WO2011042874A1

WO2011042874A1 - Visualization of proprotein convertase activity in living cells and tissues

Info

Publication number: WO2011042874A1
Application number: PCT/IB2010/054525
Authority: WO
Inventors: Daniel Mesnard; Daniel Constam
Original assignee: Ecole Polytechnique Federale De Lausanne (Epfl)
Priority date: 2009-10-06
Filing date: 2010-10-06
Publication date: 2011-04-14

Abstract

The invention relates to a system for detecting the presence of a convertase cleaving activity, the system comprising a molecule comprising a proteolytic cleavage site with the amino acid sequence -R-X₁-X₂-R-, wherein R represents the amino acid arginine, X₁ and X₂ are selected independently among any amino acid, preferably from any one of the twenty two (22) standard amino acids; wherein said system comprises a molecule, which comprises a first part and a second part separated by said cleavage site, and wherein said molecule, when cleaved at said cleavage site, loses or obtains a chemical, physical or biological property, including properties selected from fluorescence, catalytic and/or other biologic activity, said property depending on the close physical proximity or on the absence of such proximity, respectively, said first and second parts of the molecule that precede and follow the cleavage site, and which physical proximity or absence of proximity is thus lost or obtained, respectively, by cleavage through a proprotein convertase; wherein said system further comprises at least one localising element, which directs the system, when present in a human or animal cell, to a specific cell compartment, to the extracellular compartment, or to the cell surface.

Description

VISUALIZATION OF PROPROTEIN CONVERTASE ACTIVITY IN LIVING

CELLS AND TISSUES

Field of the invention

This invention concerns the field of imaging enzyme activities. More specifically, the present invention relates to a system for detecting the presence of a convertase cleaving activity in living cells and tissues.

Background of the invention

In mammals, the Proprotein Convertase (PC) family comprises nine serine proteases that share a characteristic subtilisin/kexin-like catalytic domain. Among these, Furin, Pace4, Pcsk5, and PC7 are broadly expressed and responsible for cleaving intra- and extracellular precursors of various growth factors, receptors, adhesion molecules, neuropeptides, metalloproteases, viral envelope glycoproteins and bacterial endotoxins after the minimal dibasic recognition motif RXXR (N. G. Seidah et al., Int J Biochem Cell Biol 2008, 40, 11 11). Inhibitors of these proteases may become useful for antiviral or antibacterial therapies and to combat tumor progression and invasion (G. S. Jiao et al., Proc Natl Acad Sci U S A 2006, 103, 19707 ; M. Fugere, R. Day, Trends Pharmacol Sci 2005, 26, 294; T. Komiyama et al., J Biol Chem 2009, 284, 15729).

Besides their roles in exocytic compartments, Pace4 and Furin act cellnonautonomously (S. Beck et al., Nat. Cell Biol. 2002, 4, 981), but available evidence that they also cleave membrane-bound substrates on distant target cells is indirect (M.-H. Blanchet et al., Embo J. 2008, 27, 2580).

Classic genetic approaches have provided only limited information on the specific roles of individual PCs in normal tissues and during disease, in part because extensive functional overlap among the more widely expressed family members masks their functions. Consequently, the majority of predicted PC substrates remain to be validated in vivo. Therefore there is still a need in the art for a novel tool which could be used to detect the presence of a convertase cleaving activity in living cells and tissues.

General description of the invention

The primary object of this invention is to provide a novel system for detecting the presence of a convertase cleaving activity.

The invention provides a system comprising a molecule comprising a proteolytic cleavage site with the amino acid sequence -R-X₁-X₂-R-, wherein R represents the amino acid arginine, Xi and X₂ are selected independently among any amino acid, preferably from any one of the twenty two (22) standard amino acids;

wherein said system comprises a molecule, which comprises a first part and a second part separated by said cleavage site, and wherein said molecule, when cleaved at said cleavage site, loses or obtains a chemical, physical or biological property, including properties selected from fluorescence, catalytic and/or other biologic activity, said property depending on the close physical proximity or on the absence of such proximity, respectively, said first and second parts of the molecule that precede and follow the cleavage site, and which physical proximity or absence of proximity is thus lost or obtained, respectively, by cleavage through a proprotein convertase; Preferably, said the measurable presence or absence of said chemical, physical or biological property provides the principle reporting element (or "reporter") of the present invention;

wherein said system further comprises at least one localising element, which directs the system, when present in a human or animal cell, to a specific cell compartment, to the extracellular compartment, or to the cell surface.

In one embodiment of the invention, the system described above is a peptide encoded by a nucleotide (DNA, RNA, for example) sequence, preferably said system is a peptide derivative selected from the group comprising or consisting of glycopeptides, lipopeptides and lipoglycopeptides.

In one embodiment of the invention, the system according to the invention comprises a first part comprising a fluorescent protein (a) and a second part comprising a protein (b) selected from a bioluminescent and a fluorescent protein, wherein said proteins (a) and (b) can exist in said cells in a first state, where there is no or little energy transfer, and a second state, where there is a substantial energy transfer from (b) to (a), wherein said energy transfer affects the quantity of light emitted by (a), and wherein (a) emits light of a different wavelength than (b).

In a preferred embodiment, the system according to the invention allows to assess presence or absence of proprotein convertase activity from the light emitted by the fluorescent protein (a) and/or from the protein (b) and/or from a ratio of light emitted by the fluorescent protein (a) with respect to the protein (b), or vice versa. The light emissions as described herein constitute a preferred embodiment of the reporter element of the invention.

In another preferred embodiment, said energy transfer is a resonance energy transfer, which is preferably selected from the group of FRET (Foster resonance energy transfer) and BRET (bioluminescence resonance energy transfer).

In a preferred embodiment, the first part comprises a yellow fluorescent protein (YFP) and the second part comprises a green or a cyan fluorescent protein (GFP or CFP).

In a preferred embodiment, the system according to the invention comprises a localising element which is selected from signal peptides and transmembrane domains.

In a particularly preferred embodiment, the localising element is glycophosphatidylinositol (GPI).

In one embodiment of the invention, the system according to the invention is intended to detect an activity of a prohormone protease and/or from a proprotein convertase.

In a preferred embodiment, the system according to the invention is intended to detect an activity of a protease comprising a substilisin-related domain. A subtilisin-related catalytic domain is as domain, which achieves proteolytic cleavage by the same, similar or an equivalent mechanism as subtilisin, and/or which comprises aspartic acid, histidine and serine interacting and/or contributing with a peptide substrate of which a peptide bond is to be cleaved in the cleavage process.

In a particularly preferred embodiment, said convertase is selected from any one of PCSK 1 (PC1 , PC3 (also referred to as PC1/3); PCSK 2 (PC2); PCSK 3 (Furin, Pace, PC1 ); PCSK 4 (PC4); PCSK 5 (PC5, PC6 (also referred to as PC5/6)); PCSK 6 (PACE4); PCSK 7 (PC7, PC8); PCSK 8 (Site 1 protease, S1 P, SKI); PCSK 9 (NARC-1). Preferably the convertase is Furin and/or Pace4.

Another object of the invention is to provide a nucleotide sequence encoding a polypeptide comprising a fluorescent protein (a) and a protein (b) selected from bioluminescent and fluorescent protein, wherein said proteins (a) and (b) can exist in said cells in a first state, where there is no or little energy transfer, and a second state, where there is a substantial energy transfer from (b) to (a), wherein said energy transfer affects the quantity of light emitted by (a), and wherein (a) emits light of a different wavelength than (b);

wherein said polypeptide further comprises a convertase cleavage site comprising an amino acid sequence -R-X1-X2-R-, wherein R represents the amino acid Arginine, Xi and X₂ are selected independently among any amino acid, wherein said cleavage site is located, in said polypeptide in between said proteins (a) and (b); and,

wherein said polypeptide further comprises at least one an amino acid encoding a transmembrane and/or a signal sequence.

In a preferred embodiment, at least one transmembrane and/or signal sequence is provided at an otherwise free terminus of either protein (a) and/or protein (b), preferably at the C-terminus of the protein selected from protein (a) and protein (b), which is provided at the C-terminus of said polypeptide.

In a particularly preferred embodiment, at least one signal sequence comprises a GPI signal sequence.

In another particularly preferred embodiment, at least one signal sequence comprises a sequence directing the polypeptide to a cellular compartment or to the extracellular space (secretion). Preferably, said sequence directs the polypeptide to the extracellular space by secretion via the ER-Golgi pathway.

The nucleotide sequence of the invention encodes at least two signal peptides, for example a GPI signal sequence and a secretion signal sequence.

The nucleotide sequence of the invention encodes, from a 5' to a 3' end of said nucleotide sequence, one or more of the following peptides in the order (from the amino to the carboxy terminus of said polypeptide) as shown in any one of formulae (I) to (IV) below:

I. (ss2)-(a)-(cs)-(b)-(ss1);

II. (ss2)- (b)-(cs)-(a)-(ss1);

III. (ss1)-(a)-(cs)-(b)-(ss2);

IV. (ss1)-(b)-(cs)-(a)-(ss2);

wherein one or both selected from (ss1) and (ss2) is/are optional;

wherein further amino acids, and peptides may be encoded within and at the C- or N- termini of said elements (a), (b), (cs) and (ss1); preferably said further amino acids are not provided at the terminus of the signal sequence (ss1 );

wherein peptides (a) and (b) are as proteins (a) and (b) defined above;

wherein (cs) represents a cleavage site as defined above; and

wherein (ss1) and (ss2) each independently represents a signal sequence.

In a preferred embodiment, (ss2), if present, is a nucleotide sequence encoding a cell-membrane anchoring unit and (ss1), if present, is a nucleotide sequence encoding the secretion of the encoded peptide, or vice versa.

Another object of the invention is to provide a cell and/or a non-human organism expressing the nucleotide sequence according to the invention. In a preferred embodiment, the cell according to the invention does not produce a functional convertase capable of cleaving the polypeptide according to the invention. In the cell of the invention, the expression of a convertase capable of cleaving the polypeptide according to the invention is inhibited or suppressed, for example by coexpression of an inhibitor of said convertase, by the rendering one (or more) native gene(s) encoding said convertase inoperable (knockout), and/or by the addition of an inhibitor of said convertase.

The cell of the invention can be used in detecting and/or reporting non- autonomous protein convertase activity. Another object of the invention is to provide a transgenic non-human organism, preferably a non-human animal, more preferably a rodent, said organism expressing the nucleotide sequence according to the invention.

In a preferred embodiment, the nucleotide sequence according to the invention is expressed in one or more selected from: only one cell type, in several different cell types, in only one tissue and/or organ, in several, different cell types, in several different tissues and/or organs, and uniformly or variably within the entire organism. In a particularly preferred embodiment, the nucleotide sequence according to the invention is expressed in muscular tissues, for example striated muscle cells, in neural tissue and/or in endothelial tissues.

In a preferred embodiment, the non-human, mammalian transgenic organism according to the invention harbouring the system according to the invention and/or the nucleotide sequence of the invention.

In a particularly preferred embodiment, the organism of the invention is a transgenic mouse.

Another object of the invention is to provide a use of the cells according to the invention and/or of the organism of the invention as a research model, a research tool, and in methods of screening compounds. Another object of the invention is to provide a method of detecting and/or assessing non-autonomous convertase activity between different cells, wherein said method comprises the step of incubating the cells of the invention with other cells, and wherein the presence or absence of non-autonomous convertase activity is assessed from the light emissions measured from protein (a) and/or protein (b), and/or from the ratio of the light emitted by (a) and (b), or vice versa.

Definitions

The following definitions are intended to assist in providing a clear and consistent understanding of the scope and detail of the following terms, as used to describe and define the present invention : A "signal sequence", for the purpose of the invention, is a nucleotide sequence translated to an amino acid sequence, which determines in some way the fate of the remainder of the peptide, which is connected to or associated with the signal sequence. Signal sequences are thus sequences that direct a peptide to a specific compartment, that trigger the submission of the peptide to a specific cellular metabolic process, and/or that determine the position where the peptide will be placed, located, and the like. Instead of a signal sequence, in particular for GPI, also a transmembrane domain can be encoded by the signal sequence, for example (ss1), which results in the stabilisation, positioning and/or anchoring of the peptide in a cellular membrane, for example the plasma membrane.

For the purpose of the present invention, "non-autonomous" refers to convertase activity originating from a second cell, which is other than and/or different from a first cell expressing and/or producing a compound to be cleaved / a compound susceptible of being cleaved by said convertase. Preferably, said compound to be cleaved expressed is comprised within said first cell or on the cell-surface of said first cell, for example anchored in the plasma-membrane of said first cell, most preferably anchored in a lipid raft of the plasma membrane of said first cell.

According to an embodiment, said convertase cleaving activity is detected in vivo. Detailed description of the invention

The invention and its different embodiments will be better understood by the following description of illustrative examples. The following examples are intended to be merely illustrative of the present invention and not limiting thereof in either scope or spirit.

Figure 1 : PC-mediated activation of a system according to the invention (Cell surface Linked Indicator of Proteolysis or CLIP).

(A) Strategy to visualize proprotein convertase activities (PC) using CLIP as a biosensor. Secreted CFP is fused to YFP and targeted to the plasma membrane by a GPI anchor. A short linker containing the PC consensus motif RQRR or the negative control sequence SQAG separates CFP from YFP in the CLIP and CLIPm constructs, respectively. Cleavage is visualized by monitoring the ratio of CFP and YFP fluorescence or the efficiency of proximity-dependent Forster resonance energy transfer (FRET) between CFP and YFP at the indicated wavelengths.

(B) Fluorescent imaging of HEK293T cells expressing CLIP or the cleavage mutant CLIPm.

(C) Anti-GFP Western blot analysis of CLIP processing in transfected HEK293T cells. Note that the CFP moiety (29.4 kDa) and small amounts of cleaved YFP secreted with or without the GPI signal sequence (30.8 or 27.8 kDa, respectively) are released by CLIP into conditioned medium, whereas cotransfection of al PDX or addition of decanoyl-RVKR-chloromethylketone (CMK, 20 μΜ), or mutation of the PC consensus motif RQRR (CLIPm) leads to accumulation of unprocessed biosensor. The cleaved eYFPgpi moiety of CLIP, which is enriched at the plasma membrane by its GPI anchor (panel B, top left), is not detected in cell lysates, presumably due to limited solubility.

(D) Line plots of CFP and YFP fluorescence intensities across the plasma membrane of transfected HEK293T cells treated with or without PC inhibitors. Representative regions selected randomly for analysis are marked by red lines. Figure 2 : Quantification of PC-mediated processing of CLIP in HEK393T and embryonic stem (ES) cells by FRET analysis.

(A) Heat map of the normalized FRET efficiency (NFRET) of CLIP and CLIPm in transfected HEK293T cells. Cotransfection of CLIP with crt PDX, incubation with CMK (20 μΜ) or mutation of the PC cleavage motif (CLIPm) significantly increases NFRET.

(B) Quantification of NFRET at the cell surface.

(C) Relative NFRET efficiencies at the plasma membrane of wild-type (WT) ES cells transfected with CLIP or CLIPm. Where indicated, cells were cotransfected with Furin or empty vector (mock), or incubated with CMK, respectively.

(D) Relative NFRET of CLIP compared to CLIPm in Furin-/- and Furin-/-; PACE4-/- (double knockout or DKO) double mutant ES cells. Pace4 single mutant ES cells are not available, but a comparison of Furin-/- with DKO cells suggests that endogenous Pace4 activity in ES cells is below detectable levels. ^*Significantly differs from the control (first bar), p<0.05 (Student's t-test).

Figure 3 : Cell non-autonomous secreted Furin and Pace4 activities from donor cells process CLIP at the surface of reporter cells.

(A) To test whether CLIP can detect cell non-autonomous PC activities, reporter cells expressing CLIP were mixed with donor cells that were separately transfected with PC expression vectors.

(B) Activity of secreted Furin and Pace4 in cocultures of HEK293T donor and reporter cells. To block processing by cell-autonomous PC activities, CLIP was transfected in reporter cells together with al PDX. Donor cells secreting elevated levels of Furin or Pace4 reduce CFP fluorescence and NFRET efficiency at the surface of reporter cells. Donor cells transfected with PC7 or empty vector have no effect.

(C) Anti-GFP immunoblotting of conditioned medium from the cocultures in (B) shows that donor cellderived Furin or Pace4 also rescue the shedding of CFP from cd DX-transfected CLIP reporter cells into the medium, whereas PC7 or empty vector (mock) had no effect.

(D) Cell non-autonomous PC activity quantified by FRET analysis of CLIP at the surface of the reporter cells shown in (B). (E) FRET efficiency of CLIP in Furin-/-; Pace4-/- ES cells (DKO) cocultured with wild-type ES cells (WT) or with separately transfected DKO cells expressing Furin, Pace4 or empty vector. * and ** are significantly different from the first and second bars, respectively as determined by t-test (p<0.05).

Figure 4 : Detection of PC activities in tissues and embryos of CLIP transgenic mice.

(A-D) Analysis of CFP and YFP fluorescence of CLIP or CLIPm in adult mouse tissues. CLIP mice, unlike CLIPm controls, lose CFP from the surface of cardiac striated muscle cells (A), neural tissue and endothelial cells in the brain (B), and of mesodermal and endodermal (?) cells in the intestine (C) and liver (D).

(E-G) Analysis of CLIP (E, G) and CLIPm (F, G) in E6.5 mouse embryos and double mutants lacking Furin and Pace4 (DKO). The boxed regions in (E-F) are shown at higher magnification in (G).

Methods

Whole embryo culture

Whole embryo in-vitro culture was performed as described (Beck et al., Nat. Cell Biol. 2002, 4, 981 ) but in absence of STO fibroblast feeders. In brief, embryos where recovered at 5.25 day post coitum. Reichert's membrane was mechanically removed using fine needles. Dissected embryos were transferred to Millipore filter inserts (pore size 12 i ) and incubated in OptiMEM I supplemented with 15% knock-out replacement serum, 1 % gentamycin and Glutamin sulfate, in presence of 5% C02 and water-saturated atmosphere.

Whole mount in situ hybridization

Whole mount in situ hybridization was performed as described using DIG-labelled antisense probes (Beck et al., Nat Cell Biol. 2002, 4, 981 ; Varlet et al., Development. 1997, 124, 1033). PC7 mRNA was detected by an antisense probe spanning nucleotides 1606-2407 of Genbank entry U48830. The Pcsk5 probe comprised nucleotides nt 740-2086 of Genbank entry D12619, PC2 nucleotides 1145-1588 of RefSeq NM_008792, and PC1/3 nucleotides 862-1305 of NM_013628. Anti-DIG antibodies conjugated to alkaline phosphatase and the substrate BM purple were from Roche Diagnostics (Switzerland). Color reactions were developed until saturation at RT or maximally for three days at 4°C.

Cell transfection and Western blot analysis

HEK293T cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum, 100 pg/ml Gentamycine and 2 mM Glutamine. Furin KO and Furin,Pace4 DKO ES cells (Beck et al., Nat Cell Biol. 2002, 4, 981 ; Constam et al., Development. 2000, 127, 245) were maintained on irradiated STO fibroblasts in Dulbecco's modified Eagle's medium containing 0% fetal calf serum, 100 pg/ml Gentamycine, 2 mM Glutamine and 0.1 mM β-mercaptoethanol. For transient transfection, HEK293T cells were plated on 24-well plates at a density of 5x10⁴ cells per well. The following day, the cells were incubated with plasmids (0.5 pg/well) in Lipofectamine 2000 CD Reagent (Invitrogen) during 4-6 hrs. Thereafter, the medium was replaced by OptiMEM (Invitrogen) containing 0.25% Knock Out Serum Replacement (Invitrogen). After 24 hrs, conditioned medium was harvested and cells were lysed in Laemmli buffer containing 5% β- mercaptoethanol. Expression and processing of CLIP was monitored by chemiluminescent immunoblotting of the eCFP and eYFP moieties using monoclonal anti-GFP antibody (Sigma) and HRP-conjugated anti-mouse secondary antibody (Amersham). To monitor processing of biosensors by secreted PC activities, donor cells were washed with PBS 6 hrs after transfection, trypsinized and added at a 1 :1 ratio to reporter cells that were seperately transfected with CLIP. Medium was conditioned during the following 24h. ES cells were transfected and analyzed identically, except that they were plated on gelatin- coated 24-well dishes at a density of 2.5x10⁵ cells per well. Imaging

For confocal imaging, cells were plated on glass bottom 24-well plates and maintained in the buffered Opti-MEM medium (Invitrogen). To avoid evaporation and temperature variation, the plate was sealed using parafilm and maintained at 37^°C throughout the imaging process. Image acquisition was achieved on a Leica TCS SP II confocal microscope at the following settings. CFP channel: 458 nm excitation; 462-510 nm emission; FRET channel: 458 nm excitation, 518/580 emission; YFP channel: 514 nm excitation; 518/580 emission. Scanning was done sequentially between lines at 400 Hz with a PlanApo 63x 1.4 NA Oil objective. Heat maps of C/Y ratios were generated by Imaris 5.3 software using a Matlab script. In brief, a mask was created for YFP signals above a critical threshold to highlight cell surface staining. Each CFP/YFP ratio was then attributed a proportional value between 1 (CFP/YFP = 0; blue) and 256 (CFP/YFP = 2 ; red). Values above 2 were considered as artefactual (white). Areas not included in the mask were attributed a black colour. GFP imaging was performed under the epifluorecent Leica M205FA steromicroscope using the GFP2 filter set (480/40 nm excitement filter, 505 nm LP dichromatic beam splitter, and 510 nm LP emission filter).

FRET analysis

To measure FRET efficiency of CLIP and CLIPm in transfected HEK293T or mouse ES cells, confocal microscopy images were processed using the commercial Leica TCS SP II sensitized emission (SE) wizard, or the NIH ImageJ pixFRET plug-in (Feige et al., Microsc Res Tech. 2005, 68, 51). Correction factors α, β, γ and δ were established on cells transfected with either ssCFPgpi or ssYFPgpi plasmids as described (van Rheenen et al., Biophys J. 2004, 86, 2517). Since CFP may be lost upon cleavage and therefore cannot be used to estimate the ratio of cleaved versus uncleaved biosensor, FRET efficiency (NFRET) was calculated by normalising the corrected FRET signal to corrected YFP signal representing the total amount of biosensor at the plasma membrane. Owing to this normalisation, NFRET tends to be slightly over- or understimated in regions where YFP signals are extremely low or high, respectively. Therefore, NFRET data was acquired in regions of comparable intermediate YFP fluorescence intensity values. For quantitative analysis, average NFRET values were calculated by defining ROIs at the cell surface of 15 reporter cells over three different fields of cells imaged for each specific condition.

Example 1 : Generation of a system according to the invention (CLIP) and its mutant negative control (CLIPm)

CLIP and CLIPm expression vectors were generated in pcDNA3.1 (Invitrogen). In brief, cDNA fragments comprising the signal sequence of lactase-phlorizin hydrolase, eCFP, a linker region, eYFP and the gpi attachment signal of lymphocyte function-associated antigen 3 (Keller et al., Nat Cell Biol. 2001 , 3, 140) were amplified by PCR and ligated in frame. For convenient exchange, the linker sequences were flanked by unique EcoRI and Cla1 restriction sites. Linkers comprising the PC consensus cleavage site RQRR or the cleavage-resistant sequence SQAG were obtained by annealing the oligonucleotide 5'- AATTCTCGTCCTCAGAGTTGAGCGCTCGACAACGACGCGGCACAAGCGGCA GAT-3' with 5'-

CGATGCTGCCGCTTGTGCCGCGTCGTTGTCGAGCGCTCAACTC TGAGGACGAG-3', and 5'-AATTCTCGTCCTCAACCGGTATCCCTGTTTCACTC GGCAGCGGAAGCGGCAGCAT-3' with 5'-CATGCTGCCGCTTGTGCCGCCGGC TTGAGAACCGGTCAACTCTGAGGACGAG-3', respectively. To derive ssCFPgpi and ssYFPgpi, the eCFP-linker-eYFP sequence of CLIP was replaced by eCFP or eYFP, respectively. Corresponding transgenes containing the CMV/chickBactin hybrid promoter, the first intron of β-actin and a rabbit β-globin 3'UTR were generated by replacing the EcoRI eGFP cDNA fragment of the CX-eGFP plasmid (Hadjantonakis et al., Mech Dev. 1998, 76, 79) by the open reading frames of CLIP or CLIPm (detailed maps are available upon request). After linearization using Hind III or Xmn I, respectively, the resulting transgenes (4380 bp) were purified using QIAGEN Gel extraction columns and resuspended at 20 ng/μΙ in 10 mM Tris HCI pH 7.5 containing 0.1 mM EDTA for pronuclear injection in mouse oocytes. PC expression vectors contained a CMV promoter directing the expression of full- length mouse proteins from the plasmid pRc/CMV (Invitrogen) or pCS2+.

cDNA coding for CLIP: From 5' to 3': first minuscule sequence = signal sequence of lactase-phlorizin hydrolase; first majuscule sequence = eCFP; second minuscule sequence (bold) = linker region coding for a PC consensus site; second majuscule sequence = eYFP; third minuscule sequence = gpi attachment signal of lymphocyte function- associated antigen 3. atggagctcttttggagtatagtctttactgtcctcctgagtttctcctgccgggggtcagactgggaatctctgcagtcg acggtaccgcgggcaggatccATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT

GGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAG CGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGA AGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGA CCACCCTGACCTGGGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGA AGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGC GCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGA AGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACT TCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACATCA GCCACAACGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAA CTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCA CTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAA CCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCG CGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGG CATGGACGAGCTGTACAAGGAAttctcgtcctcagagttgagcgctcgacaacgacgcggca caagcggcagcatcgatATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT GCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGT GTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTT CATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCAC CTTCGGCTACGGCCTGATGTGCTTCGCCCGCTACCCCGACCACATGAAGCA GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCAC CATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTC GAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAG GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCAC AACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCA AGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACC AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACT ACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATC ACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGG ACGAGCTGTACAAGGAAtttgcggccgcgccaagcagcggtcattctagatatgcacttatacccatac cattagcagtaattacaacatgtattgtgctgtatatgaatgttctttaa

cDNA coding for CLIPm: the only difference is that the linker region was mutated and does not code anymore for a PC consensus site (second minuscule sequence in bold). atggagctcttttggagtatagtctttactgtcctcctgagtttctcctgccgggggtcagactgggaatctctgcagtcg acggtaccgcgggcaggatccATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT GGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAG CGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGA AGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGA CCACCCTGACCTGGGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGA AGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGC GCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGA AGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACT TC AAG GAG G ACG G C AAC ATCCTGG G G CACAAG CTGG AGTAC AACTAC ATCA GCCACAACGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAA CTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCA CTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAA CCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCG CGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGG CATGGACGAGCTGTACAAGGAAttctcgtcctcagagttgaccggttctcaagccggcggca caagcggcagcatcgatATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGT GCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGT GTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTT CATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCAC CTTCGGCTACGGCCTGATGTGCTTCGCCCGCTACCCCGACCACATGAAGCA GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCAC CATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTC GAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAG GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCAC AACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCA AGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACC AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACT ACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATC ACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGG ACGAGCTGTACAAGGAAtttgcggccgcgccaagcagcggtcattctagatatgcacttatacccatac cattagcagtaattacaacatgtattgtgctgtatatgaatgttctttaa

Example 2 : Generation of transgenic mice Transgenic mice were generated at the EPFL-ISREC core facility by pronuclear injection of linearized CLIP or CLIPm into zygotes of FVB and NRMI mice (Harland and Janvier). 12 and 9 founders, respectively, and their offspring were genotyped by 31 PCR amplification cycles at the annealing temperature of 63 °C using the CLIP-specific primer 5'-GAGTTGAGCGCTCGACAACGACG-3' or the CLIPm- specific primer 5'-CTCAGAGTTGACCGGTTCTCAAGC-3' and the YFP-specific primer 5'-GAAGCAC ATCAGGCCGTAGCCG-3'. Cell surface fluorescence of the biosensor was monitored in embryos at the stages indicated. Furin and Pace4 single and double heterozygotes of a C57BI/6 inbred background (Beck et al., Nat. Cell Biol. 2002, 4, 981 ; Constam and Robertson, Genes Dev. 2000, 14, 1 146; Roebroek et al., Development. 1998, 125, 4863) were serially backcrossed to an NMRI outbred background for more than 8 generations. Example 3 : CLIP is a specific and sensitive PC biosensor

Proteolysis and other protein modifications affecting interatomic distances can be imaged in live cells by monitoring Forster resonance energy transfer (FRET) between suitable pairs of fluorophores (VanEngelenburg et al., Curr Opin Chem Biol. 2008, 12, 60). To monitor PC activities, ECFP (hereafter designated CFP) carrying a signal sequence (ss) was joined to Citrine (hereafter designated YFP) by the PC recognition motif RQRR so that cleavage should trigger a proportional loss of FRET (Fig 1A). As a negative control, YFP was coupled to CFP by the PC- resistant linker sequence SQAG. To also detect extracellular PC activities (Blanchet et al., EMBO J. 2008, 27, 2580; Klimpel et al., Proc. Natl. Acad. Sci. USA. 1992, 89, 10277; Mayer et al., J Biol Chem. 2008, 283, 2373), the resulting fusion proteins CLIP and CLIPm were targeted to the plasma membrane by a glycosylphosphatidylinositol (GPI) signal sequence. Accumulation of YFP combined with loss of CFP thus should mark the cells where processing occurred, provided that shedding of the GPI anchor is limited. Expression of CLIP in transfected HEK293T cells resulted in YFP fluorescence at the plasma membrane, whereas a fragment co-migrating with ssCFP was released into the culture medium (Fig. 1 B,C). By contrast, both YFP and CFP were enriched at the plasma membrane and shed uncleaved into culture medium in cells expressing CLIPm. Cleavage was also blocked if CLIP was cotransfected with a1-PDX, a PC-specific variant of antitrypsin (Jean et al., Proc. _Natl. Acad. Sci. USA. 1998, 95, 7293), or if it was stabilized with the PC-inhibitory peptide decanoyl-RVKR-CMK (CMK) (Fig. 1B,C and Fig. 1 D). Given that basic residues may also be recognized by less specific proteases such as Thrombin, reporter cells expressing CLIP at the cell surface were incubated with recombinant Thrombin. Although Thrombin was significantly active at the highest concentration examined, physiological amounts (below 2U/ml) had no effect. These results suggest that PC activity in HEK293T cells can be specifically detected by monitoring the ratio between CFP and YFP fluorescence of CLIP at the plasma membrane. To quantify PC activity by loss of FRET, FRET values of CLIP and CLIPm were acquired on live cells by sensitized emission analysis (Feige et al., Microsc Res Tech. 2005, 68, 51 ; Jares-Erijman et al., Nat Biotechnol. 2003, 21, 1387) and normalized to the signal of GPI-anchored YFP, which represents the total amount of biosensor at the plasma membrane. Normalized FRET efficiency (NFRET) was high for CLIPm, reaching on average 30 ± 4 % (Fig 2A,B). A similar NFRET efficiency of 41 ± 4 or 37 ± 6 %, respectively, was observed for CLIP in cells that were treated with CMK, or transfected with a1-PDX. Alternatively, maximal NFRET efficiency was determined by acceptor photobleaching in CMK-treated fixed HEK293T cells. After photobleaching more than 95% of YFP, CFP fluorescence of stably transfected CLIP increased by 34 ± 4%. Moreover, after addition of CMK to live HEK293T cells, time course experiments showed that NFRET of CLIP increases at an approximately linear rate of 10% per hour, leading to statistically significant changes already within 1 hr after treatment. By contrast, NFRET of CLIP in the absence of PC inhibitors only reached 10% and was further reduced to background levels upon cotransfection of Furin, Pace4 or Pcsk5A, but not of the unrelated protease CathepsinB (Figs. 2A,B). Likewise in mouse ES cells, cotransfection of CLIP with Furin diminished NFRET, whereas CMK increased it (Fig. 2C). Thus, PC activity can be measured by FRET analysis of CLIP at the plasma membrane.

To validate that CLIP is sensitive to variation of endogenous PCs, we measured NFRET in Furin-/-\Pace4-/- double knockout ES cells (DKO) (Beck et al., Nat. Cell Biol. 2002, 4, 981 ; Constam et al., Development. 2000, 127, 245) and in the Furin- deficient LoVo colon carcinoma cell line devoid of Furin activity (Takahashi et al., 1995). In DKO ES cells, NFRET of CLIP was comparable to that of CLIPm, whereas it was reduced below basal levels in rescue experiments where CLIP was cotransfected with exogenous Furin (Fig. 2D). Together, these results indicate that 1) CLIP can be cleaved by all of the more widespread PC family members, including Furin, Pace4, Pcsk5 and PC7, 2) among these, the main endogenous PCs active in ES cells are Furin and Pace4, and 3) no other endogenous endopeptidases in these cell lines significantly activate CLIP.

Example 4 : CLIP imaging directly reveals paracrine PCs acting at the cell surface

We next tested whether CLIP also detects paracrine PC activities. To block autocrine cleavage, CLIP was cotransfected in HEK293T cells together with a1- PDX. The resulting reporter cells were cocultured with cells that were separately transfected with PC expression vectors or DsRed fluorescent protein (Fig. 3A). CLIP did not overlap with DsRed, confirming that it does not pass from reporter to donor cells. Fluorescence imaging, FRET and immunoblot analysis revealed that both Furin and Pace4 from donor cells cleaved CLIP in reporter cells (Fig. 3B,D). Similar results were obtained in cocultures of donor and acceptor cells separated by a 0.4 pm pore-sized filter insert, suggesting that cleavage is contact- independent. Furin and Pace4 also reduced FRET cell non-autonomously in cytoplasmic compartments (Fig. 3B,D), suggesting that an intracellular FRET signal mainly emanates from uncleaved CLIP in endosomes. Pace4 was more active in this cell mixing assay than Furin, consistent with observations that it localizes mainly in the extracellular space (Mayer et al., J Biol Chem. 2008, 283, 2373; Tsuji et al., Biochim. Biophys. Acta. 2003, 1645, 95). By contrast PC7, a proprotein convertase not shed into the medium, had no effect (Figs. 3B,D), confirming that CLIP processing by cell non-autonomous Furin and Pace4 is specific. Moreover, CLIP processing was also induced in DKO reporter cells mixed with wild-type donor ES cells. By contrast, DKO donor cells had no effect, except if they were transfected with Furin or Pace4 expression vector (Fig. 3E). Together, these results establish that CLIP detects paracrine PC activities with high sensitivity, and that cell non-autonomous Furin and Pace4 activities can directly cleave a membrane-bound substrate in target cells.

Example 5 : The epiblast of implanted embryos has access to a PC activity other than zygotic Furin and Pace4

Known substrates of Furin and Pace4 include the TGFb-related Nodal precursor (Constam et al., J Cell Biol. 1999, 144, 139), which is expressed in the inner cell mass (ICM) and in its derivatives, the epiblast and surrounding visceral endoderm (Brennan et al., Genes Dev. 2002, 16, 2339; Collignon et al., Nature 1996, 381, 155; Mesnard et al., Development. 2006, 133, 2497). Targeted mutations disrupting the entire Nodal locus or specifically the PC cleavage motif established that processed Nodal is already essential at stage E4.5-5.5 to upregulate Nodal expression in an autoinductive feedback loop, and to induce additional target genes that pattern the epiblast and visceral endoderm (Ben-Haim et al., 2006; Brennan et al., 2001 ; Mesnard et al., 2006). However, in DKO embryos lacking Furin and Pace4, Nodal and its targets remained normally expressed until E5.5. To address this discrepancy, litters obtained from Furin+l-;Pace4+l- intercrosses were also imaged for CLIP processing. CFP fluorescence at the surface of epiblast cells was not significantly increased in any of these embryos (n=21). These results demonstrate that zygotic Furin and Pace4 are not the only convertases acting on the epiblast once the conceptus has implanted in the uterus. Zygotic Furin and Pace4 are essential to maintain Nodal signalling during gastrulation (Beck et al., Nat. Cell Biol. 2002, 4, 981 ; Constam et al., Development 2000, 127, 245). At this stage (E6.5), the CFP/YFP ratio at the surface of epiblast cells on average increased 2-fold in DKO mutants compared to wild-type (Fig 4E, 4F, 4G). By comparison, CLIPm transgenic epiblast cells showed a 5-fold average increase of CFP/YFP, concurring with the notion that processing is PC-specific (Fig 4E, 4F, 4G). Thus, impaired CLIP processing correlates with the onset of the DKO mutant phenotype, despite the presence of some residual, overlapping cleavage activity.

Discussion

CLIP is an affordable and convenient biosensor to image PC activities in live cells and whole tissues. Our analysis of wild-type and Furin and Pace4 single and DKO mutant blastocysts revealed that zygotic Furin and Pace4 are already active and responsible for activating CLIP in the ICM both before and during implantation (E3.5-4.5). Unlike a cleavage mutant negative control CLIPm, CLIP was also efficiently processed in the epiblast of wild-type E5.5-6.5 embryos, thus confirming that this tissue is exposed to PC activities, even though it does not endogenously express any known PC. Moreover, processing in the epiblast of zygotic DKO mutant was impaired at E6.5, coinciding with the loss of Nodal activity. This finding is consistent with a direct role for Furin and Pace4 in Nodal precursor processing (Beck et al., Nat. Cell Biol. 2002, 4, 981) and with the model that Nodal matures at the plasma membrane in a complex with Cripto (Blanchet et al., EMBO J. 2008, 27, 2580; Constam, Curr Opin Genet Dev. 2009, 19, 302). In contrast at E5.5, deletion of zygotic Furin and Pace4 neither inhibited processing of CLIP nor the induction of Nodal and its target genes. This was unexpected because on a different, inbred genetic background, zygotic DKO mutants phenocopy NodalHr/Ur embryos, which only express a cleavagedeficient mutant Nodal precursor (Beck et al., Nat. Cell Biol. 2002, 4, 98; Ben-Haim et al., Dev Cell. 2006, 11, 1 ). PC7 is not involved since it can neither cleave proNodal ex vivo nor rescue Nodal signalling in DKO mutants at E6.5 (Beck et al., Nat. Cell Biol. 2002, 4, 981 ). Before E6.5, implanted embryos also do not express detectable amounts of PC7 or Pcsk5. Therefore, the residual processing of Nodal and CLIP in DKO embryos at E5.5 is most likely mediated by a maternal PC from the uterus. Consistent with this model, the CFP fluorescence of CLIP rapidly increased in E5.25 DKO mutants that were cultured outside the uterus until E5.5-5.75, but not in cultured control littermates. Thus, while zygotic Furin/Pace4 activities clearly contribute to CLIP processing in the epiblast, their loss is efficiently compensated at E5.5 in utero, most likely by one or several maternal PCs. A likely candidate for the maternal activity is Pcsk5, which is not expressed in embryonic lineages until late gastrulation (Essalmani et al., Proc Natl Acad Sci U S A. 2008, 105, 5750; Szumska et al., Genes Dev. 2008, 22, 1465), but abundantly present in the E4.5 deciduum (Essalmani et al., Proc Natl Acad Sci U S A., 2008, 105, 5750) and able to cleave Nodal (Beck et al., Nat. Cell Biol. 2002, 4, 981).

The sensitivity and specificity of CLIP were also stringently validated in DKO mutant ES cells, and by quantitative FRET measurements. Furthermore, confirming earlier predictions (Beck et al., Nat. Cell Biol. 2002, 4, 981 ; Blanchet et al., EMBO J. 2008, 27, 2580), our analysis of CLIP in mixed cell cultures provides direct evidence that Furin and Pace4 can cell non-autonomously cleave a membrane-bound protein. In this assay, CLIP also detected robust cell nonautonomous activity of Pcsk5, which binds to heparan sulfate proteoglycans (HSPG) through a cysteine-rich region that is conserved in Pace4 (Mayer et al., J Biol Chem. 2008, 283, 2373; Nour et al., Mol Biol Cell. 2005, 16, 5215). In cultured cells, activation of Nodal at the membrane is directed to lipid rafts by the GPI- anchored coreceptor Cripto, which also binds Furin and Pace4 (Blanchet et al., EMBO J. 2008, 27, 2580). Cripto binds the Furin P-domain that is conserved in all PCs (Blanchet et al., EMBO J. 2008, 27, 2580). However, this interaction is clearly not essential to engage PCs at the plasma membrane, since CLIP can be efficiently cleaved at the surface of HEK293T cells which neither express Cripto nor the related protein Cryptic (Minchiotti et al., Mech. Dev. 2000, 90, 133; Yan et al. , Mol Cell Biol. 2002, 22, 4439). Thus, soluble PCs may be enriched at the plasma membrane by HSPGs or other receptors, whereas Cripto serves to localize processing to specific membrane domains (Constam, Traffic. 2009, 10, 783). To label cells exposed to autocrine or paracrine PC activities, CLIP was tethered to the plasma membrane like Cripto by a GPI anchor. This approach differs from earlier studies in tissue culture and in tumor xenografts monitoring intracellular PC activities by the release of alkaline phosphatase from a Golgi- resident fusion protein into the culture medium (Coppola et al., Anal Biochem. 2007, 364, 19), or by adding caged bioluminescent substrates (Dragulescu- Andrasi et al., Bioconjug Chem., 2009). PC activities have also been detected at the surface of transfected cells by the internalization of a tagged ligand of processed Anthrax Protective Antigen (Hobson et al., Nat Methods. 2006, 3, 259). However, none of these smart systems provided information on endogenous PC activities in vivo, or on their individual relative contributions to the processing of membrane-bound substrates. Earlier efforts to image proteases using FRET probes have focused on matrix metalloproteases (MMPs). A synthetic FRET probe was sufficiently sensitive ex vivo to detect endogenous MMP12 in isolated macrophages, a rich source of MMPs (Cobos-Correa et al., Nat Chem Biol. 2009, 5, 628). However, spatial resolution at the tissue level has not been analyzed, and synthetic probes also have the disadvantage that they require costly chemistry and specialized expertise. As an alternative, FRET has been monitored using a YFP- CFP fusion that can be partially cleaved by recombinant soluble MMPs in vitro (Yang et al., Biochim Biophys Acta. 2007, 1773, 400). However, targeting of this probe to the cell surface by the transmembrane domain of platelet-derived growth factor receptor was inefficient, and MMP inhibitors had no effect on FRET until after prolonged treatment for at least 72 hours (Yang et al., Biochim Biophys Acta. 2007, 1773, 400), implying that both the sensitivity and specificity of cleavable YFP-CFP fusion proteins might be insufficient to image cell surface proteases in vivo.

By contrast, our results obtained with CLIP establish that a fusion of widely used fluorescent proteins is suitable to image secreted proteases with unmatched sensitivity and spatial resolution. On the other hand, while our reporter can image the onset of enzyme activation, the time required for its own synthesis might be rate-limiting to detect more rapid changes in PC activity. CLIP also detected PC activities in adult tissues, even though its expression levels were heterogeneous across different tissues. More uniform expression might be achieved in the future by inserting the transgene into a defined locus. To our knowledge, CLIP is the first biosensor to detect specific proteolytic activities in the in vivo physiological context of a transgenic mouse model.

Claims

1. A system for detecting the presence of a convertase cleaving activity, the system comprising a molecule comprising a proteolytic cleavage site with the amino acid sequence -R-X1-X₂-R-, wherein R represents the amino acid arginine, Xi and X₂ are selected independently among any amino acid, preferably from any one of the twenty two (22) standard amino acids;

wherein said system comprises a molecule, which comprises a first part and a second part separated by said cleavage site, and wherein said molecule, when cleaved at said cleavage site, loses or obtains a chemical, physical or biological property, including properties selected from fluorescence, catalytic and/or other biologic activity, said property depending on the close physical proximity or on the absence of such proximity, respectively, said first and second parts of the molecule that precede and follow the cleavage site, and which physical proximity or absence of proximity is thus lost or obtained, respectively, by cleavage through a proprotein convertase;

2. The system of claim 1 , which is a molecule, preferably a peptide encoded by a nucleotide (DNA, RNA, for example) sequence, preferably said system is a peptide derivative selected from the group comprising or consisting of glycopeptides, lipopeptides and lipoglycopeptides.

3. The system of any one of claims 1 or 2, wherein said first part comprises a fluorescent protein (a) and said second part comprises a protein (b) selected from a bioluminescent and a fluorescent protein, wherein said proteins (a) and (b) can exist in said cells in a first state, where there is no or little energy transfer, and a second state, where there is a substantial energy transfer from (b) to (a), wherein said energy transfer affects the quantity of light emitted by (a), and wherein (a) emits light of a different wavelength than (b).

4. The system of claim 3, wherein from the light emitted by (a) and/or from (b) and/or from a ratio of light emitted by (a) with respect to (b), or vice versa, presence or absence of proprotein convertase activity is assessed.

5. The system of any one of claims 3 or 4, wherein said energy transfer is a resonance energy transfer, which is preferably selected from the group of FRET (Foster resonance energy transfer) and BRET (bioluminescence resonance energy transfer).

6. The system of any one of the preceding claims, wherein said first part comprises a yellow fluorescent protein (YFP) and said second part comprises a green or a cyan fluorescent protein (GFP or CFP).

7. The system of any one of the preceding claims, wherein said localising element is selected from signal peptides and transmembrane domains.

8. The system of any one of the preceding claims, wherein the said localising element is glycophosphatidylinositol (GPI).

9. The system according to any one of the preceding claims, which is intended to detect an activity of a prohormone protease and/or from a proprotein convertase.

10. The system according to any one of the preceding claims, which is intended to detect an activity of a protease comprising a substilisin-related domain. A subtilisin-related catalytic domain is as domain, which achieves proteolytic cleavage by the same, similar or an equivalent mechanism as subtilisin, and/or which comprises aspartic acid, histidine and serine interacting and/or contributing with a peptide substrate of which a peptide bond is to be cleaved in the cleavage process.

11. The system according to any one of the preceding claims, wherein said convertase is selected from any one of PCSK 1 (PC1 , PC3 (also referred to as PC1/3); PCSK 2 (PC2); PCSK 3 (Furin, Pace, PC1); PCSK 4 (PC4); PCSK 5 (PC5, PC6 (also referred to as PC5/6)); PCSK 6 (PACE4); PCSK 7 (PC7, PC8); PCSK 8 (Site 1 protease, S1 P, SKI); PCSK 9 (NARC-1). Preferably the convertase is Furin and/or Pace4.

12. A nucleotide sequence encoding a polypeptide comprising a fluorescent protein (a) and a protein (b) selected from bioluminescent and fluorescent protein, wherein said proteins (a) and (b) can exist in said cells in a first state, where there is no or little energy transfer, and a second state, where there is a substantial energy transfer from (b) to (a), wherein said energy transfer affects the quantity of light emitted by (a), and wherein (a) emits light of a different wavelength than (b); wherein said polypeptide further comprises a convertase cleavage site comprising an amino acid sequence -R-X₁-X₂-R-, wherein R represents the amino acid Arginine, Xi and X₂ are selected independently among any amino acid, wherein said cleavage site is located, in said polypeptide in between said proteins (a) and (b); and,

13. The nucleotide sequence of claim 12, wherein said at least one transmembrane and/or signal sequence is provided at an otherwise free terminus of either protein (a) and/or protein (b), preferably at the C-terminus of the protein selected from protein (a) and protein (b), which is provided at the C-terminus of said polypeptide.

14. The nucleotide sequence of claim 12 or 13, wherein said at least one signal sequence comprises a GPI signal sequence.

15. The nucleotide sequence according to any one of claims 12-14, wherein said at least one signal sequence comprises a sequence directing the polypeptide to a cellular compartment or to the extracellular space (secretion).

16. The nucleotide sequence of claim 15, wherein said sequence directs the polypeptide to the extracellular space by secretion via the ER-Golgi pathway.

17. The nucleotide sequence of any one of claims 12-15, encoding at least two signal peptides, for example a GPI signal sequence and a secretion signal sequence.

18. The nucleotide sequence of any one of the preceding claims, which encodes, from a 5' to a 3' end of said nucleotide sequence, one or more of the following peptides in the order (from the amino to the carboxy terminus of said polypeptide) as shown in any one of formulae (I) to (IV) below:

I. (ss2)-(a)-(cs)-(b)-(ss1);

II. (ss2)- (b)-(cs)-(a)-(ss1);

III. (ss1)-(a)-(cs)-(b)-(ss2);

IV. (ss1)-(b)-(cs)-(a)-(ss2);

wherein one or both selected from (ss1) and (ss2) is/are optional;

wherein further amino acids, and peptides may be encoded within and at the C- or

N- termini of said elements (a), (b), (cs) and (ss1); preferably said further amino acids are not provided at the terminus of the signal sequence (ss1);

wherein peptides (a) and (b) are as proteins (a) and (b) defined above;

wherein (cs) represents a cleavage site as defined above; and

wherein (ss1) and (ss2) each independently represents a signal sequence.

19. The nucleotide sequence of claim 18, wherein (ss2), if present, is a nucleotide sequence encoding a cell-membrane anchoring unit and (ss1), if present, is a nucleotide sequence encoding the secretion of the encoded peptide, or vice versa.

20. A cell and/or a non-human organism expressing the nucleotide sequence according to any one of claims 12 to 19.

21. The cell of claim 20, which does not produce a functional convertase capable of cleaving the polypeptide as defined in any one of claims 12 or 13.

22. The cell of claim 21 , in which the expression of a convertase capable of cleaving the polypeptide as defined in any one of claims 12 or 13 is inhibited or suppressed, for example by coexpression of an inhibitor of said convertase, by the rendering one (or more) native gene(s) encoding said convertase inoperable (knockout), and/or by the addition of an inhibitor of said convertase.

23. The cell of any one of claims 17 and 18, which can be used in detecting and/or reporting non-autonomous protein convertase activity.

24. A transgenic non-human organism, preferably a non-human animal, more preferably a rodent, said organism expressing the nucleotide sequence according to any one of claims 12 to 19.

25. The organism of claim 24, wherein said nucleotide sequence is expressed in one or more selected from: only one cell type, in several different cell types, in only one tissue and/or organ, in several, different cell types, in several different tissues and/or organs, and uniformly or variably within the entire organism.

26. The organism of any one of claims 24 and 25, wherein said nucleotide sequence is expressed in muscular tissues, for example striated muscle cells, in neural tissue and/or in endothelial tissues.

27. A non-human, mammalian transgenic organism harbouring the system according to any one of claims 1 -1 1 and/or the nucleotide sequence of any one of claims 12-19.

28. The organism of any one of claims 20-23, which is a transgenic mouse.

29. Use of the cells according to any one of claims 20-23 and/or of the organism of any one of claims 24-28 as a research model, a research tool, and in methods of screening compounds.

30. A method of detecting and/or assessing non-autonomous convertase activity between different cells, wherein said method comprises the step of incubating the cells of any one of claims 17 and 18 with other cells, and wherein the presence or absence of non-autonomous convertase activity is assessed from the light emissions measured from protein (a) and/or protein (b), and/or from the ratio of the light emitted by (a) and (b), or vice versa.