WO2011047153A1 - Methods for modulating autoimmunity - Google Patents

Abstract

The present invention provides methods for inhibiting pathways induced by commensal bacteria of the gastrointestinal (GI) tract that lead to Th 17 differentiation, which in turn leads to localized and systemic accumulation of Thl7 cells that are causally associated with inflammatory and autoimmune disorders and methods for identifying agents useful for treating non-gut autoimmune disorders.

Description

METHODS FOR MODULATING AUTOIMMUNITY

RELATED APPLICATIONS

This application claims the benefit of and priority to U.S. Provisional

Application Serial No. 61/279,152, filed on October 15, 2009, and U.S. Provisional

Patent Application Serial No. 61/397,794, filed on June 16, 2010. The entire contents of each of the foregoing provisional applications are incorporated herein by reference.

GOVERNMENT SUPPORT

The research leading to the present invention was funded in part by NIH grants

P01 AI065858 and RC1AI 087266 and a National Research Service Award DFCJ7NCI: T32 CA007386. Accordingly, the United States government has certain rights in the invention. FIELD OF THE INVENTION

The present invention relates to methods for treating inflammatory and autoimmune disorders. The present invention further relates to methods for inhibiting pathways induced by commensal bacteria of the gastrointestinal (GI) tract that lead to Thl7 differentiation, which in turn leads to localized and systemic accumulation of Thl7 cells that are causally associated with inflammatory and autoimmune disorders.

BACKGROUND OF THE INVENTION

Several publications and patent documents are referenced in this application in order to more fully describe the state of the art to which this invention pertains. The disclosure of each of these publications and documents is incorporated by reference herein.

Mammals host trillions of microbes at diverse locations throughout the body, in particular in the gut (Backhed, F., et al. (2005). Science 307, 1915-1920; Ley, R.E., et al. (2008b). Nat. Rev. Microbiol. 6, 776-788; Ley, R.E., et al. (2006). Cell 124, 837-848. The enormity and complexity of these commensal (or mutualistic) communities have been difficult to deal with until recently, when striking advances in "next-generation" sequencing methods, entailing either 16S rRNA or 'shot-gun' cataloguing, rendered this field navigable terrain. The gut microbiomes of humans and mice are broadly similar (Backhed, F., et al.

(2005) . Science 307, 1915-1920; Ley, R.E., et al. (2008a). Science 320, 1647-1651; Ley, R.E., et al. (2008b). Nat. Rev. Microbiol. 6, 776-788; Ley, R.E., et al. (2006). Cell 124, 837-848. In both cases, -1000 different microbial species from -10 different divisions colonize the gastrointestinal tract, but just two bacterial divisions - the Bacteroidetes and Firmicutes - and one member of the Archaea appear to dominate, together accounting for -98% of the 16S rRNA sequences obtained from this site. The number and identity of microbial communities vary along the length of the gut, in a proximal to distal gradient of abundance (small intestine < cecum < colon), and across the three

dimensions of the lumen and mucous layers. The total number of genes borne by the gastrointestinal microbiome has been estimated to exceed more than a hundred-fold that of the human genome (Ley, R.E., et al. (2006). Cell 124, 837-848). The products of these genes are put to good use by the host, for example in digestion, production of nutrients, detoxification, defense against pathogens and development of a competent immune system (Backhed, F., et al. (2005). Science 307, 1915-1920; Ley, R.E., et al.

(2006) . Cell 124, 837-848; Ley, R.E., et al. (2008b). Nat. Rev. Microbiol. 6, 776-788).

The gastrointestinal microbiome and the immune system are closely tied, each influencing and being influenced by the other (reviewed in (Macpherson, A.J. and Harris, N.L. (2004). Nat. Rev. Immunol. 4, 478-485; Mazmanian, S.K. and Kasper, D.L. (2006). Nat. Rev. Immunol. 6, 849-858; Rakoff-Nahoum, S. and Medzhitov, R. (2008). Mucosal. Immunol. Suppl 1, S10-S14; Vassallo, M.F. and Walker, W.A. (2008). Nestle. Nutr. Workshop Ser. Pediatr. Program. 61, 211-2248; Duerkop, B.A., et al. (2009). Immunity. 31, 368-376)). In general terms, the incomplete state of the immune system in germ-free (GF) conditions and in neonatal individuals argues that its normal maturation is driven by commensal microbes - for example, GF-housed individuals and neonates can have a reduced fraction of peripheral CD4⁺ T lymphocytes, a systemic tilt toward the T helper (Th)2 phenotype, defective T and B cell compartments in gut- associated lymphoid tissue (GALT), reduced complements of IgG and IgA antibodies, etc.

(Mazmanian, S.K., et al. (2005). Cell 122, 107-118; Rakoff-Nahoum, S., et al. (2004). Cell 118, 229-241; Ivanov, I.I., et al. (2008). Cell Host. Microbe 4, 337-349; Atarashi, K., et al (2008). Nature 455, 808-812; Mazmanian, S.K., et al. (2008). Nature 453, 620- 625; Grice, E.A., et al (2009). Science 324, 1190-1192; Macpherson, A.J. and Harris, N.L. (2004). Nat. Rev. Immunol. 4, 478-485; Vassallo, M.F. and Walker,W.A. (2008). Nestle. Nutr. Workshop Ser. Pediatr. Program. 61, 211-224). In more specific terms, gut-resident bacteria - sometimes even a single species - can have a strong influence on the emergence and/or maintenance of particular CD4⁺ T cell subsets. Examples include the effects of specific bacteria on the emergence of T helper (Th)17 cells in the intestinal lamina propria (LP) (IvanovJ.L, et al. (2008). Cell Host. Microbe 4, 337-349;

Atarashi,K., et al. (2008). Nature 455, 808-812; Salzman, N.H., et al. (2009). Nat.

Immunol; Gaboriau-Routhiau,V., et al. (2009). Immunity. 31, 677-689; IvanovJ.L, et al. (2009). Cell 139, 485-498) and the impact of Bacteroides fragilis on systemic Thl cells and local interleukin (IL)-lO-producing regulatory T cells (Mazmanian,S.K., et al.

(2008). Nature 453, 620-625; Mazmanian,S.K., et al. (2005). Cell 122, 107-118). In both cases, dendritic cells (DCs) are thought to be the initial target of mediators produced either by the culprit microbe or in response to it - adenosine-5'-triphosphate (ATP) or serum alpha amylase (SAA-A) in an example of the latter case (Atarashi,K., et al.

(2008). Nature 455, 808-812; IvanovJ.L, et al. (2009). Cell 139, 485-498), the polysaccharide PSA in the former (Mazmanian,S.K., et al. (2005). Cell 122, 107-118).

SUMMARY

The present invention is based, at least in part, on the discovery that commensal bacteria that populate the gastrointestinal (GI) tract can impact the onset, duration, and/or severity of inflammatory and autoimmune disorders. As demonstrated herein, the presence of certain commensal bacteria in the GI tract is correlated with the onset of inflammatory and autoimmune disorders. Of particular note, the present invention is directed to the finding that a single commensal bacteria, segmented filamentous bacteria (SFB), has a profound effect on the onset of autoimmune disease and this effect is correlated with its ability to promote Thl7 cell differentiation. The findings of the present invention, therefore, demontrate that microbial inhabitants of the GI tract, such as SFB and other commensal bacteria that trigger pathways leading to Thl7 cell differentiation, initiate a physiological cascade that results in accumulation of Thl7 cells locally and systemically that contribute to development of autoimmune disorders. The impact of SFB and other commensal bacteria that trigger pathways leading to Thl7 cell differentiation on autoimmune disorders is, thus, not restricted to autoimmune disorders of the GI tract and immediate environs. Indeed, as described herein, the presence of SFB is positively correlated with non-GI tract autoimmune disorders. An exemplary non-GI tract autoimmune disorder positively correlated with the presence of SFB in the GI tract is rheumatoid arthritis.

More particularly and as described herein, the present inventors demonstrate that autoimmune arthritis is profoundly attenuated in the K/BxN mouse model when this strain of mice is maintained under germ- free (GF) conditions. Under GF conditions, reduced serum-autoantibody titers, fewer autoantibody-secreting cells, a paucity of germinal centers and a dearth of splenic T helper (Th)17 cells are observed.

Neutralization of interleukin-17, moreover, prevented arthritis development in conventionally housed K/BxN mice. This finding indicates a direct effect of this cytokine on B cells to inhibit germinal center formation. The systemic immune system deficiencies of the GF animals reflected a loss of Thl7 cells from the small-intestinal lamina-propria in the absence of gut microbiota. The present inventors demonstrate that introduction of a single gut-residing microbe, SFB, into GF K/BxN animals reinstated the lamina-propria Thl7 compartment, and led to rapid onset of arthritis. These results show that the presence of a single commensal can drive an autoimmune disease via its ability to promote a specific Th-cell subset.

Accordingly, the present invention provides methods for treating a subject afflicted with an autoimmune disorder. The methods include administering a therapeutic amount of an inhibitor of at least one host molecule to the subject, wherein the host molecule promotes Thl7 cell differentiation and is induced by the subject responsive to the presence of a commensal bacteria in the subject's gastrointestinal tract or a therapeutic amount of an inhibitor of at least one activity of the commensal bacteria that promotes Thl7 cell differentiation, wherein the administering effectuates treatment of the subject afflicted with the autoimmune disorder.

In an embodiment, the at least one host molecule induced responsive to the commensal bacteria is serum amyloid A 1 ; resistin like beta; solute carrier family 6 (neurotransmitter transporter), member 14; placenta expressed transcript 1; serum amyloid A 2; granzyme B.; granzyme A; Z-DNA binding protein 1; nitric oxide synthase 2, inducible, macrophage; hematopoietic cell transcript 1; CD38 antigen;

interferon gamma induced GTPase; fucosyltransferase 2; UDP-GlcNAc:betaGal beta- 1,3-N-acetylglucosaminyltransferase 7; T-cell receptor gamma, variable 3;

sphingomyelin phosphodiesterase, acid-like 3B; betaine-homocysteine methyltransferase; solute carrier family 9 (sodium/hydrogen exchanger), member 3; dual oxidase maturation factor 2; or lymphocyte antigen 6 complex, locus D.

In another embodiment of the invention, the methods further comprise measuring Thl7 cell differentiation in the subject, wherein a decrease in the Thl7 cell

differentiation in the subject after the administering relative to prior to the administering is a positive indicator of effective treatment of the subject. In a particular aspect, the decrease in the Thl7 cell differentiation is detected as a decrease in Thl7 cell numbers or activity. In a more particular aspect, the decrease in Thl7 cell numbers or activity is measured in a blood sample or biopsy isolated from the subject after the administering and determined relative to Thl7 cell numbers or activity in a blood sample or biopsy isolated from the subject prior to the administering. In a particular embodiment, the biopsies isolated from the subject after and prior to the administering are isolated from the subject's joints.

In an embodiment of the invention, the at least one activity of a commensal bacteria that promotes Thl7 cell differentiation is proliferation or attachment to intestinal epithelial cells. In another embodiment, the at least one activity of a commensal bacteria that promotes Thl7 cell differentiation is an activity of a

commensal bacterial product. The at least one activity of the commensal bacteria, which may include more than one species, activates signaling pathways that lead to Thl7 differentiation and/or accumulation. Accordingly, a commensal bacterial product may act directly to induce Thl7 differentiation and/or accumulation or may act indirectly by inducing expression of a host molecule or molecules that induce Thl7 differentiation and/or accumulation.

In accordance with the present invention, the autoimmune disorder may be an autoimmune disorder of the GI tract or a non-GI tract autoimmune disorder. In a particular embodiment, the non-GI tract autoimmune disorder is autoimmune arthritis.

The present invention also provides methods for treating a subject afflicted with an autoimmune disorder. The methods include administering a therapeutic amount of an inhibitor of at least one host molecule to the subject, wherein the host molecule promotes Thl7 cell differentiation and is induced by the subject responsive to the presence of segmented filamentous bacteria (SFB) in the subject's gut or a therapeutic amount of an inhibitor of at least one SFB activity that promotes Thl7 cell differentiation, wherein the administering effectuates treatment of the subject afflicted with the autoimmune disorder.

In an aspect of the invention, the at least one host molecule induced by SFB is serum amyloid A 1 ; resistin like beta; solute carrier family 6 (neurotransmitter transporter), member 14; placenta expressed transcript 1; serum amyloid A 2; granzyme B.; granzyme A; Z-DNA binding protein 1; nitric oxide synthase 2, inducible, macrophage; hematopoietic cell transcript 1; CD38 antigen; interferon gamma induced GTPase; fucosyltransferase 2; UDP-GlcNAc:betaGal beta-l,3-N- acetylglucosaminyltransferase 7; T-cell receptor gamma, variable 3; sphingomyelin phosphodiesterase, acid- like 3B; betaine -homocysteine methyltransferase; solute carrier family 9 (sodium/hydrogen exchanger), member 3; dual oxidase maturation factor 2; or lymphocyte antigen 6 complex, locus D.

In an embodiment of the invention, the at least one SFB activity that promotes Thl7 cell differentiation is SFB proliferation or attachment to intestinal epithelial cells. In another embodiment, the at least one SFB activity that promotes Thl7 cell

differentiation is an activity of an SFB product. The at least one activity of SFB, which may act in conjunction with an activity or activities of a different species of commensal bacteria, activates signaling pathways that lead to Thl7 differentiation and/or

accumulation. Accordingly, an SFB product may act directly to induce Thl7

differentiation and/or accumulation or may act indirectly by inducing expression of a host molecule or molecules that induce Thl7 differentiation and/or accumulation.

In another aspect, the method further comprises measuring Thl7 cell

differentiation in the subject, wherein a decrease in the Thl7 cell differentiation in the subject after the administering relative to prior to the administering is a positive indicator of effective treatment of the subject. In a particular embodiment, the decrease in the Thl7 cell differentiation is detected as a decrease in Thl7 cell numbers or activity. In a more particular embodiment, the decrease in Thl7 cell numbers or activity is measured in a blood sample or biopsy isolated from the subject after the administering and determined relative to Thl7 cell numbers or activity in a blood sample or biopsy isolated from the subject prior to the administering. The biopsies isolated from the subject after and prior to the administering may be isolated from the subject's joints. In accordance with the present invention, the autoimmune disorder may be an autoimmune disorder of the GI tract or a non-GI tract autoimmune disorder. In a particular embodiment, the non-GI tract autoimmune disorder is autoimmune arthritis.

In yet another aspect of the invention, methods for treating a subject afflicted with a non-GI tract autoimmune disorder are provide. The methods include

administering a therapeutic amount of an inhibitor of at least one activity of segmented filamentous bacteria (SFB) to the subject.

In an embodiment, the at least one activity is SFB proliferation or attachment to intestinal epithelial cells. In another embodiment, the at least one SFB activity that promotes Thl7 cell differentiation is an activity of an SFB product. The at least one activity of SFB, which may act in conjunction with an activity or activities of a different species of commensal bacteria, activates signaling pathways that lead to Thl7

differentiation and/or accumulation. Accordingly, an SFB product may act directly to induce Thl7 differentiation and/or accumulation or may act indirectly by inducing expression of a host molecule or molecules that induce Thl7 differentiation and/or accumulation.

In a particular embodiment, the non-GI tract autoimmune disorder is

autoimmune arthritis.

Other features and advantages of the invention will be apparent from the following description of the particular embodiments thereof, and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1A-D depict attenuation of arthritis in GF K/xBN mice. Ankle thickening values (A) and anti-GPI titers (B) for GF and SPF K/BxN mice of the indicated ages. Each symbol represents one animal; bars indicate the group mean.

Asterisks indicate statistical significance using the Student's t-Test *P=0.05, **P<0.05, ***P<0.005). (C) GF K/BxN mice were shipped to our SPF facility upon weaning (day 21). Ankle thickening was measured from day 23. Closed circles: average of ankle thickening + s.e., serially measured on cohorts. Closed triangles: analogous

measurements for SPF-housed K/BxN mice. Open circles: values for individual GF- housed K/BxN mice, not measured serially due to experimental contingencies. (D) Sera were collected at the end of the experiment depicted in panel C. The bar indicates the mean.

Figures 2A-E depict the impact of commensal flora on the B and T cell compartments of K/BxN mice. (A) Splenocytes from GF or SPF BxN or K/BxN mice were stained with Abs recognizing B220, CD4, or FAS or with PNA-R, and were analyzed by flow cytometry, gating as indicated. Values indicate the percentages of Fas⁺PNA-R⁺ cells in total B cells. Data are representative of two independent experiments. (B) Splenocytes from GF or SPF BxN or K/BxN mice were stained with mAbs recognizing B220, CD4, CXCR5 and PD-1, and were analyzed by flow cytometry, gating as indicated. Values indicate the percentages of CXCR5⁺PD-1⁺ cells in total CD4⁺ T cells. Data are representative of two independent experiments. (C) i.

Purified B cells of GF or SPF BxN or K/BxN mice were stimulated with GPI protein (l( g/ml) for 6 hrs. An ELISPOT assay revealed GPI-specific ASCs. ii Fraction of GPI- specific ASCs among total B cells; mean + s.e. from two independent experiments. (D) Splenocytes were isolated from SPF or GF K/BxN mice, stained and analyzed by flow cytometry. The values indicate percentages of CD44⁺ cells in CD4⁺ T cells. Data are representative of two independent experiments. (E) Splenocytes were isolated from SPF and GF K/BxN mice and stimulated with GPI₂₈₂-294 peptide at the indicated

concentration. Data are representative of 2 independent experiments. Asterisks indicate statistical significance using the Student's t-Test, *P<0.05.

Figures 3A-D depict a defective Thl7 signature in GF K/BxN mice. (A) FC (fold change) vs FC plot comparing gene-expression values of SPF K/BxN vs BxN mice (x axis) and GF K/BxN vs BxN mice (y axis). Gene-expression values of each group were the average values of 3 chips from 3 independent experiments. (B) Th cell signatures. Th2, Thl and Thl7 signatures were generated from published datasets

(Nurieva, R.I., et al. (2008). Immunity. 29, 138-149), using 2 as the cut-off for FC over the expression value of two other cell types. The volcano plots depict the FC for SPF vs GF K/BxN CD4⁺ T cells versus the P value of the FC. Signature genes are superimposed in red. Values refer to the number of genes upregulated (right) or downregulated (left) in GF vis-a-vis SPF T cells. P values from a X test are indicated. (C) IL-4, IFN-γ and IL- 17 transcripts in splenic CD4⁺ T cells for GF or SPF of B/N or K/BxN mice were quantified by RT-PCR. The level in SPF BxN mice was set as 1. Mean + s.e. Results were compiled from three independent experiments with two mice per group. Asterisks indicate statistical significance using the Student's t-Test, *P<0.05. (D) Splenocytes of GF or SPF BxN or K/BxN mice were stained with Abs recognizing CCR6 and IL-17, and were analyzed by flow cytometry. Values represent percentages of IL-17⁺CCR6⁺ cells in CD3⁺CD4⁺B220^~ cells. Data are representative of two independent experiments.

Figures 4A-D depict a reduction of arthritis by neutralization of IL-17. (A) 25- day-old SPF K/BxN mice were treated with 10( g of anti-IL-17 or control rat IgG every 3 days, and ankle thickening was measured over time (left panel). Mean + s.e of the two groups (n=5 in both groups from two independent experiments; asterisks indicate statistical significance using the Student's t-Test, *P<0.05.) is plotted. Sera were collected at the end of the experiment, and anti-GPI titers quantified (right panel).

Symbols represent individual mice; bar indicates the mean. (B) At 23 days of age, GF mice were transferred to our SPF facility, and were treated with 10( g anti-IL-17 or control rat IgG every 3 days from day 24. Otherwise as in the A panels (n=4 in both groups from one experiment; asterisks indicate statistical significance using the

Student's t-Test, *P<0.05). (C) SPF K/BxN mice were treated as in panel A. At the end of treatment, splenocytes were isolated and stained with Abs recognizing B220, CD4 or Fas, or with PNA-R, and were analyzed by flow cytometry, gating as indicated. Values indicate the percentages of Fas⁺PNA-R⁺ cells in total B cells. Data are representative of two independent experiments with two mice per group. (D) B cells from either WT or IL-17R^"7" mice were combined with splenocytes from arthritic K/BxN mice and transferred into BxN Rag^_/~ recipients. The origins of B cells were identified by expression of the congenic marker: CD45.1⁺CD45.2⁺ for K/BxN B cells and CD45.2 for IL-17R^"7" or WT B cells. Percentages of K/BxN B cells and IL-17R^"7" or WT B cells among total B cell or GC B cell populations are indicated. The quantitative data of IL- 17R^_/~ or WT B cell percentage among total B cells and GC B cells were also shown as mean + s.e. (n=4, data combined from two independent experiments).

Figures 5A-C depict a link between gut and spleen IL-17 cells. (A) SI- LP lymphocytes were isolated from SPF or GF K/BxN mice. Cells were stained, analyzed by flow cytometry and gated as indicated. Expression of IL-17 versus CCR6 is plotted. The values indicate percentages of IL- 17⁺CCR6⁺ cells in CD3⁺CD4⁺B220^" cells. Data are representative of three independent experiments. (B) SI- LP lymphocytes (i) and splenocytes (ii) were isolated from SPF mice of the indicated ages, stained and analyzed by flow cytometry, gated as indicated. Plots displayed IL-17 versus CCR6 expression. Values indicate % of IL-17⁺CCR6⁺ cells in total CD4⁺ T cells (CD3⁺CD4⁺B220 ). Data are representative of two independent experiments, (iii) Measurement of ankle thickening for the same mice. Each circle represents one animal from two independent experiments. (C) Splenocytes from SPF BxN or K/BxN mice were stained and analyzed by flow cytometry, gated as indicated. Plots depict IL-17 versus 4β7 staining. Values indicate % of IL-17⁺cc4 7⁺ or Π.-17⁺α4β7^~ cells in total CD4⁺ T cells (CD3⁺CD4⁺B220^~ ). Data are representative of two independent experiments.

Figures 6A-D depict effects of various antibiotics. (A) Representative dot plots examining expression of IL-17 and CCR6 by SI-LP lymphocytes in untreated or the indicated antibiotic-treated SPF K/BxN mice, treated from birth to 5 wks of age. Values refer to % of the gated population in total CD4⁺ T cells. Representative of two independent experiments. (B) SPF K/BxN mice were treated with metronidazole (lg/1), neomycin (lg/1), vancomycin (0.5g/l) or ampicillin (lg/1) in the drinking water from birth. At 5 weeks of age, SI-LP lymphocytes (left) and splenocytes (right) were isolated, stained and analyzed by flow cytometry. Plotted are the % of IL-17⁺ cells of total CD4⁺ T cells. Mean + s.e. (data was a combination of two independent experiments with mice treated with metronidazole (n=4), neomycin (n=4), vacomycin (n=4), ampicillin (n=4) or nothing (n=8)) Asterisks indicate statistical significance using the Student's t-Test, *P<0.05. (C) Representative dot plots examining expression of 4β7 on IL-17- producing splenocytes in untreated (left) or vancomycin-treated (right) SPF K/BxN mice, treated from birth to 5 wks of age. Values refer to % of the gated population in total CD4⁺ T cells. Representative of two independent experiments. (D) K/BxN mice were untreated or were treated with metronidazole (lg/1), neomycin (lg/1), ampicillin (lg/L) or vancomycin (0.5g/l) in the drinking water from birth. Ankle thickening was followed from day 27. Mean + s.e. (none group: n=5; all other antibiotics treated groups: n=4) Representative of two independent experiments.

Figures 7A-F depict triggering of arthritis in SFB-colonized GF K/BxN mice.

(A) Experimental scheme. Mice were shipped from the GF Taconic facility to the SPF NYU facility on day 21 after birth and arrived the next day. After a 3-day rest; they were gavaged with SFB mono-feces or control GF feces (the rare animal with already swollen ankles was not used). Ankle thickening was measured every day from day 27 to day 33.

(B) Measurement of ankle thickness beginning on day 27. N=9 for SFB-treated and N=5 for controls from 4 independent experiments. Asterisks indicate statistical significance using the Student's t-Test, *P<0.05. (C) Quantitative PCR analysis of SFB and total bacterial (EUB) 16S rRNA genes in mouse feces. GF K/BxN mice were gavaged either with their own feces (C) or with feces from SFB mono-colonized mice (SFB). Genomic DNA was isolated from fecal pellets on day 6 after gavage. Data combined from two separate experiments. (D) SI-LP lymphocytes were isolated from control or SFB- inoculated K/BxN mice. Cells were stained and analyzed by flow cytometry. Expression of IL-17 versus IFN-γ is plotted. Values refer to % of the gated population in total CD4⁺TCRP⁺ cells. (E) Splenocytes were isolated from control or SFB-inoculated K/BxN mice, and were stained and analyzed by flow cytometry, gated as indicated. Plots depict IL-17 versus 4β7 staining. Values indicate % of ΙΕ-17⁺ 4β7⁺ or ϋ-17⁺α4β7^~ cells in total CD4⁺ T cells (B220^" CD3⁺CD4⁺). Data are representative of two independent experiments. (F) Sera were collected from control or SFB-inoculated K/BxN animals at the end of the experiment depicted in panel A. The bar indicates the mean.

Figure 8 is a Table listing transcriptionally upregulated genes. The upregulated genes listed in the Table were selected from the comprehensive list of those genes affected by both SFB colonization of Swiss-Webster germ-free (SW GF) mice and introduction of Taconic microbiota into Jackson B6 mice by cohousing. The

upregulated genes listed represent the most highly upregulated genes of the

comprehensive list and are arranged by fold change in GF + SFB mice.

DETAILED DESCRIPTION OF THE INVENTION

The correlation of gut-resident bacteria and the emergence and/or maintenance of particular CD4⁺ T cell subsets has led to additional studies demonstrating that gut microbiota are linked to pathologies of the immune system, notably allergies and autoimmune disorders [(Strachan, D.P. (1989). BMJ. 299, 1259-126; Wills-Karp, et al. (2001). Nat Rev. Immunol. 1, 69-75) and recently reviewed in (Kelly, D., et al. (2007). Mutat. Res. 622, 58-69)]. Ties to inflammatory bowel diseases can be appreciated based on common locale, but the cellular and molecular mechanisms by which intestinal commensals influence autoimmune responses at distal sites remain enigmatic. To investigate these issues, the present inventors have utilized new and rapidly emerging knowledge about the composition and properties of the gastrointestinal microbiome and about the activities of recently discovered effector and regulatory T cell subsets to dissect these mechanisms in autoimmune disease models. In particular, the K/BxN T cell receptor (TCR) transgenic mouse model of inflammatory arthritis was studies because of its easily distinguishable initiation and effector stages (Kouskoff, V., et al. (1996). Cell 87, 811-822; Korganow, A.S., et al. (1999). Immunity 10, 451-461; Matsumoto, I., et al. (1999). Science 286, 1732-1735). The initiation phase relies primarily on the adaptive immune system. T lymphocytes displaying the transgene-encoded TCR recognize a self-peptide derived from glucose-6-phosphate isomerase (GPI) presented by the major histocompatibility complex class II molecule, Ag7; these autoreactive T cells provide exceptionally effective help to GPTspecific B cells, resulting in massive production of anti-GPI autoantibodies (autoAbs), primarily of the immunoglobulin (Ig)Gl isotype. The effector phase, which can be mimicked by transfer of serum from K/BxN into standard mice, is executed primarily by innate immune system players.

GPI:anti-GPI immune complexes initiate a self-sustaining inflammatory response that mobilizes the following exemplary mediators, without limitiation: mast cells, neutrophils, the alternative pathway of complement, Fey receptors, tumor necrosis factor (TNF)-cc, and IL-1. Arthritis ensues rapidly (beginning at about 4 weeks of age) and with high penetrance (close to 100%).

As demonstrated herein, arthritis was attenuated in K/BxN mice housed under GF conditions. Disease dampening was traced to a dearth of Thl7 cells, which could be reversed by introducing segmented filamentous bacteria (SFB) into the gut of GF- housed mice, provoking rapid onset of arthritis. Thus, an example of an extra- gut (non- GI tract) autoimmune disease triggered by a single member of the commensal intestinal microbiota through its promotion of a particular Th subset is provided.

In order to more clearly set forth the parameters of the present invention, the following definitions are used:

As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus for example, reference to "the method" includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure.

The term "functional" as used herein implies that the nucleic or amino acid sequence is functional for the recited assay or purpose. The phrase "consisting essentially of" when referring to a particular nucleotide or amino acid means a sequence having the properties of a given SEQ ID No:. For example, when used in reference to an amino acid sequence, the phrase includes the sequence per se and molecular modifications that would not affect the basic and novel characteristics of the sequence.

A "replicon" is any genetic element, for example, a plasmid, cosmid, bacmid, phage or virus that is capable of replication largely under its own control. A replicon may be either RNA or DNA and may be single or double stranded.

A "vector" is a replicon, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached so as to bring about the replication of the attached sequence or element.

An "expression vector" or "expression operon" refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g. , ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a polypeptide coding sequence in a host cell or organism.

As used herein, the term "operably linked" refers to a regulatory sequence capable of mediating the expression of a coding sequence and which are placed in a DNA molecule (e.g. , an expression vector) in an appropriate position relative to the coding sequence so as to effect expression of the coding sequence. This same definition is sometimes applied to the arrangement of coding sequences and transcription control elements (e.g. promoters, enhancers, and termination elements) in an expression vector. This definition is also sometimes applied to the arrangement of nucleic acid sequences of a first and a second nucleic acid molecule wherein a hybrid nucleic acid molecule is generated.

The term "isolated protein" or "isolated and purified protein" is sometimes used herein. This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule of the invention. Alternatively, this term may refer to a protein that has been sufficiently separated from other proteins with which it would naturally be associated, so as to exist in "substantially pure" form. "Isolated" is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, addition of stabilizers, or compounding into, for example, immunogenic preparations or pharmaceutically acceptable

preparations.

The term "substantially pure" refers to a preparation comprising at least 50-60% by weight of a given material (e.g. , nucleic acid, oligonucleotide, protein, etc.). More particularly, the preparation comprises at least 75% by weight, and most particularly 90- 95% by weight of the given compound. Purity is measured by methods appropriate for the given compound (e.g. chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like). "Mature protein" or "mature polypeptide" shall mean a polypeptide possessing the sequence of the polypeptide after any processing events that normally occur to the polypeptide during the course of its genesis, such as proteolytic processing from a polypeptide precursor. In designating the sequence or boundaries of a mature protein, the first amino acid of the mature protein sequence is designated as amino acid residue 1.

The term "tag", "tag sequence" or "protein tag" refers to a chemical moiety, either a nucleotide, oligonucleotide, polynucleotide or an amino acid, peptide or protein or other chemical, that when added to another sequence, provides additional utility or confers useful properties to the sequence, particularly with regard to methods relating to the detection or isolation of the sequence. Thus, for example, a homopolymer nucleic acid sequence or a nucleic acid sequence complementary to a capture oligonucleotide may be added to a primer or probe sequence to facilitate the subsequent isolation of an extension product or hybridized product. In the case of protein tags, histidine residues (e.g. , 4 to 8 consecutive histidine residues) may be added to either the amino- or carboxy-terminus of a protein to facilitate protein isolation by chelating metal chromatography. Alternatively, amino acid sequences, peptides, proteins or fusion partners representing epitopes or binding determinants reactive with specific antibody molecules or other molecules (e.g., flag epitope, c-myc epitope, transmembrane epitope of the influenza A virus hemaglutinin protein, protein A, cellulose binding domain, calmodulin binding protein, maltose binding protein, chitin binding domain, glutathione S-transferase, and the like) may be added to proteins to facilitate protein isolation by procedures such as affinity or immunoaffinity chromatography. Chemical tag moieties include such molecules as biotin, which may be added to either nucleic acids or proteins and facilitates isolation or detection by interaction with avidin reagents, and the like. Numerous other tag moieties are known to, and can be envisioned by, the trained artisan, and are contemplated to be within the scope of this definition.

The terms "transform", "transfect", "transduce", shall refer to any method or means by which a nucleic acid is introduced into a cell or host organism and may be used interchangeably to convey the same meaning. Such methods include, but are not limited to, viral transduction, transfection, electroporation, microinjection, PEG-fusion and the like.

The introduced nucleic acid may or may not be integrated (covalently linked) into nucleic acid of the recipient cell or organism. In bacterial, yeast, plant and mammalian cells, for example, the introduced nucleic acid may be maintained as an episomal element or independent replicon such as a plasmid. Alternatively, the introduced nucleic acid may become integrated into the nucleic acid of the recipient cell or organism and be stably maintained in that cell or organism and further passed on or inherited to progeny cells or organisms of the recipient cell or organism. In other applications, the introduced nucleic acid may exist in the recipient cell or host organism only transiently.

As used herein, the terms "reporter," "reporter system", "reporter gene," or "reporter gene product" shall mean an operative genetic system in which a nucleic acid comprises a gene that encodes a product that when expressed produces a reporter signal that is a readily measurable, e.g. , by biological assay, immunoassay, radioimmunoassay, or by colorimetric, fluoro genie, chemiluminescent or other methods. The nucleic acid may be either RNA or DNA, linear or circular, single or double stranded, antisense or sense polarity, and is operatively linked to the necessary control elements for the expression of the reporter gene product. The required control elements will vary according to the nature of the reporter system and whether the reporter gene is in the form of DNA or RNA, but may include, but not be limited to, such elements as promoters, enhancers, translational control sequences, poly A addition signals, transcriptional termination signals and the like.

A "clone" or "clonal cell population" is a population of cells derived from a single cell or common ancestor by mitosis.

A "cell line" is a clone of a primary cell or cell population that is capable of stable growth in vitro for many generations.

An "immune response" signifies any reaction produced by an antigen, such as a protein antigen, in a host having a functioning immune system. Immune responses may be humoral, involving production of immunoglobulins or antibodies, or cellular, involving various types of B and T lymphocytes, dendritic cells, macrophages, antigen presenting cells and the like, or both. Immune responses may also involve the production or elaboration of various effector molecules such as cytokines, lymphokines and the like. The adaptive immune system and innate immune system are also described herein and understood in the art to contribute to immune responses. The differential contribution of these immune systems is dependent on the particular circumstances eliciting the immune response. Generally speaking, the innate immune system comprises cells and

mechanisms that defend the host from infection by other organisms in a non-specific manner. Accordingly, innate system cells recognize and respond to pathogens in a generic way. The adaptive immune system comprises highly specialized, systemic cells and processes that respond to pathogenic challenges. The adaptive immune system confers the ability to recognize pathogens with specificity and generate memory with regard to recognition of the specific pathogen, such that a stronger response is elicited in future encounters with the pathogen. The adaptive immune system, therefore, confers lasting immunity to the host. Immune responses may be measured both in in vitro and in various cellular or animal systems.

An "antibody" or "antibody molecule" is any immunoglobulin, including antibodies and fragments thereof, that binds to a specific antigen. The term includes polyclonal, monoclonal, chimeric, and bispecific antibodies. As used herein, antibody or antibody molecule contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunloglobulin molecule such as those portions known in the art as Fab, Fab', F(ab')2 and F(v).

As used herein, the terms "gastrointestinal tract autoimmune disorder", "GI tract autoimmune disorder", and "autoimmune disorder of the gastrointestinal tract" are used interchangeably to refer to autoimmune disorders, wherein the primary site of autoimmune cell interaction is the gastrointestinal tract. A skilled practitioner would, however, be aware of the fact that many autoimmune disorders affect multiple organs/tissues and organ systems and thus cognizant of those organs/tissues and organ systems that are understood in the art to be primary and secondary sites of disease symptoms associated with a particular autoimmune disorder. An exemplary list of gastrointestinal tract autoimmune disorders includes: Crohn's disease, ulcerative colitis, and sprue. As used herein, the terms "gut autoimmune disorder" and "autoimmune disorder of the gut" are used interchangeably to refer to autoimmune disorders, wherein the primary site of autoimmune cell interaction is the gut or digestive tract.

As used herein, the terms "non-gastrointestinal tract autoimmune disorder" and "non-GI tract autoimmune disorder" are used interchangeably to refer to autoimmune disorders, wherein the primary site of autoimmune cell interactions is not the

gastrointestinal tract. A skilled practitioner would, however, be aware of the fact that many autoimmune disorders affect multiple organs/tissues and organ systems and thus cognizant of those organs/tissues and organ systems that are understood in the art to be primary and secondary sites of disease symptoms associated with a particular autoimmune disorder. An exemplary list of non-gastrointestinal tract autoimmune disorders includes: rheumatoid arthritis, Type I diabetes, multiple sclerosis, and graft versus host disease following bone marrow transplantation. See also those autoimmune disorders listed in claim 24. The primary sites associated with disease symptoms of rheumatoid arthritis are, for example, the joints.

As used herein, the term "non-gut autoimmune disorder" is used to refer to an autoimmune disorder, wherein the primary site of autoimmune cell interactions is not the gut or digestive tract. A skilled practitioner would, however, be aware of the fact that many autoimmune disorders affect multiple organs/tissues and organ systems and thus cognizant of those organs/tissues and organ systems that are understood in the art to be primary and secondary sites of disease symptoms associated with a particular autoimmune disorder. An exemplary list of non-gut autoimmune disorders includes: rheumatoid arthritis, Type I diabetes, multiple sclerosis, and graft versus host disease following bone marrow transplantation. See also those autoimmune disorders listed in claim 24. The primary sites associated with disease symptoms of rheumatoid arthritis are, for example, the joints.

SFB Induced Immune Response Program in the Gut

To identify specific effects of SFB, the gene expression profiles in the terminal ileum of Swiss-Webster germ-free (GF) mice were compared before and after colonization with SFB and in Jackson B6 mice before and after cohousing with Taconic B6 animals. Colonization of GF mice with SFB induced at least a 2-fold change in expression of 253 genes, while cohousing of Jackson B6 mice with Taconic B6 mice induced a similar change in 470 genes. More importantly, there was a high degree of overlap between the two groups, with expression of 131 genes affected by both treatments. It was possible, therefore, to distinguish three groups of genetic profiles. Group 1 includes genes whose expression was affected only in Jackson mice by cohousing, but was not statistically different after SFB colonization. This group includes genes whose expression is influenced by microbiota other than SFB that differs between the mice from the different vendors, as well as strain- specific changes. Group 2 consists of genes whose expression only changed in GF mice upon colonization with SFB, but not in Jackson B6 mice following cohousing. A subset of these genes reflects changes induced in GF animals upon general intestinal colonization with bacteria. Group 3 includes the genes with expression differences after both SFB colonization and cohousing with Taconic mice and thus contains genes specifically induced by SFB and associated with Thl7 cell induction.

SFB exerted an inductive effect in the host, which was demonstrated by the finding that most (>70%) of the genes in group 3 were upregulated after SFB

colonization. By comparison,

most genes in group 1 (>70%) were downregulated, which indicates that the rest of the Taconic microbiota has a suppressive effect that restrains the inductive effect of SFB. Group 2, on the other hand, consisted of roughly equal numbers of upregulated and downregulated genes.

To evaluate changes specifically associated with Thl7 cell-inducing SFB, the genes in group 3 were analyzed. A list of the top upregulated genes is presented in Figure 8. A gene ontology (GO) biological pathway analysis of upregulated genes in group 3 showed that immune system pathways were among the programs most significantly induced by SFB and raised the possibility that at least some of the observed gene expression changes were mediated by Thl7 cells or their effector cytokines.

Because IL-17 and IL-22 have been associated with induction of antimicrobial peptides (AMPs) (Curtis and Way, 2009, Immunology 126: 177-185; Kolls et al, 2008, Nat. Rev. Immunol. 8:829-835; Zheng et al, 2008, Nat. Med. 14:282-289), the induction of AMP-related genes was compared on arrays. Multiple AMP genes were induced specifically by colonization with SFB, consistent with an upregulated Thl7 cell response. Upregulation of Thl7 cell- associated genes (1117, 1121, Ccr6, Nos2) and AMPs (Reg3g) after SFB colonization was confirmed by quantitative RT-PCR. See also Ivanov et al. (2009) Cell 139:485-498, the entire contents of which is incorporated herein in its entirety.

Agents

As used herein, an "agent", "candidate compound", or "test compound" may be used to refer to, for example, nucleic acids {e.g., DNA and RNA), carbohydrates, lipids, proteins, peptides, peptidomimetics, small molecules and other drugs.

A short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA is generally expressed using a vector introduced into cells, wherein the vector utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the siRNA to which it is bound.

Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, are a class of 20-25 nucleotide-long double- stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway whereby the siRNA interferes with the expression of a specific gene.

The term "control substance", "control agent", or "control compound" as used herein refers a molecule that is inert or has no activity relating to an ability to modulate a biological activity. With respect to the present invention, such control substances are inert with respect to an ability to modulate differentiation and/or activity, for example, of Thl7 cells. Exemplary controls include, but are not limited to, solutions comprising physiological salt concentrations.

The basic molecular biology techniques used to practice the methods of the invention are well known in the art, and are described for example in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Ausubel et al., 1988, Current Protocols in Molecular Biology, John Wiley &

Sons, New York; and Ausubel et al., 2002, Short Protocols in Molecular Biology, John Wiley & Sons, New York). Agents Identified by the Methods of the Invention

The invention provides methods for identifying agents (e.g., candidate compounds or test compounds) capable of inhibiting pathways due to or triggered by commensal bacteria in the Gl-tract that lead to Thl7 differentiation and accumulation. Agents that are capable of inhibiting such pathways, as identified by methods of the invention, are useful as candidate anti-inflammatory or anti- autoimmune disorder therapeutics.

Examples of agents, candidate compounds or test compounds include, but are not limited to, nucleic acids (e.g., DNA and RNA), carbohydrates, lipids, proteins, peptides, peptidomimetics, small molecules and other drugs. Agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound" library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145; U.S. Patent No. 5,738,996; and U.S. Patent No. 5,807,683, each of which is incorporated herein in its entirety by reference).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91: 11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678; Cho et al. (1993) Science 261: 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem. 37: 1233, each of which is incorporated herein in its entirety by reference.

Libraries of compounds may be presented, e.g., presented in solution (e.g., Houghten (1992) Bio/Techniques 13:412-421), or on beads (Lam (1991) Nature 354:82- 84), chips (Fodor (1993) Nature 364:555-556), bacteria (U.S. Patent No. 5,223,409), spores (Patent Nos. 5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1865-1869) or phage (Scott and Smith (19900 Science 249:386-390; Devlin (1990) Science 249:404-406; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-6382; and Felici (1991) J. Mol. Biol. 222:301-310), each of which is incorporated herein in its entirety by reference.

Therapeutic Uses of Agents Identified

The invention provides for treatment of inflammatory and/or autoimmune disorders by administration of a therapeutic agent identified using the above-described methods. Such agents include, but are not limited to proteins, peptides, protein or peptide derivatives or analogs, antibodies, nucleic acids, and small molecules.

The invention provides methods for treating patients afflicted with an

inflammatory and/or autoimmune disorder comprising administering to a subject an effective amount of a compound identified by the method of the invention. In a particular aspect, the compound is substantially purified (e.g. , substantially free from substances that limit its effect or produce undesired side-effects). The subject is particularly an animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is more particularly a mammal, and most particularly a human. In a specific embodiment, a non-human mammal is the subject.

A list of inflammatory and/or anti- autoimmune disorders that may be treated using an agent identified using a method of the invention includes, without limitation: rheumatoid arthritis, arthritis, diabetes, multiple sclerosis, uveitis, psoriasis,

osteoporosis, asthma, bronchitis, allergic rhinitis, chronic obstructive pulmonary disease, atherosclerosis, H. pylori infections and ulcers resulting from such infection, graft versus host disease following bone marrow transplantation, and inflammatory bowel diseases. Inflammatory bowel diseases treatable using agents identified by the present methods include Crohn's disease, ulcerative colitis, sprue and food allergies. An inflammatory disease or condition may involve any organ or tissue in which the presence of Thl7 cells has been demonstrated and/or implicated in disease etiology.

Formulations and methods of administration that can be employed when the compound comprises a nucleic acid are described above; additional appropriate formulations and routes of administration are described below.

Various delivery systems are known and can be used to administer a compound of the invention, e.g. , encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, e.g. , Wu and Wu (1987) J. Biol. Chem. 262:4429-4432), and construction of a nucleic acid as part of a retroviral or other vector. Methods of introduction can be enteral or parenteral and include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary

administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally, e.g., by local infusion during surgery, topical application, e.g., by injection, by means of a catheter, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.

In another embodiment, the compound can be delivered in a vesicle, in particular a liposome (see Langer (1990) Science 249: 1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.)

In yet another embodiment, the compound can be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton (1987) CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al. (1980) Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 1983, Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al. (1985) Science 228: 190; During et al. (1989) Ann. Neurol. 25:351; Howard et al. (1989) J. Neurosurg. 71: 105). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, e.g., an inflammatory site, thus requiring only a fraction of the systemic dose (see, e.g. , Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (1990, Science 249: 1527- 1533).

Pharmaceutical Compositions

The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of an agent and a

pharmaceutically acceptable carrier. In a particular embodiment, the term

"pharmaceutically acceptable" means approved by a regulatory agency of the federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.

Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin, incorporated in its entirety by reference herein. Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject. The formulation should suit the mode of administration. In a particular embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous

administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

The compounds of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

The amount of the compound of the invention which will be effective in the treatment of an inflammatory or autoimmune disorder (e.g., rheumatoid arthritis), for example, can be determined by standard clinical techniques based on the present description. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each subject's circumstances. However, suitable dosage ranges for intravenous administration are generally about 20-500 micrograms of active compound per kilogram body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight. Suppositories generally contain active ingredient in the range of 0.5% to 10% by weight; oral formulations preferably contain 10% to 95% active ingredient. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Nucleic Acids

The invention provides methods for identifying agents capable of inhibiting pathways triggered by commensal bacteria of the GI tract that lead to Thl7

differentiation and/or accumulation. The invention further provides methods for identifying agents capable of inhibiting such pathways. Accordingly, the invention encompasses administration of a nucleic acid encoding a peptide or protein capable of inhibiting such pathways, as well as antisense sequences or catalytic RNAs capable of inhibiting these pathways.

Any suitable methods for administering a nucleic acid sequence available in the art can be used according to the present invention.

Methods for administering and expressing a nucleic acid sequence are generally known in the area of gene therapy. For general reviews of the methods of gene therapy, see Goldspiel et al. (1993) Clinical Pharmacy 12:488-505; Wu and Wu (1991)

Biotherapy 3:87-95; Tolstoshev (1993) Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan (1993) Science 260:926-932; and Morgan and Anderson (1993) Ann. Rev. Biochem. 62: 191-217; May (1993) TIBTECH 11(5): 155-215. Methods commonly known in the art of recombinant DNA technology which can be used in the present invention are described in Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; and Kriegler (1990) Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY.

In a particular aspect, the compound comprises a nucleic acid encoding a peptide or protein capable of inhibiting pathways triggered by commensal bacteria of the GI tract {e.g., SFB) the presence of which leads to Thl7 differentiation and/or

accumulation, such nucleic acid being part of an expression vector that expresses the peptide or protein in a suitable host. In particular, such a nucleic acid has a promoter operably linked to the coding region, said promoter being inducible or constitutive (and, optionally, tissue- specific). In another particular embodiment, a nucleic acid molecule is used in which the coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the nucleic acid (Koller and Smithies (1989) Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al. (1989) Nature

342:435-438). Delivery of the nucleic acid into a subject may be direct, in which case the subject is directly exposed to the nucleic acid or nucleic acid-carrying vector; this approach is known as in vivo gene therapy. Alternatively, delivery of the nucleic acid into the subject may be indirect, in which case cells are first transformed with the nucleic acid in vitro and then transplanted into the subject, known as "ex vivo gene therapy".

In another embodiment, the nucleic acid is directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of numerous methods known in the art, e.g., by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by infection using a defective or attenuated retroviral or other viral vector (see U.S. Patent No. 4,980,286); by direct injection of naked DNA; by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont); by coating with lipids, cell-surface receptors or transfecting agents; by encapsulation in liposomes, microparticles or microcapsules; by administering it in linkage to a peptide which is known to enter the nucleus; or by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), which can be used to target cell types specifically expressing the receptors.

In another embodiment, a nucleic acid-ligand complex can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180 dated April 16, 1992 (Wu et al); WO 92/22635 dated December 23, 1992 (Wilson et al); WO92/20316 dated November 26, 1992 (Findeis et al); W093/14188 dated July 22, 1993 (Clarke et al), WO 93/20221 dated October 14, 1993 (Young)). Alternatively, the nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al. (1989) Nature 342:435-438).

In a further embodiment, a retroviral vector can be used (see Miller et al. (1993)

Meth. Enzymol. 217:581-599). These retroviral vectors have been modified to delete retroviral sequences that are not necessary for packaging of the viral genome and integration into host cell DNA. The nucleic acid encoding a desired polypeptide to be used in gene therapy is cloned into the vector, which facilitates delivery of the gene into a subject. More detail about retroviral vectors can be found in Boesen et al. (1994) Biotherapy 6:291-302, which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al. (1994) J. Clin. Invest. 93:644-651; Kiem et al. (1994) Blood

83: 1467-1473; Salmons and Gunzberg (1993) Human Gene Therapy 4: 129-141; and Grossman and Wilson (1993) Curr. Opin. in Genetics and Devel. 3: 110-114.

Adenoviruses may also be used effectively in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson (1993) Current Opinion in Genetics and Development 3:499-503 present a review of adenovirus-based gene therapy. Bout et al. (1994) Human Gene Therapy 5:3-10 demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al. (1991) Science 252:431-434; Rosenfeld et al. (1992) Cell 68: 143-155; Mastrangeli et al. (1993) J. Clin. Invest. 91:225-234; PCT Publication W094/12649; and Wang, et al. (1995) Gene

Therapy 2:775-783. Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al. (1993) Proc. Soc. Exp. Biol. Med. 204:289-300; U.S. Patent No. 5,436,146).

Another suitable approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a subject.

In this embodiment, the nucleic acid is introduced into a cell prior to

administration in vivo of the resulting recombinant cell. Such introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc. Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr (1993) Meth. Enzymol. 217:599-618; Cohen et al. (1993) Meth. Enzymol.

217:618-644; Cline (1985) Pharmac. Ther. 29:69-92) and may be used in accordance with the present invention, provided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.

The resulting recombinant cells can be delivered to a subject by various methods known in the art. In a particular embodiment, epithelial cells are injected, e.g., subcutaneously. In another embodiment, recombinant skin cells may be applied as a skin graft onto the subject; recombinant blood cells {e.g., hematopoietic stem or progenitor cells) are preferably administered intravenously. The amount of cells envisioned for use depends on the desired effect, the condition of the subject, etc., and can be determined by one skilled in the art.

Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and include but are not limited to neuronal cells, glial cells {e.g., oligodendrocytes or astrocytes), epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood or fetal liver. In a particular embodiment, the cell used for gene therapy is autologous to the subject that is treated.

In another embodiment, the nucleic acid to be introduced for purposes of gene therapy may comprise an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by adjusting the concentration of an appropriate inducer of transcription.

Direct injection of a DNA coding for a peptide or protein capable of inhibiting pathways triggered by commensal bacteria of the GI tract that lead to Thl7

differentiation and/or accumulation may also be performed according to, for example, the techniques described in United States Patent No. 5,589,466. These techniques involve the injection of "naked DNA", i.e., isolated DNA molecules in the absence of liposomes, cells, or any other material besides a suitable carrier. The injection of DNA encoding a protein and operably linked to a suitable promoter results in the production of the protein in cells near the site of injection.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is to be understood that this invention is not limited to particular assay methods, or test agents and experimental conditions described, as such methods and agents may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only the appended claims.

EXAMPLES

Methods and Materials

The following Materials and Methods were used in the examples below.

Mice

K/BxN mice were generated by crossing KRN TCR transgenic mice on the C57BL/6 background (KRN/B6) (Kouskoff, V., et al. (1996). Cell 87, 811-822) with NOD mice in an SPF facility at the Harvard School of Public Health. Pups from

KRN/B6 and NOD-background lines were rederived by cesarean section into the GF facility at Taconic Farms (Hudson, NY). Individuals from the two lines were crossed to generate K/BxN experimental animals. All GF mice were given sterilized food (NIH 31M) and water, and were tested weekly to establish that they were free of aerobic and anaerobic bacteria, parasites and fungi. Sentinel mice were also tested routinely and found to be negative for viral serologies. A complete list of excluded organisms is available on request. Mice were shipped in GF containers by Taconic to Boston or New York for measuring arthritis and obtaining experimental organs for analysis. Rag^_/~ mice on the B6xNOD background (BxN.Rag ⁷ ) were obtained from the colony at the Jackson Laboratory. IL-17R ⁷ mice {6867} were obtained from Amgen Washington, and were bred with B6.H-2g7 (B6g7) mice at the animal facility at the Harvard School of Public Health. IFN-y-deficient mice on the B6 genetic background were purchased from the Jackson Laboratory (Dalton, D.K., et al. (1993). Science 259, 1739-1742), and appropriate crosses were performed to yield K/BxN mice homozygous or heterozygous for the mutation.

IL-17 was neutralized by treatment with a mAb recognizing it (MAB421, R&D Systems). Control Abs were purified polyclonal rat IgG (Jackson Immunoresearch).

For antibiotic treatment, 1 g/L of Ampicillin sodium salt (Sigma), lg/L of

Metronidazole (Acros Organics), 0.5 g/L Vancomycin hydrochloride (Acros Organics), or 1 g/1 of Neomycin (Fisher BioReagents), were used as previously described (Atarashi, K., et al. (2008). Nature 455, 808-812). Antibiotics were added to the drinking water on a weekly basis. Sweetener (Equal) was added to the water (2.5 g/L). For the treatment of neonates, antibiotic- supplemented water was provided to lactating mothers.

Ankle thickness was measured with a caliper (J15 Blet micrometer) as described previously (Wu, H. J., et al. (2007). J Exp Med 204, 1911-1922).

ELISAs

Anti-GPI Ab titers were measured as described (Matsumoto, I., et al. (1999).

Science 286, 1732-1735). Briefly, ELISA plates were coated with recombinant mouse GPI at 5 mg/ml, and diluted mouse sera added. Subsequently, alkaline-phosphatase (AP)-conjugated anti-mouse IgG, IgGl or IgG2a followed by AP-conjugated

streptavidin were applied. After substrate addition, titers were quantified as optical density (OD) values via an ELISA reader.

Flow cytometry

Cells were collected for flow cytometry by filtering crushed spleen or thymus through a 40 μιη nylon membrane. For surface staining: fluorophore-labeled mAbs specific for CD4, CD8, CD3, CD25, CD44, Fas, CD19, IgM, IgD, CD21, CD23,

CXCR5, PD-1, CD45.1 or CD45.2 were obtained from BD Pharmingen. Αηίί-α4β7 and anti-CCR6 were from Biolegend. PNA-R was from Vector Laboratories. For

intracellular cytokine staining: immediately after isolation, the cells were incubated for 4 hr with 50 ng/ml phorbol 12-myristate 13-acetate (Sigma), ΙμΜ ionomycin (Sigma) and BD GolgiPlug™ (1: 1000 dilution) at 37°C. Intracellular cytokine staining was performed using Cytofix/Cytoperm (BD Pharmingen) per the manufacturer' s

instructions. Abs recognizing IL-17 and IFN-γ were obtained from Biolegend and BD Pharmingen, respectively. Foxp3 staining, Foxp3 Staining Buffer Set was obtained from eBioscience, and intracellular staining was performed following the manufacturer's instructions. Cells were run on an LSRII (BD Biosciences), and analysis was performed with FloJo (TreeStar) software. ELISPOT assay

ELISPOT assays were performed using Multiscreen IP Plates (Millipore). The plates were pre-wet with 15 μΐ of 35% ethanol (v/v in Milli-Q water) for one minute, rinsed with 150 μΐ sterile phosphate-buffered saline (PBS) three times, coated with 100 μΐ (10 μ§/πι1) recombinant GPI Matsumoto, I., et al. (2002). Nat. Immunol. 3, 360-365) in sterile PBS, and incubated overnight at 4°C. The next day, plates were washed with Milli-Q water and blocked with 150 μΐ per well of tissue-culture medium (RPMI-1640, 10% fetal bovine serum, 1% nonessential amino acids, penicillin, streptomycin, glutamine) for 2 hr at 37°C. B cells from BxN or K/BxN mice were positively isolated with directly conjugated MACS beads (Miltenyi Biotec) according to the manufacturer's instructions. Cells were resupended at 2.5 x 10⁶ cells/ml in medium, and 100 μΐ of cell suspension was added into the wells. Cells were serially diluted and incubated for 6 hr at 37°C. After washing, alkaline phosphatase-conjugated anti-mouse total IgG was applied, and the plates were incubated for 2 hours at 37°C. Plates were then washed, and 1 step™ NBT/BCIP substrate (Pierce) was added. Spots were developed during 5 min of incubation at room temperature. The plates were rinsed with water, dried overnight in the dark, and analyzed using the CTL-ImmunoSpot® UV Analyzer.

T cell proliferation and T cell suppression assays

For T cell proliferation assays, total splenocytes (2xl0⁵) in tissue-culture medium were added to 96-well plates. GPI peptide (GPI₂₈₂-294) was added to the culture at various concentrations as indicated in the relevant figure. After 2 days of culture, ΙμΟ of H-thymidine was added to each well, the plates were incubated overnight, and cells were harvested and the radioactivity determined by a beta counter. For T cell

suppression assays, responder T cells (CD4⁺CD25^~) were sorted from spleens of SPF K/BxN mice and Tregs (CD4⁺CD25⁺) were sorted from spleens of either GF or SPF K/BxN mice. Responder T cells were stimulated with anti-CD3/CD28 beads

(Dynabeads, Invitrogen) and cultured in complete medium at a density of 2.5 x 10⁴- 5.0xl0⁴ cells/well, either alone or with various concentrations of Tregs for 3 days. ³H- thymidine incorporation was examined as described above.

Gene-expression analyses

RNA was prepared as described (Hill, J .A., et al. (2008). Immunity 29, 758-

770). For microarray analysis, RNA was labeled and hybridized to GeneChip Mouse Genome 430 2.0 arrays following the Affymetrix protocols. GF or SPF splenic

CD3⁺CD4⁺ T cells from BxN or K/BxN mice were isolated via MoFlo sorting

(DakoCytomation). Data were analyzed using Multiplot software. The Thl, Th2 and Thl7 signatures were derived from the data of Dong and collaborators (Nurieva, R.L, et al. (2008). Immunity. 29, 138-149), each signature generated by using 2 as an arbitrary FC cut-off over the expression value of the other two cell-types.

RNA was isolated from splenocytes via Trizol (6756), and was reverse- transcribed using oligo dT priming and Superscript polymerase (Invitrogen).

Quantitative RT-PCR was performed on an Mx3000p instrument (Stratagene), using gene-specific fluorogenic assays (TaqMan, Applied Biosystems). Forward primers (FPs) and reverse primers (RPs) were from MWG Biotech, and probes for IL-4 and IFN-γ were ordered from Applied Biosystems. IL-4 (FP: TCCTCACAGCAAOGAAGAACAC (SEQ ID NO: 1), RP: CAAGCATGGAGTTTTCCCATG (SEQ ID NO:2), probe:

TGTAGGGCTTCCAAGGTGCTn (SEQ ID NO:3)) , IFN-γ (FP:

CAGCAACAGCAAGGCGAAA (SEQ ID NO:4), RP:

CTGGACCTGTGGGTTGTTGAC (SEQ ID NO: 5), probe:

TCAAACTTGGCAATACTCATGAATGCATCCT (SEQ ID NO:6)). For IL-17A, a 10 μΐ final reaction mix containing TaqMan Universal PCR Master Mix (Applied

Biosystems) and IL-17A TaqMan Gene Expression Assays (Mm00439619_ml) were used. Cytokine transcripts in spleens were quantified by RT-PCR using hypoxanthine guanine phosphoribosyl transferase mRNA as an internal standard.

Cell Transfers

B cells were positively purified on B220-conjugated MACS beads from

B6g7.IL-17R^_/" mice or WT B6g7 littermate controls. B cells (10X10⁶) from either WT or IL-17R^"7" mice were combined with splenocytes (12X10⁶) from arthritic K/BxN mice and transferred into lightly irradiated (450R) BxN.Rag^"7" recipients. Splenocytes were isolated after two weeks for B cell reconstitution analysis. SI-LP cell isolation and analysis

SI-LP were isolated as described, with some modification (Ivanov, I.I., et al. (2006). Cell 126, 1121-1133; Atarashi, K., et al. (2008). Nature 455, 808-812). Briefly, the SI was taken, residual mesenteric fat tissue was removed, Peyer's patches were carefully excised, and the intestine was opened longitudinally. It was then thoroughly washed in ice-cold PBS and cut into 1 cm pieces, which were incubated twice in 25 ml of 5 mM ethylenediaminetetraacetic acid (EDTA) and 0.145 mg/ml DL-Dithiothreitol (DTT) in Dulbecco's Modified Eagle Medium (DMEM) for 40 min at 37°C at a rotation speed of 200 rpm. After incubation, the epithelial cell layer, containing the

intraepithelial lymphocytes, was removed by intensive vortexing and passing through a 100 μιη cell strainer. After the second EDTA incubation, the bits were washed in PBS, cut into 1 mm pieces using scissors, and placed in 15 ml digestion solution containing 1 mg/ml each of CoUagenase D (Roche) and 0.15 mg/ml DNase I (Sigma), and 200 ng/ml liberase CI (Roche). Digestion was performed by incubating the pieces at 37°C for 20 min with rotation. After the initial 20 min, the solution was vortexed intensely and passed through a 100 μιη cell strainer. The supernatants were passed through a 40 μιη cell strainer and the cells were resuspended in 10% DMEM medium for stimulation.

Microbiota reconstitution

For inoculation of GF mice with SFB, fecal pellets were collected from SFB- monocolonized mice using sterilized test tubes in the vinyl-isolator, and were preserved frozen under dry ice until immediately before oral administration. Colonizations were performed by oral gavage with 300-400 μΐ of suspension obtained by homogenizing the fecal pellets in water. Control mice were gavaged with homogenates prepared from their own feces.

16S rRNA gene quantitative PCR analysis Bacterial genomic DNA was extracted from fresh or frozen fecal samples (within an experiment the samples were treated identically) by phenol-chloroform extraction as previously described (Ivanov, I.I., et al. (2009). Cell 139, 485-498). Arthritis is attenuated in GF K/BxN mice, reflecting reduced anti-GPI autoAb titers.

To explore the impact of commensal microbes on the development of autoimmune arthritis, GF colonies of KRN/B6 and NOD mice, were established and the two strains were mated to obtain K/BxN experimental animals. As judged by both ankle thickening (Fig. 1A) and clinical index, GF-housed K/BxN mice developed an attenuated arthritis compared with that of K/BxN animals contemporaneously housed in a specific -pathogen-free (SPF) facility - both delayed in onset and reduced in severity.

A key disease landmark in this arthritis model is the production of high titers of serum anti-GPI autoAbs, which separates the initiation phase, dependent on the adaptive immune system, from the effector phase, mostly driven by innate immune system players (Korganow, A.S., et al. (1999). Immunity 10, 451-461). The titer of serum anti- GPI Abs in 8-week-old GF K/BxN mice was substantially lower than that of their SPF counterparts (Fig. IB), true for total IgG and specifically for IgGl, the dominant anti- GPI isotype in the K/BxN model (Korganow, A.S., et al. (1999). Immunity 10, 451- 461). It should be noted that discordance between autoAb titers and the degree of ankle thickening is frequent at late timepoints (like 18 weeks) because at this stage of disease ankle thickness reflects primarily bone remodeling and fibrosis rather than inflammation (Kouskoff, V., et al. (1996). Cell 87, 811-822).

To confirm that the differences in disease parameters really reflected the GF environment - and not, for example, genetic drift - and to evaluate their reversibility, 21-day-old GF K/BxN mice were transferred back into the SPF facility. Within 14 days, they had begun to develop arthritis, which soon surpassed the disease of straight GF K/BxN animals in both its speed and severity, but was still delayed and diminished visa-vis straight SPF counterparts (Fig. 1C). Clinical disease severity reflected the titers of anti-GPI Ab attained at 7 weeks of age under the three housing conditions (Fig. ID). The impact of commensal microbes on the adaptive immune system of K/BxN mice.

While influences on effector-phase processes certainly remain possible, the reduced anti-GPI autoAb titers in the absence of commensal microbes suffices, in and of itself, to explain the attenuated arthritis in GF K/BxN mice (Matsumoto, L, et al. (1999). Science 286, 1732-1735). Therefore, the impact of commensals on the adaptive immune system in this model was examined, focusing on the spleen because by far most anti-GPI Ab-secreting cells (ASCs) reside in this organ (Maccioni, M., et al. (2002). J. Exp. Med. 195, 1071-1077; Huang, H., et al. (2010). Proc Natl Acad Sci U S A 107, 4658-4663). First, the B-lymphocyte compartments were surveyed by performing a four-way comparison of splenocytes from 6- to 8-week-old BxN vs K/BxN mice housed in SPF vs GF conditions. The percentages and numbers of splenic B cells (CD4^"CD19⁺) in GF and SPF K/BxN mice were similar, as were, more specifically, their: Tl (IgM^hiIgD^lG), T2 (IgM^hiIgD^hi), mature (IgM^loIgD^hi), follicular (CD21^loCD23^hi) and marginal zone

(CD21^hiCD23^lG) B cell compartments. SPF K/BxN mice showed an increase in the percentage of splenic germinal center (GC) B cells (Fas⁺PNA-receptor⁺) vis-a-vis BxN controls, reflecting activation and expansion of the anti-GPI specificities (Fig 2A, upper panels). This augmentation did not occur under GF conditions (Fig 2A, lower panels). Perhaps not surprisingly, then, GF K/BxN mice had a reduced complement of

CXCR5⁺PD1⁺ T follicular helper (Tfh) cells, which reside primarily in GCs (Fig. 2B). The spleens of GF K/BxN mice also had a reduced fraction of anti-GPI ASCs, as measured by an ELISPOT assay (Fig. 2C). These deficiencies can explain the reduced titer of serum anti-GPI autoAbs in GF K/BxN mice.

Given the established T-cell dependence of the anti-GPI autoAb response (Korganow, A.S., et al. (1999). Immunity 10, 451-461; Kouskoff,V., et al. (1996). Cell 87, 811-822), the T-lymphocyte compartments of K/BxN mice kept under the two husbandry conditions was also compared. There were only minor changes in the representation of thymic or splenic CD4⁺ or CD8⁺ T cells in GF animals, the biggest difference being a 20-50% reduction in the splenic CD4⁺ T cell compartment compared with that of SPF mice, and the activation state of peripheral cells was similar under the two housing conditions {e.g. Fig. 2D). Also, there was no evident change in either the fraction of CD4⁺Foxp3⁺ T regulatory (Treg) cells or in their in vitro suppressive activity. However, splenocytes from GF K/BxN mice responded less well than those from SPF K/BxN animals when challenged in vitro with the relevant GPI peptide at all doses tested (Fig. 2E).

GF K/BxN mice have a dearth of splenic IL-17-producing T cells.

It seemed, then, that the T helper capabilities of GF K/BxN mice were somehow compromised. To permit a broad, unbiased comparison of Th cells from mice under the two conditions, microarray-based gene-expression profiling on CD4⁺ T cells purified from spleens of SPF and GF BxN and K/BxN animals was performed. A

FoldChange/FoldChange (FC/FC) plot revealed up-regulation of a large number of transcripts in the K/BxN (vs BxN) T cells; the off-diagonal disposition of the major cloud of dots indicated that induction levels were muted in GF (vs SPF) mice (Fig. 3A). Another instructive way to compare gene expression in SPF and GF mice are the "volcano plots" depicted in Fig. 3B, which display for each gene the SPF vs GF FC on the x-axis and the p-value of this FC on the y-axis. Superimposing previously determined Th-cell signatures (Nurieva, R.L, et al. (2008). Immunity. 29, 138-149) onto the plots showed there to be minimal changes in GF CD4⁺ T cells in transcripts typical of Th2 cells, i.e., no bias to either side of the midline. However, as indicated by their skewed disposition away from the right, the Thl and Thl7 signatures were diminished in GF CD4⁺ T cells. The defect in the Thl subset was not further pursued in this study because a null mutation of the gene encoding interferon (IFN)-y, the major Thl cytokine had recently been crossed, and no impact on arthritis parameters, including ankle thickening, clinical score and histopathology were observed.

The transcript profiling pointed to a defect in GF K/BxN Thl7 cells that encompassed several of this subset's hallmark proteins: e.g. reductions in RORyt (1.8- fold), IL-17A (1.3-fold), IL-21 (1.3-fold), IL-22 (3.2-fold) and CCR6 (1.3-fold). The dearth of IL-17A was confirmed by both PCR quantification of splenic CD4⁺ T cell transcripts (Fig. 3C) and cytofluorimetric evaluation of IL-17 levels in this population re-stimulated ex-vivo (Fig. 3D). According to both assays, 1117 gene expression was strongly induced in SPF K/BxN vis-a-vis BxN mice, but this induction was minimal under GF conditions.

To assess the disease relevance of a defect in the Thl7 cell compartment of K/BxN mice, neutralization experiments using an anti-IL-17 monoclonal Ab (mAb) were performed. Treatment of 25-day-old SPF-housed K/BxN mice, just at arthritis onset, with anti-IL-17 completely blocked disease progression, which was reflected in low serum anti-GPI autoAb titers (Fig. 4A). In addition, when GF mice were transferred to the SPF facility, they did not succumb to arthritis if anti-IL-17 mAb was administered from the time of transfer, and they maintained low serum anti-GPI titers (Fig. 4B).

As IL-17 has generally been thought of as a pro-inflammatory cytokine, its effect on anti-GPI titers may appear surprising on first consideration. However, Hsu et al. recently reported a direct impact of IL-17 on GC formation in the BXD2 mouse model (Hsu, H.C., et al. (2008). Nat. Immunol 9, 166-175). Indeed, anti-IL-17 blocking studies showed that this cytokine was required for efficient GC formation in the K/BxN model (Fig. 4C), and transfer experiments comparing the behavior of B cells with and without IL-17R demonstrated that IL-17's promotion of GCs was a direct effect on B cells (Fig. 4D).

Linking arthritis to the gut flora.

Thus, a paucity of IL-17-producing T cells seemed to be a major factor in the diminished arthritis of GF K/BxN mice. How can commensal microbes impact on the production of IL-17 by splenic T cells? Microbial colonization of the gut promotes Thl7 cell differentiation in the small-intestinal lamina-propria (SI-LP), the major site of this subset's differentiation (Ivanov, I.I., et al. (2008). Cell Host. Microbe 4, 337-349;

Atarashi, K., et al. (2008). Nature 455, 808-812). Indeed, Thl7 cells were essentially absent from that site in GF K/BxN animals (Fig. 5A). This contrasts with the behavior of IL-17-expressing CCR6⁺ γδ T cells in the SI-LP, which were not reduced in GF mice. Several experiments were performed to explore a potential link between SI-LP and splenic Thl7 cells. First, their appearance through ontogeny was compared: Ivanov et al. have shown that SI-LP Thl7 cells arise abruptly between day 16 and day 25 after birth, around the time of weaning (Ivanov, I.I., et al. (2008). Cell Host. Microbe 4, 337-349), which is just before the window of arthritis development previously reported for the K/BxN model, i.e., day 25-31 (Kouskoff, V., et al. (1996). Cell 87, 811-822). A direct temporal comparison of the relevant parameters in SPF K/BxN mice revealed that SI-LP Thl7 cells appeared in substantial numbers between 2 and 3 weeks of age (Fig. 5Bi), followed closely by splenic Thl7 cells between 3 and 4 weeks (Fig. 5BH), and arthritis onset at around 4 weeks (Fig 5Biii). Secondly, the gut homing receptor on splenic Thl7 cells was searched for. Supporting an intestinal origin, 30-50% of splenic Thl7 cells from 5-week-old K/BxN, but not BxN, mice expressed the gut homing receptor, 4β7, which is imprinted by intestinal-mucosa-associated DCs (Sigmundsdottir, H. and Butcher, E.C. (2008). Nat Immunol. 9, 981-987) (Fig. 5C). Lastly, the sensitivities of the SI-LP and splenic Thl7 compartments and of arthritis development to antibiotic treatments was compared. Ivanov et al. reported that the differentiation of SI-LP Thl7 cells is blocked by ampicillin and vancomycin but not by metronidazole and neomycin, the latter two targeting anaerobes and Gram-negative bacteria, respectively, i.e. >90 of the gut flora (Atarashi, K., et al. (2008). Nature 455, 808-812). This pattern of sensitivity was also true of SI-LP and splenic Thl7 cells in K/BxN mice (Fig. 6A and B), including those splenic Thl7 cells that expressed 4β7 {e.g., Fig. 6C). Most important, treatment of K/BxN mice from birth with vancomycin or ampicillin, but not metronidazole or neomycin, strongly inhibited the development of arthritis (Fig. 6D). Interestingly, disease was actually exacerbated in the neomycin-treated animals, suggesting an additional negative influence of Gram-negative gut bacteria.

Introduction of SFB into the gut triggers arthritis in GF-housed K/BxN mice.

Ivanov et al. recently discovered that a single bacterial species that is a component of the normal gut flora, SFB, was sufficient to induce the development of SI- LP Th 17 cells in mice taken from an SPF facility at the Jackson Laboratory, wherein they typically show a dearth of both this bacterium and Thl7 cells (Ivanov, I.I., et al. (2009). Cell 139, 485-498). This result drew our attention because lower anti-GPI autoAb titers and attenuated arthritis development were noted when first introducing the K/BxN model into Jackson, vis-a-vis the SPF colonies in Strasbourg and Boston.

Therefore, whether SFB might be arthritogenic was tested by introducing it, via oral gavage of fecal material from SFB-monocolonized mice (vs feces from GF mice), into GF-housed K/BxN mice transferred into an SPF facility at 21 days of age (Fig. 7A). Prior experiments like those illustrated in Fig. 1C had demonstrated that transferred GF mice do develop arthritis, but typically not until 2 weeks after exposure to SPF conditions, i.e., after 35 days of age. Strikingly, introduction of SFB greatly accelerated arthritis onset in the transferred mice, beginning already 3 days after gavage, i.e., after only 28 days of age (Fig. 7B). PCR analysis of fecal material at 6 days after gavage indicated that at this early time point only those mice administered SFB-containing feces were colonized with SFB (Fig. 7C), and flow cytometry of SI-LP and spleen cells at 33 days of age confirmed the association between SFB colonization, the appearance and migration of Thl7 cells, and the triggering of arthritis (Fig. 7D and E). Lastly, as anticipated, introduction of SFB led to an elevation of anti-GPI autoAb titers to levels that are known to induce arthritis (Fig. 7F; cf Fig. IB).

DISCUSSION

Recent studies have highlighted a critical role for the gut microbiota (NiessJ .H., et al. (2008). J. Immunol. 180, 559-568; Atarashi, K., et al. (2008). Nature 455, 808- 812; Ivanov, I.I., et al. (2008). Cell Host. Microbe 4, 337-349), in particular SFB (Salzman, N.H., et al (2009). Nat. Immunol; Gaboriau-Routhiau,V., et al (2009).

Immunity. 31, 677-689; Ivanov, I.I., et al. (2009). Cell 139, 485-498), in the

differentiation of Thl7 cells in the intestinal LP. The data presented herein establish the relevance of these observations for the initiation of autoimmune disease - in particular, a non-gut autoimmune disorder. Auto-inflammatory arthritis was attenuated in K/BxN mice housed in GF vis-a-vis SPF conditions, reflecting reduced titers of the disease- driving autoAb specificity, anti-GPI, a paucity of GCs, and a dearth of Thl7 cells in the spleen and SI-LP. Introduction of SFB into the gut of GF-explanted K/BxN mice triggered arthritis within days, accompanied by the restoration of the Thl7 cell populations and anti-GPI titers.

SFB are Gram-positive, spore-forming obligate anaerobes that have not yet been successfully cultured in vitro (Klaasen, H.L., et al. (1992). FEMS Microbiol. Rev. 8, 165-180). Most closely related to Clostridia, and provisionally designated Candidatus arthromitus (Snel, J., et al. (1995). Int. J. Syst. Bacteriol. 45, 780-782), they are long and filamentous, comprised of multiple segments with distinct septa (Klaasen, H.L., et al. (1992). FEMS Microbiol. Rev. 8, 165-180). SFB have been detected morphologically in the ileum of all vertebrate species studied to date, including Homo sapiens (Klaasen, H.L., et al. (1993a). Lab Anim 27, 141-150). They colonize the gut of mice at weaning (Garland CD, et al. (1982). Microb Ecol 8, 181-190), when they adhere tightly to epithelial cells of the ileum, in particularly close association with the Peyer's patches (Klaasen, H.L., et al. (1992). FEMS Microbiol. Rev. 8, 165-180). SFB are known interact with the immune system, promoting the development of robust LP lymphocyte populations, the secretion of IgA, and the recruitment of intraepithelial lymphocytes (Klaasen, H.L., et al. (1993b). Infect. Immun. 61, 303-306; Talham, G.L., et al. (1999). Infect. Immun. 67, 1992-2000; Umesaki,Y., et al. (1995). Microbiol. Immunol. 39, 555- 562). This bacterial species has, moreover, been reported to impact on intestinal immune-responsiveness, e.g., in the context of inflammatory bowel disease (Stepankova, R., et al. (2007). Inflamm. Bowel. Dis. 13, 1202-1211) and Citrobacter infection (Ivanov, I.I., et al. (2009). Cell 139, 485-498).

SFB in the K/BxN model

How does SFB promote the development of joint inflammation in K/BxN mice? In broad outline: K/BxN arthritis relies strongly on IL-17 (Fig. 4), and the appearance of IL-17 -producing Th cells in both the intestinal LP and spleen depends critically on gut microbes, in particular SFB (Atarashi, K., et al. (2008). Nature 455, 808-812; Ivanov, I.I., et al. (2009). Cell 139, 485-498; Salzman, N.H., et al. (2009). Nat. Immunol;

Ivanov, I.I., et al. (2008). Cell Host. Microbe 4, 337-349; Gaboriau-Routhiau,V., et al. (2009). Immunity. 31, 677-689; NiessJ .H., et al. (2008). J. Immunol. 180, 559-568) and Figs. 5 and 7). The possibility that other gut microbes can promote, or can synergize with SFB in promoting, arthritis in this model is not ruled out, but note that other species, including members of the SFB-related Clostridiaceae family, were not able to induce the accumulation of SI-LP Thl7 cells in a previous set of studies (Ivanov, I.I., et al. (2009). Cell 139, 485-498).

An early step in K/BxN disease induction is likely to be activation of APCs residing in the intestinal LP, as it is known that gut microflora can have an indirect adjuvant effect in pathogen infections [e.g. (Benson, A., et al. (2009). Cell Host.

Microbe 6, 187-196)]. It was recently shown that ATP produced by gut microbes drives a unique population of CD70^hlCDl lc^lQ cecal LP APCs to produce IL-6, IL-23 and other factors that favor the differentiation of the Thl7 subset, and that ex vivo co-culture of these APCs with naive CD4⁺ T lymphocytes induces the appearance of Thl7 cells (Atarashi, K., et al. (2008). Nature 455, 808-812). Perhaps more relevant for the present studies, Ivanov et al. demonstrated that SFB do not operate via ATP or MyD88 in the SI-LP, but up-regulate the production of acute-phase isoforms of serum alpha amylase (A-SAA) in the ileum, which can act on DCs isolated from the SI-LP to induce co- cultured naive CD4⁺ T lymphocytes to differentiate into Thl7 cells (Ivanov, I.I., et al. (2009). Cell 139, 485-498). The activation of APCs in the SI-LP should be sufficient to drive an anti-GPI Thl7 response in the vicinity and, indeed, 6- to 8- week-old SPF K/BxN mice showed a near-doubling of SI-LP Thl7 cells compared with SPF BxN animals [19.9 + 2.9 vs 11.4 + 1.5 in SPF mice compared with 1.9 ± 1.0 vs 2.9 + 0.2 in GF animals (data not shown)]. Given that GPI is expressed in all cell-types, and circulates at low levels in the blood, and that this is a TCR-transgenic system with a high frequency of self-reactive T cells, there is no need to invoke more complicated scenarios entailing molecular mimicry (Harkiolaki, M., et al. (2009). Immunity. 30, 348-357) in this context, i.e., the initial activation of GPI-reactive T cells does not depend on cross-reactivity to a gut-microbe antigen.

Once generated, GPI-reactive SI-LP Thl7 cells are competent to exit the GALT and re-circulate (Sigmundsdottir, H. and Butcher,E.C. (2008). Nat Immunol. 9, 981- 987). Gut APCs, in particular the CD103⁺ subset of intestinal LP DCs, produce elevated levels of retinoic acid, which induces associated T cells to express the gut-homing receptor, the 4β7 integrin. These "gut-imprinted" T cells re-circulate through the intestinal lymphatics, enter the bloodstream and preferentially home back to the LP. In the K/BxN system, a population of cc4 7-expressing Thl7 cells appeared to be retained in the spleen (Fig. 5C), where they are positioned to provide help for the

characteristically massive anti-GPI autoAb response. The alternative explanation that CD103⁺ DCs migrate from the gut to the spleen and induce 4β7⁺ Thl7 cells there is less likely given reports that GALT DCs generally do not migrate beyond the mesenteric lymph nodes (Macpherson, A.J. and Uhr,T. (2004). Science 303, 1662-1665; Voedisch, S., et al. (2009). Infect. Immun. 77, 3170-3180). The IL-17 produced by Thl7 cells was required for effective GC formation in K/BxN spleens (Fig. 4C), which was a direct effect of this cytokine on B cells (Fig. 4D). Although IL-17 is not generally thought of as a "helper" cytokine for B cells, our data are reminiscent of findings on the BXD2 model, which argue that this cytokine can act on B cells by suppressing their

chemotactic response to CXCL12 (Hsu, H.C., et al. (2008). Nat. Immunol 9, 166-175).

The generation of high titers of anti-GPI autoAbs is a pivotal event in the K/BxN model (Korganow, A.S., et al. (1999). Immunity 10, 451-461). They combine with circulating GPI to form immune complexes, which are deposited along the non-cellular joint surface where the cartilage meets the articular cavity (Matsumoto, I., et al. (2002). Nat. Immunol. 3, 360-365). Because of the dearth of inhibitors at this site, the alternative pathway of complement is activated, leading to the recruitment and activation of inflammatory leukocytes. As has been discussed at length (Matsumoto, I., et al. (2002). Nat. Immunol. 3, 360-365; Binstadt, B.A., et al. (2006). Nat Immunol. 7, 284-292), the joint- specificity of the auto-inflammation in the K/BxN model does not result from joint- specific T or B cell responses, but rather from particularities of joint structure and physiology, such as the lack of complement inhibitors at the site where the autoAbs are deposited and a particularly leak-prone vasculature. Indeed, it is difficult to find anti- GPI T and B cells in the joint itself (Kouskoff.V., et al. (1996). Cell 87, 811-822). While the low titer of anti-GPI autoAbs in the absence of SFB suffices in and of itself to explain the dampening of arthritis observed in GF-housed mice (Matsumoto, I., et al. (1999). Science 286, 1732- 1735), it remains possible that commensal microbes also impact on downstream disease processes. Indeed, a positive influence of Thl7 cells on the K/BxN serum-transfer system was recently described (Jacobs JP, et al. (2010). Proc Natl Acad Sci U S A In press), and there is anecdotal evidence that serum-transferred disease is affected in a GF environment - though, surprisingly, exacerbated (Maslowski, K.M., et al. (2009). Nature 461, 1282-1286).

SFB and other autoimmune disorders

The influence of microbial commensals on arthritis development in other mouse models has been variable, covering the range from inhibition to little effect to augmentation (Bjork, J., et al. (1994). Scand. J Immunol. 40, 648-652; Chervonsky, A.V. (2010). Nat. Immunol. 11, 28-35). The significance of these studies is, however, difficult to assess because, in general, they relied on the administration of bacteria or bacterial products (often Complete Freunds' Adjuvant) for the induction of disease. Our findings are conceptually different from the observation that fungal infection, likely through the lungs and/or skin of conventionally (compared with SPF-) housed mice, augments arthritis development in the skg model (Yoshitomi, H., et al. (2005). J Exp Med 201, 949-960). Interestingly, the clear microbe-dependence we observed in the K/BxN model is reminiscent of reports that the "reactive" arthritis accompanying the spontaneous multi-organ inflammation of HLA-B27-transgenic rats is attenuated under GF conditions (Rath, H.C., et al. (1996). J Clin. Invest 98, 945-953; Taurog, J.D., et al. (1994). J Exp Med 180, 2359-2364). Because of the relatively high rate of discordance of human rheumatoid arthritis (RA) in monozygotic twins, the role of microbes in this disorder has been of great interest, although the conclusions have often been contentious (reviewed in (Edwards, C.J. (2008). J Rheumatol. 35, 1477-1479)). Most of the attention has been devoted to disease correlations with infectious microorganisms, resulting in claims of association with a number of them, including Mycobacterium tuberculosis, Proteus mirabilis, Escherichia coli, Epstein-Bar virus, retroviruses, etc. However, none of the associations has emerged as dominating, and mechanistic insights are lacking. Only of late has some of the focus shifted to the potential influence of microbial commensals. Most recently, Vaahtovuo et al. reported differences in the intestinal microbiota of patients with early (<6-month duration) RA vis-a-vis controls with fibromyalgia, as assessed from the 16S rRNA composition of fecal samples (Vaahtovuo, J., et al. (2008). J Rheumatol. 35, 1500-1505), but is difficult to distinguish cause from effect in such a study. Clearly, this is an area that merits further exploration, which will probably need to partner with studies on animal models to establish causality, permit mechanistic dissection and allow pre-clinical evaluation of suggested therapeutic strategies. Indeed, antibiotics such as sulfasalazine and minocyline have been known for some time to have beneficial effects on RA progression, but underlying mechanisms remain the subject of substantial controversy (Stone, M., et al. (2003). J Rheumatol. 30, 2112-2122). Most relevant in the present context, SFB and related species do populate the human gut (Klaasen, H.L., et al. (1993a). Lab Anim 27, 141-150), but their relevance to arthritis remains unexplored.

More generally, commensal microbes can have a variable influence on different spontaneously developing autoimmune diseases (Chervonsky, A.V. (2010). Nat.

Immunol. 11, 28-35). For example, introduction of Aire^"7" mice into a GF facility had no significant impact on the severity or scope of the multi-organ auto-inflammation that appears under SPF conditions (Gray, D.H., et al. (2007). Proc Natl. Acad Sci U S. A. 104, 18193-18198). And it is well known that the penetrance of type-1 diabetes in the NOD mouse strain increases with cleaner housing conditions, rising to 100% in GF facilities (Pozzilli, P., et al. (1993). Immunol. Today 14, 193-196). It is tempting to speculate that these divergent effects might, at least in part, reflect the various diseases' differential dependence on particular Th subsets. In this regard, it may be relevant that for neither of these diseases has there emerged definitive evidence of a critical role for Thl7 cells (DeVoss, J.J., et al. (2008). J Immunol 181, 4072-4079; Martin-Orozco, N., et al. (2009). Eur. J Immunol. 39, 216-224; Bending, O.,et al. (2009). J Clin. Invest.; Emamaullee, J.A.,et al. (2009). Diabetes 58, 1302-1311).

In short, the triggering of K/BxN arthritis by the gut-resident microbe, SFB, highlights the potential of exploiting probiotic or antibiotic substances to modulate particular autoimmune diseases.

Claims

What is claimed is:

1. A method for treating a subject afflicted with an autoimmune disorder, the method comprising: administering a therapeutic amount of an inhibitor of at least one host molecule to the subject, wherein the host molecule promotes Thl7 cell

differentiation and is induced by the subject responsive to the presence of segmented filamentous bacteria (SFB) in the subject's gastrointestinal (GI) tract or a therapeutic amount of an inhibitor of at least one SFB activity that promotes Thl7 cell

differentiation, wherein the administering effectuates treatment of the subject afflicted with the autoimmune disorder.

2. The method of claim 1, wherein the at least one host molecule is serum amyloid A 1; resistin like beta; solute carrier family 6 (neurotransmitter transporter), member 14; placenta expressed transcript 1; serum amyloid A 2; granzyme B.;

granzyme A; Z-DNA binding protein 1; nitric oxide synthase 2, inducible, macrophage; hematopoietic cell transcript 1; CD38 antigen; interferon gamma induced GTPase;

fucosyltransferase 2; UDP-GlcNAc:betaGal beta-l,3-N-acetylglucosaminyltransferase 7; T-cell receptor gamma, variable 3; sphingomyelin phosphodiesterase, acid- like 3B; betaine-homocysteine methyltransferase; solute carrier family 9 (sodium/hydrogen exchanger), member 3; dual oxidase maturation factor 2; or lymphocyte antigen 6 complex, locus D.

3. The method of claim 1, wherein the at least one SFB activity that promotes Thl7 cell differentiation is SFB proliferation or attachment to intestinal epithelial cells.

4. The method of claim 1, wherein the at least one SFB activity that promotes Thl7 cell differentiation is an activity of an SFB product.

5. The method of claim 1, further comprising measuring Thl7 cell

differentiation in the subject, wherein a decrease in the Thl7 cell differentiation in the subject after the administering relative to prior to the administering is a positive indicator of effective treatment of the subject.

6. The method of claim 5, wherein the decrease in the Thl7 cell differentiation is detected as a decrease in Thl7 cell numbers or activity.

7. The method of claim 6, wherein the decrease in Thl7 cell numbers or activity is measured in a blood sample or biopsy isolated from the subject after the administering and determined relative to Thl7 cell numbers or activity in a blood sample or biopsy isolated from the subject prior to the administering.

8. The method of claim 7, wherein the biopsies isolated from the subject after and prior to the administering are isolated from the subject's joints.

9. The method of claim 1, wherein the autoimmune disorder is a non- gastrointestinal (GI) tract autoimmune disorder.

10. The method of claim 9, wherein the non-GI tract autoimmune disorder is autoimmune arthritis.

11. The method of claim 1, wherein the autoimmune disorder is a GI tract autoimmune disorder.

12. A method for treating a subject afflicted with a non-GI tract autoimmune disorder, the method comprising: administering a therapeutic amount of an inhibitor of at least one activity of segmented filamentous bacteria (SFB) to the subject.

13. The method of claim 12, wherein the at least one activity is SFB

proliferation or attachment to intestinal epithelial cells.

14. The method of claim 12, wherein the at least one SFB activity that promotes Thl7 cell differentiation is an activity of an SFB product.

15. The method of claim 12, wherein the non-GI tract autoimmune disorder is autoimmune arthritis.

16. A method for treating a subject having a non-gut autoimmune disorder, the method comprising administering to the subject a therapeutically effective amount of an inhibitor of a T_hl7 cell inducing bacterial species, thereby treating the non-gut autoimmune disorder in the subject.

17. The method of claim 16, wherein the inhibitor of the T_hl7 cell inducing bacterial species inhibits the differentiation of a T_hl7 cell.

18. The method of claim 17, wherein the inhibitor of the T_hl7 cell inducing bacterial species inhibits the production of IL-17 in a T_hl7 cell.

19. The method of claim 18, wherein the inhibitor of the T_hl7 cell inducing bacterial species inhibits B cell auto-antibody production.

20. The method of claim 16, wherein the inhibitor of the T_hl7 cell inducing bacterial species inhibits the attachment of the T_hl7 cell inducing bacterial species to an intestinal epithelial cell.

21. The method of claim 16, wherein the inhibitor of the T_hl7 cell inducing bacterial species inhibits the expression and/or activity of a gene which promotes T_hl7 cell differentiation and whose expression is induced in the gut of the subject by the T_hl7 cell inducing bacterial species.

22. The method of claim 21, wherein the gene is selected from the group consisting of RORyt, IL-17 A, IL-21, IL-22, and CCR6.

23. The method of claim 21, wherein the gene is selected from the group consisting of serum amyloid A 1; resistin like beta; solute carrier family 6

(neurotransmitter transporter), member 14; placenta expressed transcript 1; serum amyloid A 2; granzyme B.; granzyme A; Z-DNA binding protein 1; nitric oxide synthase 2, inducible, macrophage; hematopoietic cell transcript 1; CD38 antigen;

interferon gamma induced GTPase; fucosyltransferase 2; UDP-GlcNAc:betaGal beta- 1,3-N-acetylglucosaminyltransferase 7; T-cell receptor gamma, variable 3; sphingomyelin phosphodiesterase, acid-like 3B; betaine-homocysteine

methyltransferase; solute carrier family 9 (sodium/hydrogen exchanger), member 3; dual oxidase maturation factor 2; or lymphocyte antigen 6 complex, locus D.

24. The method of claim 16, wherein the non-gut autoimmune disorder is selected from the group consisting of autoimmune arthritis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, Lyme arthritis, psoriatic arthritis, reactive arthritis, spondyloarthropathy, systemic lupus erythematosus, insulin dependent diabetes mellitus, thyroiditis, asthma, psoriasis, dermatitis scleroderma, atopic dermatitis, graft versus host disease, acute or chronic immune disease associated with organ

transplantation, sarcoidosis, atherosclerosis, disseminated intravascular coagulation, Kawasaki's disease, Grave's disease, nephrotic syndrome, chronic fatigue syndrome, Wegener's granulomatosis, Henoch-Schoenlein purpurea, microscopic vasculitis of the kidneys, chronic active hepatitis, uveitis, septic shock, toxic shock syndrome, sepsis syndrome, cachexia, infectious diseases, parasitic diseases, acquired immunodeficiency syndrome, acute transverse myelitis, Huntington's chorea, Parkinson's disease,

Alzheimer's disease, stroke, primary biliary cirrhosis, hemolytic anemia, sporadic, polyglandular deficiency type I and polyglandular deficiency type II, Schmidt's syndrome, adult (acute) respiratory distress syndrome, alopecia, alopecia areata, seronegative arthopathy, arthropathy, Reiter's disease, psoriatic arthropathy, chlamydia, yersinia and salmonella associated arthropathy, spondyloarthopathy, atheromatous disease/arteriosclerosis, atopic allergy, autoimmune bullous disease, pemphigus vulgaris, pemphigus foliaceus, pemphigoid, linear IgA disease, autoimmune haemo lytic anaemia, Coombs positive haemolytic anaemia, acquired pernicious anaemia, juvenile pernicious anaemia, myalgic encephalitis/Royal Free Disease, chronic mucocutaneous candidiasis, giant cell arteritis, primary sclerosing hepatitis, cryptogenic autoimmune hepatitis, Acquired Immunodeficiency Disease Syndrome, Acquired Immunodeficiency Related Diseases, Hepatitis C, common varied immunodeficiency (common variable

hypogammaglobulinemia), dilated cardiomyopathy, fibrotic lung disease, cryptogenic fibrosing alveolitis, post-inflammatory interstitial lung disease, interstitial pneumonitis, connective tissue disease associated interstitial lung disease, mixed connective tissue disease associated lung disease, systemic sclerosis associated interstitial lung disease, rheumatoid arthritis associated interstitial lung disease, systemic lupus erythematosus associated lung disease, dermatomyositis/polymyositis associated lung disease, Sjogren's disease associated lung disease, ankylosing spondylitis associated lung disease, vasculitic diffuse lung disease, haemosiderosis associated lung disease, drug-induced interstitial lung disease, radiation fibrosis, bronchiolitis obliterans, chronic eosinophilic pneumonia, lymphocytic infiltrative lung disease, postinfectious interstitial lung disease, gouty arthritis, autoimmune hepatitis, type-1 autoimmune hepatitis (classical

autoimmune or lupoid hepatitis), type-2 autoimmune hepatitis (anti-LKM antibody hepatitis), autoimmune mediated hypoglycemia, type B insulin resistance with acanthosis nigricans, hypoparathyroidism, acute immune disease associated with organ transplantation, chronic immune disease associated with organ transplantation, osteoarthrosis, primary sclerosing cholangitis, idiopathic leucopenia, autoimmune neutropenia, renal disease NOS, glomerulonephritides, microscopic vasulitis of the kidneys, discoid lupus erythematosus, male infertility idiopathic or NOS, sperm autoimmunity, multiple sclerosis (all subtypes), insulin-dependent diabetes mellitus, sympathetic ophthalmia, pulmonary hypertension secondary to connective tissue disease, Goodpasture's syndrome, pulmonary manifestation of polyarteritis nodosa, acute rheumatic fever, rheumatoid spondylitis, Still's disease, systemic sclerosis, Takayasu's disease/arteritis, autoimmune thrombocytopenia, idiopathic

thrombocytopenia, autoimmune thyroid disease, hyperthyroidism, goitrous autoimmune hypothyroidism (Hashimoto's disease), atrophic autoimmune hypothyroidism, primary myxoedema, phacogenic uveitis, primary vasculitis and vitiligo.

25. The method of claim 16, wherein the non-gut autoimmune disorder is autoimmune arthritis.

26. The method of claim 16, wherein the inhibitor of the T_hl7 cell inducing bacterial species is an antibiotic.

27. The method of claim 26, wherein the antibiotic is a beta-lactam antibiotic.

28. The method of claim 27, wherein the beta-lactam antibiotic is selected from the group consisting of penicillin derivatives, cephalosporins, carbapenems, penems, and Monobactams.

29. The method of claim 26, wherein the antibiotic is a glycopeptide antibiotic.

30. The method of claim 29, wherein the glycopeptide antibiotic is selected from the group consisting of glycosylated cyclic peptides and polycyclic nonribosomal peptides.

31. The method of claim 16, wherein the inhibitor of the T_hl7 cell inducing bacterial species is a combination of a beta-lactam antibiotic and a glycopeptide antibiotic.

32. The method of claim 29, further comprising administering to the subject a beta-lactamase inhibitor.

33. The method of claim 16, wherein the inhibitor of the T_hl7 cell inducing bacterial species is a probiotic.

34. The method of claim 33, wherein the probiotic is a Lactobacillus spp.

35. The method of claim 34, wherein the Lactobacillus spp. is selected from the group consisting of L. paracasei DSM 13434, L. plantarum DSM 15312. and L. plantarum DSM 15313.

36. The method of claim 16, wherein the inhibitor of the T_hl7 cell inducing bacterial species is a defensin.

37. The method of claim 36, wherein the defensin is an a-defensin.

38. The method of claim 16, wherein the T_hl7 cell inducing bacterial species is segmented filamentous bacteria (SFB).

39. The method of claim 16, wherein the T_hl7 cell inducing bacterial species is a homologue of SFB present in human microbiota.

40. The method of claim 16, wherein the T_hl7 cell inducing bacterial species is a human commensal species other than SFB.

41. The method of claim 16, wherein the T_hl7 cell inducing bacterial species is a Clostridia spp.

42. The method of claim 16, further comprising monitoring the effect of the treatment in the subject by monitoring T_hl7 cell differentiation in the subject.

43. The method of claim 42, wherein monitoring T_hl7 cell differentiation comprises measuring T_hl7 cell numbers or activity.

44. The method of claim 43, wherein T_hl7 cell numbers or activity are measured in a sample isolated from the subject.

45. The method of claim 44, wherein the sample is a sample isolated from the subject's joints.

46. The method of claim 44, wherein the sample is a blood sample.

47. A method for identifying a compound useful for treating a non-gut autoimmune disorder, the method comprising

providing a cellular indicator composition comprising a T_hl7 cell inducing bacterial species and a T_hl7 cell precursor;

contacting the indicator composition with a plurality of test compounds; determining the effect of a test compound on T_hl7 cell differentiation; and

selecting a compound which inhibits T_hl7 cell differentiation, thereby identifying a compound useful for treating a non-gut autoimmune disorder.

48. A method for identifying a compound useful for treating a non-gut autoimmune disorder, the method comprising

providing a cellular indicator composition; contacting the indicator composition with a plurality of test compounds; determining the effect of a test compound on the expression and/or activity of a gene which promotes T_hl7 cell differentiation and whose expression is induced in the gut of a subject by a T_hl7 cell inducing bacterial species; and

selecting a compound which modulates the expression and/or activity of the gene, thereby identifying a compound useful for treating a non-gut autoimmune disorder.

49. The method of claim 48, wherein the gene is selected from the group consisting of RORyt, IL-17A, IL-21, IL-22, and CCR6.

50. The method of claim 48, wherein the gene is selected from the group consisting of serum amyloid A 1; resistin like beta; solute carrier family 6

(neurotransmitter transporter), member 14; placenta expressed transcript 1; serum amyloid A 2; granzyme B.; granzyme A; Z-DNA binding protein 1; nitric oxide synthase 2, inducible, macrophage; hematopoietic cell transcript 1; CD38 antigen;

interferon gamma induced GTPase; fucosyltransferase 2; UDP-GlcNAc:betaGal beta- 1,3-N-acetylglucosaminyltransferase 7; T-cell receptor gamma, variable 3;

sphingomyelin phosphodiesterase, acid-like 3B; betaine-homocysteine

methyltransferase; solute carrier family 9 (sodium/hydrogen exchanger), member 3; dual oxidase maturation factor 2; or lymphocyte antigen 6 complex, locus D.

51. The method of claim 47 or 48, further comprising administering the identified compound to a non-human animal having a non-gut autoimmune disorder and determining the effect of the compound on IL-17 production and/or autoantibody production.

52. The method of claim 51, wherein the autoimmune disorder is

autoimmune arthritis.

53. The method of claim 51, further comprising determining the effect of the identified compound on the development of arthritis in the non-human animal.

54. The method of claim 47 or 48, wherein the T_hl7 cell inducing bacterial species is segmented filamentous bacteria (SFB).

55. The method of claim 47 or 48, wherein the T_hl7 cell inducing bacterial species is a homologue of SFB present in human microbiota.

56. The method of claim 47 or 48, wherein the T_hl7 cell inducing bacterial species is a human commensal species other than SFB.

57. The method of claim 47 or 48, wherein the T_hl7 cell inducing bacterial species is a Clostridia spp.