WO2011041839A1 - Udp-galactopyranose mutase from haemonchus contortus, and rnai agents that inhibit it - Google Patents

Abstract

The invention relates to the cloning of the Haemonchus contortus UDP-galactopyranose mutase gene, which is homologous to the C elegans glf-1. Also disclosed is the use of RNAi agents targeting this enzyme to treat or prevent a parasitic nematode infection, and the use of this enzyme to detect a nematode infection.

Description

ANTHELMINTIC AGENTS

Incorporation by Cross-Reference

This application claims priority from Australian provisional application no. 2009904881 filed on 7 October 2009 the entire contents of which are incorporated herein by cross-reference.

Technical Field

The invention relates generally to the detection and treatment of nematode infection. More specifically, the invention relates to the identification of a protein target in parasitic nematodes and its use for the detection and treatment of nematode infection.

Background

~„ Nematode (roundworm) parasites infect all animals, including humans, and also infect plants. They cause huge losses in animal and crop production worldwide and are responsible for significant human health problems in developing countries. Control of nematode infections in animals and humans relies on managing exposure to the larval stages of the parasites, and on drug treatment. Control of plant-parasitic nematodes is inadequate and is reliant on crop rotation, genetically resistant crops and soil sterilisation.

Drug treatment of animal and human-parasitic nematodes is dependent on a limited number of classes of anthelmintic compounds: the benzimidazoles (e.g. mebendazole, albendazole), the macrocyclic lactones (ivermectin, abamectin, moxidectin, doramectin, and milbemycin), and the imidazothiazoles (levamisole, morantel, pyrantel). While these compounds have been somewhat effective in controlling nematode parasites, they have been in use for many years and have lost efficacy in animal populations due to the development of resistance by the parasites. Further, there is accumulating evidence that some populations of nematodes that infect humans are also developing resistance to currently administered anthelmintic drugs.

There is a need for new protein targets in nematodes to provide a basis for developing more effective methods of identifying and controlling nematode infections, and to facilitate the identification of new anthelmintic agents. A need also exists for treatments capable of reducing the resistance to currently available anthelmintic drugs in nematodes. Summary of the Invention

In a first aspect, the invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a UDP-galactopyranose mutase enzyme derived from a parasitic nematode.

In one embodiment of the first aspect, the UDP-galactopyranose mutase enzyme is derived from a parasitic nematode selected from the group consisting of H. contortus, H. glycines, S. stercoralis, M. arenaria, O, volvulus, A. ceylanicum, B. malayi and M. hapla.

In one embodiment of the first aspect, the UDP-galactopyranose mutase enzyme is derived from H. contortus.

In a second aspect, the invention provides an isolated nucleic acid comprising a nucleotide sequence sharing at least 70% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

In one embodiment of the second aspect, the nucleic acid comprises a nucleotide sequence sharing at least 80% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

In one embodiment of the second aspect, the nucleic acid comprises a nucleotide sequence sharing at least 90% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

In a third aspect, the invention provides an isolated ribonucleic acid (RNA) or an isolated complementary DNA encoded by a nucleic acid according to the first or second aspect.

In one embodiment of the third aspect, the isolated ribonucleic acid (RNA) or isolated complementary DNA comprises the sequence set forth in SEQ ID NO: 39.

In one embodiment of the third aspect, the isolated ribonucleic acid (RNA) or isolated complementary DNA comprises a sequence sharing at least 70%> sequence identity with the sequence set forth in SEQ ID NO: 39.

In one embodiment of the third aspect, the isolated ribonucleic acid (RNA) or isolated complementary DNA comprises a sequence sharing at least 80% sequence identity with the sequence set forth in SEQ ID NO: 39.

In one embodiment of the third aspect, the isolated ribonucleic acid (RNA) or isolated complementary DNA comprises a sequence sharing at least 90% sequence identity with the sequence set forth in SEQ ID NO: 39. In a fourth aspect, the invention provides an isolated double stranded RNA comprising a strand that binds specifically to the RNA molecule of the third aspect.

In a fifth aspect, the invention provides a vector comprising the nucleic acid of the first or second aspect, or the RNA or cDNA of the third aspect.

In a sixth aspect, the invention provides a host cell comprising the vector of fifth aspect.

In a seventh aspect, the invention provides an isolated polypeptide encoded by the nucleic acid of the first or second aspect, or the RNA or cDNA of the third aspect.

In one embodiment of the seventh aspect, the polypeptide shares at least 70% sequence identitywith the amino acid sequence set forth in SEQ ID NO: 1.

In one embodiment of the seventh aspect, the polypeptide comprises an amino acid sequence sharing at least 80% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1.

In one embodiment of the seventh aspect, the polypeptide comprises an amino acid sequence sharing at least 90% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1.

In an eighth aspect, the invention provides an antibody specific that binds specifically to the polypeptide of the seventh aspect.

In a ninth aspect, the invention provides a method for inhibiting growth, reproduction or motility of a parasitic nematode, said method comprising inhibiting UDP- galactopyranose mutase expression or function in said nematode.

In one embodiment of the ninth aspect, the method comprises administering the double stranded RNA of the fourth aspect to the nematode.

In a tenth aspect, the invention provides a method for preventing or treating a parasitic nematode infection in a subject, said method comprising administering to the subject an agent that inhibits UDP-galactopyranose mutase expression or function in said nematode.

In one embodiment of the tenth aspect, the UDP-galactopyranose mutase is encoded by the nucleic acid of the first, second or third aspect, or comprises the polypeptide of the seventh aspect.

In one embodiment of the tenth aspect, the agent is the double-stranded RNA of the fourth aspect.

In one embodiment of the tenth aspect, the agent is the antibody of the eighth aspect. In an eleventh aspect, the invention provides a method of detecting the presence or absence of a parasitic nematode in a sample, the method comprising detecting the presence or absence of a UDP-galactopyranose mutase (GLF) derived from the parasitic nematode in the sample.

In a twelfth aspect, the invention provides a method of detecting the presence or absence of a parasitic nematode in a sample, the method comprising:

(a) contacting a nucleic acid from the sample with an agent that binds specifically to the nucleic acid of the first or second aspect, or the RNA or cDNA the third aspect, and

(b) detecting a nucleic acid from the sample bound to said agent,

wherein detection of a nucleic acid bound to agent is indicative of the presence of said parasitic nematode in the sample.

In a thirteenth aspect, the invention provides a method of detecting the presence or absence of a parasitic nematode in a sample, the method comprising:

(a) contacting a polypeptide from the sample with an agent that binds specifically to the polypeptide of the seventh aspect, and

(b) detecting a polypeptide from the sample bound to said agent,

wherein detection of a polypeptide bound to agent is indicative of the presence of said parasitic nematode in the sample.

In one embodiment of the thirteenth aspect, the agent is an antibody.

In one embodiment of the ninth, tenth, eleventh, twelfth or thirteenth aspect, the parasitic nematode is selected from the group consisting of H. contortus, H. glycines, S. stercoralis, M. arenaria, O. volvulus, A. ceylanicum, B. malayi and M. hapla.

In one embodiment of the ninth, tenth, eleventh, twelfth or thirteenth aspect, the parasitic nematode is H. contortus.

In a fourteenth aspect, the invention provides a method for increasing the sensitivity of a nematode to an anthelmintic drug, the method comprising inhibiting UDP- galactopyranose mutase expression or function in said nematode.

In one embodiment of the ninth, tenth, eleventh, twelfth, thirteenth or fourteenth aspect, the nematode is resistant to an anthelmintic drug.

In a fifteenth aspect, the invention provides a method for enhancing the effectiveness of an anthelmintic drug in a subject, the method comprising administering to the subject:

(a) an agent that inhibits UDP-galactopyranose mutase expression or function in said nematode, and (b) said anthelmintic drag.

In a sixteenth aspect, the invention provides a method treating a subject infected with a parasitic nematode having resistance to an anthelmintic drug, the method comprising administering to the subject:

(a) an agent that inhibits UDP-galactopyranose mutase expression or function in said nematode, and

(b) said anthelmintic drug.

In one embodiment of the fourteenth, fifteenth or sixteenth aspect, the anthelmintic drug is selected from the group consisting of agents in classes represented by amoscanate; arecoline; Bacillus thuringiensis crystal proteins (for example Cry5B); bephenium; bithionol; bitoscanate; brotianide; bunamidine; clonostachydiol; cyacetacide; diamfenetide,; diethylcarbamazine; dithiazanine; epsiprantel; hygromycin B; kainic acid; LY 165163; metyridine; nitazoxanide; nitroscanate; paromomycin; phenothiazine; phthalofyne; picadex; piperazine; pyrvinium; santonin; suramin; thenium closylate; tribendimidine; and members of the following anthelmintic classes amino acetonitrile derivatives (for example monepantel), arsenicals (for example melarsomine and thiacetarsamide sodium), benzene sulphonamides (for example clorsulon), benzimidazoles and probenzimidazoles (including albendazole, albendazole oxide, benzimidazole, 2- phenyl, cambendazole, cyclobendazole, dienbendazole, dribendazole, fenbendazole, fiubendazole, lobendazole, luxabendazole, mebendazole, oxfendazole, oxibendazole, parbendazole, thiabendazole, triclabendazole, febantel, netobimin, and thiophanate- methyl), cyclooctadepsipeptides (for example emodepside); isoquinolinones (for example praziquantel), macfortines (for example marcfortine A), macrocyclic lactones (such as abamectin (including abamectin Bl and abamectin Bib)), doramectin, emamectin (emamectin Bla and emamectin Bib), eprinomectin (eprinomectin Bla and eprinomectin Bib), ivermectin (ivermectin Bla and ivermectin Bib), milbemycin oxime, moxidectin, nemadectin and selamectin), organochlorines (for example dichlorophen), organophosphates (coumaphos, dichlorvos, haloxon, naftalofos, pyraclofos, trichlorfon), paraherquamides (for example derquantel), salicylanilides and nitrophenols (bromoxanide, clioxanide, closantel, disophenol, niclosamide, oxyclozanide, rafoxanide, resorantel, tribromsalans), imidazothiazoles (for example butamisole levamisole and tetramisole) and tetrahydropyrimidines (for example morantel, oxantel and pyrantel)

.In one embodiment of the fourteenth, fifteenth or sixteenth aspect, the anthelmintic drug is selected from the group consisting of amino-acetonitrile derivatives benzimidazoles, diethylcarbamazine, imidazothiazoles, macrocyclic lactones, octadepsipeptides, piperazine, and suramin.

In a seventeenth aspect, the invention provides a method of screening for an anthelmintic agent, the method comprising:

(a) contacting a nucleic acid encoding a UDP-galactopyranose mutase enzyme derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between said candidate agent and said nucleic acid, and

(b) measuring production of the UDP-galactopyranose mutase enzyme encoded by said nucleic acid.

In an eighteenth aspect, the invention provides a method of screening for an anthelmintic agent, the method comprising:

(a) contacting a nucleic acid encoding a UDP-galactopyranose mutase enzyme derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between said candidate agent and said nucleic acid, and

(b) assaying for activity of the UDP-galactopyranose mutase enzyme encoded by said nucleic acid.

In a nineteenth aspect, the invention provides a method of screening for an anthelmintic agent, the method comprising:

(a) contacting a UDP-galactopyranose mutase enzyme derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between said candidate agent and said enzyme, and

(b) measuring activity of the UDP-galactopyranose mutase enzyme.

In one embodiment of the ninth, tenth, eleventh, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth or nineteenth aspect, the UDP-galactopyranose mutase is encoded by the nucleic acid of the first or second aspect, or the RNA or cDNA of the third aspect.

In one embodiment of the ninth, tenth, eleventh, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth or nineteenth aspect, the UDP-galactopyranose mutase is encoded by the nucleic acid of the first, second or third aspect, or comprises the polypeptide of the seventh aspect.

In one embodiment of the ninth, tenth, eleventh, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth or nineteenth aspect, the UDP-galactopyranose mutase comprises an amino acid sequence having at least 70% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1. In one embodiment of the twelfth or thirteenth aspect, the nucleic acid encoding a UDP-galactopyranose mutase is the nucleic acid of the first or second aspect, or the RNA or cDNA of the third aspect.

In a twentieth aspect, the invention provides a method of screening for an anthelmintic agent, the method comprising the steps of:

(a) administering a candidate agent to a nematode, and

(b) detecting an increase in cuticle permeability in said nematode.

In one embodiment of the twentieth aspect, the detecting is performed by administering a fluorescent dye to the nematode.

Brief Description of the Drawings

A preferred embodiment of the present invention will now be described, by way of an example only, with reference to the accompanying drawings wherein:

Figure 1 shows an amino acid sequence alignment of GLF proteins from selected protozoa, fungi, the nematode C. elegans and bacteria. Lmaj: Leishmania major, Tcru; Trypanosoma cruzi; Cneo: Cryptococcus neoformans; Cele: C. elegans; Ecol: E. coli.

Figure 2 provides microscope images of C, elegans after knock down of Ce-glf-1 expression. Figure 2A: C. elegans fed E. coli expressing a control dsRNA. Figures 2B and 2C: C. elegans fed E. coli expressing Ce-glf-1 dsRNA. A low level of lethality was observed (arrows) (n=99). Scale bar 100 μηι.

Figure 3 provides microscope images showing cuticle permeability in C. elegans fed E. coli expressing Ce-glf-1 dsRNA. Figures 3A and 3B show images of the anterior of adult nematodes under epifluorescence. Figures 3C and 3D show images of the anterior of adult nematodes using bright field Nomarski microscopy. Figures 3A and 3C: C elegans fed E. coli expressing Ce-glf-1 dsRNA; Figures 3B and 3D: C. elegans fed E. coli expressing a control dsRNA. Arrows in Figure 3A highlight fluorescing nuclei which are not stained in Figure 3B.

Figure 4 is a graph showing the percentage of C. elegans paralysed after exposure to levamisole.

Figure 5 is an amino acid sequence alignment of predicted protein sequences of putative homologues of Ce-GLF-1. Hg: Heterodera glycines (CB379157); Ss: Strongyloides stercoralis (BG227443); Ma: Meloidogyne arenaria (BI397280); Ov: Onchocerca volvulus (AA294602); Ac: Ancylostoma ceylanicum (CW709484); Ce: Caenorhabditis elegans; Bm: Brugia malayi (Bml, A8QeX8; Bm2, A8PU41). Dark boxes denote regions of amino acid identity. Grey boxes denote amino acid regions of similarity. Underlined regions denoted flavin-binding region (based on E, coli enzyme). Asterisks denote proposed UDP-galactopyranose binding site. Daggers (†) denote additional conserved residues found in the proposed active site.

Figure 6 is a graphical display of H. contortus sequence fragments with homology to Ce-GLF-1. Black and white numbered bar represents Ce-glf-1. Shaded grey regions above the numbered bar represent the sequence coverage for the below region. Shaded horizontal boxes above and below the numbered bar represent H. contortus sequences with varying degrees of homology to Ce-GLF-1. +/- hsps denotes H. contortus sequences with homology to the sense or anti-sense DNA strand of Ce-glf-1 respectively.

Figure 7 provides the DNA sequence of an Hc-glf-1 fragment used to generate dsRNA for H. contortus RNAi experiments.

Figure 8 is a graph illustrating the development of H, contortus larvae fed E. coli expressing Hc-glf-1 dsRNA or control dsRNA.

Figure 9 provides microscope images of H. contortus larvae stained with the DNA- binding dye Hoechst 33258 following RNAi of Hc-glf-1 in free-living larvae. Left panel: H. contortus larvae fed E. coli expressing either Hc-glf-1 dsRNA. Right panel: H, contortus larvae fed control dsRNA.

Figure 10 provides a predicted nucleotide and amino acid sequence for Hc-glfl derived from a clonal population of H. contortus larvae. Nucleotide sequence is in lower case; protein amino acid sequence is in upper case.

Figure 11 provides an alignment of Hc-GLF-1 amino acid sequences derived from various clonal populations of H. contortus larvae. Identical residues are shown in red or blue. Different residues are shown in black. Black asterisks denote proposed UDP-Galp binding site. Blue asterisks denote additional conserved residues found in the proposed active site.

Figure 12 shows epifluorescence microscopy images of C. elegans strains WT253 and WT255 subjected to RNAi targetting Ce-glf-1 and subsequently stained with the membrane impermeant fluorescent dye Hoechst 33258. A-C: C. elegans strain WT253 expressing the transgene

open reading frame::GFP, i.e. the C. elegans GLF-1 protein fused to GFP under the control of the C. elegans glf-1 promoter. D-F: C. elegans strain WT255 expressing the transgene

open reading frame::GFP, i.e. the H. contortus GLF-1 protein fused to GFP under the control of the C. elegans glf-1 promoter. A, D - bright field; B, E - fluorescence of GFP; C, F - fluorescence of Hoechst 33258. GFP: green fluorescence protein. Scale bar 50 μη .

Figure 13 is a graph showing the percentage of worms with cuticle permeability following a differential RNAi experiment in which transgenic C. elegans were fed dsRNA corresponding to either a control gene not present in C. elegans or to Ce-glf-L

Figure 14 provides light micrographs showing RNAi phenotype of H. contortus larvae on day 7 of feeding on dsRNA targetting Hc-glf-L The Control(RNAi) panel shows healthy L3 which had been feeding on Arabidopsis thaliana lhcb4.3 dsRNA. The Hc-glf~l (RNAi) panel shows two healthy L3 plus two dead L2 (upper arrows) and a sick and pale L3 (lower arrow). Scale bar 100 μπι.

Figure 15 shows a confocal green fluorescence protein (GFP) fluorescence and brightfield overlay micrograph of a WT253 {Ce-glf-1 promoter: :Ce-glf-l open reading frame: :GFP) 4^th stage larval C. elegans. Scale bar 50μιη.

Figure 16 is a graph showing expression of Hc-glf-1 mRNA at each stage of development of H. contortus.

Figure 17 is a graph showing that RNAi of glf-1 increases sensitivity of wild-type C. elegans (strain N2) to paralysis by levamisole. glf-1 (RNAi) Geneservice- dsRNA prepared from Geneservice genomic fragment of glf-1; glf-1 (RNAi) pCBlOO ~ dsRNA prepared from pCBlOO cDNA fragment; control (RNAi) - dsRNA prepared from pCB19 (fragment of Arabidopsis thaliana lhcb4.3).

Figure 18 is a graph showing that RNAi of glf-1 increases sensitivity of levamisole- resistant C. elegans (strain CB211) to paralysis by levamisole. glf-l(RNAi) pCBlOO - dsRNA prepared from pCBlOO cDNA fragment; control (RNAi) - dsRNA prepared from pCB19 (fragment of Arabidopsis thaliana lhcb4.3).

Figure 19 is a graph showing that RNAi of glf-1 increases sensitivity of wild-type C. elegans (strain N2) to paralysis by ivermectin glf-l( NAi) Geneservice ~ dsRNA prepared from Geneservice genomic fragment of glf-1; glf-1 (RNAi) pCBlOO - dsR A prepared from pCBlOO cDNA fragment; control (RNAi) - dsRNA prepared from pCB19 (fragment of Arabidopsis thaliana lhcb4.3).

Figure 20 is a graph showing that RNAi of glf-1 increases the sensitivity of wild- type C. elegans (strain N2) to paralysis by mebendazole, glf-1 (RNAi) Geneservice - dsRNA prepared from Geneservice genomic fragment of glf-1; glf-1 (RNAi) pCBlOO - dsRNA prepared from pCBlOO cDNA fragment; control (RNAi) - dsRNA prepared from pCB19 (fragment of Arabidopsis thaliana lhcb4.3). Definitions

As used in this application, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a plant cell" also includes a plurality of plant cells.

As used herein, the term "comprising" means "including". Variations of the word "comprising", such as "comprise" and "comprises", have correspondingly varied meanings. Thus, for example, a polynucleotide "comprising" a sequence encoding a protein may consist exclusively of that sequence or may include one or more additional sequences.

As used herein, an "agent" includes within its scope any natural or manufactured element or compound. Accordingly, the term includes, but is not limited to, any chemical elements and chemical compounds, nucleic acids, amino acids, polypeptides, proteins, antibodies and fragments of antibodies, and other substances that may be appropriate in the context of the invention.

As used herein, the term "administering" and variations of that term including "administer" and "administration", includes contacting, applying, delivering or providing a compound (e.g. a nucleic acid, polypeptide, antibody) or composition of the invention to an organism by any appropriate means.

As used herein, the terms "antibody" and "antibodies" include IgG (including IgGl, IgG2, IgG3, and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY, whole antibodies, including single-chain whole antibodies, and antigen-binding fragments thereof. Antigen-binding antibody fragments include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. The antibodies may be from any animal origin. Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entire or partial of the following: hinge region, CHI, CH2, and CH3 domains. Also included are any combinations of variable region(s) and hinge region, CHI, CH2, and CH3 domains. Antibodies may be monoclonal, polyclonal, chimeric, multispecific, humanized, and human monoclonal and polyclonal antibodies, which specifically bind the biological molecule.

As used herein, the term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides.

As used herein, the term "polypeptide" means a polymer made up of amino acids linked together by peptide bonds. For the purposes of the present invention a "polypeptide" may constitute a full length protein or a portion of a full length protein.

As used herein the terms "modulating", "modulates" and variations thereof refer to increasing or decreasing the level of activity, production, secretion or functioning of a molecule in the presence of a particular modulatory molecule or agent of the invention compared to the level of activity, production, secretion or other functioning thereof in the absence of the modulatory molecule or agent. These terms do not imply quantification of the increase or decrease. The modulation may be of any magnitude sufficient to produce the desired result and may be direct or indirect.

As used herein the term "treatment", refers to any and all uses which remedy a disease state or symptoms, or otherwise prevent, hinder, retard, or reverse the progression of disease or other undesirable symptoms in any way whatsoever.

As used herein the terms "effective amount" and "therapeutically effective amount" include within their meaning a non-toxic but sufficient amount of an agent or compound to provide the desired therapeutic effect. The exact amount required will vary from subject to subject depending on factors such as the species being treated, the age and general condition of the subject, the severity of the condition being treated, the particular agent being administered and the mode of administration and so forth. Thus, it is not possible to specify an exact "effective amount". However, for any given case, an appropriate "effective amount" may be determined by one of ordinary skill in the art using only routine experimentation.

Any description of prior art documents herein, or statements herein derived from or based on those documents, is not an admission that the documents or derived statements are part of the common general knowledge of the relevant art.

For the purposes of description all documents referred to herein are incorporated by reference unless otherwise stated. Detailed Description

This invention identifies a new protein target for the development of anti-parasitic agents. The target is a predicted protein with sequence similarity to the enzyme UDP- galactopyranose mutase (UGM) from bacteria, fungi and protozoa. UGM is thought to catalyse the reversible conversion of the nucleotides UDP-galactopyranose and UDP- galactofuranose. Although the enzyme is present in bacteria, protozoa and nematodes it has not been identified in mammals. Consistent with this, the sugar galactofuranose has not been found in mammals and hence metabolism of this sugar represents a selective target for chemotherapy of infectious bacteria, fungi, protozoa and nematodes.

Accordingly, in certain aspects the invention provides nucleic acid and amino acid sequences encoding nematode UDP-galactopyranose mutases, also referred to herein as GLFs. As demonstrated herein, these GLFs are essential for the locomotion, normal growth and reproduction of both free-living and parasitic nematodes. Hence, other aspects of the invention provide methods and compositions for the prevention and or treatment of nematode infection by administration of agent(s) targeting the expression and/or activity of GLFs. Furthermore, the identification of GLFs as essential enzymes for nematode viability has facilitated the development of screening methods for the identification of agents capable of preventing or treating nematode infection.

The disruption of glf expression in nematodes is demonstrated herein to induce cuticle permeability which in turn increases the sensitivity of nematodes to anthelmintic agents. Accordingly, in additional aspects the invention provides methods and compositions for increasing the sensitivity of nematodes (including those with drug resistant phenotypes) to anthelmintic drugs.

Polypeptides and nucleic acids

The invention provides UDP-galactopyranose mutase (GLF) polypeptides derived from nematodes ("polypeptide(s) of the invention"). Also provided are nucleic acids encoding UDP-galactopyranose mutase (GLF) polypeptides derived from nematodes ("nucleic acid(s) of the invention").

In general, a UDP-galactopyranose mutase (GLF) polypeptide "derived from" a nematode as contemplated herein is one that is encoded by a portion of the genome of that nematode. Similarly, a UDP-galactopyranose mutase (GLF) nucleic acid "derived from" a nematode generally corresponds or substantially corresponds to a portion of the genome of that nematode. Typically, a polypeptide of the invention is an isolated polypeptide. It will be understood that the term "isolated" in this context means that the polypeptide has been removed from or is not associated with some or all of the other components with which it would be found in its natural state. For example, an "isolated" polypeptide may be removed from other amino acid sequences within a larger polypeptide sequence, or may be removed from natural components such as unrelated proteins. For the sake of clarity, an "isolated" polypeptide also includes a polypeptide which has not been taken from nature but rather has been prepared de novo, such as chemically synthesised and or prepared by recombinant methods. As described herein an isolated polypeptide of the invention may be included as a component part of a longer polypeptide or fusion protein.

Typically, a nucleic acid of the invention is an isolated nucleic acid. It will be understood that the term "isolated" in this context means that the nucleic acid has been removed from or is not associated with some or all of the other components with which it would be found in its natural state. For example, an "isolated" nucleic acid may be removed from other nucleic acid sequences within a larger nucleic acid sequence, or may be removed from natural components such as unrelated nucleic acids. For the sake of clarity, an "isolated" nucleic acid also includes a nucleic acid which has not been taken from nature but rather has been prepared de novo, such as chemically synthesised and or prepared by recombinant methods.

UDP-galactopyranose mutase (GLF) polypeptides and nucleic acids of the invention may be derived from any nematode expressing the same.

In certain embodiments, UDP-galactopyranose mutase (GLF) polypeptides and nucleic acids of the invention are derived from parasitic nematodes.

The parasitic nematode may be capable of infecting an animal and/or a plant.

Examples of nematodes from which UDP-galactopyranose mutase (GLF) polypeptides (or nucleic acids encoding the same) may be derived include, but are not limited to, those of the class Secernentea. For example, the nematode may be of the order Strongylida, Tylenchida, Rhabditida or Spirurida. Specific examples of such nematodes include, but are not limited to, Haemonchus contortus, Heterodera glycines, Strongyloides stercoralis, Meloidogyne arenaria, Onchocerca volvulus, Ancylostoma ceylanicum, Brugia malayi and Meloidogyne hapla.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Haemonchus contortus. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof. Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Haemonchus contortus. The nucleic acid may have the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Heterodera glycines. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 3, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 3, or a fragment thereof.

In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Heterodera glycines. The nucleic acid may have the sequence set forth in SEQ ID NO: 4, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 4, or a fragment thereof.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Strongyloides stercoralis. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 5, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 5, or a fragment thereof.

In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Strongyloides stercoralis. The nucleic acid may have the sequence set forth in SEQ ID NO: 6, or a fragment thereof. Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 6, or a fragment thereof.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Meloidogyne arenaria. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 7, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 7, or a fragment thereof.

In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Meloidogyne arenaria. The nucleic acid may have the sequence set forth in SEQ ID NO: 8, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 8, or a fragment thereof.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Onchocerca volvulus. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 9, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 9, or a fragment thereof.

In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Onchocerca volvulus. The nucleic acid may have the sequence set forth in SEQ ID NO: 10, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 10, or a fragment thereof.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Ancylostoma ceylanicum. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 11, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 11, or a fragment thereof. In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Ancylostoma ceylanicum. The nucleic acid may have the sequence set forth in SEQ ID NO: 12, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 12, or a fragment thereof.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Brugia malayi. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 13, SEQ ID NO: 27, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 13, SEQ ID NO: 27, or a fragment thereof.

In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Brugia malayi. The nucleic acid may have the sequence set forth in SEQ ID NO: 14, SEQ ID NO: 28, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%o, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 14, SEQ ID NO: 28, or a fragment thereof.

In one embodiment, the invention provides a UDP-galactopyranose mutase (GLF) polypeptide derived from Meloidogyne hapla. The polypeptide may have the amino acid sequence set forth in SEQ ID NO: 15, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in SEQ ID NO: 15, or a fragment thereof.

In another embodiment, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Meloidogyne hapla. The nucleic acid may have the sequence set forth in SEQ ID NO: 16, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%), 75%, 80%), 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in SEQ ID NO: 16, or a fragment thereof. Non-limiting examples of free-living nematodes from which UDP-galactopyranose mutase (GLF) polypeptides (or nucleic acids encoding the same) may be derived include those of the genus Caenorhabditis (e.g. Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis japonica) and those of the genus Pristionchus (e.g. Pristionchus pacificus).

Accordingly, in certain embodiments the invention provides a UDP- galactopyranose mutase (GLF) polypeptide derived from Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis japonica, or Pristionchus pacificus. The polypeptide may have the amino acid sequence set forth in any one of SEQ ID NOs: 17, 19, 21, 23, or 25, or a fragment thereof.

Polypeptides of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 17, 19, 21, 23, or 25, or a fragment thereof.

In other embodiments, the invention provides a nucleic acid sequence encoding a UDP-galactopyranose mutase (GLF) polypeptide derived from Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis japonica, or Pristionchus pacificus. The nucleic acid may have the sequence set forth in any one of SEQ ID NOs: 18, 20, 22, 24, or 26, or a fragment thereof.

Nucleic acids of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with a nucleic acid having the sequence set forth in any one of SEQ ID NOs: 18, 20, 22, 24, or 26, or a fragment thereof.

The percentage of sequence identity between two sequences may be determined by comparing two optimally aligned sequences over a comparison window. A portion of a sequence (e.g. a polypeptide or nucleic acid of the invention) in the comparison window may, for example, comprise deletions or additions (i.e. gaps) in comparison to a reference sequence (e.g. one derived from a different nematode species) which does not comprise deletions or additions, in order to align the two sequences optimally, or vice versa. A percentage of sequence identity may then be calculated by determining the number of positions at which identical amino acid residues (or nucleotides) occur in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. In the context of two or more nucleic acid or polypeptide sequences, the percentage of sequence identity refers to the specified percentage of amino acid residues or nucleotides that are the same over a specified region (or, when not specified, over the entire sequence) when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.

For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percentage of sequence identity for the test sequence(s) relative to the reference sequence, based on the program parameters.

Methods of alignment of sequences for comparison are known in the art. Optimal alignment of sequences for determination of sequence identity can be achieved conventionally using known computer programs, including, but not limited to, CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California), the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA).

For example, the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711) uses the local homology algorithm of Smith and Waterman (see Smith and Waterman, (1981), "Advances in Applied Mathematics", 2:482-489) to find the best segment of homology between two sequences. When using BESTFIT or any other sequence alignment program to determine the degree of homology between sequences, the parameters may be set such that the percentage of identity is calculated over the full length of the reference sequence and that gaps in homology of up to 5% of the total number of nucleotides or amino acid residues in the reference sequence are allowed.

GAP uses the algorithm described in Needleman and Wunsch (see Needleman and Wunsch, (1970), "Algorithm for Sequence Similarity Searches", J. Mol. Biol. 48:443- 453), to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP presents one member of the family of best alignments.

The BLAST and BLAST 2.0 algorithms, may be used for determining percent sequence identity and sequence similarity. These are described in Altschul et ai, (1977), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nuc. Acids Res. 25:3389-3402, and Altschul et ai, (1990), "Amino acid substitution matrices from an information theoretic perspective", J. Mol. Biol. 215:403- 410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold. These initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.

The BLASTP program for amino acid sequences uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff, (1989), "Performance evaluation of amino acid substitution matrices", Proc. Natl, Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin and Altschul (1993), "Applications and statistics for multiple high-scoring segments in molecular sequences", Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a polypeptide is considered similar to a reference sequence if the smallest sum probability in a comparison of the test polypeptide to the reference polypeptide is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

In certain embodiments, a nucleic acid of the invention is less than about 2000 base pairs in length, less than about 1900 base pairs in length, less than about 1800 base pairs in length, less than about 1700 base pairs in length, less than about 1600 base pairs in length, less than about 1500 base pairs in length, less than about 1400 base pairs in length, less than about 1300 base pairs in length, less than about 1200 base pairs in length, less than about 1100 base pairs in length, or less than about 1000 base pairs in length.

In certain embodiments, a polypeptide of the invention is less than about 1000 amino acids in length, than about 900 amino acids in length, less than about 800 amino acids in length, less than about 700 amino acids in length, less than about 600 amino acids in length, less than about 500 amino acids in length, or less than about 450 amino acids in length.

A polypeptide of the invention as exemplified herein may further include one or more additional amino acids. In some embodiments, the additional amino acids may correspond to amino acids immediately upstream and/or downstream of a protein or larger polypeptide from which the exemplified polypeptide may be derived. The skilled addressee will recognise that one or more amino acids of a polypeptide of the invention as exemplified herein may be deleted without loss of activity.

Polypeptides of the invention may be modified with lipids, carbohydrates and/or phosphate groups for example, to improve immunogenicity, stability and/or solubility. Capping of polypeptide termini may be used to enhance stability against cellular proteases.

A nucleic acid of the invention as exemplified herein may further include one or more additional nucleotides. In some embodiments, the additional nucleotides may correspond to nucleotides immediately upstream and/or downstream in a genomic sequence from which the nucleic acid is derived. The skilled addressee will recognise that one or more nucleotides of a nucleic acid of the invention as exemplified herein may be deleted without loss of activity. It will be understood that "polypeptide(s) of the invention" encompass variants of those polypeptides. Similarly, it will be understood that "nucleic acid(s) of the invention" encompass variants of those nucleic acids.

The term "variant" as used herein refers to a substantially similar sequence. In general, two sequences are "substantially similar" if the two sequences have a specified percentage of amino acid residues or nucleotides that are the same (percentage of "sequence identity"), over a specified region, or, when not specified, over the entire sequence. Accordingly, a "variant" of a nucleic acid or polypeptide of the invention may share at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 83% 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98% or 99% sequence identity with the reference sequence.

In general, polypeptide variants possess qualitative biological activity in common. Nucleic acid variants generally encode polypeptides which generally possess qualitative biological activity in common. Also included within the meaning of the term "variant" are homologues of nucleic acids and polypeptides of the invention. A nucleic acid homologue is typically from a different nematode species but sharing substantially the same biological function or activity as the corresponding nucleic acid of the invention. A polypeptide homologue is typically from a different nematode species but sharing substantially the same biological function or activity as the corresponding polypeptide of the invention.

Further, the term "variant" also includes analogues of the polypeptides of the invention. A polypeptide "analogue" is a polypeptide which is a derivative of a polypeptide of the invention, which derivative comprises addition, deletion, substitution of one or more amino acids, such that the polypeptide retains substantially the same function. The term "conservative amino acid substitution" refers to a substitution or replacement of one amino acid for another amino acid with similar properties within a polypeptide chain (primary sequence of a protein). For example, the substitution of the charged amino acid glutamic acid (Glu) for the similarly charged amino acid aspartic acid (Asp) would be a conservative amino acid substitution.

It will be understood that "polypeptide(s) of the invention" encompass fragments of those polypeptides. Similarly, it will be understood that "nucleic acid(s) of the invention" encompass fragments of those nucleic acids.

A "fragment" of a polypeptide of the invention is a polypeptide that encodes a constituent or is a constituent of a polypeptide of the invention or variant thereof. Typically the fragment possesses qualitative biological activity in common with the polypeptide of which it is a constituent. Typically, the polypeptide fragment may be at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350 or 375 amino acid residues in length.

A "fragment" of a nucleic acid of the invention is a nucleic acid that encodes a constituent or is a constituent of a nucleic acid of the invention or variant thereof. Fragments of a nucleic acid do not necessarily need to encode polypeptides which retain biological activity. The fragment may, for example, be useful as a hybridization probe or PCR primer. Typically, the nucleic acid fragment may be at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, or 1400 nucleotides in length.

Polypeptides of the invention may be manufactured using methods known in the art. For example, polypeptides of the invention may be manufactured by conventional methods used in peptide chemistry synthesis such as solid phase peptide synthesis, liquid phase peptide synthesis and recombinant gene technology. It will be understood that amino acid residues of polypeptides of the invention include any and all of their isomers (e.g. D-form, L-form and DL-form).

A polypeptide of the invention may be synthesised by solid phase chemistry techniques (see, for example, Steward et al, (1 63), in "Solid Phase Peptide Synthesis", H. Freeman Co., San Francisco; Meienhofer, (1973), in "Hormonal Proteins and Peptides^'", volume 2, 46) or by classical solution synthesis (see, for example, Schroder et al, (1965), in "The Peptides", volume 1, 72-75, Academic Press (New York). In general, such methods comprise the addition of one or more amino acids or suitably protected amino acids to a growing sequential polypeptide chain on a polymer. Typically, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group. The protected and/or derivatised amino acid is then either attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected and under conditions suitable for forming the amide linkage. The protecting group may then be removed from the newly added amino acid residue and the next amino acid (suitably protected) is then added to form a growing polypeptide chain.

A polypeptide of the invention may be produced, for example, by digestion of a protein or larger polypeptide with one or more proteinases such as endoLys-C, endoArg- C, endoGlu-C and Staphylococcus V8-protease. The digested peptide fragments can be purified by, for example, high performance liquid chromatographic (HPLC) techniques.

Recombinant polypeptide production techniques will typically involve the cloning of a nucleic acid encoding a polypeptide of the invention into a plasmid for subsequent overexpression in a suitable microorganism. Suitable methods for the construction of expression vectors or plasmids are described in detail, for example, in standard texts such as Sambrook et al, (1989), "Molecular Cloning: A Laboratory Manual", (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, New York; and, Ausubel et al, (Eds), (2007), "Current Protocols in Molecular Biology", John Wiley and Sons, Inc.

Recombinant methods suitable for producing a polypeptide of the invention are described in detail, for example, in standard texts such as Coligan et al, (Eds) (2007), "Current Protocols in Protein Science", (Chapter 5), John Wiley and Sons, Inc.; and Pharmacia Biotech., (1994), "The Recombinant Protein Handbook, Pharmacia Biotech.

Commonly used expression systems that may be used for the production of a polypeptide of the invention include, for example, bacterial (e.g. E. coli), yeast (e.g. Saccharomyces cerevisiae, Aspergillus, Pichia pastorisis), viral (e.g. baculo irus and vaccinia), cellular (e.g. mammalian and insect) and cell-free systems. Suitable cell-free systems that may be used include, but are not limited to, eukaryotic rabbit reticuloctye, wheat germ extract systems, and the prokaryotic E. coli cell-free system (see, for example, Madin et al, Proc, Natl. Acad. Sci. U.S.A. 97:559-564 (2000), Pelham and Jackson, Eur. J. Biochem., 67: 247-256 (1976); Roberts and Paterson, Proc. Natl. Acad. Set, 70: 2330-2334 (1973); Zubay, Ann. Rev. Genet., 7: 267 (1973); Gold and Schweiger, Meth. Enzymol, 20: 537 (1971); Lesley et al, J. Biol. Chem., 266(4): 2632-2638 (1991); Baranov et al, Gene, 84: 463-466 (1989); and Kudlicki et al, Analyt. Biochem., 206: 389-393 (1992).

Changes to the amino acid sequence of a polypeptide of the invention (e.g. to produce a polypeptide having a specified percentage of sequence identity with a polypeptide of the invention) may be affected by standard techniques in the art. For example, amino acid changes may be affected by nucleotide replacement techniques which include the addition, deletion or substitution of nucleotides (conservative and/or non-conservative), under the proviso that the proper reading frame is maintained. Exemplary techniques include random mutagenesis, site-directed mutagenesis, oligonucleotide-mediated or polynucleotide- mediated mutagenesis, deletion of selected region(s) through the use of existing or engineered restriction enzyme sites, and the polymerase chain reaction. Testing the activity of modified polypeptides for the purposes of the invention may be via any one of a number of techniques known to those of skill in the art.

Purification of polypeptides of the invention may be achieved using standard techniques in the art such as those described in Coligan et al, (2007), "Current Protocols in Protein Science", (Chapter 6), John Wiley and Sons, Inc. For example, if the polypeptide is in a soluble state it may be isolated using standard methods such as column chromatography. Polypeptides of the invention may be genetically engineered to contain various affinity tags or carrier proteins that aid purification. For example, the use of histidine and protein tags engineered into an expression vector containing a nucleic acid encoding a polypeptide of the invention may facilitate purification by, for example, metal-chelate chromatography (MCAC) under either native or denaturing conditions. Purification may be scaled-up for large-scale production purposes.

Nucleic acids of the invention can be manufactured using standard techniques known in the art such as those described, for example, in Sambrook et al, (1989) "Molecular Cloning: A Laboratory Manual", (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, New York; Itakura K. et al, (1984), "Synthesis and use of synthetic oligonucleotides", Annu. Rev. Biochem. 53:323; Innis et al, (Eds), (1990), "PCR Protocols: A Guide to Methods and Applications", Academic Press, New York; Innis and Gelfand, (Eds), (1995), "PCR Strategies", Academic Press, New York; and Innis and Gelfand, (Eds), (1 99), "PCR Methods Manual", Academic Press, New York.

Nucleic acids of the invention may be manufactured, for example, by chemical synthesis techniques including the phosphodiester and phosphotriester methods (see, for example, Narang et al, (1979), "Improved phosphotriester method for the synthesis of gene fragments", Meth. Enzymol. 68:90; Brown et al, (1979), "Chemical Synthesis and Cloning of a Tyrosine tRNA Gene", Meth. Enzymol. 68:109-151; and U.S. Patent No. 4356270) or the diethylphosphoramidite method (see Beaucage and Caruthers, (1981), "Deoxynucleotide phosphoramidite" , Tetrahedron Letters, 22:1859-1862). A method for synthesising oligonucleotides on a modified solid support is described in U.S. Patent No. 4458066.

Nucleic acids of the invention may be deoxyribonucleic acids (DNA), ribonucleic acids (RNA) or complementary deoxyribonucleic acids (cDNA). RNA may be derived from RNA polymerase-catalyzed transcription of a DNA sequence. The RNA may be a primary transcript derived transcription of a corresponding DNA sequence. RNA may also undergo post-transcriptional processing. For example, a primary RNA transcript may undergo post-transcriptional processing to form a mature RNA. Messenger RNA (mRNA) refers to RNA derived from a corresponding open reading frame that may be translated into a protein by the cell. cDNA refers to a double-stranded DNA that is complementary to and derived from mRNA. Sense RNA refers to RNA transcript that includes the mRNA and so can be translated into a protein by the cell. Anti-sense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and may be used to block the expression of a target gene.

Those skilled in the art will recognise that RNA and cDNA sequences encoded by DNA sequences disclosed herein may be derived using the genetic code. An RNA sequence may be derived from a given DNA sequence by generating a sequence that is complementary to the particular DNA sequence. The complementary sequence may be generated by converting each cytosine ('C') base in the DNA sequence to a guanine ('G') base, each guanine ('G') base in the DNA sequence to a cytosine ('C') base, each thymidine ('Τ') base in the DNA sequence to an adenine (Ά') base, and each adenine (Ά') base in the DNA sequence to a uracil ('U') base.

A complementary DNA (cDNA) sequence may be derived from a DNA sequence by deriving an RNA sequence from the DNA sequence as above, then converting the RNA sequence into a cDNA sequence. An RNA sequence can be converted into a cDNA sequence by converting each cytosine ('C') base in the RNA sequence to a guanine ('G') base, each guanine ('G') base in the RNA sequence to a cytosine (^£C) base, each uracil ('U') base in the RNA sequence to an adenine (Ά') base, and each adenine (Ά') base in the RNA sequence to a thymidine ('Τ') base.

In particular embodiments, nucleic acids of the invention may be cloned into a vector. The vector may comprise, for example, a DNA, RNA or complementary DNA (cDNA) sequence. The vector may be a plasmid vector, a viral vector, or any other suitable vehicle adapted for the insertion of foreign sequences, their introduction into cells and the expression of the introduced sequences. Typically the vector is an expression vector and may include expression control and processing sequences such as a promoter, an enhancer, ribosome binding sites, polyadenylation signals and transcription termination sequences.

The invention also contemplates host cells transformed by such vectors. For example, nucleic acids of the invention may be cloned into a vector which is transformed into a bacterial host cell such as, for example, E. coli. Methods for the construction of vectors and their transformation into host cells are generally known in the art, and described in, for example, Sambrook et al, (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Plainview, New York; and, Ausubel et al, (Eds) (2007), "Current Protocols in Molecular Biology ", John Wiley and Sons, Inc.

Probes, primers and antibodies

In certain embodiments, the invention provides probes ("probe(s) of the invention") capable of detecting nucleic acids of the invention and/or polypeptides of the invention.

In other embodiments, the invention provides primers capable of amplifying nucleic acids of the invention and homologous sequences ("primer(s) of the invention").

Probes and primers of the invention may be in the form of oligonucleotides. Oligonucleotides are short stretches of nucleotide residues suitable for use in nucleic acid amplification reactions such as PGR, typically being at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 or 80 nucleotides in length.

Methods for the design and/or production of nucleotide probes and/or primers are generally known in the art, and are described, for example, in Sambrook et al, (1989) "Molecular Cloning: A Laboratory Manual", (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, New York; Itakura K. et al., (1984), "Synthesis and use of synthetic oligonucleotides", Annu. Rev. Biochem. 53:323; Innis et al, (Eds), (1990), "PCR Protocols: A Guide to Methods and Applications", Academic Press, New York; Innis and Gelfand, (Eds), (1995), "PCR Strategies", Academic Press, New York; and Innis and Gelfand, (Eds), (1 99), "PCR Methods Manual", Academic Press, New York.

Nucleotide probes and/or primers may be prepared, for example, by chemical synthesis techniques including the phosphodiester and phosphotriester methods (see, for example, Narang et al,, (1979), "Improved phosphotriester method for the synthesis of gene fragments", Meth. Enzymol. 68:90; Brown et al., (1979), "Chemical Synthesis and Cloning of a Tyrosine tRNA Gene", Meth. Enzymol. 68:109-151; and U.S. Patent No. 4356270) or the diethylphosphoramidite method (see Beaucage and Caruthers, (1981), "Deoxynucleotide phosphoramidite" , Tetrahedron Letters, 22:1859-1862). A method for synthesising oligonucleotides on a modified solid support is described in U.S. Patent No. 4458066.

Also provided herein are anti-sense nucleic acids ("anti-sense nucleic acid(s) of the invention") capable of reducing or inhibiting the production of polypeptides of the invention. Anti-sense nucleic acids of the invention may be capable of hybridising to a portion of an RNA precursor (generally mRNA) of a polypeptide of the invention by virtue of some sequence complementarity, and generally under biological conditions. The anti-sense nucleic acid may be complementary to a coding and/or non-coding region of the RNA precursor of a polypeptide of the invention.

In certain embodiments, anti-sense nucleic acids of the invention are anti-sense RNA molecules.

Anti-sense nucleic acids of the invention may be of at least five nucleotides in length and are generally oligonucleotides which range in length from 5 to about 200 nucleotides. For example, an anti-sense oligonucleotide of the invention may be at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175 or 200 nucleotides. The oligonucleotides may be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof. The oligonucleotides may be single-stranded or double-stranded. In certain embodiments, the oligonucleotides are small interfering RNA (siRNA) molecules.

An anti-sense nucleic acid of the invention may be modified at any position on its structure using substituents generally known in the art. For example, the anti-sense nucleic acid may include at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5- iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, 2,2-dimethylguanine, 2-methyl- adenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5 '-methoxycarboxymethyluracil, pseudouracil, 2-thiocytosine, 5- methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), queosine, wybutoxosine, 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine.

An anti-sense nucleic acid of the invention may include at least one modified sugar moiety, such as arabinose, 2-fluoroarabinose, xylulose, and hexose. The anti-sense nucleic acid may also include at least one modified phosphate backbone selected from a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analogue thereof. The anti-sense nucleic acid may be conjugated to another molecule, such as a peptide, hybridisation triggered cross-linking agent, transport agent or a hybridisation- triggered cleavage agent.

Suitable anti-sense nucleic acids can be manufactured by chemical synthesis (e.g. using an on automated synthesiser) or, in the case of anti-sense RNA, by transcription in vitro or in vivo when linked to a promoter, by methods known in the art. Expression vectors (e.g. retroviral expression vectors) that may be used to generate anti-sense RNA capable of hybridising to a portion of an RNA precursor (generally mRNA) encoding a polypeptide of the invention are known in the art (see, for example, US patent no. 4868116 and US patent no. 4980286).

In other embodiments, anti-sense nucleic acids of the invention are double-stranded RNA (dsRNA) molecules comprising one strand capable of hybridising to a portion of an RNA precursor (generally mRNA) encoding a polypeptide of the invention. The strand capable of hybridising to a portion of an RNA precursor encoding a polypeptide of the invention will, in general, have sufficient sequence complementarity to the RNA precursor to mediate target-specific RNA interference (RNAi). Accordingly, the second (non-hybridising) strand of the dsRNA molecule will have at least about 50%, 60%, 70%, 75%, 80%, 85%o, or 95% sequence identity to an RNA precursor encoding a polypeptide of the invention. Preferably, the sequence identity is at least 85% and most preferably 100%.

In applications involving RNA interference, the length of a dsRNA molecule provided herein may be 19-25 nucleotides in length, and more preferably 20-22 nucleotides in length. In certain embodiments, at least one strand has a 3 '-overhang of 1-5 nucleotides, more preferably 1-3 nucleotides and most preferably 2 nucleotides. The second strand may be blunt-ended or have up to 6 nucleotides 3' overhang.

Methods of synthesizing RNA molecules are known in the art and are described, for example, in Verma and Eckstein, (1998), "Modified oligonucleotides: synthesis and strategy for users", Annu Rev Biochem., 67:99-134. Single-stranded RNAs for annealing into dsRNA molecules can also be prepared by enzymatic transcription from DNA plasmids isolated from recombinant bacteria or from synthetic DNA templates.

The invention also provides antibodies ("antibody(s) of the invention") that "bind specifically" to polypeptides of the invention.

An antibody that "binds specifically" to a polypeptide of the invention is one capable of binding to a polypeptide of the invention with a significantly higher affinity than it binds to an unrelated molecule (e.g. a non-target polypeptide). Accordingly, an antibody that binds specifically to a polypeptide of the invention is an antibody with the capacity to discriminate between that polypeptide and any other number of potential alternative binding partners. Hence, when exposed to a plurality of different but equally accessible molecules as potential binding partners, an antibody specific for a polypeptide of the invention will selectively bind to that polypeptide and other alternative potential binding partners will remain substantially unbound by the antibody. In general, an antibody specific for a polypeptide of the invention will preferentially bind to that polypeptide at least 10-fold, preferably 50-fold, more preferably 100-fold, and most preferably greater than 100-fold more frequently than other potential binding partners that are not target polypeptides. An antibody specific for a polypeptide of the invention may be capable of binding to other non-target molecules at a weak, yet detectable level. This is commonly known as background binding and is readily discernible from polypeptide- specific binding, for example, by use of an appropriate control.

Reaction conditions (e.g. concentration of antibody, incubation time, H, temperature etc) to facilitate binding of antibodies to polypeptides of the invention will depend primarily on the antibody utilised and the specific target polypeptide, and may be readily determined using methods known in the art (see, for example, Ausubel et ah, (1994), "Current Protocols in Molecular Biology", Vol. 1, John Wiley & Sons, Inc., New York; Coligan et ah, (Eds), (2008), "Current protocols in Immunology", John Wiley and Sons, Inc.; and Bonifacino et ah, (Eds) (2007), "Current protocols in Cell Biology", John Wiley and Sons, Inc.).

An antibody that binds specifically to a polypeptide of the invention can be generated using methods known in the art.

For example, a monoclonal antibody specific for a polypeptide of the invention, typically containing Fab portions, may be prepared using the hybridoma technology described in Harlow and Lane (eds.), (1988), "Antibodies-A Laboratory Manual", Cold Spring Harbor Laboratory, N.Y.

In essence, in the preparation of monoclonal antibodies directed toward a polypeptide of the invention, any technique that provides for the production of antibodies by continuous cell lines in culture may be used. These include the hybridoma technique originally developed by Kohler and colleagues (see Kohler et ah, (1975), "Continuous cultures of fused cells secreting antibody of predefined specificity", Nature, 256:495-497) as well as the trioma technique, the human B-cell hybridoma technique (see Kozbor et ah, (1983), "The Production of Monoclonal Antibodies From Human Lymphocytes ", Immunology Today, 4:72-79), and the EBV-hybridoma technique to produce human monoclonal antibodies (see Cole et ah, (1985), in "Monoclonal Antibodies and Cancer Therapy ", Π-96, Alan R. Liss, Inc.). Immortal, antibody-producing cell lines can be created by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus (see, for example, Schreier et al, (1980), "Hybridoma Techniques", Cold Spring Harbor Laboratory; Hammerling et ah, (1981), "Monoclonal Antibodies and T-cell Hybridomas" , Elsevier/North-Holland Biochemical Press, Amsterdam; and Kennett et ah, (1980), "Monoclonal Antibodies",. Plenum Press).

In summary, generating a hybridoma from which the monoclonal antibody is produced typically involves fusing a myeloma or other self-perpetuating cell line with lymphocytes obtained from the spleen of a mammal hyperimmunised with a recognition factor-binding portion thereof, or recognition factor, or an origin-specific DNA-binding portion thereof. Hybridomas producing a monoclonal antibody specific for a polypeptide of the invention are identified by their ability to immunoreact with the antigens present in that polypeptide.

A monoclonal antibody that binds specifically to a polypeptide of the invention can be produced by initiating a monoclonal hybridoma culture comprising a nutrient medium containing a hybridoma that secretes antibodies of the appropriate antigen specificity. The culture is maintained under conditions and for a time period sufficient for the hybridoma to secrete the antibody molecules into the medium. The antibody-containing medium is then collected. The antibody molecules can then be further isolated using known techniques.

Similarly, there are various procedures known in the art which may be used for the production of polyclonal antibodies. For the production of polyclonal antibodies against a polypeptide of the invention, various host animals can be immunized by injection with the polypeptide, including, but not limited to, rabbits, chickens, mice, rats, sheep, goats and the like. Further, the polypeptide can be conjugated to an immunogenic carrier (e.g. bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH)). Also, various adjuvants may be used to increase the immunological response, including, but not limited to, Freund's (complete and incomplete), mineral gels such as aluminium hydroxide, surface active substances such as rysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Screening for the desired antibody can also be accomplished by a variety of techniques known in the art. Suitable assays for immunospecific binding of antibodies include, but are not limited to, radioimmunoassays, ELISAs (enzyme-linked immunosorbent assay), sandwich immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays, Western blots, precipitation reactions, agglutination assays, complement fixation assays, immunofluorescence assays, protein A assays, Immunoelectrophoresis assays, and the like (see, for example, Ausubel et al, (1994), "Current Protocols in Molecular Biology", Vol. 1, John Wiley & Sons, Inc., New York). Antibody binding may be detected by virtue of a detectable label on the primary antibody. Alternatively, the antibody may be detected by virtue of its binding with a secondary antibody or reagent which is appropriately labelled. A variety of methods for detecting binding events in an immunoassay are known in the art, and are included in the scope of the invention.

In terms of obtaining a suitable amount of an antibody of the invention, one may manufacture the antibodies using batch fermentation with serum free medium. After fermentation the antibody may be purified via a multistep procedure incorporating chromatography and viral inactivation/removal steps. For instance, the antibody may be first separated by Protein A affinity chromatography and then treated with solvent/detergent to inactivate any lipid enveloped viruses. Further purification, typically by anion and cation exchange chromatography, may be used to remove residual proteins, solvents/detergents and nucleic acids. The purified antibody may be further purified and formulated into 0.9% saline using gel filtration columns. The formulated bulk preparation may then be sterilised and viral filtered and dispensed.

Identification of anthelmintic agents

The present inventors have identified that UDP-galactopyranose mutase (GLF) is expressed in a number of different parasitic nematodes and is essential for their survival. UDP-galactopyranose mutase (GLF) therefore represents a novel target for controlling nematode infections in animals and plants in which the enzyme it is not expressed. The identification of UDP-galactopyranose mutase (GLF) as a nematode-specific target has facilitated the development of screening methods for identifying novel anthelmintic agents. Nucleic acids and polypeptides of the invention may be used for screening candidate agents to identify anthelmintic agents capable of inhibiting UDP- galactopyranose mutase (GLF) expression or function.

Accordingly, in one embodiment the invention provides a method of screening for an anthelmintic agent comprising contacting a nucleic acid encoding a UDP- galactopyranose mutase (GLF) derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between the candidate agent and nucleic acid, and measuring production of the encoded UDP-galactopyranose mutase (GLF).

In another embodiment the invention provides a method of screening for an anthelmintic agent comprising contacting a nucleic acid encoding a UDP-galactopyranose mutase (GLF) derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between the candidate agent and nucleic acid, and assaying for activity of the encoded UDP-galactopyranose mutase (GLF).

In another embodiment the invention provides a method of screening for an anthelmintic agent comprising contacting a UDP-galactopyranose mutase (GLF) derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between the candidate agent and the enzyme, and measuring activity of the UDP- galactopyranose mutase (GLF).

It will be understood that "binding" of a candidate agent to a polypeptide or nucleic acid of the invention encompasses direct binding, indirect binding (e.g. via one or more intermediary molecules), partial binding, complete binding, transient/temporary binding and stable/enduring binding.

In particular, desirable agents are candidate agents that are capable of binding to polypeptides and/or polynucleotides of the invention and modulating their activity. Such agents may exert a modulatory effect by inhibiting or preventing expression or activity of polypeptides and/or polynucleotides of the invention. This in turn results in nematode death and hence a means of controlling nematode infection.

Accordingly, a candidate agent identified to be capable of binding or otherwise interacting with a nucleic acid and/or polypeptide of the invention and inhibiting UDP- galactopyranose mutase (GLF) expression and/or function is likely to be an effective anthelmintic agent.

Screening methods of the invention involve contacting a candidate agent with a nucleic acid or polypeptide of the invention derived from a parasitic nematode. The parasitic nematode may be any parasitic nematode capable of infecting an animal and/or a plant.

In certain embodiments the parasitic nematode is derived from the class Secernentea. For example, the parasitic nematode may be of the order Strongylida, Tylenchida, Rhabditida or Spirurida. Specific examples of such nematodes include, but are not limited to, Haemonchus contortus, Heterodera glycines, Strongyloides stercoralis, Meloidogyne arenaria, Onchocerca volvulus, Ancylostoma ceylanicum, Brugia malayi and Meloidogyne hapla. In one embodiment, the nematode is Haemonchus contortus.

In one embodiment, the UDP-galactopyranose mutase (GLF) comprises the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In certain embodiments, the UDP-galactopyranose mutase (GLF) is derived from Haemonchus contortus and comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In one embodiment, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising the sequence set forth in of SEQ ID NO: 2.

In certain embodiments, the UDP-galactopyranose mutase (GLF) is derived from Haemonchus contortus and is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In some embodiments, the UDP-galactopyranose mutase (GLF) comprises the amino acid sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, or 27, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, or 27, or a fragment thereof.

In some embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 28, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 28, or a fragment thereof. Candidate agents for use in the screening methods of the invention may be derived from any source.

For example, the candidate agent may be naturally occurring or synthetic.

Potential candidate agents may be generated for screening in the methods of the invention by a number of techniques known to those skilled in the art. For example, methods such as X-ray crystallography and nuclear magnetic resonance spectroscopy may be used to model the structure of a polypeptide or nucleic acid of the invention, thus facilitating the design of potential modulating agents using computer-based modeling. Various forms of combinatorial chemistry may also be used to generate putative anthelmintic agents.

A candidate agent may be of any molecular weight, for example, at least about 100, 200, 300, 400, 500, 750, 1000, 2000, 3000, 4000, 5000, 7000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, or 100000 daltons.

A candidate agent can be any chemical compound, non-limiting examples of which include amino acids, nucleic acids, peptide nucleic acids, lipids, polypeptides, carbohydrates, and nucleosides other non-limiting examples include, peptidomimetics (e.g., peptoids), amino acid analogues, polynucleotides, polynucleotide analogues, nucleotides, nucleotide analogues, metabolites, metabolic analogues, and organic or inorganic compounds (including heteroorganic and organometallic compounds).

In certain embodiments high-throughput methods are used to screen large libraries of chemicals. Such libraries of candidate compounds can be generated or purchased from commercial sources. For example, a library can include 10,000, 50,000, or 100,000 or more unique compounds. By way of example only, a library may be constructed from heterocycles including benzimidazoles, benzothiazoles, benzoxazoles, furans, imidazoles, indoles, morpholines, naphthalenes, piperidines, pyrazoles, pyridines, pyrimidines, pyrrolidines, pyrroles, quinolines, thiazoles, thiphenes, and triazines. A library may comprise one or more classes of chemicals, for example, those described in Carrell et al, (1994), Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al, (1994), Angew. Chem. Int. Ed. Engl. 33:2061; Cho et al, (1993), Science 261 :1303-1305; DeWitt et al, (1993), Proc. Natl. Acad. Sci. U.S.A. 90:6909-6913; Erb et al, (1994), Proc. Natl. Acad. Sci. USA 91:11422-11426; Gallop et al, (1994), J. Med. Chem. 37:1233-1251; and Zuckermann et al, (1994), J. Med. Chem. 37:2678-2685. Screening methods of the invention involve contacting the candidate agent with UDP-galactopyranose mutase (GLF) (a polypeptide of the invention) or a nucleic acid encoding UDP-galactopyranose mutase (GLF) (a nucleic acid of the invention).

Agents which bind, or otherwise interact with polypeptides and/or polynucleotides of the invention, and specifically agents which modulate their activity, may be identified by a variety of suitable methods. Non limiting methods include the two-hybrid method, co-immunoprecipitation., affinity purification, mass spectroscopy, tandem affinity purification, phage display, label transfer, DNA microarrays/gene coexpression and protein microarrays.

For example, a two-hybrid assay may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with a polypeptide of the invention. The yeast two-hybrid assay system is a yeast-based genetic assay typically used for detecting protein-protein interactions (see, for example, Fields and Song, (1 89), Nature, 340: 245-246). The assay makes use of the multi-domain nature of transcriptional activators. For example, the DNA-binding domain of a known transcriptional activator may be fused to a polypeptide of the invention and the activation domain of the transcriptional activator fused to the candidate agent. Interaction between the candidate agent and the polypeptide of the invention will bring the DNA-binding and activation domains of the transcriptional activator into close proximity. Subsequent transcription of a specific reporter gene activated by the transcriptional activator allows the detection of an interaction.

In a modification of the technique above, a fusion protein may be constructed by fusing a polypeptide of the invention to a detectable tag (e.g. alkaline phosphatase) and using a modified form of immunoprecipitation as described by Flanagan and Leder (Flanagan and Leder, (1990), Cell, 63:185-194)

Additionally or alternatively, co-immunoprecipitation may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with a polypeptide of the invention. Using this technique, parasitic nematodes expressing UDP- galactopyranose mutase (GLF) may be lysed under non-denaturing conditions suitable for the preservation of protein-protein interactions. The resulting solution can then be incubated with an antibody specific for a polypeptide of the invention and immunoprecipitated from the bulk solution, for example, by capture with an antibody- binding protein attached to a solid support. Immunoprecipitation of a polypeptide of the invention by this method facilitates the co-immunoprecipitation of an agent associated with that protein. The identification an associated agent can be established using a number of methods known in the art, including but not limited to SDS-PAGE, western blotting, and mass spectrometry.

Additionally or alternatively, the phage display method may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with a polypeptide of the invention. Phage display is a test to screen for protein interactions by integrating multiple genes from a gene bank into phage. Under this method, recombinant DNA techniques are used to express numerous genes as fusions with the coat protein of a bacteriophage such that the polypeptide product of each gene is displayed on the surface of the viral particle. A whole library of phage-displayed polypeptide products of interest can be produced in this way. The resulting libraries of phage-displayed polypeptide products may then be screened for the ability to bind to a polypeptide of the invention. DNA extracted from interacting phage contains the sequences of interacting polypeptides

Additionally or alternatively, affinity chromatography may be used to determine whether a candidate agent or plurality of candidate agents interacts or binds with a polypeptide of the invention. For example, a polypeptide of the invention may be immobilised on a support (such as sepharose) and cell lysates passed over the column. Proteins binding to an immobilised polypeptide of the invention may then be eluted from the column and identified, for example by N-terminal amino acid sequencing.

Agents which bind, or otherwise interact with the nucleic acids of the invention, and specifically agents which modulate their activity may be identified by a variety of methods known in the art, non-limiting examples of which include electrophoresis, gel shift assays, surface plasmon resonance ATPase assays, circular dichroism, mass spectroscopy, and nuclear magnetic resonance. A specific example of a screening assay for the detection of DNA-binding molecules is described in US patent no. 5726014.

Polypeptides and nucleic acids of the invention can be used in high-throughput screens to assay candidate agents for the ability to bind to, or otherwise interact therewith. These candidate compounds can be further screened against functional polypeptides to determine the effect of the agent on polypeptide activity.

The present invention also contemplates compounds which may exert their modulatory effect on polypeptides of the invention by altering expression of the polypeptide. In this case, such compounds may be identified by comparing the level of expression of the polypeptide in the presence of a candidate compound with the level of expression in the absence of the candidate compound. The enzymatic activity of UDP-galactopyranose mutase (GLF) upon exposure to a candidate agent may be assessed using methods known in the art.

For example, UDP-galactopyranose mutase (GLF) may be assessed using an assay for detecting the conversion of UDP-galactopyranose into UDP-galactofuranose by HPLC (see, for example, methods described in Scherman et al, (2003), "Galactofuranose metabolism: a potential target for antimicrobial chemotherapy", Antimicrobial Agents and Chemotherapy 47:378-382; Nassau et al., (1996), "Galactofuranose biosynthesis in Escherichia coli K-12: identification and cloning of UDP-galactopyranose mutase";, J. Bacteriol. 178:1047-1052; and Lee et al, (1996), "Enzymatic synthesis of UDP- galactofuranose and an assay for UDP-galactopyranose mutase based on high- performance liquid chromatography" , Anal. Biochem. 242:1-7).

The production of UDP-galactopyranose mutase (GLF) enzymes upon exposure to a candidate agent can be measured, in general, using any technique capable of detecting and/or quantifying proteins. Suitable methods are known in the art and include, for example, immunohistochemistry, SDS-PAGE, immunoassays, proteomics and the like.

In certain embodiments, agents which bind, or otherwise interact with polypeptides and nucleic acids of the invention, and specifically agents which modulate their activity, may be identified using nematode-based assays. For example, parasitic nematodes expressing UDP-galactopyranose mutase (GLF) may be grown on suitable media in different wells of a plate, each well comprising a different candidate agent. Nematode growth, motility, reproductive capacity (i.e. fecundity) and viability can then be determined and monitored over a suitable period of time using standard techniques such as those described in the "Examples" section of the present specification. Typically, such methods may involve visual inspection (e.g. characterisation and and/or counting of nematodes by microscopy).

It will be appreciated that the methods described above are merely examples of the types of methods that may be utilised to identify agents that are capable of interacting with, or modulating the activity of polypeptides and nucleic acids of the invention. Other suitable methods will be known by persons skilled in the art and are within the scope of the invention.

Using the methods described above, an agent may be identified that is antagonist of a polypeptide or nucleic acid of the invention. Agents which are antagonists retard one or more of the biological activities of the polypeptide or nucleic acid. Antibodies may act as antagonists of a polypeptide of the invention. Preferably suitable antibodies are prepared from discrete regions or fragments of the polypeptides of the invention. An antigenic portion of a polypeptide of the invention may be of any appropriate length, such as from about 5 to about 15 amino acids. Preferably, an antigenic portion contains at least about 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 amino acid residues.

Methods for the generation of antibodies are known in the art and are described in the section above entitled "Probes, primers and antibodies".

The disruption of glf expression in nematodes is demonstrated herein to induce cuticle permeability, a phenotype that is detrimental to the viability and growth of the organism. For example, in addition to direct effects such as loss of water/solutes to the environment and exposure to environmental solutes (e.g anthelmintic agents) it is postulated that an increased potential exists for host immune cells to recognise and respond to parasite antigens to which they are not normally exposed.

Accordingly, certain embodiments of the invention relate to methods of screening for anthelmintic agents comprising the steps of administering a candidate agent to a nematode and determining whether cuticle permeability is induced by the agent. In general, the detection of cuticle permeability in nematodes treated with a given candidate agent is indicative that the agent may be an effective anthelmintic drug or an 'adjuvant' to an anthelmintic drug.

Potential candidate agents may be generated for use in the screening methods by a number of techniques known to those skilled in the art, examples of which are described above.

Candidate agents may be administered to the nematode using standard techniques. For example, free-living or parasitic nematodes may be exposed in vitro in liquid-phase or solid-phase (e.g. agar, agarose) culture conditions to candidate agents in, for example, multiple-well microtitre plates. After a suitable exposure time, nematodes to which the candidate agent has been administered may be analysed for cuticle permeability. The level of cuticle permeability in treated nematodes may be compared to that of control nematodes to which the candidate agent was not administered. For example, cuticle permeability may be determined by soaking nematodes in a non-permeant DNA-binding fluorescent dye (e.g. Hoechst 33258) for a suitable time, washing appropriately, and then scanning the nematodes under UV light to reveal worms with fluorescent nuclei. In the case of assays utilising microtitre plates, scanning may be performed using a suitable microtitre plate reader or flow cytometer at UV wavelengths. The skilled addressee will recognize that the methods of administering candidate agents and analysing cuticle permeability described above are exemplary only and hence that other suitable methods known in the art may be utilized for these purposes.

Prevention and treatment of nematode infection

The present inventors have identified that a number of different parasitic nematodes express UDP-galactopyranose mutase (GLF). As demonstrated herein, UDP- galactopyranose mutase (GLF) is essential for the survival of the parasitic nematodes and thus represents a novel target for controlling nematode infections in animals and plants.

In certain embodiments, the invention provides methods for inhibiting the growth, reproduction or motility of a parasitic nematode. The method comprises inhibiting the expression and/or function of UDP-galactopyranose mutase (GLF) in the nematode.

In other embodiments, the invention provides methods for preventing or treating a parasitic nematode infection in a subject. The method comprises administering to the subject an agent that inhibits UDP-galactopyranose mutase expression or function in said nematode.

A parasitic nematode in accordance with the methods above may be any parasitic nematode capable of infecting an animal and/or a plant.

In certain embodiments the parasitic nematode is derived from the class Secernentea. For example, the parasitic nematode may be of the order Strongylida, Tylenchida, Rhabditida or Spirurida. Specific examples of such nematodes include, but are not limited to, Haemonchus contortus, Heterodera glycines, Strongyloides stercoralis, Meloidogyne arenaria, Onchocerca volvulus, Ancylostoma ceylanicum, Brugia malayi and Meloidogyne hapla. In one embodiment, the nematode is Haemonchus contortus.

A UDP-galactopyranose mutase (GLF) in accordance with the methods above may correspond to a polypeptide of the invention.

In some embodiments, the UDP-galactopyranose mutase (GLF) comprises the amino acid sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15 or 27, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%), 90%, or 95%o sequence identity with the sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15 or 27, or a fragment thereof. A UDP-galactopyranose mutase (GLF) in accordance with the methods above may be encoded by a nucleic acid of the invention.

In some embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising the sequence set forth in any one of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16 or 28, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in any one of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16 or 28, or a fragment thereof.

In one embodiment, the parasitic nematode is Haemonchus contortus and the UDP- galactopyranose mutase (GLF) comprises the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In certain embodiments, the parasitic nematode is Haemonchus contortus and the UDP-galactopyranose mutase (GLF) comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In one embodiment, the parasitic nematode is Haemonchus contortus and the UDP- galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In certain embodiments, the parasitic nematode is Haemonchus contortus and the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In accordance with the methods of the invention, inhibiting UDP-galactopyranose mutase (GLF) expression encompasses any means by which the expression of a gene encoding UDP-galactopyranose mutase (GLF) is eliminated or reduced.

For example, UDP-galactopyranose mutase (GLF) expression may be inhibited by reducing or eliminating transcription of a gene encoding UDP-galactopyranose mutase (GLF). Levels of gene transcription can be measured by any technique known in the art, including, for example, by transcription quantitative polymerase chain reaction (RT- PCR).

Additionally or alternatively, UDP-galactopyranose mutase (GLF) expression may be inhibited by reducing or eliminating the translation of transcribed gene product(s) into the protein. A change in the level of translated UDP-galactopyranose mutase (GLF) gene products can be measured, using any technique capable of detecting and/or quantifying proteins. Suitable methods are known in the art, and include, for example, immunohistochemistry, SDS-PAGE, immunoassays, proteomics and the like.

UDP-galactopyranose mutase (GLF) expression may be inhibited using any suitable agent.

For example, UDP-galactopyranose mutase (GLF) expression may be inhibited using an anthelmintic agent identified in accordance with the screening methods of the invention (see section above entitled "Identification of anthelmintic agents").

In certain embodiments, UDP-galactopyranose mutase (GLF) expression is inhibited using an anti-sense nucleic acid of the invention to block the translation of GLF polypeptides from RNA transcripts.

For example, anti-sense oligonucleotides, typically of 18-30 nucleotides in length (although longer or shorter length oligonucleotides are also contemplated) may be generated which are at least substantially complementary across their length to a region of the UDP-galactopyranose mutase (GLF) a nucleic acid sequence of interest. Binding of the anti-sense oligonucleotide to a cellular nucleic acid comprising a complementary sequence may interfere with transcription, RNA processing, transport, translation and/or mRNA stability. Suitable anti-sense oligonucleotides may be prepared by methods well known to those of skill in the art and may be designed to target and bind to regulatory regions of the UDP-galactopyranose mutase (GLF) nucleotide sequence, or, to coding (gene) or non-coding (intergenic region) sequences. Suitable anti-sense oligonucleotides may include modifications designed to improve their delivery into cells, their stability once inside a cell, and/or their binding to the appropriate target. For example, the anti- sense oligonucleotide may be modified by the addition of one or more phosphorothioate linkages, or the inclusion of one or morpholine rings into the backbone (so-called 'morpholino' oligonucleotides).

A further means of inhibiting UDP-galactopyranose mutase (GLF) expression in a parasitic nematode may be achieved by introducing catalytic anti-sense nucleic acid constructs, such as ribozymes, which are capable of cleaving mRNA transcripts and thereby preventing the production of wild type protein. Ribozymes are targeted to and anneal with a particular sequence by virtue of two regions of sequence complementarity to the target flanking the ribozyme catalytic site. After binding the ribozyme cleaves the target in a site-specific manner. The design and testing of ribozymes which specifically recognise and cleave sequences of interest can be achieved using techniques well known to those in the art (see for example Lieber and Strauss, (1995), "Molecular and Cellular Biology", 15:540-551.

In certain embodiments, RNA interference (RNAi) may be used to inhibit the expression of UDP-galactopyranose mutase (GLF). RNAi refers to a means of selective post-transcriptional gene silencing by destruction of specific mRNA by small interfering RNA molecules (siRNA). The siRNA is generated by cleavage of double stranded RNA, where one strand is identical to the message to be inactivated. RNAi techniques and methods for the synthesis of suitable molecules for use in RNAi and for achieving post- transcriptional gene silencing are known in the art (see, for example, Chuang et al,

(2000) , Proc Natl Acad Sci USA 97: 4985-4990; Fire et al, (1998), Nature 391 : 806-811 ; Hammond et al, (2001), Nature Rev, Genet. 2: 110-1119; Hammond et al, (2000), Nature, 404: 293-296; Bernstein et al, (2001), Nature, 409: 363-366; Elbashir et al,

(2001) , Nature, 411 : 494-498; PCT publication no. WO 1999/32619; PCT publication no. WO 1999/49029; PCT publication no. WO 2001/29058; and WO 2001/70949).

Double-stranded RNA molecules may be synthesised in vitro in which one strand is identical to a specific region of the UDP-galactopyranose mutase (GLF) transcript of interest and then introduced into the cells of the parasitic nematode.

Additionally or alternatively corresponding dsDNA can be employed, which, once presented intracellularly is converted into dsRNA. Double-stranded RNA expressing constructs may be introduced into a host using a replicable vector that remains episomal or integrates into the genome. By selecting appropriate sequences, expression of dsRNA can interfere with accumulation of endogenous mRNA encoding UDP-galactopyranose mutase (GLF),

In accordance with the methods of the invention, inhibiting UDP-galactopyranose mutase (GLF) function encompasses any means by which the normal activity of a UDP- galactopyranose mutase (GLF) enzyme expressed in a parasitic nematode is eliminated or reduced.

The enzymatic activity of UDP-galactopyranose mutase (GLF) may be assessed using methods known in the art.

For example, UDP-galactopyranose mutase (GLF) may be assessed using an assay for detecting the conversion of UDP-galactopyranose into UDP-galactofuranose by HPLC (see, for example, Scherman et al, (2003), Galactofuranose metabolism: a potential target for antimicrobial chemotherapy", Antimicrobial Agents and Chemotherapy 47:378-382; Nassau et ah, (1996), "Galactofuranose biosynthesis in Escherichia coli K- 12: identification and cloning of UDP-galactopyranose mutase", J. Bacteriol. 178:1047- 1052; and Lee et ah, (1996), "Enzymatic synthesis of UDP-galactofuranose and an assay or UDP-galactopyranose mutase based on high-performance liquid chromatography^'", Anal. Biochem. 242:1-7).

UDP-galactopyranose mutase (GLF) function may be inhibited using any suitable agent.

For example, UDP-galactopyranose mutase (GLF) function may be inhibited using an anthelmintic agent identified in accordance with the screening methods of the invention (see section above entitled "Identification of anthelmintic agents").

Additionally or alternatively, UDP-galactopyranose mutase (GLF) function may be inhibited by administering one or more antibodies of the invention. Antibodies of the invention bind specifically to UDP-galactopyranose mutase (GLF) derived from nematodes and hence may be utilised to prevent or hinder interactions of GLFs with other biological molecules.

In certain embodiments, the antibody binds specifically to a UDP-galactopyranose mutase (GLF) comprising the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In certain embodiments, the antibody binds specifically to a UDP-galactopyranose mutase (GLF) sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In some embodiments, the invention provides a method for preventing or treating Haemonchus contortus infection in a subject. The method comprises administering to the subject an agent that inhibits UDP-galactopyranose mutase expression or function in the nematode.

In other embodiments, the invention provides methods for inhibiting the growth, reproduction and/or motility of Haemonchus contortus by inhibiting UDP- galactopyranose mutase (GLF) expression and/or function in the nematode.

The expression and/or function of UDP-galactopyranose mutase (GLF) in Haemonchus contortus may be inhibited using any suitable agent.

In certain embodiments, RNA interference (RNAi) is used to inhibit UDP- galactopyranose mutase (GLF) expression and/or function in Haemonchus contortus. UDP-galactopyranose mutase (GLF) expression and/or function may be inhibited in Haemonchus contortus by administering one or more anti-sense nucleic acid(s) of the invention (e.g a dsRNA).

In certain embodiments, the anti-sense nucleic acid is a dsRNA molecule. Preferably, the dsRNA is an siRNA (e.g. a mixture of siRNAs generated by in vivo or in vitro Dicer or RNAse III cleavage of a long dsRNA).

Suitable dsRNA molecules include those comprising a strand that is complementary or substantially complementary to a UDP-galactopyranose mutase (GLF) mRNA molecule produced by Haemonchus contortus, or a fragment thereof. A strand that is "substantially complementary" to an mRNA molecule or a fragment of an mRNA molecule will have sufficient sequence complementarity to bind to the mRNA/mRNA fragment under normal biological conditions.

The dsRNA molecule may comprise a strand that is complementary or substantially complementary to any fragment of an mRNA molecule encoding Haemonchus contortus UDP-galactopyranose mutase (GLF). Preferably, the fragment is at least 5 nucleotides in length, more preferably at least 10 nucleotides in length, and still more preferably 15-25 nucleotides in length.

In certain embodiments, the dsRNA molecule comprises a strand that is complementary or substantially complementary to a fragment of an mRNA molecule having the nucleotide sequence set forth in SEQ ID NO: 29. The fragment of the mRNA molecule may be defined by residues 119-1345 of the sequence set forth in SEQ ID NO:

29, or a fragment thereof.

In one embodiment, the dsRNA molecule comprises a strand comprising the nucleotide sequence set forth in SEQ ID NO: 30, or a fragment thereof.

In certain embodiments, the dsRNA molecule comprises a strand comprising a nucleotide sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO:

30, or a fragment thereof.

UDP-galactopyranose mutase (GLF) in Haemonchus contortus may be inhibited by administering one or more antibodies of the invention.

The antibody may bind specifically to a UDP-galactopyranose mutase (GLF) comprising the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof. The antibody binds specifically to a UDP-galactopyranose mutase (GLF) sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

As described above, methods of the invention may be utilised for inhibiting the growth, reproduction and/or motility of parasitic nematodes. Nematode growth, motility and reproductive capacity (i.e. fecundity) can be determined and monitored using standard techniques in the art such as those described in the "Examples" section of the present specification. Typically, such methods may involve visual inspection (e.g. characterisation and/or counting of nematodes by microscopy).

As described above, methods of the invention may be utilised to prevent or treat a parasitic nematode infection in a subject. A subject treated in accordance with the methods of the invention may be any plant or animal susceptible to infection by a parasitic nematode. For example, the subject may be an individual of any mammalian species including, but not limited to, members of the genus ovine (e.g. sheep), bovine, equine, porcine, feline, canine, primates (e.g. humans), and rodents. Alternatively, the subject may be an individual of any plant species including, but not limited to, Solanum lycopersicum, Glycine max, Cicer arietinum, Triticum spp., Oryza sativa, Musa spp., Zea mays, Solanum tuberosum, Vitis vinifera, Saccharum spp.

The agent may be administered to the subject (e.g. a human subject) by any suitable route including, but not limited to, the parenteral (e.g. intravenous, intradermal, subcutaneous or intramuscular), enteral (e.g. oral or intrarumenal), mucosal (e.g. buccal or intranasal) or topical route.

In alternative embodiments, the invention provides use of an agent that inhibits UDP-galactopyranose mutase expression or function in a nematode for the preparation of a medicament for treating or preventing nematode infection. Also provided is use of an agent that inhibits UDP-galactopyranose mutase expression or function in a nematode for treating or preventing nematode infection. The agent may be any agent capable of inhibiting UDP-galactopyranose mutase expression or function in a nematode including, but not limited to, any one or more of those referred to in the section entitled "Prevention and treatment of nematode infection". Increasing sensitivity to anthelmintic drugs

The inhibition of GLF expression in nematodes is demonstrated herein to induce cuticle permeability which in turn increases the sensitivity of nematodes to anthelmintic agents.

Accordingly, in one embodiment the invention provides a method for increasing the sensitivity of a nematode to one or more anthelmintic drugs. The method comprises inhibiting UDP-galactopyranose mutase (GLF) expression or function in said nematode.

The nematode may be any nematode that expresses UDP-galactopyranose mutase (GLF).

The nematode may be a free living nematode. In certain embodiments the parasitic nematode is derived from the class Secernentea. Specific examples of such nematodes include, but are not limited to, Caenorhabditis elegans, Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis japonica, Pristionchus pacificus.

The nematode may be a parasitic nematode. The parasitic nematode may infect plants and/or animals.

In certain embodiments the parasitic nematode is derived from the class Secernentea. For example, the parasitic nematode may be of the order Strongylida, Tylenchida, Rhabditida or Spirurida. Specific examples of such nematodes include, but are not limited to, Haemonchus contortus, Heterodera glycines, Strongyloides stercoralis, Meloidogyne hapla, Meloidogyne arenaria, Onchocerca volvulus, Ancylostoma ceylanicum, and Brugi malayi.

As contemplated herein, "increasing the sensitivity" of a nematode to one or more anthelmintic drugs means that the detrimental effect(s) (e.g. reduction in viability, inhibition of reproduction, growth, motility, pathogenicity and the like) exerted by the drug(s) on the nematode is generally increased.

Non-limiting examples of anthelmintic drugs to which a nematode may develop increased sensitivity include classes represented by amoscanate; arecoline; Bacillus thuringiensis crystal proteins (for example Cry5B); bephenium; bithionol; bitoscanate; brotianide; bunamidine; clonostachydiol; cyacetacide; diamfenetide,; diethylcarbamazine; dithiazanine; epsiprantel; hygromycin B; kainic acid; LY 165163; metyridine; nitazoxanide; nitroscanate; paromomycin; phenothiazine; phthalofyne; picadex; piperazine; pyrvinium; santonin; suramin; rhenium closylate; tribendimidine; and members of the following anthelmintic classes amino acetonitrile derivatives (for example monepantel), arsenicals (for example melarsomine and thiacetarsamide sodium), benzene sulphonamides (for example clorsulon), benzimidazoles and probenzimidazoles (including albendazole, albendazole oxide, benzimidazole, 2-phenyl, cambendazole, cyclobendazole, dienbendazole, dribendazole, fenbendazole, flubendazole, lobendazole, luxabendazole, mebendazole, oxfendazole, oxibendazole, parbendazole, thiabendazole, triclabendazole, febantel, netobimin, and thiophanate-methyl), cyclooctadepsipeptides (for example emodepside); isoquinolinones (for example praziquantel), macfortines (for example marcfortine A), macrocyclic lactones (such as abamectin (including abamectin Bl and abamectin Bib)), doramectin, emamectin (emamectin Bla and emamectin Bib), eprinomectin (eprinomectin Bla and eprinomectin Bib), ivermectin (ivermectin Bla and ivermectin Bib), milbemycin oxime, moxidectin, nemadectin and selamectin), organochlorines (for example dichlorophen), organophosphates (coumaphos, dichlorvos, haloxon, naftalofos, pyraclofos, trichlorfon), paraherquamides (for example derquantel), salicylanilides and nitrophenols (bromoxanide, clioxanide, closantel, disophenol, niclosamide, oxyclozanide, rafoxanide, resorantel, tribromsalans), imidazothiazoles (for example butamisole levamisole and tetramisole) and tetrahydropyrimidines (for example morantel, oxantel and pyrantel).

In addition to anthelmintic drugs, the inhibition of GLF expression in nematodes may increase the sensitivity of nematodes to anthelmintic agents such as, for example, anthelmintic compounds present in plants (e.g. tannins, terpenes, flavonoids, allicin, alkaloids, naphthoquinones), bacteria (e.g. macrolides), copper and the like.

In certain embodiments, the nematode is resistant to an anthelmintic drug. Non- limiting examples of drugs to which the nematode may be resistant include any one or more of those listed in the paragraph directly above.

Accordingly, the methods of the invention may be used to increase the sensitivity of a nematode to anthelmintic drug(s) to which it has become resistant.

In certain embodiments, the invention provides a method for enhancing the effectiveness of an anthelmintic drug in a subject. The method comprises administering the anthelmintic drug to the subject and an agent that inhibits UDP-galactopyranose mutase (GLF) expression or function in said nematode.

The anthelmintic drug may be any anthelmintic drug, non-limiting examples of which are listed above. As contemplated herein, "enhancing the effectiveness" of an anthelmintic drug in a subject means that the detrimental effect that the drug(s) exert on a nematode infecting the subject is generally increased. The subject treated may be any plant or animal susceptible to infection by a parasitic nematode. For example, the subject may be an individual of any mammalian species including, but not limited to, members of the genus ovine (e.g. sheep), bovine, equine, porcine, feline, canine, primates (e.g. humans), and rodents. Alternatively, the subject may be an individual of any plant species including, but not limited to, Solanum lycopersicum, Glycine max, Cicer arietinum, Triticum spp., Oiyza sativa, Musa spp., Zea mays, Solanum tuberosum, Vitis vinifera, Saccharum spp.

Preferably, the agent that inhibits UDP-galactopyranose mutase (GLF) expression is administered prior to or in combination with the anthelmintic drug. Alternatively, the agent that inhibits UDP-galactopyranose mutase (GLF) expression may be administered after administration of the anthelmintic drug.

The agent and drug may be administered to the subject by any suitable route including, but not limited to, the parenteral (e.g. intravenous, intradermal, subcutaneous or intramuscular), mucosal (e.g. oral or intranasal) or topical route. In certain embodiments, the agent and drug are administered by different routes.

In other embodiments, the invention provides a method for treating a subject infected with a parasitic nematode having resistance to an anthelmintic drug. The anthelmintic drug may be any anthelmintic drug, non-limiting examples of which are listed above.

The method comprises administering the anthelmintic drug to the subject and an agent that inhibits UDP-galactopyranose mutase (GLF) expression or function in said nematode.

The subject treated may be any plant or animal susceptible to infection by a parasitic nematode. For example, the subject may be an individual of any mammalian species including, but not limited to, members of the genus ovine (e.g. sheep), bovine, equine, porcine, feline, canine, primates (e.g. humans), and rodents. Alternatively, the subject may be an individual of any plant species including, but not limited to, Solanum lycopersicum, Glycine max, Cicer arietinum, Triticum spp., Oiyza sativa, Musa spp., Zea mays, Solanum tuberosum, Vitis vinifera, Saccharum spp.

Preferably, the agent that inhibits UDP-galactopyranose mutase (GLF) expression is administered prior to or in combination with the anthelmintic drug. Alternatively, the agent that inhibits UDP-galactopyranose mutase (GLF) expression may be administered after administration of the anthelmintic drug. The agent and drug may be administered to the subject by any suitable route including, but not limited to, the parenteral (e.g. intravenous, intradermal, subcutaneous or intramuscular), mucosal (e.g. oral or intranasal) or topical route. In certain embodiments, the agent and drug are administered by different routes.

The methods for increasing sensitivity to anthelmintic agents comprise inhibiting UDP-galactopyranose mutase (GLF) expression or function in a nematode. The UDP- galactopyranose mutase (GLF) may be a polypeptide of the invention.

In one embodiment, the UDP-galactopyranose mutase (GLF) comprises the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In certain embodiments, the UDP-galactopyranose mutase (GLF) comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In another embodiment, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In certain embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In some embodiments, the UDP-galactopyranose mutase (GLF) comprises the amino acid sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15 or 27, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 or 27, or a fragment thereof.

A UDP-galactopyranose mutase (GLF) in accordance with the methods may be encoded by a nucleic acid of the invention.

In some embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16 or 28, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16 or 28, or a fragment thereof.

In accordance with the methods of the invention, inhibiting UDP-galactopyranose mutase (GLF) expression encompasses any means by which the expression of a gene encoding UDP-galactopyranose mutase (GLF) is eliminated or reduced.

UDP-galactopyranose mutase (GLF) expression may be inhibited using any suitable agent.

For example, UDP-galactopyranose mutase (GLF) expression may be inhibited using an anthelmintic agent identified in accordance with the screening methods of the invention (see section above entitled "Identification of anthelmintic agents").

In certain embodiments, UDP-galactopyranose mutase (GLF) expression is inhibited using anti-sense nucleic acids of the invention to block the translation of polypeptides from RNA transcripts (see section above entitled "Prevention and treatment of nematode infection"). The anti-sense nucleic acids may be dsRNA molecules. Preferably, the dsRNA comprises a strand that is complementary or substantially complementary to a fragment of the mRNA molecule set forth in SEQ ID NO: 29. The fragment of the mRNA molecule may be defined by residues 119-1345 of the sequence set forth in SEQ ID NO: 29, or a fragment thereof.

In one embodiment, the dsRNA molecule comprises a strand comprising the nucleotide sequence set forth in SEQ ID NO: 30, or a fragment thereof.

In certain embodiments, the dsRNA molecule comprises a strand comprising a nucleotide sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 30, or a fragment thereof.

UDP-galactopyranose mutase (GLF) function may be inhibited using any suitable agent.

For example, UDP-galactopyranose mutase (GLF) function may be inhibited using an anthelmintic agent identified in accordance with the screening methods of the invention (see section above entitled "Identification of anthelmintic agents").

In certain embodiments, UDP-galactopyranose mutase (GLF) function is inhibited by administering one or more antibodies of the invention (see section above entitled "Probes, primers and antibodies"). In certain embodiments, the antibody binds specifically to a UDP-galactopyranose mutase (GLF) comprising the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof. In certain embodiments, the antibody binds specifically to a UDP-galactopyranose mutase (GLF) sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In alternative embodiments, the invention provides use of an agent that inhibits UDP-galactopyranose mutase expression or function in a nematode in the preparation of a medicament for increasing the sensitivity of a nematode to one or more anthelmintic drugs. Also provided is use of an agent that inhibits UDP-galactopyranose mutase expression or function in a nematode for increasing the sensitivity of a nematode to one or more anthelmintic drugs. The agent may be any agent capable of inhibiting UDP- galactopyranose mutase expression or function in a nematode including, but not limited to, any one or more of those referred to in the section entitled "Increasing sensitivity to anthelmintic drugs".

Detection of nematodes and diagnosis of infection

The invention provides methods and kits for the detection of nematodes.

In one embodiment, the invention provides a method of detecting the presence or absence of a parasitic nematode in a sample. The method comprises detecting the presence or absence of a UDP-galactopyranose mutase (GLF) derived from the parasitic nematode in the sample.

It will be understood that detecting the presence or absence of a UDP- galactopyranose mutase (GLF) derived from the parasitic nematode in the sample may be achieved by detecting the polypeptide per se and/or a nucleic acid precursor of that polypeptide.

Detection of UDP-galactopyranose mutase (GLF) derived from the parasitic nematode in the sample is indicative of the presence of the parasitic nematode in the sample. Alternatively, failure to detect UDP-galactopyranose mutase (GLF) derived from the parasitic nematode in the sample is indicative of the absence of the parasitic nematode in the sample. Detecting the presence of the nematode in a biological sample derived from a subject will generally be diagnostic of infection by that nematode.

In one embodiment, the invention provides a method of detecting the presence or absence of a parasitic nematode in a sample. The method comprises contacting a nucleic acid from the sample with an agent that binds specifically to a nucleic acid of the invention and detecting a nucleic acid from the sample bound to said agent. Detection of a nucleic acid bound to the agent is indicative of the presence of the parasitic nematode in the sample. Alternatively, failure to detect a nucleic acid bound to the agent is indicative of the absence of the parasitic nematode in the sample. Detecting the presence of the nematode in a biological sample derived from a subject will generally be diagnostic of infection by that nematode.

In another embodiment, the invention provides a method of detecting the presence or absence of a parasitic nematode in a sample. The method comprises contacting a polypeptide from the sample with an agent that binds specifically to a polypeptide of the invention (i.e. a UDP-galactopyranose mutase (GLF) polypeptide) and detecting a polypeptide from the sample bound to said agent.

Detection of a polypeptide bound to the agent is indicative of the presence of the parasitic nematode in the sample. Alternatively, failure to detect a polypeptide bound to the agent is indicative of the absence of the parasitic nematode in the sample. Detecting the presence of the nematode in a biological sample derived from a subject will generally be diagnostic of infection by that nematode.

The invention also provides kits for detecting in a sample the presence or absence of a parasitic nematode in a sample. The kits comprise means for detecting the presence or absence of a UDP-galactopyranose mutase (GLF) derived from the parasitic nematode in the sample. Detecting the presence of a nematode in a biological sample derived from a subject using a kit of the invention will generally be diagnostic of infection by that nematode.

A parasitic nematode detected in accordance with the methods or kits of the invention may be any parasitic nematode that expresses galactopyranose mutase (GLF).

In certain embodiments the parasitic nematode is derived from the class Secernentea. For example, the parasitic nematode may be of the order Strongylida, Tylenchida, Rhabditida or Spirurida. Specific examples of such nematodes include, but are not limited to, Haemonchus contortus, Heterodera glycines, Strongyloides stercoralis, Meloidogyne arenaria, Meloidogyne hapla, Onchocerca volvulus, Ancylostoma ceylanicum, and Brugia malayi. In one embodiment, the nematode is Haemonchus contortus.

A sample for use in the detection methods and kits of the invention may be derived from any source.

For example, the sample may be obtained from an environmental source or a biological source. It will be understood that a "sample" as contemplated herein includes a sample that is modified from its original state, for example, by purification, dilution or the addition of any other component or components.

The sample may be an environmental sample. Non-limiting examples of environmental samples include a soil sample and a water sample.

The sample may be a biological sample. Non-limiting examples of biological samples include whole blood or a component thereof (e.g. plasma, serum), urine, saliva lymph, bile fluid, sputum, tears, cerebrospinal fluid, bronchioalveolar lavage fluid, synovial fluid, semen, ascitic tumour fluid, breast milk and pus.

The biological sample may be derived from a healthy individual, or an individual suffering from a particular disease or condition. For example, the individual may be suffering from or suspected to be suffering from a nematode infection.

The biological sample may be collected from an individual and used directly. Alternatively, the biological sample may be processed prior to use. For example, the biological sample may be purified, concentrated, separated into various components, or otherwise modified prior to use. It will be understood that a biological sample as contemplated herein includes cultured biological materials, including a sample derived from cultured cells, such as culture medium collected from cultured cells or a cell pellet. Accordingly, a biological sample may refer to a lysate, homogenate or extract prepared from a whole organism or a subset of its tissues, cells or component parts, or a fraction or portion thereof. A biological sample may also be modified prior to use, for example, by purification of one or more components, dilution, and/or centrifugation.

In certain embodiments, detection methods of the invention involve detecting the presence or absence of a UDP-galactopyranose mutase (GLF) derived from a parasitic nematode in the sample. Similarly, kits invention may be used to detect the presence or absence of a UDP-galactopyranose mutase (GLF) derived from a parasitic nematode in the sample. In other embodiments, the detection methods involve detecting the presence or absence of a nucleic acid or polypeptide in the sample that binds specifically to an agent. The agent binds specifically to a polypeptide or nucleic acid of the invention (i.e. a -galactopyranose mutase (GLF) derived from a parasitic nematode or a nucleic acid encoding the same). Kits of the invention may comprise agents that bind specifically to a polypeptide or nucleic acid of the invention and may be used to detect the presence or absence of a UDP-galactopyranose mutase (GLF) derived from a parasitic nematode in the sample. In one embodiment, the UDP-galactopyranose mutase (GLF) comprises the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In certain embodiments, the UDP-galactopyranose mutase (GLF) comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In one embodiment, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In certain embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 2, or a fragment thereof.

In some embodiments, the UDP-galactopyranose mutase (GLF) comprises the amino acid sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15 or 27, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) comprises an amino acid sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in any one of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15 or 27, or a fragment thereof.

In some embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16 or 28, or a fragment thereof.

In other embodiments, the UDP-galactopyranose mutase (GLF) is encoded by a nucleic acid comprising a sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16 or 28, or a fragment thereof.

Detection of nucleic acids and polypeptides of the invention may be performed using any suitable method. For example, the methods for detection may involve the use of a primer, probe or antibody of the invention that binds specifically to one or more nucleic acids or polypeptides of the invention. Such components may be present in a kit of the invention.

Suitable techniques and assays in which the skilled addressee may utilise a primer, probe or antibody of the invention that binds specifically to one or more nucleic acids and polypeptides of the invention include, for example, the polymerase chain reaction (and related variations of this technique), antibody based assays such as ELISA and flow cytometry, and fluorescent microscopy.

Methods by which polypeptides of the invention may be identified using a probe or antibody of the invention are generally known in the art, and are described for example in Coligan et al. (Eds), (2007), "Current Protocols in Protein Science", John Wiley and Sons, Inc; Walker, (Ed), (1988) "New Protein Techniques: Methods in Molecular Biology", Humana Press, Clifton, NJ; and Scopes, (1987), "Protein Purification: Principles and Practice, " 3rd, Ed., Springer- Verlag, New York, N.Y. For example, polypeptides of the invention may be detected by western blot or spectrophotometric analysis. Other examples of suitable methods for the detection of polypeptides of the invention are described, for example, in US patent no. 4683195, US patent no. 6228578, US patent no. 7282355, US patent no. 7348147 and PCT publication No. WO/2007/056723.

Methods by which nucleic acids of the invention may be identified using a probe or primer of the invention are generally known in the art. In certain embodiments, the detection of nucleic acids of the invention is achieved by amplification of DNA from the sample of interest by polymerase chain reaction, using primers that hybridise specifically to nucleic acids and detecting or sequencing the amplified nucleic acids. Accordingly, kits of the invention may comprise reagents suitable for PCR amplification of nucleic acids of the invention. Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like. Methods for designing PCR and RT-PCR primers are generally known in the art and are disclosed, for example, in Ausubel et al. (Eds), (2007), "Current Protocols in Molecular Biology", John Wiley and Sons, Inc; Maniatis et al. (1982), "Molecular Cloning, a laboratory manual" 280-281; Innis et al. (Eds), (1990), "PCR Protocols: A Guide to Methods and Applications", Academic Press, New York; Innis and Gelfand, (Eds), (1995), "PCR Strategies", Academic Press, New York; Innis and Gelfand, (Eds) (1999), "PCR Methods Manual", Academic Press, New York; and Sambrook et al, (1989), "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, Plainview, New York.

The skilled addressee will readily appreciate that various parameters of PCR and RT-PCR procedures may be altered without affecting the ability to achieve the desired product. For example, the salt concentration may be varied or the time and/or temperature of one or more of the denaturation, annealing and extension steps may be varied. Similarly, the amount of DNA, cDNA, or R A template may also be varied depending on the amount of nucleic acid available or the optimal amount of template required for efficient amplification. Primers for use in the methods of the invention are typically oligonucleotides typically being at least about 5 nucleotides to about 80 nucleotides in length, more typically about 10 nucleotides in length to about 50 nucleotides in length, and even more typically about 15 nucleotides in length to about 30 nucleotides in length. Such primers can be prepared by any suitable method, including, for example, direct chemical synthesis or cloning and restriction of appropriate sequences. Not all bases in the primer need reflect the sequence of the template molecule to which the primer will hybridize, the primer need only contain sufficient complementary bases to enable the primer to hybridize to the template. A primer may also include mismatch bases at one or more positions, being bases that are not complementary to bases in the template, but rather are designed to incorporate changes into the DNA upon base extension or amplification. A primer may include additional bases, for example in the form of a restriction enzyme recognition sequence at the 5' end, to facilitate cloning of the amplified DNA.

In certain embodiments the detection methods involve contacting nucleic acids from the sample with an agent specific for a nucleic acid of the invention (i.e. a nucleic acid encoding a UDP-galactopyranose mutase (GLF) derived from a nematode).

Kits of the invention may also comprise an agent specific for a nucleic acid of the invention.

The agent may be any agent that binds specifically to a nucleic acid of the invention.

For example, the agent may be identified in accordance with the screening methods of the invention (see section above entitled "Identification of anthelmintic agents").

In certain embodiments, the agent is an anti-sense nucleic acid of the invention (see sections above entitled "Probes, primers and antibodies").

The anti-sense nucleic acid may be a dsRNA molecule.

Suitable dsRNA molecules include those comprising a strand that is complementary or substantially complementary to a fragment of a cellular UDP-galactopyranose mutase (GLF) mRNA produced by Haemonchus contortus. The strand may be complementary or substantially complementary to any fragment of mRNA encoding Haemonchus contortus UDP-galactopyranose mutase (GLF).

Preferably, the dsRNA comprises a strand that is complementary or substantially complementary to a fragment of the mRNA molecule set forth in SEQ ID NO: 29. The fragment of the mRNA molecule may be defined by residues 119-1345 of the sequence set forth in SEQ ID NO: 29, or a fragment thereof.

In one embodiment, the dsRNA molecule comprises a strand comprising the nucleotide sequence set forth in SEQ ID NO: 30, or a fragment thereof.

In certain embodiments, the dsRNA molecule comprises a strand comprising a nucleotide sequence sharing sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 30, or a fragment thereof.

In certain embodiments the detection methods involve contacting polypeptides from the sample with an agent specific for a polypeptide of the invention (i.e. a UDP- galactopyranose mutase (GLF) derived from a nematode).

Kits of the invention may also comprise an agent specific for a polypeptide of the invention.

The agent may be any agent that binds specifically to a polypeptide of the invention.

For example, the agent that binds specifically to a polypeptide of the invention may be an agent identified in accordance with the screening methods of the invention (see section above entitled "Identification of anthelmintic agents").

In certain embodiments, the agent is an antibody of the invention (see sections above entitled "Probes, primers and antibodies").

In certain embodiments, the antibody binds specifically to a UDP-galactopyranose mutase (GLF) comprising the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In certain embodiments, the antibody binds specifically to a UDP-galactopyranose mutase (GLF) sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: I, or a fragment thereof.

It will be understood that an agent that "binds specifically to" a polypeptide or nucleic acid of the invention is one capable of binding to a polypeptide or nucleic acid of the invention with a significantly higher affinity than it binds to an unrelated molecule (e.g. a non-target polypeptide or nucleic acid). Accordingly, an agent that binds specifically to a polypeptide or nucleic of the invention is an agent with the capacity to discriminate between that polypeptide/nucleic acid and any other number of potential alternative binding partners. Hence, when exposed to a plurality of different but equally accessible molecules as potential binding partners, an agent that binds specifically to a polypeptide or nucleic acid of the invention will selectively bind to that polypeptide/nucleic acid and other alternative potential binding partners will remain substantially unbound by the agent. In general, an agent that binds specifically to a polypeptide or nucleic acid of the invention will preferentially bind to that polypeptide/nucleic acid at least 10-fold, preferably 50-fold, more preferably 100-fold, and most preferably greater than 100-fold more frequently than other potential binding partners that are not target polypeptides/nucleic acids. An agent specific for a polypeptide or nucleic acid of the invention may be capable of binding to other non-target molecules at a weak, yet detectable level. This is commonly known as background binding and is readily discernible from target polypeptide/nucleic acid-specific binding, for example, by use of an appropriate control.

Nucleic acids and polypeptides for analysis using the methods and kits of the invention may be extracted from organisms either in mixed culture or as individual species or genus isolates. Accordingly, the organisms may be cultured prior to nucleic acid and/or polypeptide isolation or alternatively nucleic acid and/or polypeptides may be extracted directly from environmental samples, such as water samples or soil samples.

Suitable methods for the extraction and purification of nucleic acids for analysis using the methods and kits of the invention are generally known in the art and are described, for example, in Ausubel et al„ (Eds), (2007), "Current Protocols in Molecular Biology", John Wiley and Sons, Inc.

Suitable methods for the extraction and purification of polypeptides of the invention are generally known in the art and are described, for example, in Coligan et αί, (Eds), (2007), "Current Protocols in Protein Science ", John Wiley and Sons, Inc; Walker, (Ed) (1988), "New Protein Techniques; Methods in Molecular Biology", Humana Press, Clifton, N.J; and Scopes, (1987), "Protein Purification: Principles and Practice ", 3rd. Ed., Springer- Verlag, New York, N.Y. Examples of suitable techniques for protein extraction include, but are not limited to dialysis, ultrafiltration, and precipitation. Protein purification techniques suitable for use include, but are not limited to, reverse-phase chromatography, hydrophobic interaction chromatography, centrifugation, gel filtration, ammonium sulfate precipitation, and ion exchange.

The skilled addressee will readily appreciate that the invention is not limited to the specific methods for nucleic acid and polypeptide extraction/isolation described therein and other suitable methods are encompassed by the invention. The invention may be performed without nucleic acid or polypeptide extraction/isolation prior to analysis of the same.

Kits of the invention may include other components required to conduct the methods of the present invention, such as buffers and/or diluents. The kits may comprise one or more means for obtaining a sample from a subject. The kits typically include containers for housing the various components and instructions for using the kit components in the methods of the invention.

Kits of the invention may comprise a suitable support on which one or more reagents are immobilised or may be immobilised. For example, kits of the invention may comprise a support coated with an antibody that binds specifically to a polypeptide of the invention. Non-limiting examples of suitable supports include assay plates (e.g. microliter plates) or test tubes manufactured from polyethylene, polypropylene, polystyrene, Sephadex, polyvinyl chloride, plastic beads, and, as well as particulate materials such as filter paper, nitrocellulose membrane, agarose, cross-linked dextran, and other polysaccharides.

Kits of the invention may be used to perform an enzyme-linked immunosorbent assay (ELISA).

Additionally or alternatively, kits of the invention may be used to perform western blotting.

Compositions/routes of administration/medicaments

The invention provides compositions comprising agents that inhibit UDP- galactopyranose mutase expression or function in a nematode.

The nematode may be any nematode that expresses UDP-galactopyranose mutase (GLF).

The nematode may be a free living nematode. In certain embodiments the parasitic nematode is derived from the class Secementea. Specific examples of such nematodes include, but are not limited to, Caenorhabditis elegans, Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis japonica, Pristionchus pacificus.

The nematode may be a parasitic nematode. The parasitic nematode may infect plants and/or animals.

In certain embodiments the parasitic nematode is derived from the class Secementea. For example, the parasitic nematode may be of the order Strongylida, W 201

60

Tylenchida, Rhabditida or Spirurida. Specific examples of such nematodes include, but are not limited to, Haemonchus contortus, Heterodera glycines, Strongyloides stercoralis, Meloidogyne arenaria, Meloidogyne hapla, Onchocerca volvulus, Ancylostoma ceylanicum, Brugia malayi.

In certain embodiments, compositions of the invention comprise an anthelmintic agent identified in accordance with the screening methods of the invention that targets a nucleic acid of the invention encoding UDP-galactopyranose mutase (GLF) (see section above entitled "Identification of anthelmintic agents").

In certain embodiments, compositions of the invention comprise anti-sense nucleic acids of the invention (see section above entitled "Prevention and treatment of nematode infection").

The anti-sense nucleic acids may be dsRNA molecules.

Suitable dsRNA molecules include those comprising a strand that is complementary or substantially complementary to a fragment of a cellular UDP-galactopyranose mutase (GLF) mRNA produced by Haemonchus contortus. The strand may be complementary or substantially complementary to any fragment of mRNA encoding Haemonchus contortus UDP-galactopyranose mutase (GLF).

Preferably, the dsRNA comprises a strand that is complementary or substantially complementary to a fragment of the mRNA molecule set forth in SEQ ID NO: 29. The fragment of the mRNA molecule may be defined by residues 119-1345 of the sequence set forth in SEQ ID NO: 29, or a fragment thereof

In one embodiment, the dsRNA molecule comprises a strand comprising the nucleotide sequence set forth in SEQ ID NO: 30, or a fragment thereof.

In certain embodiments, the dsRNA molecule comprises a strand comprising a nucleotide sequence sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 30, or a fragment thereof.

In certain embodiments, compositions of the invention comprise an anthelmintic agent identified in accordance with the screening methods of the invention that targets a polypeptide of the invention (i.e. UDP-galactopyranose mutase (GLF) (see section above entitled "Identification of anthelmintic agents").

In certain embodiments, compositions of the invention comprise one or more antibodies of the invention (see section above entitled "Probes, primers and antibodies"). In certain embodiments, the antibody binds specifically to a UDP-galactopyranose mutase (GLF) comprising the amino acid sequence set forth in SEQ ID NO: 1, or a fragment thereof. In certain embodiments, the antibody binds specifically to a UDP- galactopyranose mutase (GLF) sharing at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the sequence set forth in SEQ ID NO: 1, or a fragment thereof.

In certain embodiments, compositions of the invention are vaccines. The vaccine may be a preventative vaccine or a therapeutic vaccine.

A composition of the invention may comprise a pharmaceutically acceptable carrier, adjuvant and/or diluent. The carriers, diluents and adjuvants must be "acceptable" in terms of being compatible with the other ingredients of the composition, and not deleterious to the recipient thereof. Non-limiting examples of pharmaceutically acceptable carriers or diluents are demineralised or distilled water; saline solution; vegetable based oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oil, arachis oil or coconut oil; silicone oils, including polysiloxanes, such as methyl polysiloxane, phenyl polysiloxane and methylphenyl polysolpoxane; volatile silicones; mineral oils such as liquid paraffin, soft paraffin or squalane; cellulose derivatives such as methyl cellulose, ethyl cellulose, carboxyrnethylcellulose, sodium carboxymethylcellulose or hydroxypropylmethylcellulose; lower alkanols, for example ethanol or isopropanol; lower aralkanols; lower polyalkylene glycols or lower alkylene glycols, for example polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3- butylene glycol or glycerin; fatty acid esters such as isopropyl palmitate, isopropyl myristate or ethyl oleate; polyvinylpyrolidone; agar; gum tragacanth or gum acacia, and petroleum jelly. Typically, the carrier or carriers will form from 10% to 99.9% by weight of the compositions.

Additionally or alternatively, a composition of the invention may comprise an immunosuppressive agent, non-limiting examples of which include anti-inflammatory compounds, bronchodilatory compounds, cyclosporins, tacrolimus, sirolimus, mycophenolate mofetil, methotrexate, chromoglycalates, theophylline, leukotriene antagonist, and antihistamine, and combinations thereof. The immunosuppressive agent may also be an immunosuppressive drug or a specific antibody directed against B or T lymphocytes, or surface receptors that mediate their activation. For example, the immunosuppressive drug may be cyclosporine, tacrolimus, sirolimus, mycophenolate mofetil, methotrexate, chromoglycalates, theophylline, leukotriene antagonist, and antihistamine, or a combination thereof.

Additionally or alternatively, a composition of the invention may comprise a steroid, such as a corticosteroid.

A composition of the invention may be in a form suitable for administration by injection, in the form of a formulation suitable for oral ingestion (such as capsules, tablets, caplets, elixirs, for example), in the form of an ointment, cream or lotion suitable for topical administration, in a form suitable for delivery as an eye drop, in an aerosol form suitable for administration by inhalation, such as by intranasal inhalation or oral inhalation, in a form suitable for parenteral administration, that is, subcutaneous, intramuscular or intravenous injection.

For administration as an injectable solution or suspension, non-toxic parenterally acceptable diluents or carriers can include, Ringer's solution, isotonic saline, phosphate buffered saline, ethanol and 1,2 propylene glycol.

Some examples of suitable carriers, diluents, excipients and adjuvants for oral use include peanut oil, liquid paraffin, sodium carboxymethylcellulose, methylcellulose, sodium alginate, gum acacia, gum tragacanth, dextrose, sucrose, sorbitol, mannitol, gelatine and lecithin. In addition these oral formulations may contain suitable flavouring and colourings agents. When used in capsule form the capsules may be coated with compounds such as glyceryl monostearate or glyceryl stearate which delay disintegration.

Adjuvants typically include emollients, emulsifiers, thickening agents, preservatives, bactericides and buffering agents.

Solid forms for oral administration may contain binders acceptable in human and veterinary pharmaceutical practice, sweeteners, disintegrating agents, diluents, flavourings, coating agents, preservatives, lubricants and/or time delay agents. Suitable binders include gum acacia, gelatine, corn starch, gum tragacanth, sodium alginate, carboxymethylcellulose or polyethylene glycol. Suitable sweeteners include sucrose, lactose, glucose, aspartame or saccharine. Suitable disintegrating agents include corn starch, methylcellulose, polyvinylpyrrolidone, guar gum, xanthan gum, bentonite, alginic acid or agar. Suitable diluents include lactose, sorbitol, mannitol, dextrose, kaolin, cellulose, calcium carbonate, calcium silicate or dicalcium phosphate. Suitable flavouring agents include peppermint oil, oil of wintergreen, cherry, orange or raspberry flavouring. Suitable coating agents include polymers or copolymers of acrylic acid and/or methacrylic acid and/or their esters, waxes, fatty alcohols, zein, shellac or gluten. Suitable preservatives include sodium benzoate, vitamin E, alpha-tocopherol, ascorbic acid, methyl paraben, propyl paraben or sodium bisulphite. Suitable lubricants include magnesium stearate, stearic acid, sodium oleate, sodium chloride or talc. Suitable time delay agents include glyceryl monostearate or glyceryl distearate.

Liquid forms for oral administration may contain, in addition to the above agents, a liquid carrier. Suitable liquid carriers include water, oils such as olive oil, peanut oil, sesame oil, sunflower oil, safflower oil, arachis oil, coconut oil, liquid paraffin, ethylene glycol, propylene glycol, polyethylene glycol, ethanol, propanol, isopropanol, glycerol, fatty alcohols, triglycerides or mixtures thereof.

Suspensions for oral administration may further comprise dispersing agents and/or suspending agents. Suitable suspending agents include sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, poly-vinyl-pyrrolidone, sodium alginate or acetyl alcohol. Suitable dispersing agents include lecithin, polyoxyethylene esters of fatty acids such as stearic acid, polyoxyethylene sorbitol mono-or di-oleate, -stearate or- laurate, polyoxyethylene sorbitan mono-or di-oleate, -stearate or-laurate and the like.

The emulsions for oral administration may further comprise one or more emulsifying agents. Suitable emulsifying agents include dispersing agents as exemplified above or natural gums such as guar gum, gum acacia or gum tragacanth.

Methods for preparing parenterally administrable compositions are apparent to those skilled in the art, and are described in more detail in, for example, Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa., hereby incorporated by reference herein.

The topical formulations of the present invention, comprise an active ingredient together with one or more acceptable carriers, and optionally any other therapeutic ingredients. Formulations suitable for topical administration include liquid or semi-liquid preparations suitable for penetration through the skin to the site of where treatment is required, such as liniments, lotions, creams, ointments or pastes, and drops suitable for administration to the eye, ear or nose.

Drops according to the present invention may comprise sterile aqueous or oily solutions or suspensions. These may be prepared by dissolving the active ingredient in an aqueous solution of a bactericidal and/or fungicidal agent and/or any other suitable preservative, and optionally including a surface active agent. The resulting solution may then be clarified by filtration, transferred to a suitable container and sterilised. Sterilisation may be achieved by: autoclaving or maintaining at 90°C-100°C for half an hour, or by filtration, followed by transfer to a container by an aseptic technique. Examples of bactericidal and fungicidal agents suitable for inclusion in the drops are phenylmercuric nitrate or acetate (0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate (0.01%). Suitable solvents for the preparation of an oily solution include glycerol, diluted alcohol and propylene glycol.

Lotions according to the present invention include those suitable for application to the skin or eye. An eye lotion may comprise a sterile aqueous solution optionally containing a bactericide and may be prepared by methods similar to those described above in relation to the preparation of drops. Lotions or liniments for application to the skin may also include an agent to hasten drying and to cool the skin, such as an alcohol or acetone, and/or a moisturiser such as glycerol, or oil such as castor oil or arachis oil.

Creams, ointments or pastes according to the present invention are semi-solid formulations of the active ingredient for external application. They may be made by mixing the active ingredient in finely-divided or powdered form, alone or in solution or suspension in an aqueous or non-aqueous fluid, with a greasy or non-greasy basis. The basis may comprise hydrocarbons such as hard, soft or liquid paraffin, glycerol, beeswax, a metallic soap; a mucilage; an oil of natural origin such as almond, corn, arachis, castor or olive oil, wool fat or its derivatives, or a fatty acid such as stearic or oleic acid together with an alcohol such as propylene glycol or macrogols.

A composition of the invention may incorporate any suitable surfactant such as an anionic, cationic or non-ionic surfactant such as sorbitan esters or polyoxyethylene derivatives thereof. Suspending agents such as natural gums, cellulose derivatives or inorganic materials such as silicaceous silicas, and other ingredients such as lanolin, may also be included.

A composition of the invention may be administered in the form of a liposome. Liposomes are generally derived from phospholipids or other lipid substances, and are formed by mono-or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any non-toxic, physiologically acceptable and metabolisable lipid capable of forming liposomes can be used. The compositions in liposome form may contain stabilisers, preservatives, excipients and the like. The preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods to form liposomes are known in the art, and in relation to this specific reference is made to: Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N.Y. (1976), p.33 et seq., the contents of which are incorporated herein by reference.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

Examples

The invention will now be described with reference to specific examples, which should not be construed as in any way limiting

Example 1: RNA interference (RNAi) experiments in the free-living (non-parasitic) nematode Caenorhabditis elegans

(i) Methods

RNAi experiments targeting Ce-glf-1 in C. elegans were performed and the resulting RNAi phenotype analysed in detail.

RNAi experiments

RNAi bacterial feeding experiments were carried out using a commercially available RNAi clone targetting C. elegans glf-1. This clone was purchased from Geneservice Ltd. (www.geneservice.co.uk) and contains a genomic DNA fragment targeting exons 3 and 4 of Ce-glf-1 (see SEQ ID NO: 31) transformed into the E. coli strain, HT115 (DE3). First-stage C. elegans larvae were fed either E. coli induced to express dsRNA encoded by the fragment of Ce-glf-1 (see SEQ ID NO: 31) or dsRNA encoded by a control sequence for 48-72hr at 25°C. Control dsRNA was generated by cloning a fragment of the Arabidopsis thaliana light harvesting complex gene (Lhcb4.3) (see SEQ ID NO: 32) into the RNAi vector, pL4440, and transforming this into HT115 (DE3) E. coli.

Hoechst 33258 fluorescent dye experiments

Hoechst staining was carried out as described by Moribe et al (2004) J. Cell Sci. 117:5209. RNAi-treated worms were washed off plates and incubated in 1 μg/ml Hoechst 33258 dye (Sigma) at room temperature for 15 min with gentle agitation. Worms were washed three times to remove dye and staining of nuclei was visualised using fluorescence microscopy.

Levamisole experiments

C. elegans levamisole experiments were carried out based on methods described in Lewis et al., (1980) Genetics 95:905-928. Twenty RNAi-treated worms were picked off RNAi plates and placed onto medium supplemented with either no drug, ΙΟμΜ, ΙΟΟμΜ or ImM of levamisole. Worms were scored for movement after 30min exposure to the drug.

(ii) Results

Nematodes were fed either E. coli expressing a control dsRNA (Figure 2A) or Ce- glf-1 dsRNA (Figures 2B or 2C) at 25°C. After 48 hours, worms fed on control dsRNA had reached adulthood and could move in a normal, sinusoidal manner (Figure 2A). This was evident by the tracks that they left on the E. coli lawn, which are sinusoidal in nature (arrow). After 48 hours, worms fed on Ce-glf-1 dsRNA also reach adulthood but could not move in a sinusoidal manner (Figure 2B). This was evident by the cleared E, coli lawn surrounding the worm (see arrows) and the clump of eggs that were laid in close proximity (see asterisks). Adults were also smaller and slightly dumpy in appearance compared with controls. In addition, a low level of lethality (6%) is observed (arrows) (n=99) (Figure 2C).

Nematodes were also tested for permeability to Hoechst 33258 fluorescent dye (which stains DNA). Figure 3 shows images of the anterior of adult nematodes under epifluorescence (Figures 3A and 3B) or bright field Nomarski microscopy (Figures 3C and 3D). Figures 3A and 3C each show nematodes fed E. coli expressing Ce-glf- l(RNAi) while Figures 3B and 3D each show nematodes fed E. coli expressing control dsRNA. These results show that administration of Ce-glf-1 (RNAi) resulted in cuticle permeability. Arrows in Figure 3A highlight fluorescing nuclei which are not stained in Figure 3B.

Additional experiments were performed to test whether cuticle permeability arising from Ce-glf-1 (RNAi) affects anti -nematode drug sensitivity. Nematodes fed E. coli expressing control dsRNA or Ce-glf-1 dsRNA were exposed to increasing concentrations of levamisole on agar plates and then scored for motility. Figure 4 shows the percentage of C. elegans paralysed after 30 minutes of exposure to levamisole. After 30 minutes of exposure, nematodes fed E. coli expressing Ce-glf-1 (RNAi) were more sensitive to levamisole at lower concentrations compared with nematodes fed E. coli expressing control dsRNA. knockdown of the expression

In summary, these experiments show nematodes fed E. coli expressing Ce-glf- l(RNAi)

(a) developed a defect in locomotion that progressed to paralysis (Figure 2)

(b) failed to grow normally (Figure 2)

(c) exhibited permeability to a normally impermeant dye, Hoechst 33258 (Figure

3) ; and

(d) exhibited increased sensitivity to the anti-nematode drug levamisole (Figure

4) ·

All these phenotypic features show that expression of Ce-GLF-1 is essential for survival of C. elegans. As shown by the Hoechst 33258 experiment, knockdown of the expression Ce-glf-1 leads to nematodes with a permeable cuticle. This defect in permeability results in worms that are more sensitive to the anti-nematode drug levamisole (Figure 4).

Example 2: RNAi experiments in the parasitic nematode Haemonchus contortus

(i) Methods

Sequence identity searches

Homology searches using Ce-glf-1 were conducted using BLAST (Basic Local Alignment Search Tool) through the European Bioinformatics Institute (EBI) and the Institute for Genomic Research (TIGR). Alignments were performed using ClustalW and Boxshade. H. contortus sequence searches using Ce-glf-1 were conducted using BLAST through The Wellcome Trust Sanger Institute.

RNAi experiments

DNA extracted from the sheep parasitic nematode Haemonchus contortus was used to clone a fragment of a putative Ce-glf-1 homologue (cloning was performed on the basis of sequences haem-195dl9 and haem-226ml4). Briefly, the PCR product was sub-cloned into pGEM-Teasy before a Not I digest was carried out and the fragment transferred to the RNAi feeding vector, pL4440. This plasmid was then transformed into the RNase III deficient E. coli strain, HT115 (DE3).

The cloned fragment was used in RNAi experiments on larval stages of H, contortus in vitro. Briefly, the feeding method was used to introduce dsRNA to the larvae and their development to third-stage larvae (L3) was followed. First-stage larvae (Lis) were exposed to Hc-g ^i-specific dsRNA through ingestion and digestion of recombinant E. coli expressing the dsRNA (i.e. either Hc-glf-1 dsRNA (Figure 7) or control dsRNA (sequences as per Example 1 above). Recombinant E. coli expressing the Hc-glf-1 dsRNA sequence (or control dsRNA) were generated essentially as described in Example 1 above

The Larval Development Assay (LDA) consisted of a tightly controlled mixture of Nutrient Medium, H. contortus eggs and bacteria that was incubated at 27^°C with 80% relative humidity for up to 10 days. The success of egg hatch and development of the Lis through to L3 was monitored on Day 1, 3 and 7. Subsamples were taken from the cultures and the larvae photographed. The images were used to assess the development of larvae fed the recombinant E. coli expressing Hc-glf-1 dsRNA.

Permeability experiments

Nematodes were fed E. coli expressing either Hc-glf-1 dsRNA (Figure 7) or control dsRNA and tested for permeability to Hoechst 33258 fluorescent dye (which stains DNA) using methods essentially as described in Example 1 above.

(ii) Results

Homologues of the putative C. elegans Ce-GLF-1 protein sequence were identified in a number of other nematode species (Figures 5 and 6). Figure 7 shows the putative fragment (Ce-glf-1 homologue) cloned from Haemonchus contortus DNA.

H. contortus treated with Hc-glfl -specific dsRNA did not develop normally, with more pale/dead Lis than in the control, a dramatic increase in sick L2s observed at day 3 and sick L3s at day 7 (Figure 8). The L3s were active, but less inclined to super-coil and movement was also slower than observed in the control. At day 4 and day 8, the integrity of the cuticle was assessed and showed permeability to a normally impermeant dye, Hoechst 33258. Figure 9 shows that fluorescent nuclei are evident in Hc-glfl dsRNA- treated nematodes (left) but not control dsRNA-treated (right) nematodes.

These results show that Hc-GLF-1 is an essential protein in H. contortus larvae. Further, the cuticle permeability that develops following silencing of Hc-GLF-1 is likely to be useful for, for example, increasing the efficacy of treatment with anti-nematode drugs or of vaccines directed against H. contortus.

The complete gene from H. contortus Hc-glf-1 was subsequently cloned and sequenced. The nucleotide and amino acid sequence of a representative clone of full- length Hc-glf-1 is provided in Figure 10. Polymorphisms were identified in the DNA encoding this gene and the predicted protein sequences, which are presumed to be from different individual nematodes. Five clones were sequenced (Figure 11). Variations in sequence were not, however, observed in the conserved amino acid residues in the predicted active site of the enzyme.

Example 3: 'Differential RNAi' experiments in C. elegans

(i) Methods

Generation of transgenic C. elegans expressing Hc-glf-1

The sequences used to generate each construct were as follows: Ce-glf-1 Promoterome clone p_H04M03.4_93 (http://vidal.dfci.harvard.edupromoteromedb/) (see SEQ ID NO: 33); Ce-GLF-1 ORFeome clone (http://worfdb.dfci.harvard.edu/) (see SEQ ID NO: 34); and the Hc-GLF-1 was the full-length sequence shown in Figure 10. To generate the Ce-g ^ipromoter: : Ce-GLF-1 v.gfp construct and the Ce-g^ipromoter::j¾ GLF-l::g7j> the Gateway® recombination system was used as per the manufacturer's instructions (www.invitrogen.com). An LR clonase recombination reaction was carried out to combine the Ce-glf-1 Promoterome clone with either the Ce-GLF-1 ORFeome clone or the Hc-GLF-1 ORF with the Gateway® compatible multi-site vector, pDEST- MB14.

Microparticle bombardment (using methods published by Praitis V, Casey E, Collar D and Austin J (2001) Genetics 157:1217-1226 and Berezikov E., Bargmann CI and Plasterk RH (2004) Nucleic Acids Research 32(4):e40) of C. elegans unc-119(ed3) hermaphrodites was carried out to create the transgenic strains WT253 (vrtEx253[Ce-glf- lipro oter::Ce-GLF-l::gfp,unc-119(+) ) and WT255 (wtEx255[Ce-g//-ipromoter::Hc- GLV-\ :gfp,unc-119(+)]). 'Differential RNAi ' experiments

RNAi was carried out against C. elegans glf-1 in the following strains; N2 (wild-type), WT253 (Ce-g//-/promoter::Ce-GLF-l::GFP) and WT255 (Ce-g/-/promoter::Hc-GLF- 1::GFP). Each strain was fed, from the LI stage, on dsRNA corresponding to either a control gene not present in C. elegans or to Ce-glf-1. The sequences of the D A encoding the dsRNAs used are described in Example 1. After two days of culture at 25°C, worms were incubated in a solution of Hoechst 33258 (1 μg/ml) as described in Example 1 above. Epifluorescence microscopy was used to observe fluorescence of Hoechst 33258 and Green Fluorescent Protein (GFP).

(ii) Results

Transgenic C. elegans expressing the Hc-glf-1 transgene under the control of the upstream promoter sequence from the Ce-glf-1 gene were generated and 'differential RNAi' experiments then performed on the transgenic nematodes. In these experiments the expression of the endogenous C, elegans gene, Ce-glf-1, but not Hc-glf-1, was specifically silenced by RNAi.

Figure 12 shows that expression of H. contortus GLF-1 in C. elegans can rescue the effects of RNAi treatment targetting Ce-glf-1. The anterior end of representative WT253 (A-C) and WT255 (D-E) adult worms are shown.

GFP fluorescence in the hypodermis (hyp) is evident in WT255 (Figure 12E), but not WT253 (Figure 12B), showing that the RNAi treatment effectively silenced expression of GFP fused to Ce-glf-1 (Figure 12B), but did not silence GFP fused to Hc- glf-1 (Figure 12E). This shows that Hc-glf-1 is not targetted by RNAi that targets Ce-glf- 1. Nuclei are fluorescent in WT253 (Figure 12C), but not in WT255 (Figure 12F), showing that the WT253 nematodes were permeable to the dye while the WT255 worms were not. This shows that the effects of silencing expression of Ce-glf-1 are not observed in nematodes that express Hc-glf-1, i.e. that expression of Hc-glf-1 is sufficient to prevent the phenotype induced by anti-Ce-glfl RNAi.

Thus, as illustrated in the graph of Figure 13, N2 worms fed on control dsRNA did not show fluorescence of nuclei (n=557), but they did show nuclear fluorescence when Ce-glf-1 was silenced by RNAi (n=213). Nuclear fluorescence shows that the cuticle and underlying hypodermis have become permeable. WT253 and WT255 worms fed on control dsRNA showed a low level of nuclear fluorescence (5% and 7% respectively) (n=82 and 179 respectively) (Figure 13). When WT253 worms were fed on Ce-glf-1 dsRNA, 68% of worms displayed fluorescent nuclei (n=l l l). In contrast, when WT255 worms, which express Hc-GLF-1, were fed on Ce-glf-1 dsRNA, only 11% of worms displayed fluorescent nuclei (n=224), which is comparable with controls (Figure 13).

These results show that the majority of nematodes expressing Hc-glf-1 did not exhibit permeability to the dye Hoechst 33258, whereas nematodes expressing only Ce- glf-1 were permeable to the dye. This experiment shows that expression of the H. contortus protein can prevent or 'rescue' the development of the RNAi phenotype observed when Ce-glf-1 is silenced in C. elegans, and provides evidence that the GLF-1 proteins from the two nematode species have similar physiological functions.

Figure 14 provides two light micrographs showing the RNAi phenotype of H. contortus larvae on day 7 of feeding on dsRNA targetting Hc-glf-1 (see description of the Larval Development Assay (LDA) in Example 2 above for methods). The Control(RNAi) panel shows healthy L3 which had been feeding on Arabidopsis thaliana lhcb4.3dsKNA. The Hc-glf-1 (RNAi) panel shows two healthy L3 plus two dead L2 (upper arrows) and a sick and pale L3 (lower arrow).

Figure 15 provides a confocal GFP fluorescence and brightfield overlay micrograph of a WT253 (Ce-glf-1 promoter: :Ce-g ^- open reading frame: :GFP) 4^th stage larval C, elegans. The image shows that GFP fluorescence is observed in the hypodermis. Expression of Ce-glf-1 was detected in all developmental stages (data not shown).

Example 4: Spatial and temporal expression of Hc-glf-1 mR A in H. contortus

(i) Methods

A benzimidazole-resistant line (designated VSRG) of H. contortus (McMaster Laboratory, CSIRO, Sydney, Australia) was maintained by serial passage in 3-6 month- old, helminth-free Merino weaner sheep. Faecal cultures from weaners with a patent infection (incubated at 27 °C) were harvested to recover second stage-larvae (L2) after 3- 4 days and infective third-stage larvae (L3) after 6-7 days. L3 were exsheathed by exposure to C0₂ for 15 min in a shaking waterbath at 40°C, followed by continuous agitation for 3 hours. Exsheathed L3 (xL3) were separated from cuticular casts by migration through two 20 μπι nylon meshes. xL3 were axenised in antibiotic solution (0.6 mg penicillin, 1 mg streptomycin, 40 pg gentamycin and 10 g amphotericin B per ml), then suspended in RPMI 1640/PIPES medium containing 20 % (v/v) sheep serum (see Rothwell, J.T., Sangster, N.C., (1993), "An in vitro assay utilising parasitic larval Haemonchus contortus to detect resistance to closantel and other anthelmintics", Int. J. Parasitol. 23, 573-578], placed in tissue culture flasks (175 cm², vented cap, Falcon) at a concentration of 1,000-2,000 larvae per ml and incubated at 40 °C in 20 % C0₂ for 6-7 days to produce early fourth-stage larvae (eL4). Adult stages of H. contortus were collected at necropsy from the abomasa of infected donor sheep 13 or 28 days after inoculation with 5,000-7,500 L3. Nematodes of each stage were suspended in pre- warmed (37 °C) phosphate-buffered saline (PBS), washed extensively to remove any debris and subsequently frozen at -80 °C.

Total RNA was extracted from L2, L3, xL3, eL4, day 13 or 28 adults of H. contortus, using the RiboPure™ Kit (Ambion). Messenger RNA was then prepared using the Poly(A) Pure mRNA Purification Kit (Ambion) with 01igo(dT)Cellulose. cDNA was synthesised from 2μg of mRNA from each stage using Superscript III Reverse Transcriptase (Invitrogen).

The stage-specific messenger RNA (mRNA) expression profile was determined for He- glf-1 by Quantitative Real-Time PCR. The PCRs were carried out using the Light Cycler real-time PCR machine, and Light Cycler capillaries (Roche). The Hc-glf-1- specific reactions were conducted in duplicate and compared with a standard curve produced using a gene-specific Hc-glf-1 plasmid at various concentrations. The MgCl₂ concentration, annealing temperature and PCR efficiency were optimised for the primer set used in this study. The integrity of the reactions was determined by melting curve analysis.

Hc-glf-1 gene-specific quantitative PCRs were carried out in a 20 μΐ final volume containing 5 pmol Hc-glf-1 forward primer 5'- GCTGGAGTAGGGATGGGAT A-3 ' (SEQ ID NO: 35); 5 pmol Hc-glf-1 reverse primer (5⁵- TGGCTTTATTTCCCTGATCC-3' (SEQ ID NO: 36); 3 mM MgCl₂; 1 x FastStart™ DNA master SYBR Green I mix; and 2 μL template cDNA. The levels of Hc-glf-1 expression were determined by the generation of a normalised value for each stage- specific cDNA preparation, using the Light Cycler Relative Quantification Software version 4 (Roche). These profiles indicate the developmental stages in which the target gene is expressed and allow an estimation of when the protein is required and consequently when an RNAi effect could be expected. (it) Results

Figure 16 shows expression of Hc-glf-1 mRNA at each stage of development of H. contortus. Expression is presented relative to the level in the adult nematodes. Values are the mean of two independent determinations using the same cDNA samples. L2, L3, L4 - 2^nd, 3^rd, 4^th-stage larvae; xL3 - exsheathed L3; eL4 - early L4; eLbf - early L4 blood- feeding; yAd - young adult.

As shown in Figure 16 expression of Hc-glf-1 was detected in all post-embryonic stages.

Example 5: Anthelmintic drug sensitivity experiments in C. elegans using different RNAi constructs

(i) Methods

Generation of Ce-glf-1 RNAi constructs

- glf-1 (ΚΝΑϊ) pCBlOO: C. elegans glf-1 mRNA was used as a PCR template to prepare an RNAi construct to target Ce-glf-1. The following primers were used to amplify the Ce-glf-1 mRNA fragment:

Forward primer: 5 '-GA A ACGAGGCTGCTC A A A AC-3 ' (SEQ ID NO: 37)

Reverse primer. 5'-ACTCCCACAATGAACACCTTA-3' (SEQ ID NO: 38)

The PCR product was inserted into pGEM-T Easy using A-tailing and then excised from the vector using Notl. It was then blunt-end ligated into pL4440 which had been linearised by Notl digestion and alkaline phosphatase treatment. The ligation product, called pCBlOO, was electroporated into E. coli HT115(DE3) following sequencing to check that the insert was correct.

The sequence of the Ce-glf-1 fragment in pCBlOO is shown below. The sequence in bold/underline is from Ce-glf-1 (see SEQ ID NO: 39); the flanking 3' and 5' fragments are from pGEM-T Easy, the intermediate plasmid used for cloning. The Ce-glf-1 sequence below is 850 nucleotides in length and spans nucleotides 78-927 of the complete glf-1 mRNA from C. elegans. GGAATTCGATTGAAACGAGGCTGCTCAAAACGCTGAAATTGTTCTTCTTGAACAGGAGGC CATTGCTGGAGGACTCTCCTGCACTGTAACCGATGAGAAAGGTTTCCTCTGGGATATGGG AGGTCATATCACTTTCAATCACAACTACCCATACTACGAGAAGGCTACTCAATGGGCTGT TGACGACTGGAATAAGTTGGCAAGAAACTGTATGGTTGATATGAATTATTTGTATGACAA GAAAGGAATCCATTTGGTACCATATCCAGCTCAATTCGCTGTTCCATTGTTCCCGGATGA AGTTAAGAACCGTTGTCTTGCTGATTTGAAGGAGAGATATGAGAATCCACAAGACGGAAC TACCCCAGACAACTTTGAAGAATGGGTTCTCCAACACTTTGGACCAACAATTCTTAACAC TTTCTTCAAACCATACACTAAGAAAGTATGGACTGTTGAGCCATTAAAAATGTCTCCAAA TTGGGTTGGATCTCGCGTTGCTAAGCTTCCACAGGAGAAGCTCGAGGAGCTTTGCTCAAT GGATCAAGCAGAGTTGGCTAATGCTGATTTTGGATGGGGACCAAATTCCTATTTCACTTT CCCAACTTATGGAGGAACTGGAAATGTTTGGAATTCGATGGCAAAGAAGTTGCCAAATGA GTGGTTCAAGTTCAACAATAAGGTCACCGGAGTCGATCACAAGGAGAAGACCGTTGAGAT TCTTGAAAAGGGACAAACCGAGCCAACCAAGATGTCATATGATGTTCTTCTTAACACTGC TCCAATTGATCAACTTGTGAACAACACACAAATCACTGCTCCATTGGATATTGTTCATAA TAAGGTGTTCATTGTGGGAGTAATCACTAGTGAATTC

- glf-l(KNAi) Geneservice: this clone was purchased from Geneservice Ltd. (www.geneservice.co.uk) and contains a genomic DNA fragment targeting exons 3 and 4 of Ce-glf-1 (see SEQ ID NO: 31) transformed into the E. coli strain, HT115 (DE3) (i.e. as described in Example 1 above).

RNAi and permeability experiments

(i) Levamisole: methods were as described in Example 1. Levamisole-sensitive and levamisole-resistant C. elegans were used in these experiments.

(ii) Ivermectin: methods were as described in Example 1, with ivermectin used instead of levamisole and a 0.4% DMSO solvent control (^t0μg/mL ivermectin') included in each experiment. Ivermectin-sensitive C. elegans was used in these experiments.

(iii) Mebendazole: the C. elegans mebendazole treatment was modified from methods published by Spence et al. (1982) [see Spence, A.M., Malone, K.M.B., Novak, M.M.A., Woods, R.A. (1982), "The effects of mebendazole on the growth and development of Caenorhabditis elegans" Canad. J. Zool. 60, 2616-2623.]. Briefly, developmentally synchronized wild-type C. elegans l^st-stage larvae were inoculated onto RNAi plates and fed on E. coli expressing each dsRNA for 24 hours at 20°C, then washed off each plate and approximately 20 worms transferred to fresh RNAi plates which also contained mebendazole at 0.7, 7, 70μ§/πιΙ, in the medium. A solvent control RNAi plate containing 0.7% DMSO in the medium was included with every experiment. After exposure to mebendazole for 50 hours each worm was observed and scored for paralysis, coiling or other abnormal phenotypes. Mebendazole-sensitive C. elegans was used in these experiments.

(i) Results

Levamisole

Figure 17 shows the sensitivity of (levamisole-sensitive) C. elegans strain N2 to 30 minutes exposure to different concentrations of levamisole following Ce-glf-1 RNAi. Results are from seven {glf-l(RNAi) Geneservice, 150-180 nematodes scored for each condition) or four (glf-1 (RNAi) pCBlOO, 60-90 nematodes scored for each condition) independent biological repeats. Values for glfl(RNAi) Geneservice at 10 or 1000μΜ are significantly different from control at p < 0.002 or lower; values for glf-1 (RNAi) pCBlOO at 10, 100, 1000μΜ are significantly different from control at p < 0.0007 or lower, using Fischer's exact test comparing each value with the control at the same levamisole concentration.

Figure 18 shows the sensitivity of (levamisole-resistant) C. elegans strain CB211 to 30 minutes exposure to different concentrations of levamisole following Ce-glf-1 RNAi. Results are from three independent biological repeats, 35-70 nematodes scored for each condition. Values for glf-1 (RNAi) pCBlOO at 10 and ΙΟΟμΜ are significantly different from control at p < 0.04 or lower, using Fischer's exact test comparing each value with the control at the same levamisole concentration.

Ivermectin

Figure 19 shows the sensitivity of (ivermectin-sensitive) C. elegans strain N2 to 30 minutes exposure to different concentrations of ivermectin (IVM) following Ce-glf-1 RNAi. Results are from seven (glf-1 (RNAi) Geneservice, 150-190 nematodes scored for each condition) or four (glf-l(RNAi) pCBlOO, 60-80 nematodes scored for each condition) independent biological repeats. Values for glf-1 (RNAi) Geneservice at 2, 20 or 200ng/mL are significantly different from control at p < 0.02 or lower; values for glf- l(RNAi) pCBlOO at 20 or 200ng/mL are significantly different from control at p < 0.004 or lower, using Fischer's exact test comparing each value with the control at the same levamisole concentration.

Mebendazole

Figure 20 shows the sensitivity of (mebendazole-sensitive) C. elegans to different concentrations of mebendazole for 50 hours following Ce-glf-1 RNAi. Results are from 3 independent biological repeats, 75 - 175 worms scored for each condition. Values for glf-l(RNAi) Geneservice at 70 and 7μg/mL mebendazole are significantly different from control at p < 0.0006 or lower; values for glf-l(RNAi) pCBlOO at 70, 7 or 0.7 μξ/mL mebendazole are significantly different from control at p < 0.001 or lower, using Fischer's exact test comparing each value with the control at the same mebendazole concentration.

Claims

CLAIMS:

1. An isolated nucleic acid comprising a nucleotide sequence sharing at least 70% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

2. The isolated nucleic acid of claim 1 comprising a nucleotide sequence sharing at least 80% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

3. The isolated nucleic acid of claim 1 or claim 2 comprising a nucleotide sequence sharing at least 90% sequence identity with the nucleotide sequence set forth in SEQ ID NO: 2.

4. An isolated ribonucleic acid (RNA) or an isolated complementary DNA encoded by a nucleic acid according to any one of claims 1 to 3.

5. An isolated double stranded RNA comprising a strand that binds specifically to the RNA molecule of claim 4.

6. An isolated polypeptide encoded by the nucleic acid of any one of claims 1 to 3, or the RNA or cDNA of claim 4.

7. An isolated polypeptide, wherein said polypeptide comprises an amino acid sequence sharing at least 70% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1.

8. The isolated polypeptide of claim 7, wherein said polypeptide comprises an amino acid sequence sharing at least 80% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1.

9. The isolated polypeptide of claim 7 or claim 8, wherein said polypeptide comprises an amino acid sequence sharing at least 90% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1.

10. An antibody specific that binds specifically to the polypeptide of any one of claims 6 to 9.

11. A method for preventing or treating a parasitic nematode infection in a subject, said method comprising administering to the subject an agent that inhibits UDP- galactopyranose mutase expression or function in said nematode.

12. The method of claim 11, wherein said UDP-galactopyranose mutase is encoded by the nucleic acid of any one of claims 1 to 5, or comprises the polypeptide of any one of claims 7 to 9.

13. The method according to claim 11 or claim 12, wherein said agent is the double-stranded RNA of claim 6, or the antibody of claim 10.

14. A method of detecting the presence or absence of a parasitic nematode in a sample, the method comprising:

(a) contacting a nucleic acid from the sample with an agent that binds specifically to the nucleic acid of any one of claims 1 to 4, or the RNA or cDNA of claim 5, and

(b) detecting a nucleic acid from the sample bound to said agent,

wherein detection of a nucleic acid bound to the agent is indicative of the presence of said parasitic nematode in the sample.

15. A method of detecting the presence or absence of a parasitic nematode in a sample, the method comprising:

(a) contacting a polypeptide from the sample with an agent that binds specifically to the polypeptide of any one of claims 6 to 10, and

(b) detecting a polypeptide from the sample bound to said agent,

wherein detection of a polypeptide bound to the agent is indicative of the presence of said parasitic nematode in the sample.

16. The method according to claim 15, wherein said agent is an antibody.

17. The method according to any one of claims 11 to 16, wherein said parasitic nematode is selected from the group consisting of H. contortus, H. glycines, S. stercoralis, M. arenaria, O. volvulus, A, ceylanicum, B. malayi, and M. hapla.

18. The method according to any one of claims 11 to 17, wherein said parasitic nematode is H. contortus.

19. A method for increasing the sensitivity of a nematode to an anthelmintic drug, the method comprising inhibiting UDP-galactopyranose mutase expression or function in said nematode.

20. The method according to any one of claims 11 to 19, wherein said nematode is resistant to an anthelmintic drug.

21. The method according to claim 20, wherein said anthelmintic drug is selected from the group consisting of amino-acetonitrile derivatives, benzimidazoles, diethylcarbamazine, imidazothiazoles, macrocyclic lactones, octadepsipeptides, piperazine, and suramin.

22. A method of screening for an anthelmintic agent, the method comprising:

(a) contacting a nucleic acid encoding a UDP-galactopyranose mutase enzyme derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between said candidate agent and said nucleic acid; (b) measuring production of the UDP-galactopyranose mutase enzyme encoded by said nucleic acid; and/or

(c) assaying for activity of the UDP-galactopyranose mutase enzyme encoded by said nucleic acid.

23. A method of screening for an anthelmintic agent, the method comprising:

(a) contacting a UDP-galactopyranose mutase enzyme derived from a parasitic nematode with a candidate agent under conditions suitable for binding to occur between said candidate agent and said enzyme, and

(b) measuring activity of the UDP-galactopyranose mutase enzyme.

24. The method according to claim 22 or claim 23, wherein said UDP- galactopyranose mutase is encoded by the nucleic acid of any one of claims 1 to 6, or comprises the polypeptide of any one of claims 7 to 9.