concentration of the variants of 0.2 ⁇ and in Figure 7 using a concentration of the variants of 1 ⁇ .
  • CM5 chips using CM5 chips and immobilization of smFcRn-GST and shFcRn-GST variants or smFcRn was performed using the amine coupling kit (GE Healthcare). Protein samples (10 g/ml) were injected in 10 mM sodium acetate at pH 4.5 (GE Healthcare), all as described by the manufacturer. Unreacted moieties on the surface were blocked with 1 M ethanolamine.
  • phosphate buffer (67 mM phosphate buffer, 0.15 M NaCI, 0.005% TWEEN® 20) at pH 6.0 or pH 7.4, or HBS-P buffer (0.01 M HEPES, 0.15 M NaCI, 0.005% surfactant P20) at pH 7.4 were used as running buffer or dilution buffer.
  • Kinetic measurements were performed using a low density immobilized surface (100-200 resonance units (RU)).
  • the KD's were generated using the BIAevaluation 4.1 software) A Langmuir 1 : 1 ligand model was used throughout. The kinetic values represent the average of triplicates. ND means: Not determined. NA means: Not acquired
  • animal albumin (either Sigma-Aldrich or Calbiochem) were further purified as described in Andersen et al (2010). J.Biol.Chem. 285, (7),4826-4836.
  • the binding of donkey serum albumin, bovine serum albumin, goat serum albumin, sheep serum albumin, rabbit serum albumin, dog serum albumin, hamster serum albumin, guinea pig albumin, rat serum albumin and chicken serum albumin to shFcRn was determined using the techniques described in Materials and Methods..
  • the ELISA results are disclosed in Figure 9 A-D and the relative bindings summarized in Figure 9 E.
  • Relative binding responses are categorized from strongest (++++) to weakest (+) and no binding (- ) ⁇
  • binding constants for variants according to the invention were determined according to the methods described in Materials and Methods.
  • the KD's were generated using the BIAevaluation 4.1 software) A Langmuir 1 :1 ligand model was used throughout. The kinetic values represent the average of triplicates. ND means: Not determined.
  • Example 1 variants of HSA having the substitutions Q417A and D494E+Q417H were constructed.
  • the kinetic properties of these variants were tested using the methods in Materials and Methods and are shown in Table 12.
  • Table 12 Binding constants of HSA variants for shFcRn
  • Example 1 variants of HSA having the substitutions P499A, K500A, K536A, P537A, K538A and K573A were constructed.
  • the receptor binding properties of these variants were tested as described in Materials and Methods. Results are shown in Figure 1 1 .
  • variants P499A, K536A, P537A and K538A had a reduced binding affinity to shFcRn relative to HSA.
  • variant K500A had almost completely lost its ability to bind to shFcRn and K573A had an increased binding affinity to shFcRn both relative to HSA.
  • Example 1 variants of HSA having the substitutions E501A and E501 Q were constructed.
  • the kinetic properties of these variants were tested as described in Materials and Methods.
  • Example 1 variants of HSA having a substitution at position 573 were constructed. All variants at position 573 were generated and the receptor binding properties of these variants were tested as described in Materials and Methods but with SPR analysis performed at pH5.5. Results are shown in the table 14 below and Figure 12 and 13.
  • the steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BIAevaluation 4.1 software.
  • the kinetic values represent the average of duplicates
  • d Not determined (ND).
  • the results show that all variants having substitution in position 573 have improved binding to shFcRn compared with WT HSA.
  • the variants K573F, K573H, K573P, K573W and K573Y have more than 10 fold lower KD to shFcRn than the parent HSA.
  • the variant K573STOP is a truncated albumin having a stop codon in position 573.
  • the sensorgram for the K573STOP variant show significantly reduced binding compare to the WT HSA and generated a high KD.
  • the increased affinity that we have shown for the variant K573E, a natural variant characterized by Otagiri (2009). Biol.Pharm. Bull. 32(4) 527-534, is predicted to have increased half-life in vivo.
  • Example 15 Analysis of HSA variants in position 500 Using the method of Example 1 variants of HSA having a substitution at position 500 were constructed. All variants at position 500 were generated and the receptor binding properties of these variants were tested. Biacore X, Biacore X100 and Sensor Chip CM5 were used for all analyses, both supplied by G E Healthcare.
  • shFcRn produced by GeneArt AG (Germany) (diluted to " ⁇ g/rmL in 10mM sodium acetate pH5.0 (G E Healthcare)) was immobilised on flow cell 2 (FC2) to levels between 1600 - 2200 response u nits (RU ) via standard amine cou pling as per manufacturers instructions (G E Healthcare).
  • FC1 flow cell 1
  • FC1 flow cell 1
  • 3-5 start up cycles were run first, with running buffer (67mM phosphate buffer, 0.15M NaCI, 0.005% Tween 20 at pH5.75 ⁇ 0.25) only, followed by regeneration.
  • WT rHA and K500 library variants were injected at various concentrations (1 ⁇ - 150 ⁇ ) for 90s at a constant flow rate of (30 ⁇ / ⁇ - ⁇ ) at 25 °C followed by regeneration of the surface using HBS-EP buffer pH7.4 (G E Healthcare) until approximate initial baseline RU was restored (usually 12s pulse would suffice).
  • Table 17 Kinetics of HSA K500 single point mutants.
  • Plasmids containing expression cassettes for the production of scFv (vHvL) genetically- fused to HSA, at either the N- or C-terminus or both, were modified to allow the production of albumin fusions using in vivo cloning (describe above). That is, pDB3017 ( Figure 17), pDB3021 ( Figure 18), pDB3056 ( Figure 19) were digested with Nsi ⁇ /Spe ⁇ and Nsi ⁇ fragments corresponding 9.51 1 kb, 9.569kb and 8.795kb, respectively, were purified using standard techniques. Purified Nsi ⁇ fragments were self-ligated and used to transform chemically competent E. coli DH5a to produce pDB4168, pDB4169 and pDB4170, respectively (Table 18).
  • pDB3165 (containing the bivalent fusion) ( Figure 20) was digested with A/oil and the expression cassette (4.506kb fragment) was purified before being ligated into ⁇ / ⁇ -digested pDB3927 to produce pDB4172 ( Figure 21 , Table 18).
  • Synthetic Sal ⁇ /Bsu36 ⁇ DNA fragments (269bp), which contain point mutations within the albumin encoding nucleotide sequence to introduce amino acid substitutions corresponding to K500A, or D550N or K573P into the translated albumin protein sequence, were generated by gene assembly (GeneArt AG, Germany).
  • the Sal ⁇ /Bsu36 ⁇ fragments were individually ligated into Sa/l/Sst/36l-digested pDB4168-pDB4170 and pDB4172 and used to transform chemically competent E. coli DH5a using standard techniques to generate plasmids pDB4265 - pDB4276 (Table 18).
  • a DNA fragment was generated by PCR (using standard techniques), to introduce a K573A substitution in the translated albumin protein sequence.
  • PCR was performed using the New England Biolabs Phusion kit using pDB4267 ( Figure 22) as template DNA and oligonucleotides xAP238 (SEQ ID NO: 53) and xAP239 (SEQ ID NO: 54):
  • Table 19 describes PCR cycling.
  • PCR-product was purified, digested with Sal ⁇ /Bsu36 ⁇ , and the fragment (269bp) isolated was ligated into Sa/l/Sst/36l-digested pDB4168-pDB4170 and pDB4172 and used to transform chemically competent E. coli DH5a.
  • Resulting plasmids (pDB4277 - pDB4280) are listed in Table 18.
  • the nucleotide sequence encoding the FLAG tag was removed from plasmids pDB4168 and pDB4268-4270 (plasmids for the expression of scFv N-terminally fused to HSA and HSA muteins K500A, D550N and K573P, respectively.
  • pDB4168 and pDB4268-4270 (Table 18) were digested with Bsu36 ⁇ /Sph ⁇ to remove a 231 bp product comprising 3' region of HSA-encoding gene, nucleotide sequence encoding FLAG tag and 5' region of ADH 1 terminator.
  • a Bsu36 ⁇ /Sph ⁇ fragment (207bp), comprising 3' region of HSA-encoding gene and 5' region of mADH1 terminator (SEQ ID1 ) from pDB4181 was ligated into est/36l/Sp/?l-digested pDB4168 and pDB4268-pDB4270 using standard techniques. Ligation mixtures were used to transform chemically competent E. coli DH5a using standard techniques to generate plasmids pDB4281 -pDB4284 (Table 18)
  • pDB4265-pDB4284 were digested with fisiEII/fisrBI and the linearised DNA molecules were purified using standard techniques.
  • One hundred ng SsiEII/SsrBI DNA samples were mixed with 100ng /Acc65l/SamHI-digested pDB3936 and used to transform S. cerevisiae BXP10cir° using the Sigma Yeast Transformation kit described below.
  • the expression plasmid was generated in the yeast by homologous recombination (in vivo cloning) between the albumin-fusion containing plasmid (pDB4265-pDB4280) (Table 18) and pDB3936.
  • Plasmids pDB3017, pDB3021 , pDB3056 and pDB3165 were used to transform S. cerevisiae Strain Acir 0 (described in WO/2005/061718) using the Sigma Yeast Transformation kit described below.
  • the nucleotide sequence encoding human IL-1 RA (interleukin-1 receptor antagonist)
  • the nucleotide sequence of the 708bp synthetic fragment (Bsu36l/Sphl fragment) is given in SEQ ID NO: 55 and includes the 3'region of the gene encoding HSA, the nucleotide sequence encoding a GS linker, the nucleotide sequence encoding human I L-1 RA (N84Q to abolish the N-linked glycosylation motif) and the 5' region of the ADH 1 terminator.
  • the synthetic DNA fragment could be ligated into Bsu36l/Sphl-digested pDB3927 to produce pDB2588.
  • Plasmids containing the expression cassettes for the production of IL-1 RA genetically fused to the C-terminus of HSA and the HSA variants K500A, D550N, K573A and K573P were prepared as follows.
  • pDB2588 was digested with Bsu36l/Sphl and a 705bp fragment containing the '3 region of the HSA encoding gene, nucleotide sequence encoding a GS linker, nucleotide sequence encoding human IL1 -RA (N84Q) and the 5' region of a modified S.
  • cerevisiae ADH1 terminator (SEQ ID3) was purified using standard techniques then ligated into Bsu36l/Sphl-digested pDB4006 (containing HSA K573A expression cassette), pDB4010 (containing HSA D550N expression cassette), pDB4086 (containing HSA K500A expression cassette), pDB41 10 (containing HSA K573P expression cassette) to generate pDB4287, pDB4286, pDB4285 and pDB4288, respectively (for an example, see Figure 23).
  • pDB4285-pDB4288 were digested with Nsi l/Pvu l and the linearised DNA molecules were purified using standard techniques.
  • Nsil/Pvul- digested DNA samples were mixed with 100ng Acc65l/BamHI-digested pDB3936 (9721 bp) (i.e. in vivo cloning) and used to transform S. cerevisiae (i.e. by in vivo cloning) using the Sigma Yeast Transformation kit described below.
  • the fusion polypeptides were analysed for their binding to FcRn using the SPR method described above and following results were obtained:
  • Table 20 Kinetics of HSA fusion variants.
  • Example 8 it was shown that the K500A variant did not significantly bind shFcRn, in Example 10 it was shown that the K573P and K573A variants bind shFcRn stronger than HSA and in Example 1 1 it was shown that the D550N variant binds FcRn weaker than HSA.
  • fusion polypeptides in different configurations: C-terminal fusions with a small moiety (HSA-FLAG), C-terminal fusions with a larger polypeptide (HSA-IL1 RA); N-terminal fusions with polypeptide (scFv-HSA); N- and C-terminal fusions (scFv-HSA-FLAG and scFv-HSA-scFv- FLAG).
  • Example 17 Conjugation of Horseradish peroxidase protein to Albumin and the K573P variant.
  • recombinant albumin (RecombuminTM) was used as a control molecule.
  • RecombuminTM recombinant albumin
  • a final 200mg/mL albumin K573P variant of the invention was purified from a fed batch fermentation by means described in Material and Methods.
  • a two step purification was carried out; The first step used a column (bed volume approximately 400ml_, bed height 1 1 cm) packed with AlbuPureTM matrix (ProMetic). This was equilibrated with 50mM sodium acetate, pH 5.3 and loaded with neat culture supernatant, at approximately pH 5.5-6.5, to approximately 20 mg/mL matrix.
  • the eluate from the first step was diluted approximately two fold with water to give a conductivity of 2.5 ⁇ 0.5 mS/cm after adjustment to pH 5.5 ⁇ 0.3 with acetic acid.
  • This was loaded onto a DEAE-Sepharose Fast Flow (GE Healthcare) column (bed volume approximately 400ml_, bed height 1 1 cm), equilibrated with 80mM sodium acetate, 5mM octanoate, pH 5.5. Loading was approximately 30mg protein/mL matrix.
  • the column was washed with approximately 5 column volumes of 80mM sodium acetate, 5mM octanoate, pH 5.5.
  • the eluate from the first step was diluted approximately two fold with water to give a conductivity of 2.5 ⁇ 0.5 mS/cm after adjustment to pH 5.5 ⁇ 0.3 with acetic acid.
  • This was loaded onto a DEAE-Sepharose Fast Flow (GE Healthcare) column (bed volume approximately 400ml_, bed height 1 1 cm), equi
  • the bound protein was eluted using two column volumes of 1 10mM potassium tetraborate, 200mM sodium chloride, approximately pH 9.0.
  • the flow rate was 183mL/min during the load and wash steps, and 169mL/min during the elution step.
  • the eluate was concentrated and diafiltered against 145mM NaCI, using a Pall Centramate Omega 10,000 Nominal MWCO membrane, to give a final protein concentration of approximately 200mg/mL.
  • Both 200mg/mL stock solutions of the rHA and K573P variant albumin were diluted down to 5mg/mL, using phosphate buffer saline (PBS), pH adjusted to pH 6.5-6.7.
  • PBS phosphate buffer saline
  • 2mg of the EZ-Link® Maleimide Activated Horseradish Peroxidase (HRP) was mixed with either 1 mL of the 5mg/ML rHA or K573P variant albumin.
  • This mixture ensured an approximate 2 fold molar excess of the albumin, or K573P variant albumin. This mixture was minimally incu bated at 4 °C, for 24 hours. The reaction mixtures were then checked for conjugation, using GP-HPLC.
  • Example 18 Conjugation of Fluorescein to Albumin and the K573P variant.
  • the two same albumin samples used in Example 17, were also the start materials for this example. I.e. Approximately 200mg/ml_ rHA or the K573P albumin variant.
  • Fluorescein-5-Maleimide was dissolved in dimethylformamide, to give a final concentration of 25mg/ml_. This was then further diluted into 18mls of PBS, pH adjusted to approximately pH 6.5. To this solution either 1 ml of 200mg/ml_ rHA or 1 ml_ of 200mg/ml_ K573P variant was added. This gave an approximate 20 fold final molar excess of F5M. These samples were incubated and allowed to conjugate overnight at 4°C, in the dark, to allow the maleimide groups on the F5M to react with predominantly the free sulfhydryl, present in both albumin species.
  • Example 19 Further albumin variants.
  • Figure 30A and 30B shows the effect on shFcRn binding for the albumin variants.
  • Table 22 Kinetics of the HSA C-terminal swapped variant interactions with shFcRn.
  • HSA-MouseC i 3.7+0.1 1 .3+0.0 i: 0.3
  • Example 21 Competitive binding analysis of variant albumin fusions
  • the competitive binding hierarchy was identical for the variants fusions of HSA-FLAG and , N+C-terminal scFv HSA-FLAG to the hierarchy of the individual HSA variants (unfused and fused) affinity data.
  • the IL1 Ra variants K573P, K573A, and the K500A were as predicted, however the D550N appears to inhibit more efficiently than the WT fusion.
  • HSA E492G+K573A HSA E492G+ N503K+ K573A, unlike HSA E492G+ N503H + K573A, had marginally improved binding beyond that of HSA K573A.
  • the combination variants containing K573P did not show improved binding over the K573P single variant.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to variants of a parent albumin having altered plasma half-life compared with the parent albumin. The present invention also relates to fusion polypeptides and conjugates comprising said variant albumin.

Description

ALBUMIN VARIANTS
Reference to a Sequence Listing
This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.
Background of the Invention
Field of the Invention
The present invention relates to variants of albumin or fragments thereof or fusion polypeptides comprising variant albumin or fragments thereof having a change in half-life compared to the albumin, fragment thereof or fusion polypeptide comprising albumin or a fragment thereof.
Description of the Related Art
Albumin is a protein naturally found in the blood plasma of mammals where it is the most abundant protein. It has important roles in maintaining the desired osmotic pressure of the blood and also in transport of various substances in the blood stream.
Albumins have been characterized from many species including human, pig, mouse, rat, rabbit and goat and they share a high degree of sequence and structural homology.
Albumin binds in vivo to its receptor, the neonatal Fc receptor (FcRn) "BrambeH" and this interaction is known to be important for the plasma half-life of albumin. FcRn is a membrane bound protein, expressed in many cell and tissue types. FcRn has been found to salvage albumin from intracellular degradation (Roopenian D. C. and Akilesh, S. (2007), Nat. Rev. Immunol 7, 715-725.). FcRn is a bifunctional molecule that contributes to maintaining a high level of IgGs and albumin in serum in mammals such as human beings.
Whilst the FcRn-immunoglobulin (IgG) interaction has been characterized in the prior art, the FcRn-albumin interaction is less well characterized. The major FcRn binding site is localized within DIN (381 -585). Andersen ei a/ (2010). Clinical Biochemistry 43,367-372. Data indicates that IgG and albumin bind non-cooperatively to distinct sites on FcRn (Andersen et al. (2006), Eur. J. Immunol 36, 3044-3051 ; Chaudhury et al. (2006), Biochemistry 45, 4983-4990.).
It is known that mouse FcRn binds IgG from mice and humans whereas human FcRn appears to be more discriminating (Ober ei a/. (2001 ) Int. Immunol 13, 1551 -1559). Andersen et al. (2010). Journal of Biological Chemistry 285(7):4826-36, describes the affinity of human and mouse FcRn for each mouse and human albumin (all possible combinations). No binding of albumin from either species was observed at physiological pH to either receptor. At acidic pH, a 100-fold difference in binding affinity was observed. In all cases, binding of albumin and IgG from either species to both receptors were additive.
Human serum albumin (HSA) has been well characterized as a polypeptide of 585 amino acids, the sequence of which can be found in Peters, T., Jr. (1996) All about Albumin: Biochemistry, Genetics and Medical, Applications pp10, Academic Press, Inc., Orlando (ISBN 0-12-5521 10-3). It has a characteristic binding to its receptor FcRn, where it binds at pH 6.0 but not at pH 7.4.
The plasma half-life of HSA has been found to be approximately 19 days. A natural variant having lower plasma half-life has been identified (Peach, R. J. and Brennan, S. 0.,(1991 ) Biochim Biophys Acta.1097:49-54) having the substitution D494N. This substitution generated an N- glycosylation site in this variant, which is not present in the wild-type albumin. It is not known whether the glycosylation or the amino acid change is responsible for the change in plasma half- life.
Albumin has a long plasma half-life and because of this property it has been suggested for use in drug delivery. Albumin has been conjugated to pharmaceutically beneficial compounds (WO 2000/69902A), and it was found that the conjugate - maintained the long plasma half-life of albumin. The resulting plasma half-life of the conjugate was generally considerably longer than the plasma half-life of the beneficial therapeutic compound alone.
Further, albumin has been fused to therapeutically beneficial peptides (WO 2001/79271 A and WO 2003/59934 A) with the typical result that the fusion has the activity of the therapeutically beneficial peptide and a considerably longer plasma half-life than the plasma half-life of the therapeutically beneficial peptides alone.
Otagiri et al (2009), Biol. Pharm, Bull. 32(4), 527-534, discloses that 77 albumin variant are know, of these 25 are found in domain III. A natural variant lacking the last 175 amino acids at the carboxy termini has been shown to have reduced half-life (Andersen et al (2010), Clinical Biochemistry 43, 367-372). Iwao et a/.(2007) studied the half-life of naturally accuring human albumin variants using a mouse model, and found that K541 E and K560E had reduced half-life, E501 K and E570K had increased half-life and K573E had almost no effect on half-life (Iwao, et. al. (2007) B.B.A. Proteins and Proteomics 1774, 1582-1590).
Galliano et al (1993) Biochim. Biophys.Acta 1225, 27-32 discloses a natural variant E505K. Minchiotti et a/.(1990) discloses a natural variant K536E. Minchiotti et al (1987) Biochim. Biophys. Acta 916, 41 1 -418 discloses a natural variant K574N. Takahashi et al (1987) Proc. Natl. Acad. Sci. USA 84, 4413-4417, discloses a natural variant D550G. Carlson et al (1992). Proc.Nat.Acad.Sci.USA 89, 8225- 8229, discloses a natural variant D550A.
Albumin has the ability to bind a number of ligands and these become associated (associates) with albumin. This property has been utilized to extend the plasma half-life of drugs having the ability to noncovalently bind to albumin. This can also be achieved by binding a pharmaceutical beneficial compound, which has little or no albumin binding properties, to a moiety having albumin binding properties. See review article and reference therein, Kratz (2008). Journal of Controlled Release 132, 171 -183.
Albumin is used in preparations of pharmaceutically beneficial compounds, in which such a preparation maybe for example, but not limited to, a nano particle or micro particle of albumin. In these examples the delivery of a pharmaceutically beneficial compound or mixture of compounds may benefit from alteration in the albumins affinity to its receptor where the beneficial compound has been shown to associate with albumin for the means of delivery.
It is not clear what determines the plasma half-life of the formed associates (for example but not limitited to Levemir®, Kurtzhals P et al. Biochem. J. 1995; 312:725-731 ) conjugates or fusion polypeptides but it appears to be a result of the combination of the albumin and the selected pharmaceutically beneficial compound/polypeptide. It would be desirable to be able to control the plasma half-life of given albumin conjugates, associates or albumin fusion polypeptides so that a longer or shorter plasma half-life can be achieved than given by the components of the association, conjugation or fusion, in order to be able to design a particular drug according to the particulars of the indication intended to be treated.
Albumin is known to accumulate and be catabolised in tumours, it has also been shown to accumulate in inflamed joints of rheumatoid arthritis sufferers. See review article and reference therein, Kratz (2008). Journal of Controlled Release 132, 171 -183. It is envisaged that HSA variants with increased affinity for FcRn would be advantageous for the delivery of pharmaceutically beneficial compounds.
It may even be desirable to have variants of albumin that have little or no binding to FcRn in order to provide shorter half-lives or controlled serum pharmacokinetics as described by Kenanova et al (2009) J. Nucl. Med.; 50 (Supplement 2): 1582).
Summary of the Invention
The present invention provides variants of a parent albumin with improved properties compared to its parent. In particular the invention provides variants of a parent albumin having altered plasma half-life compare to its parent.
The present invention relates to isolated variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof, of a parent albumin, comprising an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of the mature polypeptide of SEQ I D NO: 2, wherein the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501 K, K541 E, D550GA K573E or K574N.
The alteration at one or more position may independently be selected among substitutions, insertions and deletions, where substitution are preferred.
The present invention also relates to isolated polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of producing the variants.
The present invention also relates to conjugates or associates comprising the variant albumin or fragment thereof according to the invention and a beneficial therapeutic moiety or to a fusion polypeptide comprising a variant albumin or fragment thereof of the invention and a fusion partner polypeptide.
The invention further relates to compositions comprising the variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment thereof, according to the invention or associates comprising the variant albumin or fragment thereof, according to the invention. The compositions are preferably pharmaceutical compositions.
The invention further relates to a pharmaceutical composition comprising a variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment thereof, or associates comprising the variant albumin or fragment thereof, wherein said variant albumin, fragment thereof, fusion polypeptide comprising variant albumin or fragment thereof or conjugates comprising the variant albumin or fragment or associates of variant albumin or fragment thereof has altered plasma half-life compared to the corresponding plasma half-life of the HSA or fragment thereof, fusion polypeptide comprising HSA or fragment thereof or conjugates or associates of HSA or, fragment thereof, comprising HSA or fragment thereof.
Brief Description of the Figures
Figure 1 shows a restriction map of the expression plasmid pDB4082.
Figure 2 shows a restriction map of the expression plasmid pDB2305
Figure 3 shows a restriction map of the expression plasmid pDB4005
Figure 4 shows SPR sensorgrams 10 μΜ albumin injected over shFcRn HSA (JTA) = fatty acid free HSA obtained from Sigma-Aldrich (A3782), HSA (Novozymes) = Commercial Recombinant human serum albumin (RECOMBUMIN).
Figure 5 shows ELISA binding of shFcRn-GST to human serum albumin (HSA) variants (100-0.045 μς/πιΙ). Binding of WT, D494N, D494Q and D494A pH 6.0 and pH 7.4. Binding of WT, D494N, D494N/T496A and T496A at pH 6.0 and pH 7.4. Binding of WT, E495Q and E495A at pH 6.0 and pH 7.4.
Figure 6 shows representative sensorgrams of binding of 0.2 μΜ of HSA variants to immobilized shFcRn (-4600 RU). WT, D494N, D494Q, D494A, D494N/T496A and T496A.
Figure 7 shows representative sensorgrams of binding of 1 μΜ of HSA variants to immobilized shFcRn (-1400 RU). WT, D494N, D494Q, D494A, D494N/T496A and T496A.
Figure 8 shows relative binding of the HSA variants compared to WT based on two independent SPR experiments as shown (A) Figure 6 and (B) Figure 7.
Figure 9 shows ELISA: (A) binding of shFcRn to albumins from human, donkey, bovine, sheep, goat and rabbit at pH 6.0. (B) binding of shFcRn to albumin from guinea pig, hamster, rat and chicken at pH 6.0. (C) binding of shFcRn to albumin from human, donkey, bovine, sheep, goat and rabbit at pH 7.4. (D) binding of shFcRn to albumin from guinea pig, hamster, rat and chicken at pH 7.4. (E) relative binding of the different albumins. Relative binding of human albumin to shFcRn is defined as 1.0. The ELISA values represent the mean of duplicates.
Figure 10 shows SPR: Binding of shFcRn-GST to albumin from several species at pH 6.0 and pH 7.4. Representative sensorgrams showing binding of 5.0 μΜ of albumin from different species; (A) human, (B) donkey, (C) bovine, (D) goat, (E) sheep, (F) rabbit, (G) dog, (H) guinea pig, (I) hamster, (J) rat, (K) mouse and (L) chicken. The albumin variants were injected over immobilized GST-tagged shFcRn (-2100 RU). Injections were performed at 25°C at a rate of 40 μΙ/min.
Figure 11 shows SPR sensorgrams of selected HSA mutants compared with wild-type HSA. 20 μΜ of (A) WT and P499A (B) WT and K500A, (C) WT and K536A, (D) WT and P537A and (E) WT and K538A and (F) WT and K537A were injected over immobilized shFcRn at pH 6.0 (-1500 RU)
Figure 12 shows SPR sensorgrams of HSA mutants compared with WT HSA. 10 μΜ of (A)
WT and K573A (B) WT and K573C, (C) WT and K573F, (D) WT and K573G and (E) WT and K573L and (F) WT and K573M, (G) WT and K573Q, (H) WT and K573R and (I) WT and K573T and (J) WT and K573V injected over immobilized shFcRn at pH 5.5 and pH7.4. Injections were performed at 25°C at a flow rate of 80 μΙ/min.
Figure 13 shows SPR sensorgrams of HSA mutants compared with wild-type HSA. 10 μΜ of (A) WT and K573D (B) WT and K573E, (C) WT and K573H, (D) WT and K573I and (E) WT and K573N and (F) WT and K573P, (G) WT and K573S, (H) WT and K573* and (I) WT and K573W and (J) WT and K573Y injected over immobilized shFcRn at pH 5.5 and pH7.4. Injections were performed at 25°C at a flow rate of 80 μΙ/min. Figure 14 shows SPR sensorgrams of HSA mutants compared with wild-type HSA. 20 μΜ of (A) WT and E492G+K538H+K541 N+E542D (B) WT and E492T+N503K+K541A, (C) WT and
E 4 92 P + N 503 K + K 54 1 G + E 542 P , ( D ) WT a n d E 4 92 H + E 50 1 P + N 503 H + E 505 D
+T506S+T540S+K541 E and (E) WT and A490D+E492T+V493L+E501 P+N503D+A504E +E505K+T506F+K541 D and (F) WT and E492G+V493P+K538H+K541 N+E542D injected over immobilized shFcRn at pH 6.0. Injections were performed at 25°C at a flow rate of 80 μΙ/min.
Figure 15 shows SPR sensorgrams of HSA mutants compared with wild-type HSA. Twenty μΜ of (A) WT, (B) H440Q, (C) H464Q and (D) H535Q injected over immobilized shFcRn at pH 6.0.
Injections were performed at 25°C at a flow rate of 80 μΙ/min.
Figure 16 shows SPR sensorgrams of HSA mutant K500E compared with wild-type HSA.
Ten μΜ of HSA mutant K500E injected over immobilized sh FcRn at pH 5.75. Injections were performed at 25°C at a flow rate of 30 μΙ/min.
Figure 17 shows a restriction map of the expression plasmid pDB3017
Figure 18 shows a restriction map of the expression plasmid pDB3021
Figure 19 shows a restriction map of the expression plasmid pDB3056
Figure 20 shows a restriction map of the expression plasmid pDB3165
Figure 21 shows a restriction map of the expression plasmid pDB4172
Figure 22 shows a restriction map of the expression plasmid pDB4267
Figure 23 shows a restriction map of the expression plasmid pDB4285
Figure 24 shows a GP-H P LC chromatogram of WT HSA and m utant K573 P H RP conjugates for shFcRn analysis. Injections of 25μΙ_ were made onto a TSK G3000SWXL column
(Tosoh Bioscience) as described in materials and methods.
Figure 25 shows SDS PAGE separation followed by both visual (A) and ultraviolet (B) detection of the Fluorescein conjugated albumin. HSA::F5M (Lane 1 ), K573P::F5M (Lane 2) and rHA standard (Lane 3).
Figure 26 shows shFcRn binding properties of HSA variants. 10μ Μ of WT rHA and
E492T(A), WT rHA and D494N/E495Q/T496A(B), WT rHA and N503D(C), WT rHA and N503K(D),
WT rHA and E492T/N503D(E), WT rHA and E495Q/T496A(F), WT rHA and K538H(G), WT rHA and E492D(H) injected over immobilised shFcRn at pH5.5
Figure 27 shows shFcRn binding properties of HSA variants. 10μΜ of WT rHA and
K541 A(l) and WT rHA and K541 N(J) were injected over immobilised shFcRn at pH5.5.
Figure 28 shows competitive binding of K573A and K573P measured by injecting shFcRn
(100 nM) alone or pre-incubated with different amounts of HSA K573A and K573P over immobilized HSA (-2500 RU) at pH6.0 Figure 29 shows competitive binding of HSA-FLAG variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSA-FLAG variants over immobilized HSA (-2500 RU) at pH6.0.
Figure 30 shows competitive binding of HSA-IL1 Ra variants measured by injecting shFcRn (100 nM) alone or together with different amounts of HSA-IL1 Ra variants over immobilized HSA (-2500 RU) at pH6.0
Figure 31 shows competitive binding of scFv-fused HSA variants measured by injecting shFcRn (100 nM) alone or together with different amounts of (A) scFv-HSA-FLAG variants or (B) HSA-scFv-FLAG variants over immobilized HSA (-2500 RU) at pH6.0.
Figure 32 shows binding of HSA, single, double and triple mutant variants to shFcRn.
Samples of 10 μΜ of each HSA variant were injected over immobilized shFcRn at pH 5.5 or pH 7.4.
Detailed Description of the Invention
The present invention relates to isolated variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof, of a parent albumin, comprising an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of the mature polypeptide of SEQ ID NO: 2, wherein the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501 K, K541 E, D550G,A, K573E or K574N..
The alteration at one or more position may independently be selected among substitutions, insertions and deletions, where substitution are preferred.
Definitions
Variant: The term "variant" means a polypeptide derived from a parent albumin by one or more alteration(s), i.e., a substitution, insertion, and/or deletion, at one or more (several) positions. A substitution means a replacement of an amino acid occupying a position with a different amino acid; a deletion means removal of an amino acid occupying a position; and an insertion means adding 1 or more, preferably 1 -3 amino acids immediately adjacent to an amino acid occupying a position.
Mutant: The term "mutant" means a polynucleotide encoding a variant.
Wild-Type Albumin: The term "wild-type" (WT) albumin means albumin having the same amino acid sequence as naturally found in an animal or in a human being.
Parent or Parent albumin The term "parent" or "parent albumin" means an albumin to which an alteration is made by the hand of man to produce the albumin variants of the present invention. The parent may be a naturally occurring (wild-type) polypeptide or an allele thereof, or even a variant thereof.
FcRn and shFcRn: The term "FcRn" means the human neonatal Fc receptor (FcRn). shFcRn is a soluble recombinant form of FcRn.
smFcRn: The term "smFcRn" is a soluble recombinant form of the mouse neonatal Fc
Receptor.
Isolated variant: The term "isolated variant" means a variant that is modified by the hand of man and separated completely or partially from at least one component with which it naturally occurs. In one aspect, the variant is at least 1 % pure, e.g., at least 5% pure, at least 10% pure, at least 20% pure, at least 40% pure, at least 60% pure, at least 80% pure, and at least 90% pure, as determined by SDS-PAGE or GP-HPLC.
Substantially pure variant: The term "substantially pure variant" means a preparation that contains at most 10%, at most 8%, at most 6%, at most 5%, at most 4%, at most 3%, at most 2%, at most 1 %, and at most 0.5% by weight of other polypeptide material with which it is natively or recombinantly associated. Preferably, the variant is at least 92% pure, e.g., at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99%, at least 99.5% pure, and 100% pure by weight of the total polypeptide material present in the preparation. The variants of the present invention are preferably in a substantially pure form. This can be accomplished, for example, by preparing the variant by well known recombinant methods and by purification methods.
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 1 to 585 of SEQ ID NO: 2, with the inclusion of any post-translational modifications.
Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature albumin polypeptide. In one aspect, the mature polypeptide coding sequence is nucleotides 1 to 1758 of SEQ ID NO: 1 .
Sequence Identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".
For purposes of the present invention, the degree of sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et ai, 2000, Trends Genet. 16: 276-277), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSU M62 (EMBOSS version of BLOSU M62) substitution matrix. The output of Needle labelled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment)
For purposes of the present invention, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides x 100)/(Length of Alignment - Total Number of Gaps in Alignment) Fragment: The term "fragment" means a polypeptide having one or more (several) amino acids deleted from the amino and/or carboxyl terminus of an albumin and/or an internal region of albumin that has retained the ability to bind to FcRn. Fragments may consist of one uninterrupted sequence derived from HSA or it may comprise two or more sequences derived from HSA. The fragments according to the invention have a size of more than approximately 20 amino acid residues, preferably more than 30 amino acid residues, more preferred more than 40 amino acid residues, more preferred more than 50 amino acid residues, more preferred more than 75 amino acid residues, more preferred more than 100 amino acid residues, more preferred more than 200 amino acid residues, more preferred more than 300 amino acid residues, even more preferred more than 400 amino acid residues and most preferred more than 500 amino acid residues.
Allelic variant: The term "allelic variant" means any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of its translated polypeptide product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with the ATG start codon or alternative start codons such as GTG and TTG and ends with a stop codon such as TAA, TAG, and TGA. The coding sequence may be a DNA, cDNA, synthetic, or recombinant polynucleotide.
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.
Control sequences: The term "control sequences" means all components necessary for the expression of a polynucleotide encoding a variant of the present invention. Each control sequence may be native or foreign to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences within the coding region of the polynucleotide encoding a variant.
Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.
Expression: The term "expression" includes any step involved in the production of the variant including, but not limited to, transcription, post-transcriptional modification, translation, post- translational modification, and secretion.
Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to additional nucleotides that provide for its expression.
Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, and the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
Plasma half-life: Plasma half-life is ideally determined in vivo in suitable individuals. However, since it is time consuming and expensive and there inevitable are ethical concerns connected with doing experiments in animals or man it is desirable to use an in vitro assay for determining whether plasma half-life is extended or reduced. It is known that the binding of albumin to its receptor FcRn is important for plasma half-life and the correlation between receptor binding and plasma half-life is that a higher affinity of albumin to its receptor leads to longer plasma half-life. Thus for the present invention a higher affinity of albumin to FcRn is considered indicative of an increased plasma half-life and a lower affinity of albumin to its receptor is considered indicative of a reduced plasma half-life.
In this application and claims the binding of albumin to its receptor FcRn is described using the term affinity and the expressions "stronger" or "weaker". Thus, it should be understood that a molecule having a higher affinity to FcRn than HSA is considered to bind stronger to FcRn than HSA and a molecule having a lower affinity to FcRn than HSA is considered to bind weaker to FcRn than HSA.
The terms "longer plasma half-life" or "shorter plasma half-life" and similar expressions are understood to be in relationship to the corresponding parent albumin molecule. Thus, a longer plasma half-life with respect to a variant albumin of the invention means that the variant has longer plasma half-life than the corresponding albumin having the same sequences except for the alteration(s) in positions corresponding to 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2.
Conventions for Designation of Variants
For purposes of the present invention, the mature polypeptide disclosed in SEQ ID NO: 2 is used to determine the corresponding amino acid residue in another albumin. The amino acid sequence of another albumin is aligned with the mature polypeptide disclosed in SEQ ID NO: 2, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide disclosed in SEQ ID NO: 2 is determined using the Needleman- Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 3.0.0 or later.
Identification of the corresponding amino acid residue in another albumin can be confirmed by an alignment of multiple polypeptide sequences using "ClustalW" (Larkin et al., 2007, Bioinformatics 23: 2947-2948).
When the other polypeptide (or protein) has diverged from the mature polypeptide of SEQ ID NO: 2 such that traditional sequence-based comparison fails to detect their relationship (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615), other pairwise sequence comparison algorithms can be used. Greater sensitivity in sequence-based searching can be attained using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and is capable of detecting remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has one or more representatives in the protein structure databases. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-81 5; McGuffi n and Jones , 2003 , Bioinformatics 19: 874-881 ) utilize information from a variety of sources (PSI-BLAST, secondary structure prediction, structural alignment profiles, and solvation potentials) as inputs to a neural network that predicts the structural fold for a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919, can be used to align a sequence of unknown structure within the superfamily models present in the SCOP database. These alignments can in turn be used to generate homology models for the polypeptide, and such models can be assessed for accuracy using a variety of tools developed for that purpose.
For proteins of known structure, several tools and resources are available for retrieving and generating structural alignments. For example the SCOP superfamilies of proteins have been structurally aligned, and those alignments are accessible and downloadable. Two or more protein structures can be aligned using a variety of algorithms such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11 : 739-747), and implementations of these algorithms can additionally be utilized to query structure databases with a structure of interest in order to discover possible structural homologs (e.g., Holm and Park, 2000, Bioinformatics 16: 566-567).
In describing the albumin variants of the present invention, the nomenclature described below is adapted for ease of reference. The accepted lUPAC single letter or three letter amino acid abbreviation is employed.
Substitutions. For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, for example the substitution of threonine with alanine at position 226 is designated as "Thr226Ala" or "T226A". Multiple mutations are separated by addition marks ("+"), e.g., "Gly205Arg + Ser41 1 Phe" or "G205R + S41 1 F", representing substitutions at positions 205 and 41 1 of glycine (G) with arginine (R) and serine (S) with phenylalanine (F), respectively. The Figures also use ("/"), e.g., "E492T/N503D" this should be viewed as interchangeable with ("+").
Deletions. For an amino acid deletion, the following nomenclature is used: Original amino acid, position*. Accordingly, the deletion of glycine at position 195 is designated as "Gly195*" or "G195*". Multiple deletions are separated by addition marks ("+"), e.g., "Gly195* + Ser41 1 *" or "G195* + S41 1 *". Insertions. For an amino acid insertion, the following nomenclature is used: Original amino acid, position, original amino acid, inserted amino acid. Accordingly the insertion of lysine after glycine at position 195 is designated "Gly195Glyl_ys" or "G195GK". An insertion of multiple amino acids is designated [Original amino acid, position, original amino acid, inserted amino acid #1 , inserted amino acid #2; etc.]. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as "Gly195Glyl_ysAla" or "G195GKA".
In such cases the inserted amino acid residue(s) are numbered by the addition of lower case letters to the position number of the amino acid residue preceding the inserted amino acid residue(s). In the above example, the sequence would thus be:
Figure imgf000014_0001
Multiple alterations. Variants comprising multiple alterations are separated by addition marks ("+"), e.g., "Arg170Tyr+Gly195Glu" or "R1 70Y+G 195E" representing a substitution of tyrosine and glutamic acid for arginine and glycine at positions 170 and 195, respectively.
Different substitutions. Where different substitutions can be introduced at a position, the different substitutions are separated by a comma, e.g., "Arg170Tyr,Glu" represents a substitution of arginine with tyrosine or glutamic acid at position 170. Thus, "Tyr167Gly,Ala + Arg170Gly,Ala" designates the following variants:
"Tyr 1 67 G ly + Arg 1 70 G l y" , "Tyr 1 67 G l y + Arg 1 70Al a " , "Ty r 1 67Al a +Arg 1 70 G l y" , a n d "Tyr167Ala+Arg170Ala".
Parent albumin
Albumins are proteins and constitute the most abundant protein in plasma in mammals and albumins from a long number of mammals have been characterized by biochemical methods and/or by sequence information. Several albumins, e.g., human serum albumin (HSA), have also been characterized crystallographically and the structure determined.
HSA is a preferred albumin according to the invention and is a protein consisting of 585 amino acid residues and has a molecular weight of 67 kDa. In its natural form it is not glycosylated. The amino acid sequence of HSA is shown in SEQ ID NO: 2. The skilled person will appreciate that natural alleles may exist having essentially the same properties as HSA but having one or more amino acid changes compared to SEQ ID NO: 2, and the inventors also contemplate the use of such natural alleles as parent albumin according to the invention. Albumins have generally a long plasma half-life of approximately 20 days or longer, e.g., HSA has a plasma half-life of 19 days. It is known that the long plasma half-life of HSA is mediated via interaction with its receptor FcRn, however, an understanding or knowledge of the exact mechanism behind the long half-life of HSA is not essential for the present invention.
According to the invention the term "albumin" means a protein having the same, or very similar three dimensional structure as HSA and having a long plasma half-life. As examples of albumin proteins according to the invention can be mentioned human serum albumin, primate serum albumin, (such as chimpanzee serum albumin, gorilla serum albumin), rodent serum albumin (such as hamster serum albumin, guinea pig serum albumin, mouse albumin and rat serum albumin), bovine serum albumin, equine serum albumin, donkey serum albumin, rabbit serum albumin, goat serum albumin, sheep serum albumin, dog serum albumin, chicken serum albumin and pig serum albumin. HSA as disclosed in SEQ ID NO: 2 or any naturally occurring allele thereof, is the preferred albumin according to the invention.
The parent albumin, a fragment thereof, or albumin part of a fusion polypeptide comprising albumin or a fragment thereof according to the invention has generally a sequence identity to the sequence of HSA shown in SEQ ID NO: 2 of at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 86%, preferably at least 87%, preferably at least 88%, preferably at least 89%, preferably at least 90%, preferably at least 91 %, preferably at least 92%, preferably at least 93%, preferably at least 94%, preferably at least 95%, more preferred at least 96%, more preferred at least 97%, more preferred at least 98% and most preferred at least 99%.
The parent preferably comprises or consists of the amino acid sequence of SEQ ID NO: 2. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2.
In another embodiment, the parent is an allelic variant of the mature polypeptide of SEQ ID NO: 2.
In a second aspect, the parent is encoded by a polynucleotide that hybridizes under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , (ii) the mature polypeptide coding sequence of SEQ ID NO: 1 , or (iii) the full-length complementary strand of (i) or (ii) (J. Sambrook, E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
The polynucleotide of SEQ ID NO: 1 or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or a fragment thereof, may be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 14, e.g., at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labelled for detecting the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.
A genomic DNA or cDNA library prepared from such other organisms may be screened for DNA that hybridizes with the probes described above and encodes a parent. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that is homologous with SEQ ID NO: 1 or a subsequence thereof, the carrier material is used in a Southern blot.
For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labelled nucleotide probe corresponding to the polynucleotide shown in SEQ ID NO: 1 , its complementary strand, or a subsequence thereof, under low to very high stringency conditions. Molecules to which the probe hybridizes can be detected using, for example, X-ray film or any other detection means known in the art.
In one aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 1. In another aspect, the nucleic acid probe is nucleotides 1 to 1785 of SEQ ID NO: 1 . In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2 or a fragment thereof. In another aspect, the nucleic acid probe is SEQ ID NO: 1 .
For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formam ide for mediu m and mediu m-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45°C (very low stringency), 50°C (low stringency), 55°C (medium stringency), 60°C (medium-high stringency), 65°C (high stringency), or 70°C (very high stringency). For short probes that are about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as prehybridization and hybridization at about 5°C to about 10°C below the calculated Tm using the calculation according to Bolton and McCarthy (1962, Proc. Natl. Acad. Sci. USA 48: 1390) in 0.9 M NaCI, 0.09 M Tris-HCI pH 7.6, 6 mM EDTA, 0.5% NP-40, 1X Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed once in 6X SCC plus 0.1 % SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5°C to 10°C below the calculated Tm.
In a third aspect, the parent is encoded by a polynucleotide with a sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1 of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which encodes a polypeptide which is able to function as an albumin. In an embodiment, the parent is encoded by a polynucleotide comprising or consisting of SEQ ID NO: 1.
Preparation of Variants
In a further aspect the invention relates to a method for preparing a variant albumin, fragment thereof, or fusion polypeptide comprising variant albumin or a fragment thereof comprising the steps of:
a. Identifying one or more amino acid residue positions being important for the binding of albumin to FcRn, in an albumin or a fragment thereof or the albumin part of a fusion polypeptide comprising albumin or a fragment thereof;
b. Providing a nucleic acid encoding said albumin, the fragment thereof or the albumin part of a fusion polypeptide comprising albumin or the fragment thereof;
c. Modifying the nucleic acid provided in b., so that the one or more (several) amino acid residue located at the positions identified in a., are deleted or substituted or inserted with a different amino acid;
d. Expressing the modified nucleic acid in a suitable host cell; and
e. Recovering the variant albumin, the fragment thereof or the fusion polypeptide comprising variant albumin or the fragment thereof.
The identification of one or more amino acid residue positions being important for the binding of albumin to FcRn, in albumin, fragment thereof or the albumin part of a fusion polypeptide can be done in several ways including, but not limited to, random mutagenesis followed by analysis of the generated mutants and comparison with the non-mutated parent molecule, and identification based on structural considerations optionally followed by generation of variants having the identified alterations and comparison with the non-mutated patent molecule.
A preferred method for identification of one or more amino acid residue positions to be changed to in order to prepare a variant HSA having an altered binding to FcRn compared with natural HSA, comprises the following steps:
i) Identifying a non-human albumin having a different binding property to FcRn;
ii) Identifying the amino acid residues of the human serum albumin interacting with FcRn;
iii) Comparing the primary and/or the tertiary structure of the identified non-human albumin and human serum albumin with respect to the amino acid residues identified in step ii) and identifying the amino acid residues that differ between said non-human albumin and human serum albumin as being responsible for the observed binding difference; and
iv) Optionally preparing variants of HSA at the positions identified in step iii) and confirming that the prepared variants have altered binding to FcRn compared with
HSA.
Step i) above may be done using the SPR assay described below. However, the skilled person will appreciate that other methods may be used to identify non-human albumins having different binding properties to FcRn than HSA, and that the method is not dependent on how the non- human albumin, having different binding properties to FcRn, has been identified.
In one preferred embodiment the identified non-human albumin has a stronger binding to FcRn than HSA. Examples of non-human albumins having stronger binding to FcRn than HSA include donkey serum albumin, rabbit serum albumin, dog serum albumin, hamster serum albumin, guinea pig serum albumin, mouse serum albumin and rat serum albumin. Step ii) may be accomplished by considering the structure of FcRn, HSA and the binding complex of these two. In the absence of an available structure of the binding complex it is possible to use a model where the HSA structure is docked into the structure of the FcRn structure and thereby identify amino acid residues of HSA interacting with FcRn.
In another preferred embodiment the identified non-human albumin has a weaker binding to FcRn than HSA. Examples of non-human albumins having weaker binding to FcRn than HSA include bovine serum albumin, goat serum albumin, sheep serum albumin and chicken serum albumin. Step ii) may be accomplished by considering the structure of FcRn, HSA and the binding complex of these two. In absence of an available structure of the binding complex it is possible to use a model where the HSA structure is docked into the structure of the FcRn structure and thereby identify residues of HSA interacting with FcRn. I n this invention and claims, an amino acid residues of HSA interacting with FcRn is considered any amino acid residues of HSA being located less than l OA from an amino acid in the FcRn or any amino acid residue that is involved in a hydrogen bond, a salt bridge or a polar or nonpolar interaction with an amino acid residue that is located less than l OA from an amino acid in the FcRn. Preferably the amino acid in HSA residues are located less than l OA from amino acids in the FcRn, more preferred less than 6A from amino acids in the FcRn and most preferred less than 3A from amino acids in the FcRn.
Step iii) and iv) can be done using techniques well known to the skilled person.
The present invention also relates to methods for obtaining a variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof, or associates of variant albumin or fragment thereof comprising: (a) introducing into a parent albumin or fragments thereof, or fusion polypeptides comprising the parent albumin or fragments thereof an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of the mature polypeptide of SEQ I D NO: 2; and (b) recovering the variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof.
The variants can be prepared by those skilled persons using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.
Site-directed mutagenesis is a technique in which one or more (several) mutations are created at one or more defined sites in a polynucleotide encoding the parent.
Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests at the plasmid and the oligonucleotide is the same, permitting ligation of the plasmid and insert to one another. See, e.g., Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76: 4949- 4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.
Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004/0171 154; Storici et al., 2001 , Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16. Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.
Synthetic gene construction entails in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed utilizing a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies wherein olgionucleotides are synthesized and assembled upon photo-programable microfluidic chips.
Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).
Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
Semi-synthetic gene construction is accomplished by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling. Semisynthetic constuction is typified by a process utilizing polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes may th us be synthesized de novo, while other regions may be amplified using site-specific mutagenic primers, while yet other regions may be subjected to error-prone PCR or non-error prone PCR amplification. Polynucleotide sub sequences may then be shuffled. Variants
The present invention also provides variant albumins or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof, of a parent albumin, comprising an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2, wherein each alteration is independently a substitution, insertion or deletion with the provision that the and the variant is not SEQ ID NO: 2 having the substitution D494N, E501 K, K541 E, D550GA K573E or K574N..
The variant albumin, a fragment thereof, or albumin part of a fusion polypeptide comprising variant albumin or a fragment thereof according to the invention has generally a sequence identity the sequence of HSA shown in SEQ ID NO: 2 of at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90 %, more preferred at least 95%, more preferred at least 96%, more preferred at least 97%, more preferred at least 98% and most preferred at least 99%.
In one aspect, the number of alterations in the variants of the present invention is 1 -20, e.g.,
1 -10 and 1 -5, such as 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 alterations.
The variant albumin, a fragment thereof or fusion polypeptide comprising the variant albumin or fragment thereof has altered plasma half-life compared with the corresponding parent albumin, fragment thereof, or fusion polypeptide comprising the variant albumin or fragment thereof.
In a particular preferred embodiment the parent albumin is HSA and the variant albumin, a fragment thereof or fusion polypeptide comprising the variant albumin or fragment thereof has altered plasma half-life compared with the HSA, the corresponding fragment or fusion polypeptide comprising HSA or fragment thereof.
The correlation between binding of albumin to its receptor and plasma half-life has been realized by the present inventors based on the natural occurring allele of HSA D494N. The inventors have analyzed this allele and found that it has a lower affinity to its receptor FcRn.
Further, it has been disclosed that a transgenic mouse having the natural mouse FcRn replaced with human FcRn has a higher serum albumin level than normal mouse; see (J Exp Med. (2003) 197(3):315-22). The inventors have discovered that human FcRn has a higher affinity to mouse serum albumin than mouse FcRn has to mouse serum albumin and, therefore, the observed increase in serum albumin in the transgenic mice corresponds with a higher affinity between serum albumin and its receptor, confirming the correlation between albumin binding to FcRn and plasma half-life. In addition, variants of albumin that have little or no binding to FcRn have been shown to have reduced half-life in a mouse model, Kenanova et al (2009) J. Nucl. Med.; 50 (Supplement 2):1582).
One way to determine whether the affinity of a variant albumin to FcRn is higher or lower than the parent albumin is to use the Surface Plasmon Resonance assay (SPR) as described below. The skilled person will understand that other methods might be useful to determine whether the affinity of a variant albumin to FcRn is higher or lower than the affinity of the parent albumin to FcRn, e.g., determination and comparison of the binding constants KD. Thus, according to the invention variant albumins having a KD that is lower than the KD for natural HSA is considered to have a higher plasma half-life than HSA and variant albumins having a KD that is higher than the KD for natural HSA is considered to have a lower plasma half-life than HSA.
The variants of albumin or fragments thereof or fusion polypeptides comprising albumin or fragments thereof comprise one or more alterations, such as substitutions, deletions or insertions at one or more (several) positions corresponding to the positions in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584. The substitution may be any substitution where the amino acid in the natural albumin sequence is substituted with a different amino acid selected among the remaining 19 natural occurring amino acids.
In one aspect, a variant comprises an alteration at one or more (several) positions corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2. In another aspect, a variant comprises an alteration at two positions corresponding to any of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2. I n another aspect, a variant comprises an alteration at three positions corresponding to any of positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2. In another aspect, a variant comprises an alteration at each position corresponding to positions 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2.
In another aspect, the variant comprises the substitution Q417A,H of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution H440Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution H464Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A490D of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E492G, Τ,Ρ,Η of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution V493P,L of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution D494N,Q,A,E,P of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E495Q,A of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution T496A of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution P499A of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K500E,G,D,A,S,C,P,H,F,N,W,T,M,Y,V,Q,L,I,R of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E501 A,P,Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution N503K,D,H of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A504E of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E505K, D of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution T506F, S of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution H510Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution H535Q of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K536A of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution P537A of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K538A,H of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution T540S of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K541A,D,G,N,E of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution E542P,D of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution D550N of the mature polypeptide of SEQ ID NO: 2. In a n o t h e r a s p e c t , t h e v a r i a n t c o m p r i s e s t h e s u b s t i t u t i o n K573Y,W,P,H,F,V,I,T,N,S,G,M,C,A,E,Q,R,L,D of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution K574N of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution L575F of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A577T,E of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A578R,S of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution S579C,T of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution A581 D of the mature polypeptide of SEQ I D NO: 2. I n another aspect, the variant comprises the substitution A582T of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the substitution G584A of the mature polypeptide of SEQ ID NO: 2.
In one aspect, the variant comprises an alteration at a position corresponding to position 417. In another aspect, the amino acid at a position corresponding to position 417 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala or His. In another aspect, the variant comprises the substitution Q417A, H of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 440. In another aspect, the amino acid at a position corresponding to position 440 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution H440Q of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 464. In another aspect, the amino acid at a position corresponding to position 464 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution H464Q of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 490 In another aspect, the amino acid at a position corresponding to position 490 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the substitution A490G of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 492. In another aspect, the amino acid at a position corresponding to position 492 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly. In another aspect, the variant comprises the substitution E492G of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 493. In another aspect, the amino acid at a position corresponding to position 493 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Pro. In another aspect, the variant comprises the substitution V493P of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 494. In another aspect, the amino acid at a position corresponding to position 494 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn, Gin or Ala. In another aspect, the variant comprises the substitution D494N,Q, A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 495. In another aspect, the amino acid at a position corresponding to position 495 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gin or Ala. In another aspect, the variant comprises the substitution E495Q or A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 496. In another aspect, the amino acid at a position corresponding to position 496 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution T496A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 499. In another aspect, the amino acid at a position corresponding to position 499 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution P499A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 500. In another aspect, the amino acid at a position corresponding to position 500 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution K500E,G,D,A,S,C,P,H,F,N,W,T,M,Y,V,Q,L,I,R of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 501 . In another aspect, the amino acid at a position corresponding to position 501 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala or Gin to reduce affinity and Pro to increase affinity. In another aspect, the variant comprises the substitution E501A, Q, P of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 503. In another aspect, the amino acid at a position corresponding to position 503 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp or Lys or His. In another aspect, the variant comprises the substitution N503D, K, H of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 504. In another aspect, the amino acid at a position corresponding to position 504 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the substitution A504 of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 505. In another aspect, the amino acid at a position corresponding to position 505 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the substitution E505D of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 506. In another aspect, the amino acid at a position corresponding to position 506 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the substitution T506S,F of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 510. In another aspect, the amino acid at a position corresponding to position 510 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gin. In another aspect, the variant comprises the substitution H510Q of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 535. In another aspect, the amino acid at a position corresponding to position 535 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gin. In another aspect, the variant comprises the substitution H535Q of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 536. In another aspect, the amino acid at a position corresponding to position 536 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution K536A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 537. In another aspect, the amino acid at a position corresponding to position 537 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution P537A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 538. In another aspect, the amino acid at a position corresponding to position 538 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution K538H, A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 540. In another aspect, the amino acid at a position corresponding to position 540 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val. In another aspect, the variant comprises the substitution T540S of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 541 . In another aspect, the amino acid at a position corresponding to position 541 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly, Asp or Ala. In another aspect, the variant comprises the substitution K541 G, D A, N of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 542. In another aspect, the amino acid at a position corresponding to position 542 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp or Pro. In another aspect, the variant comprises the substitution E542D, P of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 550. In another aspect, the amino acid at a position corresponding to position 550 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn to reduce affinity, preferably with Glu to increase affinity.
In another aspect, the variant comprises an alteration at a position corresponding to position 573. In another aspect, the amino acid at a position corresponding to position 573 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Tyr, Trp, Pro, His. Phe, Val, lie, Thr, Asn, Ser, Gly, Met, Cys, Ala, Glu, Gin, Arg, Leu, Asp. In another aspect, the variant comprises the substitution K573Y,W,P,H,F,V,I,T,N,S,G,M,C,A,E,Q,R,L,D of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 574. In another aspect, the amino acid at a position corresponding to position 574 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn. In another aspect, the variant comprises the substitution K574N of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 575. In another aspect, the amino acid at a position corresponding to position 575 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Phe. In another aspect, the variant comprises the substitution L575F of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 577. In another aspect, the amino acid at a position corresponding to position 577 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Thr or Glu. In another aspect, the variant comprises the substitution A577TE of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 578. In another aspect, the amino acid at a position corresponding to position 578 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg or Ser. In another aspect, the variant comprises the substitution A578R,S of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 579. In another aspect, the amino acid at a position corresponding to position 579 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Cys or Thr. In another aspect, the variant comprises the substitution S579C,T of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 580. In another aspect, the amino acid at a position corresponding to position 580 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Lys. In another aspect, the variant comprises the substitution Q580K of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 581 . In another aspect, the amino acid at a position corresponding to position 581 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp. In another aspect, the variant comprises the substitution A581 D of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 582. In another aspect, the amino acid at a position corresponding to position 582 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Thr. In another aspect, the variant comprises the substitution A582T of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at a position corresponding to position 584. In another aspect, the amino acid at a position corresponding to position 584 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, lie, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises the substitution G584A of the mature polypeptide of SEQ ID NO: 2.
In another aspect, the variant comprises an alteration at positions corresponding to positions 494 and 496 in SEQ ID NO: 2, such as those described above. In another aspect, the variant comprises alterations at positions corresponding to positions 492 and 493 in SEQ ID NO: 2, such as those described above.
In another aspect, the variant comprises alterations at positions corresponding to positions 494 and 417 in SEQ ID NO: 2, such as those described above.
In another aspect, the variant comprises alterations at positions corresponding to positions
492 and 503 in SEQ ID NO: 2, such as those described above.
In another aspect, the variant comprises alterations at positions corresponding to positions 492 and 573 in SEQ ID NO: 2, such as those described above.
In another aspect, the variant comprises alterations at positions corresponding to positions 492, 503, and 573 in SEQ ID NO: 2, such as those described above.
In one embodiment the variant albumin or fragments thereof, or fusion polypeptides comprising the variant albumin or fragments thereof according to the invention contains one substitution at a position corresponding to a position in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 in SEQ ID NO: 2 provided that the variant albumin is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501 K, K541 E, D550G,A, K573E or K574N. The variant albumin, fragment thereof or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention may comprise additional substitutions, insertions or deletions at one or more (several) positions corresponding to other positions in HSA.
In another embodiment the variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention contains two, three, four, five , six, seven, eight, nine, ten, eleven, twelve , thirteen, fourteen fifteen, sixteen, seventeen, eighteen, nineteen twenty or even more substitutions at positions corresponding to positions in HSA selected from the group consisting of 417, 440, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 575, 577, 578, 579, 580, 581 , 582 and 584 of SEQ ID NO: 2. The variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention may comprise additional substitutions, insertions or deletions at positions corresponding to other positions in HSA.
In a further embodiment the variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention have a plasma half-life that is longer than the plasma half-life of the parent albumin fragment thereof or fusion polypeptide comprising the parent albumin or a fragment thereof. Examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof comprising a substitution in the position corresponding to 492, 503, 542, 550, 573, 574, 580, 581 , 582 or 584 in SEQ ID NO: 2. Preferred substitutions according to this embodiment of the invention include the substitution of the amino acid residue in the position corresponding to 492 in SEQ ID NO: 2 with a G residue, substitution of the amino acid residue in the position corresponding to 503 in SEQ I D NO: 2 with a H or a K residue, substitution of the amino acid residue in the position corresponding to 550 in SEQ ID NO: 2 with an E residue, the substitution of the amino acid residue in a position corresponding to 573 in SEQ ID NO: 2 with an Y,W,P,H,F,V,I,T,N,S,G,M,C,A,E,Q,R,L or a D, the substitution of the amino acid residue in a position corresponding to 574 in SEQ ID NO: 2 with an N residue, or the substitution of the amino acid residue in the position corresponding to 580 in SEQ I D NO: 2 with an K residue. Other preferred variants have a substitution in the position corresponding to 492 in SEQ ID NO: 2 with a G residue and a substitution in the position corresponding to 573 in SEQ ID NO: 2 with an A or a P residue. Other preferred variant has a number of substitutions corresponding to position 492 in SEQ ID NO: 2 with an H residue in position 503 in SEQ ID NO: 2.
Other preferred variants have a substitution in the position corresponding to 492 in SEQ ID
NO: 2 with a G residue and a substitution in the position corresponding to position 503 in SEQ ID NO: 2 corresponding to a H or a K and a substitution in position 573 in SEQ ID NO: 2 with an A or a P residue.
In a further embodiment the variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention have a plasma half-life that is shorter than the plasma half-life of the parent albumin fragment thereof or fusion polypeptide comprising the parent albumin or a fragment thereof. Examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof comprising a substitution in the position corresponding to 417, 440, 494, 495, 496, 499, 500, 501 , 536, 537, 538, 541 , 494+496 or 492+493 in SEQ I D NO: 2. Preferred substitutions include the substitutions corresponding to Q417A, H440Q, D494E+Q417H, D494N,Q,A, E495Q,A, T496A, D494N+T496A or, P499A, K500A, E501A , E501 Q, K536A, P537A , K538A, K541 G, K541A K541 D or D550N in SEQ ID NO: 2.
In another embodiment of the invention the variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or a fragment thereof according to the invention have lost their ability to bind FcRn. In this connection variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof is considered to have lost the ability to bind FcRn if the measured resonance units for the variant in the SPR assay described below is less than 10% of the measured resonance units for the corresponding parent albumin or fragment thereof. Examples according to this embodiment include variants of albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof comprising a substitution at a position corresponding to 464, 500, 510 or 535 in SEQ ID NO: 2. Preferred substitutions include the substitutions corresponding to H464Q, K500A,P,C,S,A,D.G H510Q or H535Q in SEQ ID NO: 2.
In addition to the one or more substitutions at one or more positions corresponding to positions 417, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574, 580 581 , 582 and 584 in SEQ ID NO: 2 the variant albumin or fragments thereof, or fusion polypeptides comprising variant albumin or fragments thereof according to the invention may contain additional substitutions, deletions or insertions in other positions of the molecules. Such additional substitutions, deletions or insertions may be useful in order to alter other properties of the molecules such as but not limited to altered glycosylation; introduction of reactive groups of the surface such a thiol groups, removing/generating a carbamoylation site; etc.
Residues that might be altered in order to provide reactive residues on the surface and which advantageously could be applied to the present invention has been disclosed in the unpublished patent application WO 2010/092135 (Included by reference). Particular preferred residues include the positions corresponding to positions in SEQ ID NO: 2 .
As examples of alterations that can be made in SEQ ID NO: 2 or in corresponding positions in other albumins in order to provide a reactive thiol group on the surface includes alterations corresponding to following alterations in SEQ ID NO: 2: L585C, D1 C, A2C, D562C, A364C, A504C, E505C, T79C, E86C, D129C, D549C, A581 C, D121 C, E82C, S270C, A578C, L595LC, D1 DC, A2AC, D562DC, A364AC, A504AC, E505EC, T79TC, E86EC, D129DC, D549DC, A581AC, A581AC, D121 DC, E82EC, S270SC, A579AC, C360*, C316*, C75*, C168*, C558*, C361 *, C91 *, C124*, C169* and C567*. Alternatively a cysteine residue may be added to the N or C terminal of albumin.
Polynucleotides
The present invention also relates to isolated polynucleotides that encode any of the variants of the present invention.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. A polynucleotide may be manipulated in a variety of ways to provide for expression of a variant. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
The control sequence may be a promoter sequence, which is recognized by a host cell for expression of the polynucleotide. The promoter sequence contains transcriptional control sequences that mediate the expression of the variant. The promoter may be any nucleic acid sequence that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1 ), Saccharomyces cerevisiae protease A (PRA1 ), Saccharomyces cerevisiae protease B (PRB1 ), Saccharomyces cerevisiae translation elongation factor (TEF1 ), Saccharomyces cerevisiae translation elongation factor (TEF2), Saccharomyces cerevisiae galactokinase (GAL1 ), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde- 3-phosphate dehydrogenase (ADH1 , ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1 ), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.
The control sequence may also be a suitable transcription terminator sequence, which is recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3'-terminus of the polynucleotide encoding the variant. Any terminator that is functional in the host cell may be used.
Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1 ), Saccharomyces cerevisiae alcohol dehydrogenase (ADH1 ) and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5'-terminus of the polynucleotide encoding the variant. Any leader sequence that is functional in the host cell may be used.
Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1 ), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the variant-encoding sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.
The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant into the cell's secretory pathway. The 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the variant. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding region that is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the variant. However, any signal peptide coding region that directs the expressed variant into the secretory pathway of a host cell may be used.
Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.
Where both signal peptide and propeptide regions are present at the N-terminus of a variant, the propeptide region is positioned next to the N-terminus of the variant and the signal peptide region is positioned next to the N-terminus of the propeptide region.
Methods of Production
The variants of the present invention can be prepared using techniques well known to the skilled person. One convenient way is by cloning nucleic acid encoding the parent albumin or a fragment thereof or fusion polypeptide comprising albumin or a fragment thereof, modifying said nucleic acid to introduce the desired substitution(s) at one or more (several) positions corresponding to positions 417, 464, 490, 492, 493, 494, 495, 496, 499, 500, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 550, 573, 574 and 580 in SEQ ID NO: 2, where the variant is not the variant consisting of SEQ ID NO:2 with the substitution D494N, E501 K, K541 E, D550G,A, K573E or K574N., preparing a suitable genetic construct where the modified nucleic acid is placed in operative connection with suitable regulatory genetic elements, such as promoter, terminator, activation sites, ribosome binding sites etc., introducing the genetic construct into a suitable host organism, culturing the transformed host organism under conditions leading to expression of the variant and recovering the variant. All these techniques are known in the art and it is within the skills of the average practitioner to design a suitable method for preparing a particular variant according to the invention.
The variant polypeptide of the invention may also be connected to a signal sequence in order to have the variant polypeptide secreted into the growth medium during culturing of the transformed host organism. It is generally advantageous to have the variant polypeptide secreted into the growth medium in order to ease recovery and purification.
Techniques for preparing variant polypeptides have also been disclosed in WO 2009019314 (included by reference) and these techniques may also be applied to the present invention.
Albumins have been successfully expressed as recombinant proteins in a range of hosts including fungi (including but not limited to Aspergillus (WO06066595), Kluyveromyces (Fleer 1991 , Bio/technology 9, 968-975), Pichia (Kobayashi 1998 Therapeutic Apheresis 2, 257-262) and Saccharomyces (Sleep 1990, Bio/technology 8, 42-46)), bacteria (Pandjaitab 2000, J. Allergy Clin. Immunol. 105, 279-285)), animals (Barash 1993, Transgenic Research 2, 266-276) and plants (including but not limited to potato and tobacco (Sijmons 1990, Bio/technology 8, 217 and Farran 2002, Transgenic Research 11 , 337-346). The variant polypeptide of the invention is preferably produced recombinantly in a suitable host cell. In principle any host cell capable of producing a polypeptide in suitable amounts may be used and it is within the skills of the average practitioner to select a suitable host cell according to the invention. A preferred host organism is yeast, preferably selected among Saccharomycacae, more preferred Saccharomyces cerevisiae.
The variant polypeptides of the invention may be recovered and purified from the growth medium using a combination of known separation techniques such as filtration, centrifugation, chromatography, and affinity separation techniques etc. It is within the skills of the average practitioner to purify the variants of the invention using a particular combination of such known separation steps. As an example of purification techniques that may be applied to the variants of the present invention can be mentioned the teaching of WO0044772.
The variant polypeptides of the invention may be used for delivering a therapeutically beneficial compound to an animal or a human individual in need thereof. Such therapeutically beneficial compounds include, but are not limited, to labels and readily detectable compounds for use in diagnostics, such as various imaging techniques; pharmaceutical active compounds such as drugs, or specifically binding moieties such as antibodies. The variants of the invention may even be connected to two or more different therapeutically beneficial compounds, e.g., an antibody and a drug, which gives the combined molecule the ability to bind specifically to a desired target and thereby provide a high concentration of the connected drug at that particular target.
Fusion polypeptides
The variants of albumin or fragments thereof according to the invention may also be fused with a non-albumin polypeptide fusion partner. The fusion partner may in principle be any polypeptide but generally it is preferred that the fusion partner is a polypeptide having therapeutic or diagnostic properties. Fusion polypeptides comprising albumin or fragments thereof are known in the art. It has been found that such fusion polypeptide comprising albumin or a fragment thereof and a fusion partner polypeptide have a longer plasma half-life compared to the unfused fusion partner polypeptide. According to the invention it is possible to alter the plasma half-life of the fusion polypeptides according to the invention compared to the corresponding fusion polypeptides of the prior art.
One or more therapeutic polypeptides may be fused to the N-terminus, the C-terminus of albumin, inserted into a loop in the albumin structure or any combination thereof. It may or it may not comprise linker sequences separating the various components of the fusion polypeptide.
Teachings relating to fusions of albumin or a fragment thereof are known in the art and the skilled person will appreciate that such teachings can also be applied to the present invention. WO 2001/79271 A and WO 2003/59934 A also contain examples of therapeutic polypeptides that may be fused to albumin or fragments thereof, and these examples apply also to the present invention.
Conjugates
The variants of albumin or fragments thereof according to the invention may be conjugated to a second molecule using techniques known within the art. Said second molecule may comprise a diagnostic moiety, and in this embodiment the conjugate may be useful as a diagnostic tool such as in imaging; or the second molecule may be a therapeutic compound and in this embodiment the conjugate may be used for therapeutic purposes where the conjugate will have the therapeutic properties of the therapeutic compound as well as the long plasma half-life of the albumin. Conjugates of albumin and a therapeutic molecule are known in the art and it has been verified that such conjugates have long plasma half-life compared with the non-conjugated, free therapeutic molecule as such. The conjugates may conveniently be linked via a free thio group present on the surface of HSA (amino acid residue 34 of mature HSA) using well known chemistry.
In one particular preferred aspect the variant albumin or fragment thereof is conjugated to a beneficial therapeutic compound and the conjugate is used for treatment of a condition in a patient in need thereof, which condition is responsive to the particular selected therapeutic compound. Techniques for conjugating such a therapeutically compound to the variant albumin or fragment thereof are known in the art. WO 2009/019314 discloses examples of techniques suitable for conjugating a therapeutically compound to a polypeptide which techniques can also be applied to the present invention. Further WO 2009/019314 discloses examples of compounds and moieties that may be conjugated to substituted transferrin and these examples may also be applied to the present invention. The teaching of WO 2009/019314 is included herein by reference.
HSA contains in its natural form one free thiol group that conveniently may be used for conjugation. As a particular embodiment within this aspect the variant albumin or fragment thereof may comprise further modifications provided to generate additional free thiol groups on the surface. This has the benefit that the payload of the variant albumin or fragment thereof is increased so that more than one molecule of the therapeutic compound can be conjugated to each molecule of variant albumin or fragment thereof, or two or more different therapeutic compounds may be conjugated to each molecule of variant albumin or fragment thereof, e.g., a compound having targeting properties such as an antibody specific for example a tumour; and a cytotoxic drug conjugated to the variant albumin or fragment thereof thereby creating a highly specific drug against a tumour. Teaching of particular residues that may be modified to provide for further free thiol groups on the surface can be found in copending patent application WO 2010/092135, which is incorporated by reference.
Associates
The variants of albumin or fragments thereof may further be used in form of "associates". In this connection the term "associate" is intended to mean a compound comprising a variant of albumin or a fragment thereof and another compound bound or associated to the variant albumin or fragment thereof by non-covalent binding. As an example of such an associate can be mentioned an associate consisting variant albumin and a lipid associated to albumin by a hydrophobic interaction. Such associates are known in the art and they may be prepared using well known techniques. As an example of a preferred associate according to the invention can be mentioned an associate comprising variant albumin and paclitaxel.
Other uses
The variant albumin or fragments thereof or fusion polypeptides comprising variant albumin or fragments thereof according to the invention have the benefit that their plasma half-life is altered compared to the parent albumin or fragments thereof or fusion polypeptides comprising parent albumin or fragments thereof. This has the advantage that the plasma half-life of conjugates comprising variant albumin or a fragment thereof or fusion polypeptide comprising variant albumin or a fragment thereof, or an associate comprising variant albumin or a fragment thereof according to the invention can be selected in accordance with the particular therapeutic purpose. For example for a conjugate, associate or fusion polypeptide used for imaging purposes in animals or human beings, where the imaging moiety has an very short half-life and a conjugate or a fusion polypeptide comprising HSA has a plasma half-life that is far longer than needed for the imaging purposes it would be advantageous to use a variant albumin or fragment thereof of the invention having a shorter plasma half-life than the parent albumin or fragment thereof, to provide conjugates of fusion polypeptides having a plasma half-life that is sufficiently long for the imaging purpose but sufficiently short to be cleared form the body of the particular patient on which it is applied.
In another example for a conjugate, an associate or fusion polypeptide comprising a therapeutic compound effective to treat or alleviate a particular condition in a patient in need for such a treatment it would be advantageous to use the variant albumin or fragment thereof having a longer plasma half-life than the parent albumin or fragment thereof, to provide associates or conjugates or fusion polypeptides having longer plasma half-lives which would have the benefit that the administration of the associate or conjugate or fusion polypeptide of the invention would be needed less frequently or reduced dose with less side affects compared to the situation where the parent albumin or associates thereof or fragment thereof was used.
In a further aspect the invention relates to compositions comprising the variant albumin, associates thereof or fragment thereof, variant albumin fragment or associates thereof or fusion polypeptide comprising variant albumin or fragment thereof according to the invention. The compositions are preferably pharmaceutical compositions. The composition may be prepared using techniques known in the area such as disclosed in recognized handbooks within the pharmaceutical field.
In a particular embodiment the compositions comprise a variant albumin or a fragment thereof according to the invention and a compound comprising a pharmaceutically beneficial moiety and an albumin binding domain (ABD). According to the invention ABD means a site, moiety or domain capable of binding to circulating albumin in vivo and thereby conferring transport in the circulation of the ABD and any compound or moiety bound to said ABD. ABD's are known in the art and have been shown to bind very tight to albumin so a compound comprising an ABD bound to albumin will to a certain extent behave as a single molecule. The inventors have realized by using the variant albumin or fragment thereof according to the invention together with a compound comprising a pharmaceutically beneficial moiety and an ABD makes it possible to alter the plasma half-life of the compound comprising a pharmaceutically beneficial moiety and an ABD compared to the situation where said compound were injected as such in a patient having need thereof or administered in a formulation comprising natural albumin or a fragment thereof. The variant albumin or fragments thereof, conjugates comprising variant albumin or a fragment thereof or fusion polypeptide comprising variant albumin or a fragment thereof, or an associate comprising variant albumin or a fragment thereof according to the invention may also be incorporated into nano- or microparticles using techniques well known within the art. A preferred method for preparing nano- or microparticles that may be applied to the variant albumins or fragments thereof according to the invention is disclosed in WO 2004/071536, which is incorporated herein by reference.
Compositions
The present invention is also directed to the use of a variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, or a conjugate comprising a variant of albumin or a fragment thereof, or an associate comprising a variant of albumin or a fragment thereof for the manufacture of a pharmaceutical composition, where in the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, or a conjugate comprising a variant of albumin or a fragment thereof, or an associate comprising a variant of albumin or a fragment thereof has an altered plasma half-life compared with HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof or conjugate comprising HSA.
In this connection the corresponding fragment of HSA is intended to mean a fragment of HSA that aligns with and has same number of amino acids as the fragment of the variant albumin with which it is compared. Similarly the corresponding fusion polypeptide comprising HSA or conjugate comprising HSA is intended to mean molecules having same size and amino acid sequence as the fusion polypeptide of conjugate comprising variant albumin, with which it is compared.
Preferably the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof has a plasma half-life that is higher than the plasma half-life of HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof.
Alternatively, this may be expressed as the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof has a KD to FcRn that is lower that the corresponding KD for HSA or the corresponding fragment thereof or fusion polypeptide comprising HSA or fragment thereof. Preferably, is KD for the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof less than 0.9X KD for HSA, more preferred less than 0.5X KD for HSA, more preferred less than 0.1 X KD for HSA, even more preferred less than 0.05X KD for HSA, even more preferred less than 0.02X KD for HSA and most preferred less than 0.01 X KD for HSA.
The variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof is preferably the variant of albumin or a fragment thereof or fusion polypeptides comprising variant albumin or fragments thereof, fragment thereof, or a conjugate comprising a variant of albumin or a fragment thereof according to the invention.
The present invention is further described by the following examples that should not be construed as limiting the scope of the invention.
Examples
Materials and Methods ELISA:
Wells were coated with wild-type HSA or variants diluted in phosphate buffered saline (PBS) to stated concentrations, incubated overnight at 4 C and then blocked with 4% skimmed milk (Acumedia) for 1 hour at room temperature. The wells were then washed four times with PBS/0.005% TWEEN® 20 (PBS/T) pH 6.0 before glutathione-S-transferase (GST) -fused ()shFcRn (0.5 μς/πιΙ) as described in FEBS J. 2008 Aug;275(16):4097-1 10. pre-incubated with an horseradish peroxidase (HRP)-conjugated polyclonal anti-GST from goat (1 :5000; GE Healthcare), diluted in 4% skimmed milk PBS/0.005% TWEEN® 20 (PBS/T) pH 6.0 was added to each well and incubated for 1 .5 h at room temperature followed by washing four times with PBS/T pH 6.0. One hundred μΙ of the substrate tetramethylbenzidine (TMB) (Calbiochem) was added to each well and incubated for 45 min before 100 μΙ of 0.25 M HCI was added. The absorbance was measured at 450 nm using a Sunrise TECAN spectrophotometer (TECAN, Maennedorf, Switzerland).
The same ELISA was repeated with PBS/T pH 7.4.
Surface Plasmon Resonance (SPR):
SPR experiments were carried out using a Biacore 3000 instrument (GE Healthcare). Flow cells of CM5 sensor chips were coupled with shFcRn-GST (-1400-5000RU) using amine coupling chemistry as described in the protocol provided by the manufacturer. The coupling was performed by injecting 10μg/ml of the protein in 10mM sodium acetate pH 5.0 (GE healthcare). Phosphate buffer (67mM phosphate buffer, 0.15M NaCI, 0.005% TWEEN® 20) at pH 6.0) was used as running buffer and dilution buffer. Regeneration of the surfaces were achieved using injections of HBS-EP buffer (0.01 M HEPES, 0.15M NaCI, 3mM EDTA, 0.005% surfactant P20) at pH 7.4 (Biacore AB). For binding to immobilized shFcRn-GST, 1.0-0.5 μΜ of each HSA variant was injected over the surface at constant flow rate (40 μΙ/ml) at 25 C. In all experiments, data was zero adjusted and the reference cell subtracted. Data evaluation was performed using BIAevaluation 4.1 software (BIAcore AB).
The same SPR assay was repeated with HBS-EP buffer pH 7.4.
For the purposes of this patent unless otherwise stated HSA, WT HSA, rHA refer to
Recombinant human serum albumin commercially available under the registered tradename
RECOMBUMIN (available from Novozymes Biopharma UK Ltd, Nottingham UK) was used for the examples.
Serum albumin from other species: The albumins were recombinant wheres stated, produced using sequences provided from publicly available databases. Or purchased from commercial suppliers.
FcRn Expression and purification of soluble Human (shFcRn) and Mouse (smFcRn) FcRn : Methods for the generation of shFcRn and smFcRn expression plasmids, expression and purification of each heterodimer can be found in Berntzen et al. (2005) J. Immunol. Methods 298:93-104).AIternatively shFcRn FcRn heterodimer was produced by GeneArt AG (Germany). Sequences for the two sub units of the heterodimer can be found in SEQ ID NO: 3 and SEQ ID NO: 4. The soluble receptor was expressed in HEK293 cells and purified from culture supernatant using Ni-HiTrap chromatography columns. Example 1. Preparation of variants
Preparation of specific HSA mutein expression plasmids
Methods for the expression of HSA mutant variants and HSA fusion variants were produced using several techniques. Standard molecular biology techniques were employed throughout such as described in Sambrook, J. and D. W. Russell, 2001 . Molecular Cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Method 1 . Amino acid substitutions in HSA detailed in Tablel
Synthetic DNA Nco\/Sac\ fragments (859 bp) were generated by gene assembly (GeneArt AG, Germany) containing point mutations within the HSA-encoding gene (SEQ ID NO: 1 ) to introduce the desired amino acid substitution in the translated protein. Table 2 details the codons used to introduce the amino acid substitutions into the HSA-encoding gene. The nucleotide sequence of the synthetic fragment encoding unchanged amino acids (i.e. wild type) was identical to that in pDB2243 (described in WO 00/44772). The synthetic nucleotide fragments were ligated into Λ/col/Sacl-digested pDB2243 to produce plasmids pDB3876 - pDB3886 (Table 1 ). For the production of expression plasmids, pDB3876 - pDB3886 (see Table 1 ) were each digested with Λ/οίΙ and Pvu\ , the DNA fragments were separated through a 0.7% (w/v) TAE gel, and 2992bp fragments ('Λ/οίΙ cassettes' including PRB1 promoter, DNA encoding the fusion leader (FL) sequence (disclosed in WO 2010/092135), nucleotide sequence encoding HSA and ADH1 terminator; see Figure 1 ) were purified from the agarose gel using a Qiagen Gel Extraction Kit following the manufacturer's instructions. 'A/oil cassettes' were ligated into a Λ/οίΙ/Shrimp Alkaline Phosphatase (Roche)- treated "disintegration" plasmid pSAC35, disclosed in EP-A-286 424 and described by Sleep, D., et al. (1991 ) Bio/Technology 9, 183 - 187. Ligation mixtures were used to transform chemically-competent E. coli DH5a. Expression plasmids pDB3887 - pDB3897, pSAC35-derivatives containing the "A/oil cassettes", were identified using standard techniques. Disintegration plasmids pDB3887 - pDB3897 and pDB2244 (For the expression of wild type HSA, described in WO 00/44772) (Table 1 ) were used to transform S. cerevisiae BXP10cir° (as previously described WO/2001/079480 as described below.
Table 1 : Plasmid, amino acid substitution introduced into HSA
Plasmid Construct
pDB2244 HSA
pDB3876 HSA D494N
pDB3877 HSA D494A
pDB3878 HSA E495Q
pDB3879 HSA E495A
pDB3880 HSA D494Q
pDB3881 HSA D494N,
T496A
pDB3882 HSA T496A
pDB3883 HSA E492G
pDB3884 HSA E492G,
V493P
pDB3885 HSA E492P
pDB3886 HSA E492H
pDB3887 HSA D494N
pDB3888 HSA D494A
pDB3889 HSA E495Q
pDB3890 HSA E495A
pDB3891 HSA D494Q
pDB3892 HSA D494N,
T496A
pDB3893 HSA T496A
pDB3894 HSA E492G
pDB3895 HSA E492G,
V493P
pDB3896 HSA E492P
pDB3897 HSA E492H n/a = Not applicable. pDB3876-pDB3886 are sub-cloning plasmids. Table 2: Codons used to introduce amino acid substitutions into HSA
Figure imgf000042_0001
Method 2. Production of HSA variants D494N+E495Q+T496A and E495Q+T496A
A PCR-based method, using a QuickChange Lightening Kit (Statagene), was employed to introduce point mutations into HSA. Oligonucleotide pairs xAP094 (SEQ ID NO: 5)/xAP095 (SEQ ID NO: 6) and xAP096 (SEQ ID NO: 7)/xAP097 (SEQ ID NO: 8) were used to generate two HSA variants (D494N+E495Q+T496A and E495Q+T496A, respectively). Plasmid pDB3927(disclosed in WO 2010/092135) was used as template DNA and the methodology recommended by the manufacturer of the kit was followed. The resulting plasmids were named pDB3995 and pDB3996 (contain HSA D494N+E495Q+T496A and E495Q+T496A expression cassettes, respectively). pDB3995 and pDB3996 were digested with SsfEII/SsrBI and the linearised DNA molecules were purified using standard techniques. One hundred ng of each SsiEII/SsrBI digested DNA, purified using a Qiagen PCR-Purification kit following the manufacturer's instructions, was mixed individually with 100ng /\cc65l/SamHI-digested pDB3936) (disclosed in WO 2010/092135) and used to directly transform S. cerevisiae BXP10cir° using the Sigma Yeast Transformation kit described below.
Method 3. Amino acid substitutions in HSA detailed in Table 3
Plasmid pDB3927 (disclosed in WO 2010/092135) (containing an identical nucleotide sequence encoding HSA as in pDB2243) was manipulated to amino acid substitutions within the mature HSA protein. Synthetic DNA fragments were generated (GeneArt AG, Germany or DNA2.0 Inc, USA) (Nco\/Bsu36\, AvA\ISph\ or Sac\/Sph\ fragments), containing point mutations within the HSA-encoding gene to introduce the desired amino acid substitution(s) into the translated protein sequence. Table 2 details the codons used to introduce the amino acid substitutions into the HSA- encoding gene. The nucleotide sequence of the synthetic fragment encoding unchanged amino acids (i.e. wild type) was identical to those in pDB3927. Synthetic DNA fragments were sub-cloned into Nco\/Bsu36\, AvA\ISph\-, SacUSph -digested pDB3927 (described in PCT 1 1527.204-WO) to generate pDB4006-pDB4010, pDB4083-pDB4101 and pDB4103-pDB41 1 1 and pDB4194, pDB4200,pDB4202 (see Table 3).
Similarly, Bam \/Sal\ fragments containing point mutations in the nucleotide sequence encoding HSA were generated by gene assembly (DNA2.0 Inc, USA) and ligated into Bam \/Sal\- digested pDB3964 (described in WO 2010/092135) to produce plasmids pDB3986-pDB3989 (Table 3).
The C-terminal string of amino acids from position 573-585 (KKLVAASQAALGL) (SEQ ID
NO: 9) in HSA were mutated to those in macaque ( P K FVAAS QAAL A) (SEQ ID NO: 10), mouse (PNLVTRCKDALA) (SEQ ID NO: 1 1 ), rabbit (PKLVESSKATLG) (SEQ ID NO: 12) and sheep (PKLVASTQAALA) (SEQ ID NO: 13) serum albumin. The codons used to introduce each amino acid substitution are given in Table 2. Synthetic DNA fragments (Sac\/Sph\) were generated (DNA2.0 Inc, USA) by gene assembly (the nucleotide sequence of the synthetic fragment encoding unchanged amino acids (i.e. wild type) was identical to that in pDB3927) and were sub-cloned into Sacl/Sp/7l-digested pDB3927 to produce plasmids pDB41 14-41 17 (Table 3).
Plasmids pDB3883 (Table 1 ), pDB4094 and pDB4095 (Table 3) were digested with Ncol/Sacl and 857bp fragments from each digest were purified before being ligated into Ncol/Sacl- digested pDB4006 or pDB41 10 (8.688kb) (Table 3) to produce pDB4156-pDB4161.
Expression plasmids were generated in vivo (i.e. via homologous recombination in S. cerevisiae; a technique referred to as gap repair or in vivo cloning- see Orr-Weaver & Szostak. 1983. Proc. Natl. Acad. Sci. USA. 80:4417-4421 ). Modified plasmids listed in Table 3 were digested with SsfEII/SsrBI and the linearised DNA molecules were purified using standard techniques. One hundred ng of each SsiEII/SsrBI digested DNA, purified using a Qiagen PCR-Purification kit following the manufacturer's instructions, was mixed individually with 100ng Acc65\/Bam \- digested pDB3936 (disclosed in WO 2010/092135) and used to directly transform S. cerevisiae BXPI Ocir0 using the Sigma Yeast Transformation kit described below. Table 3.
Figure imgf000044_0001
Figure imgf000045_0001
Table 4: K500 primers and plasmids
Original primers CODONS
USED
CTTTGGAAGTCGACGAAACTTACGTTCCAGGTGAATTCAACGCTG
XAP216 (SEQ ID NO: 14) Gly GGT
CTTTGGAAGTCGACGAAACTTACGTTCCAGAAGAATTCAACGCTG
XAP217 (SEQ ID NO: 15) Glu GAA
CTTTGGAAGTCGACGAAACTTACGTTCCAGACGAATTCAACGCTG
XAP218 (SEQ ID NO: 16) Asp GAC
CTTTGGAAGTCGACGAAACTTACGTTCCAGTTGAATTCAACGCTG
XAP219 (SEQ ID NO: 17) Val GTT
CTTTGGAAGTCGACGAAACTTACGTTCCAAGAGAATTCAACGCTG
XAP220 (SEQ ID NO: 18) Arg AGA
CTTTGGAAGTCGACGAAACTTACGTTCCAAACGAATTCAACGCTG
XAP221 (SEQ ID NO: 19) Asn AAC
CTTTGGAAGTCGACGAAACTTACGTTCCAATGGAATTCAACGCTG
XAP222 (SEQ ID NO: 20) Met ATG
CTTTGGAAGTCGACGAAACTTACGTTCCAATTGAATTCAACGCTG
XAP223 (SEQ ID NO: 21 ) lie ATT
CTTTGGAAGTCGACGAAACTTACGTTCCAACCGAATTCAACGCTG
XAP224 (SEQ ID NO: 22) Thr ACC
CTTTGGAAGTCGACGAAACTTACGTTCCA T'GGGAATTCAACGCTG
XAP225 (SEQ ID NO: 23) Trp TGG
CTTTGGAAGTCGACGAAACTTACGTTCCATGTGAATTCAACGCTG
XAP226 (SEQ ID NO: 24) Cys TGT
CTTTGGAAGTCGACGAAACTTACGTTCCATACGAATTCAACGCTG
XAP227 (SEQ ID NO: 25) Tyr TAC
CTTTGGAAGTCGACGAAACTTACGTTCCATTGGAATTCAACGCTG
XAP228 (SEQ ID NO: 26) Leu TTG
XAP229 CTTTGGAAGTCGACGAAACTTACGTTCCATTGGAATTCAACGCTG Phe TTC
Figure imgf000046_0001
Table 5: K573 primers and plasmids
Original primers CODONS
USED
ATAAG C CTAAG G CAG CTTG ACTTG CAG CAACAAGTTT C CAC CCTCCTCG
XAP187 (SEQ ID NO: 34) Gly GGT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTT T CACCCTCCTCG
xAP188 (SEQ ID NO: 35) Glu GAA
AT AAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTT T CACCCTCCTCG
XAP189 (SEQ ID NO: 36) Asp GAT
AT AAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTAA CACCCTCCTCG
XAP190 (SEQ ID NO: 37) Val GTT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTTCTACCCTCCTCG
XAP191 (SEQ ID NO: 38) Arg AGA
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTAI TACCCTCCTCG
XAP192 (SEQ ID NO: 39) Asn AAT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTCATACCCTCCTCG
xAP193 (SEQ ID NO: 40) Met ATG
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTAATACCCTCCTCG
XAP194 (SEQ ID NO: 41 ) lie ATT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTAGTACCCTCCTCG
XAP195 (SEQ ID NO: 42) Thr ACT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTCC ACCCTCCTCG
XAP196 (SEQ ID NO: 43) Trp TGG
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTACAACCCTCCTCG
XAP197 (SEQ ID NO: 44) Cys TGT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTAT AACCCTCCTCG
xAP198 (SEQ ID NO: 45) Tyr TAT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTCAAACCCTCCTCG
XAP199 (SEQ ID NO: 46) Leu TTG
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTAAAACCCTCCTCG
XAP200 (SEQ ID NO: 47) Phe TTT
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTAGAACCCTCCTCG
XAP201 (SEQ ID NO: 48) Ser TCT ATAAG C CTAAG G C AG CTTG ACTTG CAG CAACAAG 1 1 1 ACCCTCCTCG
XAP202 (SEQ ID NO: 49) Gin CAA
ATAAGCCTAAGGCAGCTTGACTTGCAGCAACAAGTTTATGACCCTCCTCG
xAP203 (SEQ ID NO: 50) His CAT
ATAAG C CTAAG G CAG CTTG ACTTG CAG CAACAAGTTT ΪΪ AAC CCTC CTC G
XAP204 (SEQ ID NO: 51 ) STOP taa
XAP205 AATGCTGCCiArGGAGATCTGCTTGAATGTGCTGATG (SEQ ID NO: 52)
Method 4. HSA K500 and K573 permutation library
PCR was used to produce two permutation libraries in which the codons encoding amino acid 500 or 573 of mature HSA were changed (mutated) to alternative non-wild type amino acids and a termination codons (K5XXSTOP). Mutagenic oligonucletides (Table 4 and Table 5), were designed to amplify HSA- encoding DNA and incorporate the desired changes. That is, for the changes at position 500, pDB4082 (Figure 1 ) was used as a template DNA. pDB4082 is a derivative of pDB2305 (disclosed in EP1788084) and was produced as follows. pDB2305 (Figure 2) was digested with Nsi\/Spe\ and the yielded 8.779kb Λ/s/'l fragment was self-ligated to produce pDB4005 (Figure 3). A synthetic DNA fragment (Bsa\ISph\) was generated by gene assembly (DNA2.0 Inc, USA) (SEQ ID NO: 1 ) (containing 3' region of the PRB1 promoter, modified fusion leader sequence, nucleotide sequence encoding HSA and 5' region of the modified ADH† terminator), and ligated into /-//ndlll/Spftl-digested pDB4005 (Figure 3) to produce pDB4082. Note. The Hind\ \\ site in PRB† promoter site has been removed and a Sacl l site within the nucleotide sequence encoding HSA has been introduced.
For the permutation library for position 500 of HSA, the nucleotide sequence encoding HSA corresponding to that between the Sa/I / Hind\\\ sites (see plasmid map pDB4082, Figure 1 ) was generated using the New England Biolabs Phusion kit (Table 6) and oligonucleotides listed in Table 4. Table 7 describes the PCR method employed.
The permutation library at amino acid position 573 in HSA was generated using pDB3927 as template DNA and involved amplifying the albumin-encoding DNA corresponding to that between the Nco\ and Bsu3Q\ sites using oligonucleotides detailed in Table 5.
Table 6:. PCR ingredients
Figure imgf000047_0001
Figure imgf000048_0001
Table 7: PCR conditions:
Figure imgf000048_0002
For the albumin variants based at positions 500 and 573, each PCR-product was purified using a Qiagen PCR-clean up kit (according to the manufactures instructions), digested with Sal\/Hind\\\ (position 500 library) or Nco\/Bsu36\ (position 573 library). The digested DNAs were then purified using a Qiagen PCR-clean up kit and ligated into Sa/I/ Hind\\\ - or Nco\/Bsu36\ - digested pDB4082 or pDB3927, respectively, replacing the equivalent native sequence. Ligations were transformed into E. coli DH5a, subsequent plasmids isolated from transformants using a Qiagen miniprep kit (according to the manufacturer's instructions) and the correct constructs identified by restriction analysis. This produced a collection of plasmids, pDB4204 - pDB4222 (position 500 library) pDB4173 to pDB4190 (position 573 library), containing albumin genes which differed only in their sequence corresponding to the codon for the amino acid at position 500 or 573 Table 4 and 5, respectively). The specific changes in each plasmid were confirmed by sequencing.
The resultants plasmids were used to generate expression plasmids and albumin fusion producing yeast by in vivo cloning as described above. That is, S. cerevisiae was transformed using the Sigma Yeast Transformation kit (described below), using a mixture of a 100 ng SsiEII/esrBI-digeste HSA variant containing plasmid and 100 ng Acc65\/Bam \ digested pDB3936.
Transformation of S. cerevisiae
S. cerevisiae BXP10 cir° (as previously described WO/2001 /079480) or Strain A cir° (described in WO/2005/061718) was streaked on to YEPD plates (1 % (w/v) yeast extract, 2% (w/v) Bactopeptone, 2% (w/v) glucose), 1 .5% agar) and allowed to grow for 4 days at 30°C prior to transformation. One μg of whole plasmid (i.e. circular plasmids) or, for gap repair, 100 ng BstE\\/Bsr \- or /Vs/'l/Pvt/l-digested HSA variant or HSA variant fusion containing plasmid and 100 ng Acc65\/Bam \ digested pDB3936 were used to transform S. cerevisiae using a Sigma Yeast Transformation kit using a modified lithium acetate method (Sigma yeast transformation kit, YEAST- 1 , protocol 2; Ito et al. (1983) J. Bacterid., 153, 16; Elble, (1992) Biotech niques, 13, 18). The protocol was amended slightly by incubating the transformation at room temperature for 4 h prior to heat shock. Following heat shock, the cells were briefly centrifuged before being re- suspended in 200μΙ 1 M sorbitol then spread over BMMD agar plates, the composition of BMMD is described by Sleep et al., (2001 ), Yeast, 18, 403. Plates were incubated at 30°C for 4 days before individual colonies were patched on to fresh BMMD plates. Yeast strain numbers are detailed in Table 1 .
Stocks were prepared for each yeast strain as follows: BMMD broth was inoculated with a heavy loop of each yeast patch and grown for 24h at 30°C with orbital shaking at 200rpm. Cells were harvested by centrifugation at 1 900 χ g for 5 min in a Sorval RT600 centrifuge, 15ml_ supernatant was removed and replaced by trehalose 40% (w/v). The cells were resuspended and transferred to cyrovials (1 mL) for storage at -80°C.
Shake flask growth of S. cerevisiae
BMMD (recipe 0.17% (w/v) yeast nitrogen base without amino acid and ammonium sulphate (Difco), 37.8mM ammonium sulphate, 29mM citric acid, 142mM disodium hydrogen orthophosphate dehydrate pH6.5, 2% (w/v) glucose) media (10ml_) was inoculated with each yeast strain and grown for 12h at 30°C with orbital shaking at 200rpm. An aliquot of each starter culture (4ml_) was used to inoculate 2 200ml_ BMMD media and grown for 36h at 30°C with orbital shaking at 200rpm. Cells were harvested by filtration through 0.2μηι vacuum filter membranes (Stericup, Millipore) including a GF-D prefilter (Whatman) and the supernatant retained for purification. Primary concentration
Retained culture supernatant was concentrated using Tangential Flow Filtration using a Pall Filtron LV system fitted with a Omega 10KD (0.093sq.m2) filter (LV CentramateTM cassette, Pall Filtron) with a transmembrane pressure of 20psi and a recirculation rate of 180ml_.min"1.
Fermentation
Fed-batch fermentations were carried out in a 10 L Sartorius Biostat C fermenter at 30°C; pH was monitored and adjusted by the addition of ammonia or sulphuric acid as appropriate. The ammonia also provided the nitrogen source for the cultures. The level of dissolved oxygen was monitored and linked to the stirrer speed, to maintain the level at >20% of saturation. Inocula were grown in shake flasks in buffered minimal media (recipe). For the batch-phase the cultures was inoculated into fermenter media (approximately 50% of the fermenter volume) containing 2% (w/v) sucrose. The feed stage was automatically triggered by a sharp rise in the level of dissolved oxygen. Sucrose was kept at growth-limiting concentrations by controlling the rate of feed to a set nominal growth rate. The feed consisted of fermentation media containing 50% (w/v) sucrose, all essentially as described by Collins. (Collins, S.H., (1990) Production of secreted proteins in yeast, in: T.J.R. Harris (Ed.) Protein production by biotechnology, Elsevier, London, pp. 61 -77).
GP-HPLC quantitation Purified albumin variants, fusions and conjugates were analysed by GP-H PLC and quantification as follows. Injections of 25μΙ_ were made onto a 7.8mm id x 300mm length TSK G3000SWXL column (Tosoh Bioscience), with a 6.0mm id x 40mm length TSK SW guard column (Tosoh Bioscience). Samples were chromatographed in 25mM sodium phosphate, 100mM sodium sulphate, 0.05% (w/v) sodium azide, pH 7.0 at 1 mL/min, Samples were quantified by UV detection at 280nm, by peak area, relative to a recombinant human albumin standard of known concentration (10mg/ml_) and corrected for their relative extinction coefficients.
Purification of albumin variants from shake flask
Albumin variants were purified from shake flask (either culture supernatant or concentrated culture supernatant) using a single chromatographic step using an albumin affinity matrix (AlbuPure™ - ProMetic Biosciences, Inc.). Chromatography was performed at a constant linear velocity of 240cm/h throughout. Culture supernatant was applied to a 6cm bed height, 2.0ml_ packed bed pre-equilibrated with 50mM sodium acetate pH5.3. Following load the column was washed with 10 column volume (CV) of equilibration buffer, then 50mM ammonium acetate pH8.0 (10CV). Product was eluted with either 50mM ammonium acetate 10mM octanoate pH8.0, 50mM Ammonium Acetate 30mM Sodium Octanoate 200mM Sodium Chloride pH7.0 or 200mM Potassium thiocyanate. The column was cleaned with 0.5M NaOH (3cv) and 20mM NaOH (3.5cv). Eluate fraction from each albumin variant were concentrated and diafiltered against 10 volumes of 50mM sodium chloride (Vivaspin20 10,000 MWCO PES with optional diafiltration cups, Sartorius). Purified albumin variants were quantified by GP-HPLC as described above.
Purification of albumin-fusion variants from shake flask
Albumin-fusion variants were purified from shake flask culture supernatant using a single chromatographic step using an albumin affinity matrix (AlbuPure™ - ProMetic Biosciences, Inc.). Chromatography was performed at a constant linear velocity of 240cm/h throughout. Culture supernatant or concentrated culture supernatant was applied to a 6cm bed height, 2.0ml_ packed bed pre-equilibrated with 50mM sodium acetate pH5.3. Following load the column was washed with 10 column volume (cv) equilibration buffer then 50mM ammonium acetate pH8.0 (10cv). Product was eluted with either 50m M ammonium acetate 1 0m M octanoate pH8.0, 50m M Ammonium Acetate 30mM Sodium Octanoate 200mM Sodium Chloride pH7.0, 50mM Ammonium Acetate 100mM Sodium Octanoate pH9.0 or 200mM Potassium thiocyanate. The column was cleaned with 0.5M NaOH (3cv) and 20mM NaOH (3.5cv). Eluate fraction from each albumin variant-fusion were concentrated and diafiltered against 10 volumes of 25 mM Tris, 150 mM NaCI, 2 mM KCI, pH 7.4 (Vivaspin20 10,000 MWCO PES with optional diafiltration cups, Sartorius). Purified albumin-fusion variants were quantified by GP-HPLC as described above.
Purification of albumin variants from fermentation Albumin variants were purified from high cell density fed batch fermentation supernatants after separation by centrifugation, using a Sorvall RC 3C centrifuge (DuPont). Culture supernatant was chromatographed through an 1 1 cm bed height column 8.6ml_ packed bed packed with a custom synthesised albumin affinity matrix (AlbuPure™ - ProMetic Biosciences, Inc.) as described above. Product was eluted using elution buffers describe above at a flow rate of 120cm/h. The eluate fraction(s) was analysed by GP-HPLC. (above) .and reducing SDS-PAGE for purity and if required concentrated (Vivaspin20 10,000 MWCO PES) and applied to a 2.4x96cm column packed with Superdex 75 run at a flow rate of 39cm/h in 25 mM Tris, 150 mM NaCI, 2 mM KCI, pH 7.4 . The peak was fractionated, assayed by GP-HPLC and pooled in order to generate the monomeric protein of interest. Pooled fractions were concentrated (Vivaspin20 10,000 MWCO P ES, Sartorius).
All proteins to be assayed for receptor (FcRn) binding properties and or other analysis were quantified by GP-HPLC as described above corrected for their relative extinction coefficients. Example 2. Determination of receptor (shFcRn) binding properties of blood derived HSA and recombinant human albumin
Essentially fatty acid-free HSA (Sigma-Aldrich) was further purified by size exclusion chromatography as described in Andersen et al (2010). J.Biol.Chem. 285, (7),4826-4836. Ten μΜ of monomeric HSA and rHA were analysed using SPR as described above and the data presented in Figure 4.
Direct comparison of HSA (blood derived) with recombinant human albumin (Recombumin) at the same concentration (10μΜ) (Figure 4A and 4B) shows for both samples binding to immobilized shFcRn (pH6.0, pH7.4 respectively) was reversible and pH dependent. In addition, comparison of HSA vs recombinant human albumin by Bosse et al (2005).. J. Clin. Pharmacol. 45; 57-67, demonstrated equivalent half life in vivo human study
Example 3. Determination of receptor (shFcRn) binding properties of albumin variants
Two established FcRn binding assays were used, ELISA and SPR. There are major differences between the assays: In the ELISA system HSA is coated directly in wells and shFcRn- GST is added in solution whereas in the SPR assay shFcRn-GST is immobilized to a CM5 chip and HSA injected in solution. The pH can be varied in both systems.
The variants were analysed using ELISA at pH 6.0 and pH 7.4. Results are disclosed in Figure 5. The ELISA values represent the mean of duplicates. The variants were analysed using SPR analysis at pH 6.0 and pH 7.4. Results are disclosed for a representative number of variants in Figure 6 using a concentration of the variants of 0.2 μΜ and in Figure 7 using a concentration of the variants of 1 μΜ.
The SPR data disclosed in Figures 6 and 7 were normalized and the relative binding of variants at each concentration is shown in Figure 8 A and B respectively.
The conclusions of the analysis are that all tested variants have the characteristic binding to the receptor at pH 6.0 but no binding at pH 7.4. The variants D494N,Q,A, E495Q.A, T496A, and D494N+T496A show reduced binding to the receptor compared to HSA. Example 4. Determination of receptor (shFcRn/smFcRn) binding properties of albumin variants
Using the SPR analysis method below the association constant Ka , the dissociation constant Kd and the binding constant KD calculated for HSA and mouse serum albumin (MSA) binding to human and mouse FcRn (Table 8).
SPR analyses- S PR analyses were performed on a B IAcore 3000 instru ment (G E
Healthcare) using CM5 chips and immobilization of smFcRn-GST and shFcRn-GST variants or smFcRn was performed using the amine coupling kit (GE Healthcare). Protein samples (10 g/ml) were injected in 10 mM sodium acetate at pH 4.5 (GE Healthcare), all as described by the manufacturer. Unreacted moieties on the surface were blocked with 1 M ethanolamine. For all experiments, phosphate buffer (67 mM phosphate buffer, 0.15 M NaCI, 0.005% TWEEN® 20) at pH 6.0 or pH 7.4, or HBS-P buffer (0.01 M HEPES, 0.15 M NaCI, 0.005% surfactant P20) at pH 7.4 were used as running buffer or dilution buffer. Kinetic measurements were performed using a low density immobilized surface (100-200 resonance units (RU)). Serial dilutions of hlgG1 (2000.0-31 .2 nM), mlgG1 (1000.0-15.6 nM), MSA (20.0-0.3 μΜ) and HSA (200.0-3.1 μΜ) were injected at pH 6.0 or pH 7.4, at a flow rate 50 μΙ/minute at 25°C. Additive binding was recorded by injecting HSA (10 μΜ), MSA (5 μΜ), hlgG1 (100 nM) or mlgG1 (100 nM) alone or two at a time at 25°C at 20 μΙ/minute at pH 6.0 over immobilized shFcRn (-600 RU) or smFcRn (-600 RU). Competitive binding was measured by injecting shFcRn (50 nM) or smFcRn (100 nM) alone or together with different amounts of HSA or MSA (10.0-0.05 μΜ) over immobilized HSA (-2600 RU) or MSA (-2000 RU). In all cases, to correct for nonspecific binding and bulk buffer effects, responses obtained from the control surfaces and blank injections were subtracted from each interaction curve. Kinetic rate values were calculated using predefined models (Langmuir 1 :1 ligand model, heterogeneous ligand model and steady state affinity model) provided by the BIAevaluation 4.1 software. The closeness of the fit, described by the statistical value χ2 that represents the mean square, was lower than 2.0 in all affinity estimations. Table 8: Binding constants of HSA and MSA shFcRn and smFcRn.
Figure imgf000053_0001
The KD's were generated using the BIAevaluation 4.1 software) A Langmuir 1 : 1 ligand model was used throughout. The kinetic values represent the average of triplicates. ND means: Not determined. NA means: Not acquired
Example 5. Binding of albumins from other species to human FcRn
Commercially available animal albumin (either Sigma-Aldrich or Calbiochem) were further purified as described in Andersen et al (2010). J.Biol.Chem. 285, (7),4826-4836. The binding of donkey serum albumin, bovine serum albumin, goat serum albumin, sheep serum albumin, rabbit serum albumin, dog serum albumin, hamster serum albumin, guinea pig albumin, rat serum albumin and chicken serum albumin to shFcRn was determined using the techniques described in Materials and Methods.. The ELISA results are disclosed in Figure 9 A-D and the relative bindings summarized in Figure 9 E.
The SPR results are shown in Figure 10, where the binding at pH 6.0 and pH 7.4 for each albumin species are shown. Table 10 shows an overview of the relative binding responses measured using ELISA and SPR: Table 10: Cross-species albumin-FcRn binding
Figure imgf000053_0002
Relative binding responses are categorized from strongest (++++) to weakest (+) and no binding (- )
a: Not determined (ND).
A hierarchy ranging from strongest to weakest binding is as follows; guinea pig =/> rabbit > hamster/dog > rat/mouse > donkey > human > bovine > goat/sheep > chicken. This data shows that animal albumins have different affinities for shFcRn.
Example 6. Kinetics of the HSA variant for shFcRn
The binding constants for variants according to the invention were determined according to the methods described in Materials and Methods.
Table 1 1 : Binding constants of HSA variants for shFcRn
Figure imgf000054_0001
The KD's were generated using the BIAevaluation 4.1 software) A Langmuir 1 :1 ligand model was used throughout. The kinetic values represent the average of triplicates. ND means: Not determined.
The results correspond with the conclusions made in Example 3 based on SPR and ELISA data but in addition shows that E492G has increased affinity to its receptor,
Example 7. Competitive analysis of the HSA variants
Competitive analysis of the HSA variants prepared in example 1 and WT HSA was performed using the methods described in example 4. Results are shown in Figure 15.
The results show that the variant E492G, unlike E492H E492P and E492G+V493P, has stronger binding to shFcRn than HSA. .
Example 8. Analysis of Q417 substitutions
Using the method of Example 1 variants of HSA having the substitutions Q417A and D494E+Q417H were constructed. The kinetic properties of these variants were tested using the methods in Materials and Methods and are shown in Table 12. Table 12: Binding constants of HSA variants for shFcRn
Figure imgf000055_0001
a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU).
b: The kinetic rate constants were obtained using a simple first-order (1 :1 ) bimolecular interaction model.
c: The steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BIAevaluation 4.1 software. The kinetic values represent the average of triplicates, d: Not determined (ND).
The data show that variants Q417A and D494E+Q417H bind weaker to the receptor than the wild-type HSA.
Example 9. Analysis of HSA variants in position 499, 500, 536, 537, 538 and 573
Using the method of Example 1 variants of HSA having the substitutions P499A, K500A, K536A, P537A, K538A and K573A were constructed. The receptor binding properties of these variants were tested as described in Materials and Methods. Results are shown in Figure 1 1 .
The data demonstrated that variants P499A, K536A, P537A and K538A had a reduced binding affinity to shFcRn relative to HSA. Variant K500A had almost completely lost its ability to bind to shFcRn and K573A had an increased binding affinity to shFcRn both relative to HSA.
Example 10. Analysis of variants in position 501 of HSA
Using the method of Example 1 variants of HSA having the substitutions E501A and E501 Q were constructed. The kinetic properties of these variants were tested as described in Materials and Methods.
Table 13 Binding constants of HSA variants for shFcR
Figure imgf000055_0002
a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU).
b: The kinetic rate constants were obtained using a simple first-order (1 :1 ) bimolecular interaction model.
c: The steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BIAevaluation 4.1 software. The kinetic values represent the average of triplicates d: Not determined (ND). The data shows that variants E501A and E501 Q have a slightly decreased binding affinity to shFcRn relative to HSA.
Example 11. Analysis of HSA variants in position 573
Using the method of Example 1 variants of HSA having a substitution at position 573 were constructed. All variants at position 573 were generated and the receptor binding properties of these variants were tested as described in Materials and Methods but with SPR analysis performed at pH5.5. Results are shown in the table 14 below and Figure 12 and 13.
Figure imgf000056_0001
a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU).
b: The kinetic rate constants were obtained using a simple first-order (1 :1 ) bimolecular interaction model.
c: The steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BIAevaluation 4.1 software. The kinetic values represent the average of duplicates, d: Not determined (ND). The results show that all variants having substitution in position 573 have improved binding to shFcRn compared with WT HSA. In particular the variants K573F, K573H, K573P, K573W and K573Y have more than 10 fold lower KD to shFcRn than the parent HSA. The variant K573STOP is a truncated albumin having a stop codon in position 573. The sensorgram for the K573STOP variant show significantly reduced binding compare to the WT HSA and generated a high KD. The increased affinity that we have shown for the variant K573E, a natural variant characterized by Otagiri (2009). Biol.Pharm. Bull. 32(4) 527-534, is predicted to have increased half-life in vivo.
Example 12. Analysis of further HSA variants
Using the method of Example 1 variants of HSA having the su bstitutions E492G ,
E492G+N503H, N503H, D550E, E492G+N503K, E542P, H440Q, K541 G, K541 D, D550N E492G+K538H+K541 N+E542D, E492T+N503K+K541 A, E492P+N503K+K541 G+E542P, E492H+E501 P+N503H+E505D+T506S+T540S+K541 E, A490D+E492T+V493L+E501 P
+N503D+A504E+E505K+T506F+K541 D, E492G+V493P+K538H+K541 N+E542D were constructed. The receptor binding properties of these variants were tested as described in Materials and Methods, and the results are shown in Table 15 and Figure 14.
Table 15: Binding constants of HSA variants for shFcR
Figure imgf000057_0001
a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU).
b: The kinetic rate constants were obtained using a simple first-order (1 :1 ) bimolecular interaction model.
c: The steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BIAevaluation 4.1 software. The kinetic values represent the average of triplicates. d: Not determined (ND). The results show that for position 550, a substitution to E results in an increased affinity whilst a substitution to N resulted in reduced affinity for shFcRn at pH6.0. When this analysis was repeated for the D550E substitution at pH5.5 however no observable increase in affinity was seen. The substituted for an acid amino acid (E) maintains and improves the binding. However the substitution for an uncharged amide amino acid reduces binding at pH6.0. Based on this observation, we would predict for this position that substitutions to basic amino acids (H, K and R) would result in further reductions in binding. Example 13. Mutations in His residues
The following variants were generated using the methods described in Example 1 : H440Q, H464Q, H510Q and H535Q.. Figure 15 shows SPR sensorgrams of these variants interacting with shFcRn as described in Materials and Methods.
It was found that the variant H440Q bound with comparable affinity as HSA. In contrast H464Q, H51 0Q and H535Q had significantly reduced affinity to shFcRn. This supports the previously published observations that mutagenesis of these Histidine residues significantly reduced HSA binding to shFcRn (Wu et al (2010). PEDS,23(10)789-798). Wu et al show a reduced half-life for a diabody fusion proteins (scFv-DII I)2 in mice with an order of removal from slowest to fastest: Db-DIII WT>H535A>H510A>H464A>Db. Based on affinity to shFcRn and when compared to smFcRn (example 5) we would predict the clearance order in humans to be (for glutamine (Q) substitutions) WT> H440Q>H510Q>H464Q>H535Q.
Example 14. Further variants
The following variants were generated using the methods described in Example 1 : K574N and Q580K in HSA. Binding of the variants to FcRn was tested using the SPR assay as described in Materials and Methods and the results are shown in Table 16.
The results show that variants K574N and Q580K bound stronger to shFcRn.
Tablel 6: Following kinetic data was found for these variants:
Albumin variant i ka i kd I KD
i (103/Ms) j (10"3/s) h (μΜ)
WT j j 9.7±0.0 i 30.0±0.1 i 3.1
K574N : 4.9±01 I 8.4±0.1 i 1 .7
Q580K H 6.0±0.0 I 9.3±0.0 ! 1 .5
Example 15. Analysis of HSA variants in position 500 Using the method of Example 1 variants of HSA having a substitution at position 500 were constructed. All variants at position 500 were generated and the receptor binding properties of these variants were tested. Biacore X, Biacore X100 and Sensor Chip CM5 were used for all analyses, both supplied by G E Healthcare. shFcRn produced by GeneArt AG (Germany) (diluted to "^g/rmL in 10mM sodium acetate pH5.0 (G E Healthcare)) was immobilised on flow cell 2 (FC2) to levels between 1600 - 2200 response u nits (RU ) via standard amine cou pling as per manufacturers instructions (G E Healthcare). A blank immobilisation was performed on flow cell 1 (FC1 ) for it to serve as a reference cell. To stabilise the assay, 3-5 start up cycles were run first, with running buffer (67mM phosphate buffer, 0.15M NaCI, 0.005% Tween 20 at pH5.75 ±0.25) only, followed by regeneration. WT rHA and K500 library variants were injected at various concentrations (1 μΜ - 150μΜ) for 90s at a constant flow rate of (30μΙ/η-ιίη) at 25 °C followed by regeneration of the surface using HBS-EP buffer pH7.4 (G E Healthcare) until approximate initial baseline RU was restored (usually 12s pulse would suffice).
Results are shown in the Table 17 and Figure 16
Table 17: Kinetics of HSA K500 single point mutants.
Figure imgf000059_0001
a: Mean of 4 values.
b: The kinetic rate constants were obtained using a simple first-order (1 :1 ) bimolecular interaction model.
c: The steady state affinity constant was obtained using an equilibrium (Req) binding model supplied by the BIAevaluation 4.1 software.
The results show for variants K500R and K500I have increased and comparable affinity for shFcRn compared to WT HSA respectively. Variant K500E bound tightly to immobilised shFcRn but still demonstrated the characteristic pH-dependency of the FcRn interaction. This complex was very stable, such that kinetic analysis was not possible (Figure 16). All other variants have reduced binding to shFcRn than wt rHA.
All variants bound to shFcRn (to some extent) at pH5.5. No binding of K500 library variants to shFcRn was detectable at pH7.4. Example 16. Fusion polypeptides
The generation of albumin fusions containing albumin muteins
Plasmids containing expression cassettes for the production of scFv (vHvL) genetically- fused to HSA, at either the N- or C-terminus or both, (described in, Evans et al., 2010. Protein Expression and Purification. 73,1 13-124) were modified to allow the production of albumin fusions using in vivo cloning (describe above). That is, pDB3017 (Figure 17), pDB3021 (Figure 18), pDB3056 (Figure 19) were digested with Nsi\/Spe\ and Nsi\ fragments corresponding 9.51 1 kb, 9.569kb and 8.795kb, respectively, were purified using standard techniques. Purified Nsi\ fragments were self-ligated and used to transform chemically competent E. coli DH5a to produce pDB4168, pDB4169 and pDB4170, respectively (Table 18).
Similarly, pDB3165 (containing the bivalent fusion) (Figure 20) was digested with A/oil and the expression cassette (4.506kb fragment) was purified before being ligated into Λ/οίΙ-digested pDB3927 to produce pDB4172 (Figure 21 , Table 18).
Synthetic Sal\/Bsu36\ DNA fragments (269bp), which contain point mutations within the albumin encoding nucleotide sequence to introduce amino acid substitutions corresponding to K500A, or D550N or K573P into the translated albumin protein sequence, were generated by gene assembly (GeneArt AG, Germany). The Sal\/Bsu36\ fragments were individually ligated into Sa/l/Sst/36l-digested pDB4168-pDB4170 and pDB4172 and used to transform chemically competent E. coli DH5a using standard techniques to generate plasmids pDB4265 - pDB4276 (Table 18).
Table 18: Albumin variant fusions
Plasmid Construct
Figure imgf000061_0001
Similarly, a DNA fragment was generated by PCR (using standard techniques), to introduce a K573A substitution in the translated albumin protein sequence. PCR was performed using the New England Biolabs Phusion kit using pDB4267 (Figure 22) as template DNA and oligonucleotides xAP238 (SEQ ID NO: 53) and xAP239 (SEQ ID NO: 54):
Table 19 describes PCR cycling.
Table 19: PCR cycling 98°C for 2 min 1 cycle
98°C for 10sec 35 cycles
57°C for 30sec
72°C for 10sec
72°C for 5 min 1 cycle
The PCR-product was purified, digested with Sal\/Bsu36\, and the fragment (269bp) isolated was ligated into Sa/l/Sst/36l-digested pDB4168-pDB4170 and pDB4172 and used to transform chemically competent E. coli DH5a. Resulting plasmids (pDB4277 - pDB4280) are listed in Table 18.
The nucleotide sequence encoding the FLAG tag was removed from plasmids pDB4168 and pDB4268-4270 (plasmids for the expression of scFv N-terminally fused to HSA and HSA muteins K500A, D550N and K573P, respectively. pDB4168 and pDB4268-4270 (Table 18) were digested with Bsu36\/Sph\ to remove a 231 bp product comprising 3' region of HSA-encoding gene, nucleotide sequence encoding FLAG tag and 5' region of ADH 1 terminator. A Bsu36\/Sph\ fragment (207bp), comprising 3' region of HSA-encoding gene and 5' region of mADH1 terminator (SEQ ID1 ) from pDB4181 was ligated into est/36l/Sp/?l-digested pDB4168 and pDB4268-pDB4270 using standard techniques. Ligation mixtures were used to transform chemically competent E. coli DH5a using standard techniques to generate plasmids pDB4281 -pDB4284 (Table 18)
pDB4265-pDB4284 were digested with fisiEII/fisrBI and the linearised DNA molecules were purified using standard techniques. One hundred ng SsiEII/SsrBI DNA samples were mixed with 100ng /Acc65l/SamHI-digested pDB3936 and used to transform S. cerevisiae BXP10cir° using the Sigma Yeast Transformation kit described below. In each case the expression plasmid was generated in the yeast by homologous recombination (in vivo cloning) between the albumin-fusion containing plasmid (pDB4265-pDB4280) (Table 18) and pDB3936.
Plasmids pDB3017, pDB3021 , pDB3056 and pDB3165 (wild type HSA fusions, described by Evans et al., 2010. Protein Expression and Purification. 73,1 13-124) were used to transform S. cerevisiae Strain Acir0 (described in WO/2005/061718) using the Sigma Yeast Transformation kit described below.
The nucleotide sequence encoding human IL-1 RA (interleukin-1 receptor antagonist)
(accession number: CAA59087) could be synthetically generated by gene assembly. The nucleotide sequence of the 708bp synthetic fragment (Bsu36l/Sphl fragment) is given in SEQ ID NO: 55 and includes the 3'region of the gene encoding HSA, the nucleotide sequence encoding a GS linker, the nucleotide sequence encoding human I L-1 RA (N84Q to abolish the N-linked glycosylation motif) and the 5' region of the ADH 1 terminator. The synthetic DNA fragment could be ligated into Bsu36l/Sphl-digested pDB3927 to produce pDB2588. Plasmids containing the expression cassettes for the production of IL-1 RA genetically fused to the C-terminus of HSA and the HSA variants K500A, D550N, K573A and K573P were prepared as follows. pDB2588 was digested with Bsu36l/Sphl and a 705bp fragment containing the '3 region of the HSA encoding gene, nucleotide sequence encoding a GS linker, nucleotide sequence encoding human IL1 -RA (N84Q) and the 5' region of a modified S. cerevisiae ADH1 terminator (SEQ ID3) was purified using standard techniques then ligated into Bsu36l/Sphl-digested pDB4006 (containing HSA K573A expression cassette), pDB4010 (containing HSA D550N expression cassette), pDB4086 (containing HSA K500A expression cassette), pDB41 10 (containing HSA K573P expression cassette) to generate pDB4287, pDB4286, pDB4285 and pDB4288, respectively (for an example, see Figure 23). pDB4285-pDB4288 were digested with Nsi l/Pvu l and the linearised DNA molecules were purified using standard techniques. One hundred ng Nsil/Pvul- digested DNA samples were mixed with 100ng Acc65l/BamHI-digested pDB3936 (9721 bp) (i.e. in vivo cloning) and used to transform S. cerevisiae (i.e. by in vivo cloning) using the Sigma Yeast Transformation kit described below.
Preparation of an S. cerevisiae strain expressing wild type HSA genetically fused to a GS linker and IL1 -RA (N84Q) (see Table 18) could also be generated following the methods described above.
The fusion polypeptides were analysed for their binding to FcRn using the SPR method described above and following results were obtained:
Table 20: Kinetics of HSA fusion variants.
Albumin variant3 i ka i kd i KDb
ii (103/Ms) i (10 3/s) i (MM)
HSAWT i 9.7±0.0 ii 30.0+0.1 i 3.1
i K574N i 4.9±01 iii 8.4+0.1 ii 1 .7
iii Q580K ii 6.0±0.0 ii 9.3+0.0 ii 1 .5
: K573P ii 2.8±0.0 ! 0.4+0.0 ii 0.1
: HSA-WT-FLAG i 8.2±0.2 iii 24.0+0.2 ii 2.9
I HSA-D550N-FLAG ii 5.9±0.0 i 49.0+0.1 i 8.3
i HSA-K500A-FLAG ii NDC ii ND ii ND
i HSA-K573A-FLAG ii 6.1 ±0.1 ii 7.1 +0.1 ii 1 .1
i HSA-K573P-FLAG ii 6.2±0.1 iii 1 .2+0.1 ii 0.2
: HSA-WT-IL1 RA i 6.2±0.0 i 25.0+0.2 ii 4.0
I HSA-K500A-IL1 RA i i ND i ND i ND
i HSA-D550N-IL1 RA i 7.310.2 iii 38.0+0.0 ii 5.2
i HSA-K573A-IL1 RA i 6.1 +0.0 ii 7.1 +0.1 ii 1 .1
i HSA-K573P-IL1 RA i 6.2+0.1 iii 1 .3+0.1 ii 0.2
i scFv-HSA-K500A-FLAG ii ND i ND ii ND
Figure imgf000064_0001
a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU).
b: The kinetic rate constants were obtained using a simple first-order (1 :1 ) bimolecular interaction model. The kinetic values represent the average of duplicates.
c: Not determined due to weak binding (ND).
In example 8 it was shown that the K500A variant did not significantly bind shFcRn, in Example 10 it was shown that the K573P and K573A variants bind shFcRn stronger than HSA and in Example 1 1 it was shown that the D550N variant binds FcRn weaker than HSA.
In the present example it is shown that these observed difference in binding properties also are reflected in fusion polypeptides in different configurations: C-terminal fusions with a small moiety (HSA-FLAG), C-terminal fusions with a larger polypeptide (HSA-IL1 RA); N-terminal fusions with polypeptide (scFv-HSA); N- and C-terminal fusions (scFv-HSA-FLAG and scFv-HSA-scFv- FLAG).
Example 17. Conjugation of Horseradish peroxidase protein to Albumin and the K573P variant.
For conjugation analysis, commercially available recombinant albumin (Recombumin™) was used as a control molecule. For this example, a final 200mg/mL albumin K573P variant of the invention was purified from a fed batch fermentation by means described in Material and Methods. A two step purification was carried out; The first step used a column (bed volume approximately 400ml_, bed height 1 1 cm) packed with AlbuPureTM matrix (ProMetic). This was equilibrated with 50mM sodium acetate, pH 5.3 and loaded with neat culture supernatant, at approximately pH 5.5-6.5, to approximately 20 mg/mL matrix. The column was then washed with approximately 5 column volumes each of 50mM sodium acetate, pH 5.3, 50mM sodium phosphate, pH 6.0, 50mM sodium phosphate, pH 7.0 and 50mM ammonium acetate, pH 8.0, respectively. Bound protein was eluted using approximately two column volumes of 50mM ammonium acetate, 10mM octanoate, pH 7.0. The flow rate for the entire purification was 154ml_/min.
For the second step, the eluate from the first step was diluted approximately two fold with water to give a conductivity of 2.5±0.5 mS/cm after adjustment to pH 5.5±0.3 with acetic acid. This was loaded onto a DEAE-Sepharose Fast Flow (GE Healthcare) column (bed volume approximately 400ml_, bed height 1 1 cm), equilibrated with 80mM sodium acetate, 5mM octanoate, pH 5.5. Loading was approximately 30mg protein/mL matrix. The column was washed with approximately 5 column volumes of 80mM sodium acetate, 5mM octanoate, pH 5.5. Followed by approximately 10 column volumes of 15.7mM potassium tetraborate, pH 9.2. The bound protein was eluted using two column volumes of 1 10mM potassium tetraborate, 200mM sodium chloride, approximately pH 9.0. The flow rate was 183mL/min during the load and wash steps, and 169mL/min during the elution step.
The eluate was concentrated and diafiltered against 145mM NaCI, using a Pall Centramate Omega 10,000 Nominal MWCO membrane, to give a final protein concentration of approximately 200mg/mL.
Both 200mg/mL stock solutions of the rHA and K573P variant albumin were diluted down to 5mg/mL, using phosphate buffer saline (PBS), pH adjusted to pH 6.5-6.7. This ensured a favourable pH environment for the maleimide reactive group of the EZ-Link® Maleimide Activated Horseradish Peroxidase (Thermo Scientific) to react with the free sulphydryl, to form a stable thioester bond. 2mg of the EZ-Link® Maleimide Activated Horseradish Peroxidase (HRP) was mixed with either 1 mL of the 5mg/ML rHA or K573P variant albumin. This mixture ensured an approximate 2 fold molar excess of the albumin, or K573P variant albumin. This mixture was minimally incu bated at 4 °C, for 24 hours. The reaction mixtures were then checked for conjugation, using GP-HPLC.
To separate unconjugated species (rHA, or Albumin variant K573P and unreacted HRP) from the corresponding conjugated species the samples were first concentrated (Vivaspin20, 10,000 MWCO PES, Sartorius), and then individually applied to a Tricorn Superdex™ 200, 10/300 GL column (G E Healthcare), run at a flow rate of 45cm/hr in PBS. The elution peak was fractionated and GP-HPLC analysed. Fractions containing the conjugated species were pooled, concentrated and diafiltered against 50mM NaCI and analysed by GP-HPLC to demonstrate (Figure 24)
These samples were then assayed using the Biacore method described herein (Table 21 ). This example demonstrates that the K573P maintains its increased affinity for shFcRn compared the the WT HSA.
Example 18. Conjugation of Fluorescein to Albumin and the K573P variant.
The two same albumin samples used in Example 17, were also the start materials for this example. I.e. Approximately 200mg/ml_ rHA or the K573P albumin variant.
Fluorescein-5-Maleimide, Thermo Scientific (F5M) was dissolved in dimethylformamide, to give a final concentration of 25mg/ml_. This was then further diluted into 18mls of PBS, pH adjusted to approximately pH 6.5. To this solution either 1 ml of 200mg/ml_ rHA or 1 ml_ of 200mg/ml_ K573P variant was added. This gave an approximate 20 fold final molar excess of F5M. These samples were incubated and allowed to conjugate overnight at 4°C, in the dark, to allow the maleimide groups on the F5M to react with predominantly the free sulfhydryl, present in both albumin species.
Following overnight incubation aliquots of the reaction mixtures were extensively diafiltered against 50mM NaCI to remove unconjugated F5M, (Vivaspin20, 10,000 MWCO PES, Sartorius). Conjugation was confirmed by ultraviolet visualization of conjugated Fluorescein::Albumins Following standard SDS-PAGE (Figure 25).
These diafiltered samples were then assayed using the Biacore method described herein (Table 21 ). This example demonstrates that the conjugation of a small molecule to either rHA or a variant, e.g. K573P does not affect the trend in binding affinities to shFcRn. Table 21 : Representative Biacore assay KD values of conjugated rHA or a variant (K573P) when binding to immobilized shFcRn.
Figure imgf000066_0001
Example 19. Further albumin variants.
The following variants were generated using the methods described in Example 1 E492T, N503D, E492T+N503D, K538H, E542D, D494N+E495Q+T496A, E495Q+T496A, N403K, K541A and K541 N. SPR analysis was carried out as described in Example 15 and the results presented in Figure 26 and figure 27.
Figure 30A and 30B shows the effect on shFcRn binding for the albumin variants.
Substitutions N503D, D494N+E495Q+T496A E492T+N503D, E495Q+T496A within HSA had a negative inpact on binding to shFcRn at pH5.5. Example 20. Variants of albumin at the C-termini.
The following variants were generated using the methods described in Example 1 . Binding to the shFcRn was determined as described in Materials and Methods and the results are presented in Table 22.
Table 22: Kinetics of the HSA C-terminal swapped variant interactions with shFcRn.
Albumin i ka kd KDb
variant3 I (103/Ms) (10 3/s) I (μΜ)
I; HSA :! 4.4±0.0 24.0+0.1 i: 5.4
i MacS A !: 3.1 ±0.1 8.6+0.1 I; 2.7
i HSA-MacC 5 4.110.1 5.6+0.0 !: 1 .3
|i MouseSA0 |i 3.8+0.0 3.1 +0.1 I; 0.8
: HSA-MouseC i: 3.7+0.1 1 .3+0.0 i: 0.3
: RabbitSA" :i 1 .9+0.3 1 .7+0.1 i: 0.9
: HSA-RabC ! 3.5+0.0 1 .6+0.0 I; 0.4
i SheepSA I; ND ND !: ND
i HSA-SheepC i 3.3+0.0 2.1 +0.0 ! 0.6 a: Dilutions of HSA variants were injected over immobilized shFcRn (-1500 RU).
b: The kinetic rate constants were obtained using a simple first-order (1 :1 ) bimolecular interaction model.
c: Data from Table 2
d: Data from Table 3
Not determined due to weak binding (ND) This example demonstrates that for all C-terminal swaps to human albumin tested an increase in binding over the donor albumin was observed. All donor sequences contain the K573P substitution shown to significantly increase binding but less that the K573P alone (Table 20).
Example 21. Competitive binding analysis of variant albumin fusions
Competitive binding studies, using variant albumin fusions and a selection of variant albumins prepared as described in Example 1 , were performed as described in Example 4. Results are presented in Figures 28-31.
The competitive binding hierarchy was identical for the variants fusions of HSA-FLAG and , N+C-terminal scFv HSA-FLAG to the hierarchy of the individual HSA variants (unfused and fused) affinity data. For the IL1 Ra variants K573P, K573A, and the K500A were as predicted, however the D550N appears to inhibit more efficiently than the WT fusion.
Example 22. Further HSA variants
The following variants were generated using methods described in Example 1 : HSA E492G+K573A, HSA E492G+ N503K+ K573A, HSA E492G+ N503H + K573A, HSA E492G + K573P, HSA E492G + N503K + K573P, HSA E492G + N503H + K573P. SPR analysis was performed as described in Materials and Methods. Results (Figure 32) showed that all HSA variants bound more strongly to shFcRn compared to wild type HSA at pH 5.5. No binding was observed at pH 7.4.
HSA E492G+K573A, HSA E492G+ N503K+ K573A, unlike HSA E492G+ N503H + K573A, had marginally improved binding beyond that of HSA K573A. The combination variants containing K573P did not show improved binding over the K573P single variant.

Claims

A Method for preparing a variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof, comprising following steps: a. Providing a nucleic acid encoding a parent albumin having at least 80% sequence identity to SEQ ID NO: 2;
b. Modifying the sequence of step a., to encode a variant albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof having one or more substitutions corresponding to the substitutions in SEQ ID NO: 2 selected among:
Q417A,C,D,E,F,G,H,I,K,L,M,N,P, R,S,T,V,W,Y;
H440A,C,D,E,F,G, l,K,L,M,N,P,Q,R,S,T,V,W,Y;
A490C,D,E, F,G,H,I,K,L,M,N,P, R,S,T,V,W,Y
E492A,C,D,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
V493A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T.W,Y:
D494A,C,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
E495A,C,D,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
T496A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,V,W,Y;
P499A,C,D,E,F,G,H,I,K,L,M,N, Q,R,S,T,V,W,Y;
K500A,C,D,E,F,G,H,I, ,L,M,N, Q,R,S,T,V,W,Y;
E501A,C,D,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
N503A,C,D,E,F,G,H,I,K,L,M, P,Q,R,S,T,V,W,Y;
A504C,D,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
E505A,C,D,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
T506A,C,D,F,G,H,I,K,L,M,N,P,Q,R,S, V,W,Y;
H510A,C,D,F,G, l,K,L,M,N,P,Q,R,S,T,V,W,Y;
H535A,C,D,F,G, l,K,L,M,N,P,Q,R,S,T,V,W,Y;
K536A,C,D,E,F,G,H,I, L,M,N,P,Q,R,S,T,V,W,Y;
P537A,C,D,E,F,G,H,I,K,L,M,N, Q,R,S,T,V,W,Y;
K538A,C,D,E,F,G,H,I, L,M,N,P,Q,R,S,T,V,W,Y;
T540A,C,D,E,F,G,H,I, L,M,N,P,Q,R,S, ,V,W,Y;
K541A,C,D,E,F,G,H,I, L,M,N,P,Q,R,S,T,V,W,Y;
E542A,C,D,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y; D550A,C,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
K573A,C,D,E,F,G,H,I, L,M,N,P,Q,R,S,T,V,W,Y;
K574A,C,D,E,F,G,H,I, L,M,N,P,Q,R,S,T,V,W,Y;
Q580A,C,D,E,F,G,H,I, K, L,M,N,P,R,S,T,V,W,Y;
A581 C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y;
A582C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y; or
G584A,C,D,E,F,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y; c. Introducing the modified sequence of step b., in a suitable host cell; d. Growing the cells in a suitable growth medium under condition leading to expression of the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof; and
e. Recovering the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof from the growth medium; wherein the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof, has an altered plasma half-life compared with the parent albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof.
2. A variant of albumin, fragments thereof or fusion polypeptides comprising said variant albumin or a fragment thereof having altered plasma half-life compared with the parent albumin, fragment thereof or fusion polypeptide comprising said parent albumin or fragment thereof, comprising one or more substitutions in positions corresponding to the positions in SEQ ID NO:2 selected among: 573, 500, 550, 492, 580, 574, 417, 440, 464, 490, 493, 494, 495, 496, 499, 501 , 503, 504, 505, 506, 510, 535, 536, 537, 538, 540, 541 , 542, 575, 577, 578, 579, 581 , 582 and 584, where the variant is not the variant consisting of SEQ ID NO: 2 with the substitution D494N, E501 K, K541 E, D550G,A, K573E or K574N..
3. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to claim 2, having a longer plasma half-life than the parent albumin.
4. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to claim 3, comprising one or more substitutions c o r r e s p o n d i n g t o t h e f o l l o w i n g s u b s t i t u t i o n s i n S E Q I D N O : 2 : K573Y,W,P,H,F,V,I,T,N,S,G,M,C,A,E,Q,R,L,D. K573P+K574N+A577T+A578R+S579C+Q580K+A581D+G584A.
K573P+A577E+A578S+Q580K+A582T, K573P+A578S+S579T+G584A, K573P+L575F+G584A, E492G, N503K, K500R N503H, D550E, , K574N, Q580K and E492G+N503K, E492G+N503H. E492H+E501 P+N503H+E505D+T506S+T540S+K541 E, E492G + K573A, E492 G + N 503 K+ K573 A, E492G+N503H, E492G+K573P,
E492G+N503K+K573P, E492G+N503H+K573P.
5. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to claim 2, having a shorter plasma half-life than the parent albumin
6. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to claim 5, comprising one or more substitution(s) corresponding to the substitutions in SEQ ID NO: 2 selected among: K500E,G,D,A,S,C,P,H,F,N,W,T,M,Y,V,Q,L,I,R. D550N, H464Q, H510Q, H535Q,
D494N,Q,A. E495QA T496A, E492G+V493P, K541G,D, D494N+E495Q+T496A, E495Q+T496A, E492G+V493P+K538H+K541 N+E542D, N503K,D P499A, K541A,N, D494E + Q 4 1 7 H , Q 4 1 7 A , E 4 9 2 T + N 5 0 3 D , A490D+E492T+V493L+E501 P+N503D+A504E+E505K+T506F+K541 D, K536A, P537A, E501A,Q, E492G+K538H+K541N+E542D.
7. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to any of the previous claims, comprising one or more further alteration that generates thio group on the surface.
8. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to the previous claims, wherein the sequence identity of the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof to SEQ ID NO: 2 is more than 80%, preferably more than 90%, more preferred more than 95%, more preferred more than 96%, even more preferred more than 97%, more preferred more than 98% and most preferred more than 99%. The variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof according to the previous claims being a variant fragment of albumin or a fusion polypeptide comprising a variant fragment of albumin wherein the fragment is at least 20 amino acids, preferably at least 50 amino acids, preferably at least 100 amino acids, more preferred at least 200 amino acids, more preferred at least 300 amino acids, more preferred at least 400 amino acids and most preferred at least 500 amino acids.
9. A nucleic acid encoding the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof of claim 2.
10. A conjugate comprising the variant albumin or fragment thereof according to claim 2 and a beneficial therapeutic moiety.
1 1 . An Associate comprising the variant albumin or fragment thereof according to claim 2 and a beneficial therapeutic moiety.
12. A fusion polypeptide comprising a variant albumin or fragment thereof according to claim 2 and a fusion partner polypeptide.
13. A composition comprising a variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof or a conjugate comprising said variant albumin, wherein the binding to FcRn is stronger than for the corresponding albumin or fragment thereof or fusion polypeptide comprising said albumin or fragment thereof or a conjugate comprising said albumin.
14. The composition of claim 13 where the binding to FcRn is stronger than the binding of HSA to FcRn.
15. The composition of claim 14, wherein the binding coefficient of the variant of albumin, fragments thereof or fusion polypeptide comprising said variant albumin or fragment thereof or a conjugate comprising said variant albumin to FcRn is less than 0.9X KD for HSA, more preferred less than 0.5X KD for HSA, more preferred less than 0.1X KD for HSA, even more preferred less than 0.05X KD for HSA, even more preferred less than 0.02X KD for HSA and most preferred less than 0.01 X KD for HSA.
16. The composition according to any of claims 12-15, comprising a variant albumin or a fragment thereof according to claim 1 , a conjugate of claim 10, an associate of claim 1 1 or a fusion polypeptide of claim 12.
17. The composition according to any of claims 13-16, comprising a variant albumin or a fragment thereof according to claim 1 , further comprising a compound comprising a ABD and a pharmaceutically beneficial moiety.
18. The composition according to any of the claims 13-17, being a pharmaceutical composition.
PCT/EP2010/066572 2009-10-30 2010-11-01 Albumin variants WO2011051489A2 (en)

Priority Applications (37)

Application Number Priority Date Filing Date Title
JP2012535864A JP2013509170A (en) 2009-10-30 2010-11-01 Albumin variant
EP18188293.7A EP3421491A3 (en) 2009-10-30 2010-11-01 Albumin variants
EP10771471.9A EP2493921B1 (en) 2009-10-30 2010-11-01 Albumin variants
MX2014010841A MX367177B (en) 2009-10-30 2010-11-01 Albumin variants.
CN201080060322.5A CN102741280B (en) 2009-10-30 2010-11-01 Albumin variants
BR112012009450A BR112012009450A2 (en) 2009-10-30 2010-11-01 albumin variants
GB1209553.5A GB2488077A (en) 2009-10-30 2010-11-01 Albumin variants
ES10771471T ES2700230T3 (en) 2009-10-30 2010-11-01 Albumin variants
MX2012004793A MX2012004793A (en) 2009-10-30 2010-11-01 Albumin variants.
AU2010311332A AU2010311332B2 (en) 2009-10-30 2010-11-01 Albumin variants
US13/504,326 US8748380B2 (en) 2009-10-30 2010-11-01 Albumin variants
RU2012122173A RU2607374C2 (en) 2009-10-30 2010-11-01 Versions of albumin
KR1020127013398A KR101874834B1 (en) 2009-10-30 2010-11-01 Albumin variants
CA2776241A CA2776241A1 (en) 2009-10-30 2010-11-01 Albumin variants
US13/882,653 US20130225496A1 (en) 2010-11-01 2011-11-01 Albumin Variants
EP11778866.1A EP2635598A1 (en) 2010-11-01 2011-11-01 Albumin variants
CN2011800638125A CN103347893A (en) 2010-11-01 2011-11-01 Albumin variants
PCT/EP2011/069188 WO2012059486A1 (en) 2010-11-01 2011-11-01 Albumin variants
IL218858A IL218858B (en) 2009-10-30 2012-03-27 Albumin variants
US14/262,244 US20140234311A1 (en) 2009-10-30 2014-04-25 Albumin variants
US14/863,836 US20160075762A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,868 US20160075763A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,752 US20160075760A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,780 US20160075761A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,655 US20160075757A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,719 US20160075759A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,597 US20160075756A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,685 US20160075758A1 (en) 2009-10-30 2015-09-24 Albumin variants
US14/863,628 US20160009787A1 (en) 2009-10-30 2015-09-24 Albumin variants
US15/709,261 US20180105577A1 (en) 2009-10-30 2017-09-19 Albumin variants
US15/709,227 US20180072792A1 (en) 2009-10-30 2017-09-19 Albumin variants
US15/709,263 US20180105578A1 (en) 2009-10-30 2017-09-19 Albumin variants
US15/709,169 US20180105576A1 (en) 2009-10-30 2017-09-19 Albumin variants
US15/870,349 US20180162925A1 (en) 2009-10-30 2018-01-12 Albumin variants
US15/870,376 US20180222963A1 (en) 2009-10-30 2018-01-12 Albumin variants
US15/979,319 US10696732B2 (en) 2009-10-30 2018-05-14 Albumin variants
US16/882,019 US20200385442A1 (en) 2009-10-30 2020-05-22 Albumin variants

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
EP09174698 2009-10-30
EP09174698.2 2009-10-30
US32717110P 2010-04-23 2010-04-23
US61/327,171 2010-04-23
US34800110P 2010-05-25 2010-05-25
US61/348,001 2010-05-25
EP10174162.7 2010-08-26
EP10174162 2010-08-26

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/504,326 A-371-Of-International US8748380B2 (en) 2009-10-30 2010-11-01 Albumin variants
US14/262,244 Division US20140234311A1 (en) 2009-10-30 2014-04-25 Albumin variants

Publications (2)

Publication Number Publication Date
WO2011051489A2 true WO2011051489A2 (en) 2011-05-05
WO2011051489A3 WO2011051489A3 (en) 2011-06-23

Family

ID=43922679

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/066572 WO2011051489A2 (en) 2009-10-30 2010-11-01 Albumin variants

Country Status (14)

Country Link
US (19) US8748380B2 (en)
EP (2) EP3421491A3 (en)
JP (3) JP2013509170A (en)
KR (1) KR101874834B1 (en)
CN (2) CN102741280B (en)
AU (1) AU2010311332B2 (en)
BR (1) BR112012009450A2 (en)
CA (1) CA2776241A1 (en)
ES (1) ES2700230T3 (en)
GB (1) GB2488077A (en)
IL (1) IL218858B (en)
MX (1) MX2012004793A (en)
RU (1) RU2607374C2 (en)
WO (1) WO2011051489A2 (en)

Cited By (99)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012059486A1 (en) 2010-11-01 2012-05-10 Novozymes Biopharma Dk A/S Albumin variants
WO2012150319A1 (en) 2011-05-05 2012-11-08 Novozymes Biopharma Dk A/S Albumin variants
EP2536756A1 (en) * 2010-02-16 2012-12-26 MedImmune, LLC Hsa-related compositions and methods of use
WO2013006675A1 (en) 2011-07-05 2013-01-10 Novozymes Biopharma Uk Limited Albumin formulation and use
WO2013010840A2 (en) 2011-07-18 2013-01-24 Arts Biologics A/S Long acting biologically active luteinizing hormone (lh) compound
WO2013075066A2 (en) 2011-11-18 2013-05-23 Eleven Biotherapeutics, Inc. Proteins with improved half-life and other properties
WO2013135896A1 (en) 2012-03-16 2013-09-19 Novozymes Biopharma Dk A/S Albumin variants
WO2013167750A2 (en) 2012-05-11 2013-11-14 Prorec Bio Ab Method for diagnosis and treatment of prolactin associated disorders
WO2014005596A1 (en) 2012-07-03 2014-01-09 Aarhus Universitet Modified payload molecules and their interactions and uses
US20140128326A1 (en) * 2012-11-08 2014-05-08 Novozymes Biopharma Dk A/S Albumin variants
US8748380B2 (en) 2009-10-30 2014-06-10 Novozymes Biopharma Dk A/S Albumin variants
WO2014125082A1 (en) 2013-02-16 2014-08-21 Novozymes Biopharma Dk A/S Pharmacokinetic animal model
WO2015014228A1 (en) 2013-08-01 2015-02-05 江苏泰康生物医药有限公司 Glp-1 analog fusion protein and preparation method and use thereof
WO2015066550A1 (en) 2013-10-31 2015-05-07 Resolve Therapeutics, Llc Therapeutic nuclease-albumin fusions and methods
US9045564B2 (en) 2011-02-15 2015-06-02 Medimmune, Llc HSA-related compositions and methods of use
WO2015063611A3 (en) * 2013-11-01 2015-11-05 University Of Oslo Albumin variants and uses thereof
WO2016025645A1 (en) 2014-08-12 2016-02-18 Massachusetts Institute Of Technology Synergistic tumor treatment with il-2, a therapeutic antibody, and an immune checkpoint blocker
WO2016025642A1 (en) 2014-08-12 2016-02-18 Massachusetts Institute Of Technology Synergistic tumor treatment with il-2 and integrin-binding-fc-fusion protein
WO2016064817A1 (en) 2014-10-22 2016-04-28 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
US9388231B2 (en) 2012-07-13 2016-07-12 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
WO2016145307A1 (en) 2015-03-12 2016-09-15 Medimmune, Llc Method of purifying albumin-fusion proteins
WO2016166360A1 (en) 2015-04-17 2016-10-20 Bayer Pharma Aktiengesellschaft Bispecific antibody constructs for cdh3 and cd3
US9499605B2 (en) 2011-03-03 2016-11-22 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
WO2017021362A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Antibody constructs for flt3 and cd3
WO2017021349A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Bispecific antibody constructs binding dll3 and cd3
WO2017021354A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Antibody constructs for cd70 and cd3
WO2017021370A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Bispecific antibody constructs binding egfrviii and cd3
WO2017021356A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Bispecific antibody constructs binding mesothelin and cd3
WO2017112847A1 (en) 2015-12-22 2017-06-29 Albumedix A/S Improved protein expression strains
WO2017117631A1 (en) 2016-01-07 2017-07-13 Csl Limited Mutated truncated von willebrand factor
WO2017184590A1 (en) 2016-04-18 2017-10-26 The Broad Institute Inc. Improved hla epitope prediction
US9823255B2 (en) 2013-06-17 2017-11-21 Armo Biosciences, Inc. Method for assessing protein identity and stability
WO2018065491A1 (en) 2016-10-04 2018-04-12 Albumedix A/S Uses of recombinant yeast-derived serum albumin
US9943568B2 (en) 2013-04-18 2018-04-17 Armo Biosciences, Inc. Methods of using pegylated interleukin-10 for treating cancer
WO2018082758A1 (en) 2016-11-04 2018-05-11 Aarhus Universitet Identification and treatment of tumors characterized by an overexpression of the neonatal fc receptor
WO2018096396A1 (en) * 2016-11-22 2018-05-31 University Of Oslo Albumin variants and uses thereof
WO2018115953A1 (en) 2016-12-21 2018-06-28 Prometic Pharma Smt Limited Methods and compositions for preventing or minimizing epithelial-mesenchymal transition
US10010588B2 (en) 2013-08-30 2018-07-03 Armo Biosciences, Inc. Methods of using pegylated interleukin-10 for treating hyperlipidemia
WO2018148671A1 (en) 2017-02-12 2018-08-16 Neon Therapeutics, Inc. Hla-based methods and compositions and uses thereof
WO2018234518A1 (en) 2017-06-22 2018-12-27 CSL Behring Lengnau AG Modulation of fviii immunogenicity by truncated vwf
WO2018234349A1 (en) 2017-06-20 2018-12-27 Albumedix Ltd Improved protein expression strains
US10195274B2 (en) 2015-05-28 2019-02-05 Armo Biosciences Inc. Method of modulating a chimeric antigen receptor t cell immune response by administering IL-10
WO2019036605A2 (en) 2017-08-17 2019-02-21 Massachusetts Institute Of Technology Multiple specificity binders of cxc chemokines and uses thereof
US10233228B2 (en) 2010-04-09 2019-03-19 Albumedix Ltd Albumin derivatives and variants
WO2019075519A1 (en) * 2017-10-18 2019-04-25 Csl Limited Human serum albumin variants and uses thereof
US10293043B2 (en) 2014-06-02 2019-05-21 Armo Biosciences, Inc. Methods of lowering serum cholesterol
WO2019104385A1 (en) 2017-11-29 2019-06-06 Csl Limited Method of treating or preventing ischemia-reperfusion injury
US10350270B2 (en) 2014-10-14 2019-07-16 Armo Biosciences, Inc. Interleukin-15 compositions and uses thereof
WO2019140196A1 (en) 2018-01-12 2019-07-18 Amgen Inc. Anti-pd-1 antibodies and methods of treatment
US10398761B2 (en) 2015-08-25 2019-09-03 Armo Biosciences, Inc. Methods of using combinations of PEG-IL-10 and IL-15 for treating cancers
WO2019218009A1 (en) 2018-05-16 2019-11-21 Csl Limited Soluble complement receptor type 1 variants and uses thereof
US10548954B2 (en) 2010-07-09 2020-02-04 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
WO2020025792A1 (en) 2018-08-03 2020-02-06 Amgen Research (Munich) Gmbh Antibody constructs for cldn18.2 and cd3
WO2020049151A1 (en) 2018-09-06 2020-03-12 Bavarian Nordic A/S Storage improved poxvirus compositions
WO2020072700A1 (en) 2018-10-02 2020-04-09 Dana-Farber Cancer Institute, Inc. Hla single allele lines
US10618970B2 (en) 2015-02-03 2020-04-14 Armo Biosciences, Inc. Method of treating cancer with IL-10 and antibodies that induce ADCC
US10633428B2 (en) 2015-08-20 2020-04-28 Albumedix Ltd Albumin variants and conjugates
US10640504B2 (en) 2017-09-08 2020-05-05 Amgen Inc. Inhibitors of KRAS G12C and methods of using the same
WO2020092202A2 (en) 2018-10-29 2020-05-07 Biogen Ma Inc. Humanized and stabilized fc5 variants for enhancement of blood brain barrier transport
WO2020131586A2 (en) 2018-12-17 2020-06-25 The Broad Institute, Inc. Methods for identifying neoantigens
WO2020187848A1 (en) 2019-03-18 2020-09-24 Biontech Cell & Gene Therapies Gmbh Lnterleukin-2 receptor (il2r) and interleukin-2 (il2) variants for specific activation of immune effector cells
WO2020200481A1 (en) 2019-04-05 2020-10-08 Biontech Rna Pharmaceuticals Gmbh Treatment involving interleukin-2 (il2) and interferon (ifn)
US10801070B2 (en) 2013-11-25 2020-10-13 The Broad Institute, Inc. Compositions and methods for diagnosing, evaluating and treating cancer
US10835585B2 (en) 2015-05-20 2020-11-17 The Broad Institute, Inc. Shared neoantigens
WO2020252039A1 (en) 2019-06-12 2020-12-17 Biontech Us Inc. Neoantigen compositions and uses thereof
EP3753567A1 (en) 2011-10-11 2020-12-23 Viela Bio, Inc. Cd40l-specific tn3-derived scaffolds and methods of use thereof
WO2021044362A1 (en) 2019-09-06 2021-03-11 Novartis Ag Therapeutic fusion proteins
US10975442B2 (en) 2014-12-19 2021-04-13 Massachusetts Institute Of Technology Molecular biomarkers for cancer immunotherapy
US10993997B2 (en) 2014-12-19 2021-05-04 The Broad Institute, Inc. Methods for profiling the t cell repertoire
EP3819007A1 (en) 2019-11-11 2021-05-12 Amgen Research (Munich) GmbH Dosing regimen for anti-bcma agents
WO2021111143A1 (en) 2019-12-04 2021-06-10 Albumedix Limited Methods and compositions produced thereby
WO2021150824A1 (en) 2020-01-22 2021-07-29 Amgen Research (Munich) Gmbh Combinations of antibody constructs and inhibitors of cytokine release syndrome and uses thereof
WO2021183861A1 (en) 2020-03-12 2021-09-16 Amgen Inc. Method for treatment and prophylaxis of crs in patients comprising a combination of bispecifc antibodies binding to cds x cancer cell and tnfalpha or il-6 inhibitor
WO2021180943A1 (en) 2020-03-12 2021-09-16 Bavarian Nordic A/S Compositions improving poxvirus stability
WO2021185775A1 (en) 2020-03-16 2021-09-23 Biontech Cell & Gene Therapies Gmbh Antigen-specific t cell receptors and t cell epitopes
US11183272B2 (en) 2018-12-21 2021-11-23 Biontech Us Inc. Method and systems for prediction of HLA class II-specific epitopes and characterization of CD4+ T cells
WO2021236638A1 (en) 2020-05-19 2021-11-25 Amgen Inc. Mageb2 binding constructs
WO2022060901A1 (en) 2020-09-16 2022-03-24 Amgen Inc. Methods for administering therapeutic doses of bispecific t-cell engaging molecules for the treatment of cancer
WO2022096700A1 (en) 2020-11-06 2022-05-12 Amgen Research (Munich) Gmbh Polypeptide constructs selectively binding to cldn6 and cd3
WO2022096704A1 (en) 2020-11-06 2022-05-12 Amgen Inc. Antigen binding domain with reduced clipping rate
WO2022096698A1 (en) 2020-11-06 2022-05-12 Amgen Inc. Polypeptide constructs binding to cd3
WO2022103781A1 (en) 2020-11-10 2022-05-19 Amgen Inc. Methods for administering a bcma x cd3 binding molecule
WO2022132596A2 (en) 2020-12-14 2022-06-23 Biontech Us Inc. Tissue-specific antigens for cancer immunotherapy
US11413332B2 (en) 2013-11-11 2022-08-16 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
US11434302B2 (en) 2016-02-03 2022-09-06 Amgen Research (Munich) Gmbh Bispecific T cell engaging antibody constructs
US11452768B2 (en) 2013-12-20 2022-09-27 The Broad Institute, Inc. Combination therapy with neoantigen vaccine
US11541103B2 (en) 2017-08-03 2023-01-03 Amgen Inc. Interleukin-21 mutein/ anti-PD-1 antibody conjugates
US11549149B2 (en) 2017-01-24 2023-01-10 The Broad Institute, Inc. Compositions and methods for detecting a mutant variant of a polynucleotide
US11555061B2 (en) 2009-02-11 2023-01-17 Albumedix, Ltd Albumin variants and conjugates
US11661462B2 (en) 2014-07-31 2023-05-30 Amgen Research (Munich) Gmbh Optimized cross-species specific bispecific single chain antibody contructs
US11725237B2 (en) 2013-12-05 2023-08-15 The Broad Institute Inc. Polymorphic gene typing and somatic change detection using sequencing data
WO2024015892A1 (en) 2022-07-13 2024-01-18 The Broad Institute, Inc. Hla-ii immunopeptidome methods and systems for antigen discovery
WO2024077256A1 (en) 2022-10-07 2024-04-11 The General Hospital Corporation Methods and compositions for high-throughput discovery ofpeptide-mhc targeting binding proteins
WO2024077044A1 (en) 2022-10-05 2024-04-11 Amgen Inc. Combination therapies comprising t-cell redirecting therapies and agonistic anti-il-2r antibodies or fragments thereof
WO2024089258A1 (en) 2022-10-28 2024-05-02 Aarhus Universitet Albumin conjugated to cpg oligodeoxynucleotides as super-boosters of immune response
WO2024170756A1 (en) 2023-02-17 2024-08-22 Ablynx N.V. Polypeptides binding to the neonatal fc receptor
US12071484B2 (en) 2011-06-13 2024-08-27 Csl Limited Nucleic acids encoding antibodies against human granulocyte-colony stimulating factor receptor (G-CSFR) and method of expressing encoded protein
WO2024200573A1 (en) 2023-03-27 2024-10-03 LAVA Therapeutics N.V. Nectin-4 binding agents and methods of use
EP4442251A1 (en) 2023-04-05 2024-10-09 Albumedix Ltd Formulations and uses thereof

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6555543B2 (en) 2000-08-04 2003-04-29 Dmi Biosciences, Inc. Method of using diketopiperazines and composition containing them
KR20150080004A (en) 2003-05-15 2015-07-08 앰피오 파마슈티컬스 인코퍼레이티드 Treatment of t-cell mediated diseases
JP5856843B2 (en) 2008-05-27 2016-02-10 アンピオ ファーマシューティカルズ,インコーポレイテッド Pharmaceutical composition using diketopiperazine
CA2800173C (en) 2010-05-21 2019-05-14 Ulrik Nielsen Bi-specific fusion proteins
MY172699A (en) 2011-10-10 2019-12-10 Ampio Pharmaceuticals Inc Implantable medical devices with increased immune tolerance, and methods for making and implanting
WO2013055734A1 (en) 2011-10-10 2013-04-18 Ampio Pharmaceuticals, Inc. Treatment of degenerative joint disease
MX355446B (en) 2011-10-28 2018-04-18 Ampio Pharmaceuticals Inc Treatment of rhinitis.
BR112015017958A2 (en) * 2013-02-01 2017-07-11 Ampio Pharmaceuticals Inc methods for producing diketopiperazine and compositions containing diketopiperazine
EP2968315B1 (en) 2013-03-15 2020-06-03 Ampio Pharmaceuticals, Inc. Compositions for the mobilization, homing, expansion and differentiation of stem cells and methods of using the same
TWI683666B (en) 2013-03-15 2020-02-01 美商百歐維拉提夫治療公司 Factor ix polypeptide formulations
WO2016028790A1 (en) 2014-08-18 2016-02-25 Ampio Pharmaceuticals, Inc. Treatment of joint conditions
JP2016179951A (en) * 2015-03-23 2016-10-13 学校法人 中央大学 Transgenic animal serum albumin, hemoglobin-transgenic animal serum albumin complex, artificial plasma expander, and artificial oxygen carrier
JP2018517708A (en) 2015-06-05 2018-07-05 ニューヨーク・ユニバーシティ Compositions and methods for anti-staphylococcal biological agents
US11389512B2 (en) 2015-06-22 2022-07-19 Ampio Pharmaceuticals, Inc. Use of low molecular weight fractions of human serum albumin in treating diseases
CN115960249A (en) 2015-10-02 2023-04-14 银溪制药股份有限公司 Bispecific therapeutic proteins for tissue repair
US20200270335A1 (en) 2015-12-23 2020-08-27 Biogen Ma Inc. Dkk2 cysteine rich domain 2 containing proteins and uses thereof
US11110122B2 (en) * 2016-06-03 2021-09-07 New York University Methods and reagents for modulating macrophage phenotype
US10268924B2 (en) * 2016-12-05 2019-04-23 Sap Se Systems and methods for integrated cargo inspection
KR102599445B1 (en) * 2018-10-25 2023-11-08 닛폰세이테츠 가부시키가이샤 Coating liquid for forming an insulating film for grain-oriented electrical steel sheets, grain-oriented electrical steel sheets, and method for manufacturing grain-oriented electrical steel sheets
GB202004514D0 (en) 2020-03-27 2020-05-13 Inst De Medicina Molecular Joaeo Lobo Antunes Treatment of Immunosuppressive Cancer

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0286424A1 (en) 1987-04-09 1988-10-12 Delta Biotechnology Limited Yeast vector
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1995017413A1 (en) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Process for the evolutive design and synthesis of functional polymers based on designer elements and codes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
WO2000044772A2 (en) 1999-01-30 2000-08-03 Delta Biotechnology Limited Human serum albumin
WO2000069902A1 (en) 1999-05-17 2000-11-23 Conjuchem, Inc. Long lasting fusion peptide inhibitors or viral infection
WO2001079480A1 (en) 2000-04-12 2001-10-25 Human Genome Sciences, Inc. Albumin fusion proteins
WO2003059934A2 (en) 2001-12-21 2003-07-24 Human Genome Sciences, Inc. Albumin fusion proteins
WO2004071536A1 (en) 2003-02-17 2004-08-26 Upperton Limited Conjugates for medical imaging comprising carrier, targeting moiety and a contrast agent
US20040171154A1 (en) 2001-07-27 2004-09-02 Francesca Storici Systems for in vivo site-directed mutagenesis using oligonucleotides
WO2005061718A1 (en) 2003-12-23 2005-07-07 Delta Biotechnology Limited Gene expression technique
WO2006066595A2 (en) 2004-12-22 2006-06-29 Novozymes A/S Recombinant production of serum albumin
EP1788084A1 (en) 2004-08-06 2007-05-23 Juridical Foundation The Chemo-Sero-Therapeutic Research Institute Yeast promoter
WO2009019314A1 (en) 2007-08-08 2009-02-12 Novozymes A/S Transferrin variants and conjugates
WO2010092135A2 (en) 2009-02-11 2010-08-19 Novozymes Biopharma Uk Ltd. Albumin variants and conjugates

Family Cites Families (150)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9019919D0 (en) 1990-09-12 1990-10-24 Delta Biotechnology Ltd Purification of proteins
US5625041A (en) 1990-09-12 1997-04-29 Delta Biotechnology Limited Purification of proteins
US2714586A (en) 1951-06-25 1955-08-02 Phillips Petroleum Co Washing urea and thiourea containing adducts
US4302386A (en) 1978-08-25 1981-11-24 The Ohio State University Antigenic modification of polypeptides
US4741900A (en) 1982-11-16 1988-05-03 Cytogen Corporation Antibody-metal ion complexes
US4757006A (en) 1983-10-28 1988-07-12 Genetics Institute, Inc. Human factor VIII:C gene and recombinant methods for production
JPS60169498A (en) 1984-02-10 1985-09-02 Kyowa Hakko Kogyo Co Ltd Adult t cell leukemic viral antigen peptide derivative
EP0218712B1 (en) 1985-04-12 1992-02-26 Genetics Institute, Inc. Novel procoagulant proteins
GR860984B (en) 1985-04-17 1986-08-18 Zymogenetics Inc Expression of factor vii and ix activities in mammalian cells
ATE125865T1 (en) 1987-08-28 1995-08-15 Novo Nordisk As RECOMBINANT HUMICOLA LIPASE AND METHOD FOR PRODUCING RECOMBINANT HUMICOLA LIPASES.
GB8725529D0 (en) 1987-10-30 1987-12-02 Delta Biotechnology Ltd Polypeptides
IL88326A (en) 1987-11-18 1993-03-15 Gist Brocades Nv Purification of serum albumin
US5075222A (en) 1988-05-27 1991-12-24 Synergen, Inc. Interleukin-1 inhibitors
GB8909916D0 (en) 1989-04-29 1989-06-14 Delta Biotechnology Ltd Polypeptides
US5766883A (en) 1989-04-29 1998-06-16 Delta Biotechnology Limited Polypeptides
FR2650598B1 (en) 1989-08-03 1994-06-03 Rhone Poulenc Sante DERIVATIVES OF ALBUMIN WITH THERAPEUTIC FUNCTION
US5073627A (en) 1989-08-22 1991-12-17 Immunex Corporation Fusion proteins comprising GM-CSF and IL-3
US5208020A (en) 1989-10-25 1993-05-04 Immunogen Inc. Cytotoxic agents comprising maytansinoids and their therapeutic use
GB8927722D0 (en) 1989-12-07 1990-02-07 British Bio Technology Proteins and nucleic acids
DE4000939A1 (en) 1990-01-15 1991-07-18 Brem Gottfried Prof Dr Dr METHOD FOR OBTAINING ANTIBODIES
JP3230091B2 (en) 1990-06-25 2001-11-19 ウェルファイド株式会社 Method for suppressing coloration of human serum albumin
US5698426A (en) 1990-09-28 1997-12-16 Ixsys, Incorporated Surface expression libraries of heteromeric receptors
CA2058820C (en) 1991-04-25 2003-07-15 Kotikanyad Sreekrishna Expression cassettes and vectors for the secretion of human serum albumin in pichia pastoris cells
US5264586A (en) 1991-07-17 1993-11-23 The Scripps Research Institute Analogs of calicheamicin gamma1I, method of making and using the same
FR2686899B1 (en) 1992-01-31 1995-09-01 Rhone Poulenc Rorer Sa NOVEL BIOLOGICALLY ACTIVE POLYPEPTIDES, THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM.
US5663060A (en) 1992-04-07 1997-09-02 Emory University Hybrid human/animal factor VIII
ZA932522B (en) 1992-04-10 1993-12-20 Res Dev Foundation Immunotoxins directed against c-erbB-2(HER/neu) related surface antigens
DE4226971C2 (en) 1992-08-14 1997-01-16 Widmar Prof Dr Tanner Modified fungal cells and processes for the production of recombinant products
US5728553A (en) 1992-09-23 1998-03-17 Delta Biotechnology Limited High purity albumin and method of producing
DE69329503T2 (en) 1992-11-13 2001-05-03 Idec Pharma Corp Therapeutic use of chimeric and labeled antibodies directed against a differentiation antigen, the expression of which is restricted to human B lymphocyte, for the treatment of B cell lymphoma
WO1995003402A1 (en) 1993-07-22 1995-02-02 Merck & Co., Inc. EXPRESSION OF HUMAN INTERLEUKIN-1β IN A TRANSGENIC ANIMAL
US6811773B1 (en) 1993-12-22 2004-11-02 Human Genome Sciences, Inc. Human monocyte colony inhibitory factor (M-CIF) polypeptides
GB9404270D0 (en) * 1994-03-05 1994-04-20 Delta Biotechnology Ltd Yeast strains and modified albumins
US5773001A (en) 1994-06-03 1998-06-30 American Cyanamid Company Conjugates of methyltrithio antitumor agents and intermediates for their synthesis
US7597886B2 (en) 1994-11-07 2009-10-06 Human Genome Sciences, Inc. Tumor necrosis factor-gamma
US5712374A (en) 1995-06-07 1998-01-27 American Cyanamid Company Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates
US5714586A (en) 1995-06-07 1998-02-03 American Cyanamid Company Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates
US5716808A (en) 1995-11-09 1998-02-10 Zymogenetics, Inc. Genetic engineering of pichia methanolica
US5955349A (en) 1996-08-26 1999-09-21 Zymogenetics, Inc. Compositions and methods for producing heterologous polypeptides in Pichia methanolica
GB9526733D0 (en) 1995-12-30 1996-02-28 Delta Biotechnology Ltd Fusion proteins
US6509313B1 (en) 1996-02-28 2003-01-21 Cornell Research Foundation, Inc. Stimulation of immune response with low doses of cytokines
CN1230997A (en) 1996-07-17 1999-10-06 津莫吉尼蒂克斯公司 Transformation of pichia methanolica
US5736383A (en) 1996-08-26 1998-04-07 Zymogenetics, Inc. Preparation of Pichia methanolica auxotrophic mutants
US6274305B1 (en) 1996-12-19 2001-08-14 Tufts University Inhibiting proliferation of cancer cells
US6605699B1 (en) 1997-01-21 2003-08-12 Human Genome Sciences, Inc. Galectin-11 polypeptides
US7196164B2 (en) 1997-07-08 2007-03-27 Human Genome Sciences, Inc. Secreted protein HHTLF25
US7053190B2 (en) 1997-03-07 2006-05-30 Human Genome Sciences, Inc. Secreted protein HRGDF73
US6506569B1 (en) 1997-05-30 2003-01-14 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor TR10
US5948609A (en) 1997-12-03 1999-09-07 Carter; Daniel C. Oxygen-transporting albumin-based blood replacement composition and blood volume expander
WO2000008207A1 (en) 1998-08-06 2000-02-17 Syntron Bioresearch, Inc. Uric acid assay device with stabilized uricase reagent composition
AU3128000A (en) 1998-12-23 2000-07-31 Human Genome Sciences, Inc. Peptidoglycan recognition proteins
EP1178786A4 (en) 1999-05-21 2006-03-01 American Bioscience Inc Protein stabilized pharmacologically active agents, methods for the preparation thereof and methods for the use thereof
MXPA02009221A (en) 2000-03-22 2005-07-25 Octagene Gmbh Production of recombinant blood clotting factors in human cell lines.
US20030091565A1 (en) 2000-08-18 2003-05-15 Beltzer James P. Binding polypeptides and methods based thereon
EP1366077B1 (en) 2000-09-15 2011-05-25 Coley Pharmaceutical GmbH PROCESS FOR HIGH THROUGHPUT SCREENING OF CpG-BASED IMMUNO-AGONIST/ANTAGONIST
WO2002055110A2 (en) 2000-10-25 2002-07-18 Genzyme Corp Methods for treating blood coagulation disorders
WO2002043658A2 (en) 2000-11-06 2002-06-06 The Jackson Laboratory Fcrn-based therapeutics for the treatment of auto-immune disorders
KR20080085082A (en) 2000-12-07 2008-09-22 일라이 릴리 앤드 캄파니 Glp-1 fusion proteins
US7175988B2 (en) 2001-02-09 2007-02-13 Human Genome Sciences, Inc. Human G-protein Chemokine Receptor (CCR5) HDGNR10
US7507413B2 (en) 2001-04-12 2009-03-24 Human Genome Sciences, Inc. Albumin fusion proteins
EP2228389B1 (en) 2001-04-13 2015-07-08 Human Genome Sciences, Inc. Antibodies against vascular endothelial growth factor 2
AUPR446701A0 (en) 2001-04-18 2001-05-17 Gene Stream Pty Ltd Transgenic mammals for pharmacological and toxicological studies
WO2002102830A1 (en) 2001-06-15 2002-12-27 New Century Pharmaceuticals, Inc. Human albumin animal models for drug evaluation, toxicology and immunogenicity studies
AUPR622301A0 (en) 2001-07-09 2001-08-02 Novapharm Research (Australia) Pty Ltd Infection control system
CN1405182A (en) * 2001-08-10 2003-03-26 中国人民解放军军事医学科学院生物工程研究所 Serum albumin and granulocyte colony stimulating factor fusion protein
ES2500918T3 (en) 2001-12-21 2014-10-01 Human Genome Sciences, Inc. Albumin and interferon beta fusion proteins
US20080167238A1 (en) 2001-12-21 2008-07-10 Human Genome Sciences, Inc. Albumin Fusion Proteins
JP2005516607A (en) 2002-02-07 2005-06-09 デルタ バイオテクノロジー リミテッド HIV inhibitory protein
EP1572936A2 (en) 2002-03-05 2005-09-14 Eli Lilly And Company Heterologous g-csf fusion proteins
WO2003102136A2 (en) 2002-05-30 2003-12-11 Human Genome Sciences, Inc. Antibodies that specifically bind to neurokinin b
CN1241946C (en) 2002-07-01 2006-02-15 美国福源集团 Human serum albumins recombined merge protein having hyperplasia stimulation function to multiple cells
GB0217347D0 (en) 2002-07-26 2002-09-04 Univ Edinburgh Novel albumins
AU2003257032A1 (en) 2002-08-02 2004-02-23 Human Genome Sciences, Inc. Antibodies against c3a receptor
WO2004058044A2 (en) 2002-11-19 2004-07-15 Drg International, Inc. Diagnostic method for diseases by screening for hepcidin in human or animal tissues, blood or body fluids and therapeutic uses therefor
CA2513213C (en) 2003-01-22 2013-07-30 Human Genome Sciences, Inc. Albumin fusion proteins
GB0305989D0 (en) 2003-03-15 2003-04-23 Delta Biotechnology Ltd Agent
US20070041987A1 (en) 2003-03-19 2007-02-22 Daniel Carter Fragments or polymers of albumin with tunable vascular residence time for use in therapeutic delivery and vaccine development
WO2004092405A2 (en) 2003-04-15 2004-10-28 Xenon Pharmaceuticals Inc. Juvenile hemochromatosis gene (hfe2a), expression products and uses thereof
WO2004101620A2 (en) 2003-05-01 2004-11-25 Compound Therapeutics, Inc. Serum albumin scaffold-based proteins and uses thereof
US7569215B2 (en) 2003-07-18 2009-08-04 Massachusetts Institute Of Technology Mutant interleukin-2 (IL-2) polypeptides
US6949961B2 (en) 2003-10-06 2005-09-27 Semiconductor Components Industries, L.L.C. Power switch structure with low RDSon and low current limit
WO2005082423A2 (en) 2003-11-18 2005-09-09 Beth Israel Deaconess Medical Center Serum albumin conjugated to fluorescent substances for imaging
US9057061B2 (en) 2003-12-23 2015-06-16 Novozymes Biopharma Dk A/S Gene expression technique
GB0329722D0 (en) 2003-12-23 2004-01-28 Delta Biotechnology Ltd Modified plasmid and use thereof
JP4649954B2 (en) 2003-12-26 2011-03-16 ニプロ株式会社 Albumin with enhanced antibacterial activity
CA2486245C (en) 2003-12-26 2013-01-08 Nipro Corporation Albumin having enhanced antimicrobial activity
KR100671005B1 (en) 2004-01-15 2007-01-18 고려대학교 산학협력단 Biomarker proteins for diagnosing the exposure to PAH
RU2369404C2 (en) * 2004-02-09 2009-10-10 Хьюман Дженом Сайенсиз, Инк. Fused proteins of albumine
SI1729795T1 (en) 2004-02-09 2016-04-29 Human Genome Sciences, Inc. Albumin fusion proteins
JP4492156B2 (en) 2004-03-03 2010-06-30 ニプロ株式会社 Protein containing serum albumin domain
US20060018859A1 (en) 2004-07-16 2006-01-26 Carter Daniel C Modified human serum albumin with reduced or eliminated affinity to chemical or biological contaminants at Cys 34
US20060051859A1 (en) * 2004-09-09 2006-03-09 Yan Fu Long acting human interferon analogs
CA2580141C (en) 2004-09-23 2013-12-10 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2006073195A1 (en) 2005-01-07 2006-07-13 Biomarker Science Co., Ltd Method for predicting or diagnosing diabetes and kit for predicting or diagnosing diabetes
US20060178301A1 (en) 2005-02-04 2006-08-10 Mathias Jurs Albumin-fused ciliary neurotrophic factor
WO2006118772A2 (en) 2005-04-29 2006-11-09 The Jackson Laboratory Fcrn antibodies and uses thereof
GB0512707D0 (en) 2005-06-22 2005-07-27 Delta Biotechnology Ltd Gene expression technique
CN101287750A (en) * 2005-08-12 2008-10-15 人类基因科学公司 Albumin fusion proteins
JP2009504157A (en) * 2005-08-12 2009-02-05 ヒューマン ジノーム サイエンシーズ, インコーポレイテッド Albumin fusion protein
US8008257B2 (en) * 2005-10-20 2011-08-30 University Of Ottawa Heart Institute ANF fusion proteins
MX2008008076A (en) 2005-12-22 2008-11-28 Conjuchem Biotechnologies Inc Process for the production of preformed conjugates of albumin and a therapeutic agent.
EP1816201A1 (en) 2006-02-06 2007-08-08 CSL Behring GmbH Modified coagulation factor VIIa with extended half-life
WO2007112940A2 (en) 2006-03-31 2007-10-11 Ablynx N.V. Albumin-derived amino acid sequence, use thereof for increasing the half-life of therapeutic proteins and of other therapeutic compounds and entities, and constructs comprising the same
EP2474318A1 (en) 2006-06-07 2012-07-11 Human Genome Sciences, Inc. Albumin fusion proteins
WO2007144173A1 (en) 2006-06-14 2007-12-21 Csl Behring Gmbh Proteolytically cleavable fusion protein comprising a blood coagulation factor
US9139611B2 (en) 2006-07-13 2015-09-22 Novozymes Biopharma Dk A/S Process for preparing particles of proteinaceous material
JP4983148B2 (en) 2006-08-18 2012-07-25 ニプロ株式会社 Glycan-containing albumin, method for producing the same, and use thereof
KR20090060294A (en) 2006-09-08 2009-06-11 암브룩스, 인코포레이티드 Modified human plasma polypeptide or fc scaffolds and their uses
US20100129846A1 (en) 2006-12-07 2010-05-27 Power3 Medical Products, Inc. Isoform specificities of blood serum proteins and their use as differentially expressed protein biomarkers for diagnosis of breast cancer
US8906356B2 (en) 2007-11-05 2014-12-09 Massachusetts Institute Of Technology Mutant interleukin-2 (IL-2) polypeptides
CA2611540C (en) 2007-11-09 2017-05-30 Nipro Corporation Sugar chain-containing albumin as a drug carrier to the liver
EP2245064B1 (en) 2007-12-21 2014-07-23 Medimmune Limited BINDING MEMBERS FOR INTERLEUKIN-4 RECEPTOR ALPHA (IL-4Ralpha)
PL2288715T3 (en) 2008-04-11 2015-03-31 Merrimack Pharmaceuticals Inc Human serum albumin linkers and conjugates thereof
US20110112040A1 (en) 2008-04-28 2011-05-12 President And Fellows Of Harvard College Supercharged proteins for cell penetration
AU2009270793A1 (en) 2008-07-18 2010-01-21 Oragenics, Inc. Compositions for the detection and treatment of colorectal cancer
KR20110112301A (en) * 2008-11-18 2011-10-12 메리맥 파마슈티컬즈, 인크. Human serum albumin linkers and conjugates thereof
US20120009123A1 (en) 2008-12-05 2012-01-12 Abraxis Bioscience, Llc Albumin binding peptide-mediated disease targeting
CN102307905B (en) 2008-12-10 2015-11-25 斯克利普斯研究院 Chemical reactivity alpha-non-natural amino acid is utilized to produce carrier-peptide conjugate
AU2010234459A1 (en) 2009-04-08 2011-11-03 The Regents Of The University Of California Human protein scaffold with controlled serum pharmacokinetics
EP2424877A4 (en) 2009-04-28 2013-01-02 Harvard College Supercharged proteins for cell penetration
WO2010138814A2 (en) 2009-05-29 2010-12-02 The Brigham And Women's Hospital, Inc. Disrupting fcrn-albumin interactions
ES2548030T3 (en) 2009-06-01 2015-10-13 Medimmune, Llc Molecules with prolonged half-lives and uses thereof
KR101286721B1 (en) 2009-06-05 2013-07-16 한국과학기술연구원 Recombinant albumins fused with poly-cysteine peptide and the methods for preparing the same
RU2547592C2 (en) 2009-07-20 2015-04-10 Нэйшнл Ченг Кунг Юниверсити αvβ3 INTEGRIN SELECTIVE POLYPEPTIDES CONJUGATED WITH VARIANT OF HUMAN SERUM ALBUMIN (HSA), AND THEIR PHARMACEUTICAL APPLICATIONS
EP2456787A4 (en) 2009-07-24 2013-01-30 Univ Leland Stanford Junior Cytokine compositions and methods of use thereof
DK2889624T3 (en) 2009-08-10 2018-12-10 Ucl Business Plc Reversible covalent bonding of functional molecules
US20110172398A1 (en) 2009-10-02 2011-07-14 Boehringer Ingelheim International Gmbh Bispecific binding molecules for anti-angiogenesis therapy
JP2013507132A (en) 2009-10-10 2013-03-04 ザ ボード オブ トラスティーズ オブ ザ リーランド スタンフォード ジュニア ユニバーシティ IL-17 family cytokine composition and use
CA2776241A1 (en) 2009-10-30 2011-05-05 Novozymes Biopharma Dk A/S Albumin variants
US9044436B2 (en) 2009-12-23 2015-06-02 National Cheng Kung University Compositions and methods for the treatment of angiogenesis-related eye diseases
CN101875693B (en) 2010-01-22 2012-07-18 成都正能生物技术有限责任公司 Albumin variant having anti-angiogenesis activity and preparation method thereof
CN104610454A (en) 2010-02-16 2015-05-13 米迪缪尼有限公司 HSA-related compositions and methods of use
WO2011124718A1 (en) 2010-04-09 2011-10-13 Novozymes A/S Albumin derivatives and variants
CA2800173C (en) 2010-05-21 2019-05-14 Ulrik Nielsen Bi-specific fusion proteins
WO2011161127A1 (en) 2010-06-21 2011-12-29 Medimmune, Llc Protease variants of human neprilysin
US9012609B2 (en) 2010-08-13 2015-04-21 Glaxosmithkline Intellectual Property Development Limited Anti-serum albumin binding variants
US20130225496A1 (en) 2010-11-01 2013-08-29 Novozymes Biopharma Dk A/S Albumin Variants
JP2014510518A (en) 2011-02-15 2014-05-01 メディミューン,エルエルシー HSA related compositions and methods of use
US9045564B2 (en) 2011-02-15 2015-06-02 Medimmune, Llc HSA-related compositions and methods of use
GB2491006A (en) * 2011-05-05 2012-11-21 Novozymes Biopharma Uk Ltd Albumin variants
WO2013010840A2 (en) 2011-07-18 2013-01-24 Arts Biologics A/S Long acting biologically active luteinizing hormone (lh) compound
EP2780364A2 (en) 2011-11-18 2014-09-24 Eleven Biotherapeutics, Inc. Proteins with improved half-life and other properties
US9944691B2 (en) 2012-03-16 2018-04-17 Albumedix A/S Albumin variants
WO2014005596A1 (en) 2012-07-03 2014-01-09 Aarhus Universitet Modified payload molecules and their interactions and uses
US20140128326A1 (en) * 2012-11-08 2014-05-08 Novozymes Biopharma Dk A/S Albumin variants
CN105007722A (en) 2013-02-16 2015-10-28 诺维信生物制药丹麦公司 Pharmacokinetic animal model
WO2014179657A1 (en) 2013-05-03 2014-11-06 Eleven Biotherapeutics, Inc. Albumin variants binding to fcrn
US20160222087A1 (en) 2013-09-13 2016-08-04 Novozymes Biopharma Dk A/S Albumin variants
JP6306700B2 (en) * 2013-11-01 2018-04-04 ユニバーシティ オブ オスロUniversity of Oslo Modified albumin and use thereof
BR112018003179A2 (en) 2015-08-20 2018-09-25 Albumedix As albumin conjugates and variants

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0286424A1 (en) 1987-04-09 1988-10-12 Delta Biotechnology Limited Yeast vector
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
WO1992006204A1 (en) 1990-09-28 1992-04-16 Ixsys, Inc. Surface expression libraries of heteromeric receptors
WO1995017413A1 (en) 1993-12-21 1995-06-29 Evotec Biosystems Gmbh Process for the evolutive design and synthesis of functional polymers based on designer elements and codes
WO1995022625A1 (en) 1994-02-17 1995-08-24 Affymax Technologies N.V. Dna mutagenesis by random fragmentation and reassembly
WO2000044772A2 (en) 1999-01-30 2000-08-03 Delta Biotechnology Limited Human serum albumin
WO2000069902A1 (en) 1999-05-17 2000-11-23 Conjuchem, Inc. Long lasting fusion peptide inhibitors or viral infection
WO2001079271A1 (en) 2000-04-12 2001-10-25 Principia Pharmaceutical Corporation Albumin fusion proteins
WO2001079480A1 (en) 2000-04-12 2001-10-25 Human Genome Sciences, Inc. Albumin fusion proteins
US20040171154A1 (en) 2001-07-27 2004-09-02 Francesca Storici Systems for in vivo site-directed mutagenesis using oligonucleotides
WO2003059934A2 (en) 2001-12-21 2003-07-24 Human Genome Sciences, Inc. Albumin fusion proteins
WO2004071536A1 (en) 2003-02-17 2004-08-26 Upperton Limited Conjugates for medical imaging comprising carrier, targeting moiety and a contrast agent
WO2005061718A1 (en) 2003-12-23 2005-07-07 Delta Biotechnology Limited Gene expression technique
EP1788084A1 (en) 2004-08-06 2007-05-23 Juridical Foundation The Chemo-Sero-Therapeutic Research Institute Yeast promoter
WO2006066595A2 (en) 2004-12-22 2006-06-29 Novozymes A/S Recombinant production of serum albumin
WO2009019314A1 (en) 2007-08-08 2009-02-12 Novozymes A/S Transferrin variants and conjugates
WO2010092135A2 (en) 2009-02-11 2010-08-19 Novozymes Biopharma Uk Ltd. Albumin variants and conjugates

Non-Patent Citations (66)

* Cited by examiner, † Cited by third party
Title
ANDERSEN ET AL., CLINICAL BIOCHEMISTRY, vol. 43, 2010, pages 367 - 372
ANDERSEN ET AL., EUR. J. IMMUNOL, vol. 36, 2006, pages 3044 - 3051
ANDERSEN ET AL., J.BIOL.CHEM., vol. 285, no. 7, 2010, pages 4826 - 4836
ANDERSEN ET AL., JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 285, no. 7, 2010, pages 4826 - 36
ATSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
BARASH, TRANSGENIC RESEARCH, vol. 2, 1993, pages 266 - 276
BARTON ET AL., NUCLEIC ACIDS RES., vol. 18, 1990, pages 7349 - 4966
BERNTZEN ET AL., J. IMMUNOL. METHODS, vol. 298, 2005, pages 93 - 104
BOSSE ET AL., J. CLIN. PHARMACOL., vol. 45, 2005, pages 57 - 67
BOWIE; SAUER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 2152 - 2156
CALISSANO; MACINO, FUNGAL GENET. NEWSLETT., vol. 43, 1996, pages 15 - 16
CARLSON ET AL., PROC.NAT.ACAD.SCI.USA, vol. 89, 1992, pages 8225 - 8229
CHAUDHURY ET AL., BIOCHEMISTRY, vol. 45, 2006, pages 4983 - 4990
COLLINS, S.H.: "Protein production by biotechnology", 1990, ELSEVIER, article "Production of secreted proteins in yeast", pages: 61 - 77
DERBYSHIRE ET AL., GENE, vol. 46, 1986, pages 145
ELBLE, BIOTECHNIQUES, vol. 13, 1992, pages 18
EVANS ET AL., PROTEIN EXPRESSION AND PURIFICATION, vol. 73, 2010, pages 113 - 124
FARRAN, TRANSGENIC RESEARCH, vol. 11, 2002, pages 337 - 346
FEBS J., vol. 275, no. 16, August 2008 (2008-08-01), pages 4097 - 110
FLEER, BIOLTECHNOLOGY, vol. 9, 1991, pages 968 - 975
GALLIANO ET AL., BIOCHIM. BIOPHYS.ACTA, vol. 1225, 1993, pages 27 - 32
GOUGH ET AL., J. MOL. BIOL., vol. 313, 2000, pages 903 - 919
GUO; SHERMAN, MOL. CELLULAR BIOL., vol. 15, 1995, pages 5983 - 5990
HOLM; PARK, BIOINFORMATICS, vol. 16, 2000, pages 566 - 567
HOLM; SANDER, PROTEINS, vol. 33, 1998, pages 88 - 96
ITO ET AL., J. BACTERIOL., vol. 153, 1983, pages 16
IWAO, B.B.A. PROTEINS AND PROTEOMICS, vol. 1774, 2007, pages 1582 - 1590
J EXP MED., vol. 197, no. 3, 2003, pages 315 - 22
J. SAMBROOK; E.F. FRITSCH; T. MANIATIS: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR
JONES, J. MOL. BIOL., vol. 287, 1999, pages 797 - 815
KENANOVA ET AL., J. NUCL. MED., vol. 50, no. 2, 2009, pages 1582
KOBAYASHI, THERAPEUTIC APHERESIS, vol. 2, 1998, pages 257 - 262
KRATZ, JOURNAL OF CONTROLLED RELEASE, vol. 132, 2008, pages 171 - 183
KREN ET AL., NAT. MED., vol. 4, 1998, pages 285 - 290
KURTZHALS P ET AL., BIOCHEM. J., vol. 312, 1995, pages 725 - 731
LARKIN ET AL., BIOINFORMATICS, vol. 23, 2007, pages 2947 - 2948
LINDAHL; ELOFSSON, J. MOL. BIOL., vol. 295, 2000, pages 613 - 615
LOWMAN ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 10832 - 10837
MCGUFFIN; JONES, BIOINFORMATICS, vol. 19, 2003, pages 874 - 881
MINCHIOTTI ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 916, 1987, pages 411 - 418
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NER ET AL., DNA, vol. 7, 1988, pages 127
NESS ET AL., NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 893 - 896
OBER ET AL., INT. IMMUNOL, vol. 13, 2001, pages 1551 - 1559
ORR-WEAVER; SZOSTAK, PROC. NATL. ACAD. SCI. USA., vol. 80, 1983, pages 4417 - 4421
OTAGIRI ET AL., BIOL. PHARM, BULL., vol. 32, no. 4, 2009, pages 527 - 534
OTAGIRI, BIOL.PHARM. BULL., vol. 32, no. 4, 2009, pages 527 - 534
PANDJAITAB, J. ALLERGY CLIN. IMMUNOL., vol. 105, 2000, pages 279 - 285
PEACH, R. J.; BRENNAN, S. 0., BIOCHIM BIOPHYS ACTA, vol. 1097, 1991, pages 49 - 54
PETERS, T., JR.: "All about Albumin: Biochemistry, Genetics and Medical, Applications", 1996, ACADEMIC PRESS, INC., pages: 10
REIDHAAR-OLSON; SAUER, SCIENCE, vol. 241, 1988, pages 53 - 57
RICE ET AL., THE EUROPEAN MOLECULAR BIOLOGY OPEN SOFTWARE SUITE, 2000
RICE ET AL.: "The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: doi:10.1016/S0168-9525(00)02024-2
ROMANOS ET AL., YEAST, vol. 8, 1992, pages 423 - 488
ROOPENIAN D. C.; AKILESH, S., NAT. REV. IMMUNOL7, 2007, pages 715 - 725
SAMBROOK, J.; D. W. RUSSELL: "Molecular Cloning: a laboratory manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SCHERER; DAVIS, PROC. NATL. ACAD. SCI. USA, vol. 76, 1979, pages 4949 - 4955
SHINDYALOV; BOURNE, PROTEIN ENGINEERING, vol. 11, 1998, pages 739 - 747
SIJMONS, BIOLTECHNOLOGY, vol. 8, 1990, pages 217
SLEEP ET AL., YEAST, vol. 18, 2001, pages 403
SLEEP, BIOLTECHNOLOGY, vol. 8, 1990, pages 42 - 46
SLEEP, D. ET AL., BIO/TECHNOLOGY, vol. 9, 1991, pages 183 - 187
STORICI ET AL., NATURE BIOTECHNOL., vol. 19, 2001, pages 773 - 776
TAKAHASHI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 4413 - 4417
TIAN ET AL., NATURE, vol. 432, 2004, pages 1050 - 1054
WU ET AL., PEDS, vol. 23, no. 10, 2010, pages 789 - 798

Cited By (184)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11555061B2 (en) 2009-02-11 2023-01-17 Albumedix, Ltd Albumin variants and conjugates
US10696732B2 (en) 2009-10-30 2020-06-30 Albumedix, Ltd Albumin variants
US8748380B2 (en) 2009-10-30 2014-06-10 Novozymes Biopharma Dk A/S Albumin variants
US8697650B2 (en) 2010-02-16 2014-04-15 Medimmune, Llc HSA-related compositions and methods of use
US9120875B2 (en) 2010-02-16 2015-09-01 Medimmune, Llc HSA-related compositions and methods of use
EP2536756A1 (en) * 2010-02-16 2012-12-26 MedImmune, LLC Hsa-related compositions and methods of use
EP2536756A4 (en) * 2010-02-16 2013-08-14 Medimmune Llc Hsa-related compositions and methods of use
US10233228B2 (en) 2010-04-09 2019-03-19 Albumedix Ltd Albumin derivatives and variants
US10568943B2 (en) 2010-07-09 2020-02-25 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US10561714B2 (en) 2010-07-09 2020-02-18 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US10548954B2 (en) 2010-07-09 2020-02-04 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US10898554B1 (en) 2010-07-09 2021-01-26 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
WO2012059486A1 (en) 2010-11-01 2012-05-10 Novozymes Biopharma Dk A/S Albumin variants
US20130225496A1 (en) * 2010-11-01 2013-08-29 Novozymes Biopharma Dk A/S Albumin Variants
US9045564B2 (en) 2011-02-15 2015-06-02 Medimmune, Llc HSA-related compositions and methods of use
US10155803B2 (en) 2011-03-03 2018-12-18 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
US10711051B2 (en) 2011-03-03 2020-07-14 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
US9499605B2 (en) 2011-03-03 2016-11-22 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
US8822417B2 (en) 2011-05-05 2014-09-02 Novozymes Biopharma DIC A/S Albumin variants
WO2012150319A1 (en) 2011-05-05 2012-11-08 Novozymes Biopharma Dk A/S Albumin variants
GB2491006A (en) * 2011-05-05 2012-11-21 Novozymes Biopharma Uk Ltd Albumin variants
US12071484B2 (en) 2011-06-13 2024-08-27 Csl Limited Nucleic acids encoding antibodies against human granulocyte-colony stimulating factor receptor (G-CSFR) and method of expressing encoded protein
WO2013006675A1 (en) 2011-07-05 2013-01-10 Novozymes Biopharma Uk Limited Albumin formulation and use
WO2013010840A2 (en) 2011-07-18 2013-01-24 Arts Biologics A/S Long acting biologically active luteinizing hormone (lh) compound
EP3753567A1 (en) 2011-10-11 2020-12-23 Viela Bio, Inc. Cd40l-specific tn3-derived scaffolds and methods of use thereof
US11555062B2 (en) 2011-10-11 2023-01-17 Viela Bio, Inc. Methods of administering a composition comprising a Tn3 scaffold and a CD40L-specific monomer
US11104720B2 (en) 2011-10-11 2021-08-31 Viela Bio, Inc. Nucleic acids encoding a Tn3 scaffold comprising a CD40L-specific monomer subunit
US10711050B2 (en) 2011-11-18 2020-07-14 Albumedix Ltd Variant serum albumin with improved half-life and other properties
WO2013075066A2 (en) 2011-11-18 2013-05-23 Eleven Biotherapeutics, Inc. Proteins with improved half-life and other properties
WO2013075066A3 (en) * 2011-11-18 2013-07-04 Eleven Biotherapeutics, Inc. Variant serum albumin with improved half -life and other properties
WO2013135896A1 (en) 2012-03-16 2013-09-19 Novozymes Biopharma Dk A/S Albumin variants
AU2013234299B2 (en) * 2012-03-16 2017-06-22 Albumedix Ltd. Albumin variants
CN104736559A (en) * 2012-03-16 2015-06-24 诺维信生物制药丹麦公司 Albumin variants
JP2015512893A (en) * 2012-03-16 2015-04-30 ノボザイムス バイオファーマ デーコー アクティーゼルスカブ Albumin variant
US9944691B2 (en) 2012-03-16 2018-04-17 Albumedix A/S Albumin variants
EP3330283A2 (en) 2012-03-16 2018-06-06 Albumedix A/S Albumin variants
US10329340B2 (en) 2012-03-16 2019-06-25 Albumedix Ltd Albumin variants
EP3330283A3 (en) * 2012-03-16 2018-07-11 Albumedix A/S Albumin variants
WO2013167750A2 (en) 2012-05-11 2013-11-14 Prorec Bio Ab Method for diagnosis and treatment of prolactin associated disorders
WO2014005596A1 (en) 2012-07-03 2014-01-09 Aarhus Universitet Modified payload molecules and their interactions and uses
US11248037B2 (en) 2012-07-13 2022-02-15 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
US10358479B2 (en) 2012-07-13 2019-07-23 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
US9388231B2 (en) 2012-07-13 2016-07-12 Zymeworks Inc. Multivalent heteromultimer scaffold design and constructs
EP2917233A1 (en) * 2012-11-08 2015-09-16 Novozymes Biopharma DK A/S Albumin variants
US10501524B2 (en) 2012-11-08 2019-12-10 Albumedix Ltd Albumin variants
JP2015535300A (en) * 2012-11-08 2015-12-10 ノボザイムス バイオファーマ デーコー アクティーゼルスカブ Albumin variant
US10934341B2 (en) 2012-11-08 2021-03-02 Albumedix, Ltd. Albumin variants
RU2670063C2 (en) * 2012-11-08 2018-10-17 Альбумедикс А/С Albumin variants
US20140128326A1 (en) * 2012-11-08 2014-05-08 Novozymes Biopharma Dk A/S Albumin variants
CN105452290A (en) * 2012-11-08 2016-03-30 诺维信生物制药丹麦公司 Albumin variants
GB2512156A (en) * 2012-11-08 2014-09-24 Novozymes Biopharma Dk As Albumin variants
WO2014072481A1 (en) * 2012-11-08 2014-05-15 Novozymes Biopharma Dk A/S Albumin variants
EP3318124A2 (en) 2013-02-16 2018-05-09 Albumedix A/S Pharmacokinetic animal model
EP3318124A3 (en) * 2013-02-16 2018-05-30 Albumedix A/S Pharmacokinetic animal model
WO2014125082A1 (en) 2013-02-16 2014-08-21 Novozymes Biopharma Dk A/S Pharmacokinetic animal model
US9943568B2 (en) 2013-04-18 2018-04-17 Armo Biosciences, Inc. Methods of using pegylated interleukin-10 for treating cancer
US10357545B2 (en) 2013-04-18 2019-07-23 Armo Biosciences, Inc. Methods of using interleukin-10 for treating solid tumors
US9823255B2 (en) 2013-06-17 2017-11-21 Armo Biosciences, Inc. Method for assessing protein identity and stability
US10209261B2 (en) 2013-06-17 2019-02-19 Armo Biosciences Inc. Method for assessing protein identity and stability
WO2015014228A1 (en) 2013-08-01 2015-02-05 江苏泰康生物医药有限公司 Glp-1 analog fusion protein and preparation method and use thereof
US10010588B2 (en) 2013-08-30 2018-07-03 Armo Biosciences, Inc. Methods of using pegylated interleukin-10 for treating hyperlipidemia
US10988745B2 (en) 2013-10-31 2021-04-27 Resolve Therapeutics, Llc Therapeutic nuclease-albumin fusions and methods
WO2015066550A1 (en) 2013-10-31 2015-05-07 Resolve Therapeutics, Llc Therapeutic nuclease-albumin fusions and methods
WO2015066557A1 (en) 2013-10-31 2015-05-07 Resolve Therapeutics, Llc Therapeutic nuclease molecules with altered glycosylation and methods
CN105992770A (en) * 2013-11-01 2016-10-05 奥斯陆大学 Albumin variants and uses thereof
CN105992770B (en) * 2013-11-01 2021-06-25 奥斯陆大学 Variants of albumin and uses thereof
US10781245B2 (en) 2013-11-01 2020-09-22 University Of Oslo Albumin variants and uses thereof
WO2015063611A3 (en) * 2013-11-01 2015-11-05 University Of Oslo Albumin variants and uses thereof
US10208102B2 (en) 2013-11-01 2019-02-19 University Of Oslo Albumin variants and uses thereof
US11413332B2 (en) 2013-11-11 2022-08-16 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
US10801070B2 (en) 2013-11-25 2020-10-13 The Broad Institute, Inc. Compositions and methods for diagnosing, evaluating and treating cancer
US11834718B2 (en) 2013-11-25 2023-12-05 The Broad Institute, Inc. Compositions and methods for diagnosing, evaluating and treating cancer by means of the DNA methylation status
US11725237B2 (en) 2013-12-05 2023-08-15 The Broad Institute Inc. Polymorphic gene typing and somatic change detection using sequencing data
US11452768B2 (en) 2013-12-20 2022-09-27 The Broad Institute, Inc. Combination therapy with neoantigen vaccine
US10293043B2 (en) 2014-06-02 2019-05-21 Armo Biosciences, Inc. Methods of lowering serum cholesterol
US11661462B2 (en) 2014-07-31 2023-05-30 Amgen Research (Munich) Gmbh Optimized cross-species specific bispecific single chain antibody contructs
EP3646879A1 (en) 2014-08-12 2020-05-06 Massachusetts Institute Of Technology Synergistic tumor treatment with il-2 and integrin-binding-fc-fusion protein
WO2016025647A1 (en) 2014-08-12 2016-02-18 Massachusetts Institute Of Technology Synergistic tumor treatment with il-2, a therapeutic antibody, and a cancer vaccine
WO2016025642A1 (en) 2014-08-12 2016-02-18 Massachusetts Institute Of Technology Synergistic tumor treatment with il-2 and integrin-binding-fc-fusion protein
WO2016025645A1 (en) 2014-08-12 2016-02-18 Massachusetts Institute Of Technology Synergistic tumor treatment with il-2, a therapeutic antibody, and an immune checkpoint blocker
US10350270B2 (en) 2014-10-14 2019-07-16 Armo Biosciences, Inc. Interleukin-15 compositions and uses thereof
WO2016064817A1 (en) 2014-10-22 2016-04-28 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
US10143726B2 (en) 2014-10-22 2018-12-04 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
US10653751B2 (en) 2014-10-22 2020-05-19 Armo Biosciences Inc. Methods of treating cancer metastasis by using interleukin-10
US11939637B2 (en) 2014-12-19 2024-03-26 Massachusetts Institute Of Technology Molecular biomarkers for cancer immunotherapy
US10993997B2 (en) 2014-12-19 2021-05-04 The Broad Institute, Inc. Methods for profiling the t cell repertoire
US10975442B2 (en) 2014-12-19 2021-04-13 Massachusetts Institute Of Technology Molecular biomarkers for cancer immunotherapy
US10618970B2 (en) 2015-02-03 2020-04-14 Armo Biosciences, Inc. Method of treating cancer with IL-10 and antibodies that induce ADCC
EP3842451A1 (en) 2015-03-12 2021-06-30 MedImmune, LLC Method of purifying albumin-fusion proteins
WO2016145307A1 (en) 2015-03-12 2016-09-15 Medimmune, Llc Method of purifying albumin-fusion proteins
US11926666B2 (en) 2015-04-17 2024-03-12 Amgen Research (Munich) Gmbh Bispecific antibody constructs for CDH3 and CD3
EP4276116A2 (en) 2015-04-17 2023-11-15 Amgen Research (Munich) GmbH Bispecific antibody constructs for cdh3 and cd3
US11028171B2 (en) 2015-04-17 2021-06-08 Amgen Research (Munich) Gmbh Bispecific antibody constructs for CDH3 and CD3
WO2016166360A1 (en) 2015-04-17 2016-10-20 Bayer Pharma Aktiengesellschaft Bispecific antibody constructs for cdh3 and cd3
US10835585B2 (en) 2015-05-20 2020-11-17 The Broad Institute, Inc. Shared neoantigens
US10195274B2 (en) 2015-05-28 2019-02-05 Armo Biosciences Inc. Method of modulating a chimeric antigen receptor t cell immune response by administering IL-10
US11884720B2 (en) 2015-07-31 2024-01-30 Amgen Research (Munich) Gmbh Antibody constructs for MSLN and CD3
EP4327885A2 (en) 2015-07-31 2024-02-28 Amgen Research (Munich) GmbH Antibody constructs for msln and cd3
US11447567B2 (en) 2015-07-31 2022-09-20 Amgen Research (Munich) Gmbh Antibody constructs for FLT3 and CD3
US11591396B2 (en) 2015-07-31 2023-02-28 Amgen Research (Munich) Gmbh Antibody constructs for DLL3 and CD3
US10683351B2 (en) 2015-07-31 2020-06-16 Amgen Research (Munich) Gmbh Antibody constructs for DLL3 and CD3
EP4382169A2 (en) 2015-07-31 2024-06-12 Amgen Research (Munich) GmbH Antibody constructs for dll3 and cd3
WO2017021354A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Antibody constructs for cd70 and cd3
WO2017021349A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Bispecific antibody constructs binding dll3 and cd3
WO2017021362A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Antibody constructs for flt3 and cd3
WO2017021356A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Bispecific antibody constructs binding mesothelin and cd3
EP3912999A1 (en) 2015-07-31 2021-11-24 Amgen Research (Munich) GmbH Bispecific antibody constructs binding egfrviii and cd3
US10519241B2 (en) 2015-07-31 2019-12-31 Amgen Research (Munich) Gmbh Antibody constructs for EGFRVIII and CD3
US11155629B2 (en) 2015-07-31 2021-10-26 Amgen Research (Munich) Gmbh Method for treating glioblastoma or glioma with antibody constructs for EGFRVIII and CD3
EP4219562A2 (en) 2015-07-31 2023-08-02 Amgen Research (Munich) GmbH Antibody constructs for flt3 and cd3
US10294300B2 (en) 2015-07-31 2019-05-21 Amgen Research (Munich) Gmbh Antibody constructs for DLL3 and CD3
US10851170B2 (en) 2015-07-31 2020-12-01 Amgen Research (Munich) Gmbh Antibody constructs for CD70 and CD3
WO2017021370A1 (en) 2015-07-31 2017-02-09 Amgen Research (Munich) Gmbh Bispecific antibody constructs binding egfrviii and cd3
EP3865514A1 (en) 2015-07-31 2021-08-18 Amgen Research (Munich) GmbH Bispecific antibody constructs binding dll3 and cd3
US10633428B2 (en) 2015-08-20 2020-04-28 Albumedix Ltd Albumin variants and conjugates
US10398761B2 (en) 2015-08-25 2019-09-03 Armo Biosciences, Inc. Methods of using combinations of PEG-IL-10 and IL-15 for treating cancers
WO2017112847A1 (en) 2015-12-22 2017-06-29 Albumedix A/S Improved protein expression strains
US10023618B2 (en) 2015-12-22 2018-07-17 Albumedix A/S Protein expression strains
US10806774B2 (en) 2016-01-07 2020-10-20 CSL Behring Lengnau AG Mutated truncated von Willebrand Factor
WO2017117631A1 (en) 2016-01-07 2017-07-13 Csl Limited Mutated truncated von willebrand factor
US11434302B2 (en) 2016-02-03 2022-09-06 Amgen Research (Munich) Gmbh Bispecific T cell engaging antibody constructs
WO2017184590A1 (en) 2016-04-18 2017-10-26 The Broad Institute Inc. Improved hla epitope prediction
EP3603391A1 (en) 2016-10-04 2020-02-05 Albumedix Ltd Uses of recombinant yeast-derived serum albumin
WO2018065491A1 (en) 2016-10-04 2018-04-12 Albumedix A/S Uses of recombinant yeast-derived serum albumin
WO2018082758A1 (en) 2016-11-04 2018-05-11 Aarhus Universitet Identification and treatment of tumors characterized by an overexpression of the neonatal fc receptor
WO2018096396A1 (en) * 2016-11-22 2018-05-31 University Of Oslo Albumin variants and uses thereof
WO2018115953A1 (en) 2016-12-21 2018-06-28 Prometic Pharma Smt Limited Methods and compositions for preventing or minimizing epithelial-mesenchymal transition
US11549149B2 (en) 2017-01-24 2023-01-10 The Broad Institute, Inc. Compositions and methods for detecting a mutant variant of a polynucleotide
EP4287191A2 (en) 2017-02-12 2023-12-06 BioNTech US Inc. Hla-based methods and compositions and uses thereof
US11650211B2 (en) 2017-02-12 2023-05-16 Biontech Us Inc. HLA-based methods and compositions and uses thereof
WO2018148671A1 (en) 2017-02-12 2018-08-16 Neon Therapeutics, Inc. Hla-based methods and compositions and uses thereof
WO2018234349A1 (en) 2017-06-20 2018-12-27 Albumedix Ltd Improved protein expression strains
US11130979B2 (en) 2017-06-20 2021-09-28 Albumedix Ltd Protein expression strains
US11396670B2 (en) 2017-06-20 2022-07-26 Albumedix Limited Protein expression strains
EP4026908A1 (en) 2017-06-20 2022-07-13 Albumedix Ltd Improved protein expression strains
WO2018234518A1 (en) 2017-06-22 2018-12-27 CSL Behring Lengnau AG Modulation of fviii immunogenicity by truncated vwf
US11141466B2 (en) 2017-06-22 2021-10-12 CSL Behring Lengnau AG Modulation of FVIII immunogenicity by truncated VWF
US11541103B2 (en) 2017-08-03 2023-01-03 Amgen Inc. Interleukin-21 mutein/ anti-PD-1 antibody conjugates
WO2019036605A2 (en) 2017-08-17 2019-02-21 Massachusetts Institute Of Technology Multiple specificity binders of cxc chemokines and uses thereof
US10640504B2 (en) 2017-09-08 2020-05-05 Amgen Inc. Inhibitors of KRAS G12C and methods of using the same
CN111247165A (en) * 2017-10-18 2020-06-05 Csl有限公司 Human serum albumin variants and uses thereof
AU2018350370B2 (en) * 2017-10-18 2023-05-04 Csl Limited Human serum albumin variants and uses thereof
CN111247165B (en) * 2017-10-18 2023-11-10 Csl有限公司 Human serum albumin variants and uses thereof
WO2019075519A1 (en) * 2017-10-18 2019-04-25 Csl Limited Human serum albumin variants and uses thereof
US11466073B2 (en) 2017-10-18 2022-10-11 Csl Limited Human serum albumin variants and uses thereof
WO2019104385A1 (en) 2017-11-29 2019-06-06 Csl Limited Method of treating or preventing ischemia-reperfusion injury
WO2019140196A1 (en) 2018-01-12 2019-07-18 Amgen Inc. Anti-pd-1 antibodies and methods of treatment
US11518808B2 (en) 2018-01-12 2022-12-06 Amgen Inc. Anti-PD-1 antibodies and methods of treatment
EP4410379A2 (en) 2018-05-16 2024-08-07 CSL Ltd. Soluble complement receptor type 1 variants and uses thereof
WO2019218009A1 (en) 2018-05-16 2019-11-21 Csl Limited Soluble complement receptor type 1 variants and uses thereof
WO2020025792A1 (en) 2018-08-03 2020-02-06 Amgen Research (Munich) Gmbh Antibody constructs for cldn18.2 and cd3
US11692031B2 (en) 2018-08-03 2023-07-04 Amgen Research (Munich) Gmbh Antibody constructs for CLDN18.2 and CD3
WO2020049151A1 (en) 2018-09-06 2020-03-12 Bavarian Nordic A/S Storage improved poxvirus compositions
WO2020072700A1 (en) 2018-10-02 2020-04-09 Dana-Farber Cancer Institute, Inc. Hla single allele lines
WO2020092202A2 (en) 2018-10-29 2020-05-07 Biogen Ma Inc. Humanized and stabilized fc5 variants for enhancement of blood brain barrier transport
WO2020131586A2 (en) 2018-12-17 2020-06-25 The Broad Institute, Inc. Methods for identifying neoantigens
US11183272B2 (en) 2018-12-21 2021-11-23 Biontech Us Inc. Method and systems for prediction of HLA class II-specific epitopes and characterization of CD4+ T cells
WO2020187848A1 (en) 2019-03-18 2020-09-24 Biontech Cell & Gene Therapies Gmbh Lnterleukin-2 receptor (il2r) and interleukin-2 (il2) variants for specific activation of immune effector cells
WO2020200481A1 (en) 2019-04-05 2020-10-08 Biontech Rna Pharmaceuticals Gmbh Treatment involving interleukin-2 (il2) and interferon (ifn)
WO2020252039A1 (en) 2019-06-12 2020-12-17 Biontech Us Inc. Neoantigen compositions and uses thereof
WO2021044362A1 (en) 2019-09-06 2021-03-11 Novartis Ag Therapeutic fusion proteins
EP3819007A1 (en) 2019-11-11 2021-05-12 Amgen Research (Munich) GmbH Dosing regimen for anti-bcma agents
WO2021094000A1 (en) 2019-11-11 2021-05-20 Amgen Research (Munich) Gmbh Dosing regimen for anti-bcma agents
EP4424709A2 (en) 2019-11-11 2024-09-04 Amgen Research (Munich) GmbH Dosing regimen for anti-bcma agents
WO2021111143A1 (en) 2019-12-04 2021-06-10 Albumedix Limited Methods and compositions produced thereby
WO2021150824A1 (en) 2020-01-22 2021-07-29 Amgen Research (Munich) Gmbh Combinations of antibody constructs and inhibitors of cytokine release syndrome and uses thereof
WO2021183861A1 (en) 2020-03-12 2021-09-16 Amgen Inc. Method for treatment and prophylaxis of crs in patients comprising a combination of bispecifc antibodies binding to cds x cancer cell and tnfalpha or il-6 inhibitor
WO2021180943A1 (en) 2020-03-12 2021-09-16 Bavarian Nordic A/S Compositions improving poxvirus stability
WO2021185775A1 (en) 2020-03-16 2021-09-23 Biontech Cell & Gene Therapies Gmbh Antigen-specific t cell receptors and t cell epitopes
WO2021236638A1 (en) 2020-05-19 2021-11-25 Amgen Inc. Mageb2 binding constructs
WO2022060901A1 (en) 2020-09-16 2022-03-24 Amgen Inc. Methods for administering therapeutic doses of bispecific t-cell engaging molecules for the treatment of cancer
WO2022096698A1 (en) 2020-11-06 2022-05-12 Amgen Inc. Polypeptide constructs binding to cd3
WO2022096700A1 (en) 2020-11-06 2022-05-12 Amgen Research (Munich) Gmbh Polypeptide constructs selectively binding to cldn6 and cd3
WO2022096704A1 (en) 2020-11-06 2022-05-12 Amgen Inc. Antigen binding domain with reduced clipping rate
WO2022103781A1 (en) 2020-11-10 2022-05-19 Amgen Inc. Methods for administering a bcma x cd3 binding molecule
WO2022132596A2 (en) 2020-12-14 2022-06-23 Biontech Us Inc. Tissue-specific antigens for cancer immunotherapy
WO2024015892A1 (en) 2022-07-13 2024-01-18 The Broad Institute, Inc. Hla-ii immunopeptidome methods and systems for antigen discovery
WO2024077044A1 (en) 2022-10-05 2024-04-11 Amgen Inc. Combination therapies comprising t-cell redirecting therapies and agonistic anti-il-2r antibodies or fragments thereof
WO2024077256A1 (en) 2022-10-07 2024-04-11 The General Hospital Corporation Methods and compositions for high-throughput discovery ofpeptide-mhc targeting binding proteins
WO2024089258A1 (en) 2022-10-28 2024-05-02 Aarhus Universitet Albumin conjugated to cpg oligodeoxynucleotides as super-boosters of immune response
WO2024170756A1 (en) 2023-02-17 2024-08-22 Ablynx N.V. Polypeptides binding to the neonatal fc receptor
WO2024200573A1 (en) 2023-03-27 2024-10-03 LAVA Therapeutics N.V. Nectin-4 binding agents and methods of use
EP4442251A1 (en) 2023-04-05 2024-10-09 Albumedix Ltd Formulations and uses thereof
WO2024209085A1 (en) 2023-04-05 2024-10-10 Albumedix Ltd Formulations and uses thereof

Also Published As

Publication number Publication date
BR112012009450A2 (en) 2017-05-23
KR101874834B1 (en) 2018-07-05
US20160075763A1 (en) 2016-03-17
MX2012004793A (en) 2012-07-20
US20180222963A1 (en) 2018-08-09
CN105567699A (en) 2016-05-11
GB2488077A (en) 2012-08-15
US20160075760A1 (en) 2016-03-17
US20160075761A1 (en) 2016-03-17
US20180105576A1 (en) 2018-04-19
IL218858A0 (en) 2012-06-28
EP3421491A3 (en) 2019-03-27
US20200385442A1 (en) 2020-12-10
JP2016165289A (en) 2016-09-15
US20160075759A1 (en) 2016-03-17
RU2607374C2 (en) 2017-01-10
IL218858B (en) 2018-10-31
US20180265570A1 (en) 2018-09-20
CN102741280A (en) 2012-10-17
ES2700230T3 (en) 2019-02-14
EP2493921A2 (en) 2012-09-05
RU2012122173A (en) 2013-12-10
US10696732B2 (en) 2020-06-30
US20180105577A1 (en) 2018-04-19
JP6306628B2 (en) 2018-04-04
WO2011051489A3 (en) 2011-06-23
AU2010311332A1 (en) 2012-04-26
JP2018102300A (en) 2018-07-05
KR20120101403A (en) 2012-09-13
US20180162925A1 (en) 2018-06-14
JP2013509170A (en) 2013-03-14
US20120220530A1 (en) 2012-08-30
US20180105578A1 (en) 2018-04-19
EP2493921B1 (en) 2018-09-26
CN102741280B (en) 2015-12-02
US20160075758A1 (en) 2016-03-17
US20160075762A1 (en) 2016-03-17
GB201209553D0 (en) 2012-07-11
US20180072792A1 (en) 2018-03-15
US20160009787A1 (en) 2016-01-14
US20160075756A1 (en) 2016-03-17
US20140234311A1 (en) 2014-08-21
US8748380B2 (en) 2014-06-10
EP3421491A2 (en) 2019-01-02
AU2010311332B2 (en) 2015-04-23
CA2776241A1 (en) 2011-05-05
JP6703016B2 (en) 2020-06-03
US20160075757A1 (en) 2016-03-17

Similar Documents

Publication Publication Date Title
US20200385442A1 (en) Albumin variants
EP1427750B1 (en) Modified transferrin fusion proteins
US20160152686A1 (en) Fibronectin based scaffold domains linked to serum albumin or moiety binding thereto
EP1951277A2 (en) Natriuretic peptide modified transferrin fusion proteins
JP2020100633A (en) Albumin variants
AU2015205821B2 (en) Albumin variants

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080060322.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10771471

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 218858

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2010311332

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2776241

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2012/004793

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2010311332

Country of ref document: AU

Date of ref document: 20101101

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012535864

Country of ref document: JP

Ref document number: 13504326

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 4307/CHENP/2012

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20127013398

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 1209553

Country of ref document: GB

Kind code of ref document: A

Free format text: PCT FILING DATE = 20101101

WWE Wipo information: entry into national phase

Ref document number: 1209553.5

Country of ref document: GB

Ref document number: 2012122173

Country of ref document: RU

Ref document number: 2010771471

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012009450

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012009450

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120420