WO2011041350A9

WO2011041350A9 - Xenotropic mulv-related virus (xmrv) compositions and methods of use

Info

Publication number: WO2011041350A9
Application number: PCT/US2010/050633
Authority: WO
Inventors: Jerry Leroy Blackwell; Natalia Makarova; Ross Joseph Molinaro; Suganthi Suppiah; Hinh Ly
Original assignee: Emory University
Priority date: 2009-10-02
Filing date: 2010-09-29
Publication date: 2011-10-06
Also published as: WO2011041350A2; WO2011041350A3

Abstract

The invention relates to compositions and methods for analyzing and treating a disease, disorder, or condition associated with an XMRV infection.

Description

XENOTROPIC MULV-RELATED VIRUS (XMRV) COMPOSITIONS AND

METHODS OF USE

BACKGROUND

Prostate cancer affects one in six men in the United States. The American Cancer

Society (ACS) estimates that in 2009 there will be 192,000 new cases of prostate cancer with 27,000 deaths. Many factors, including genetic predisposition, have been implicated in the development of prostate cancer. The RNase L gene is in hereditary prostate cancer 1 (HPCl) region of chromosome lq25.3. RNase L is involved in innate immune responses to viral infections. Germline mutations segregate with prostate cancer in families with linkage to HPCl, and patients heterozygous for mutations in RNase L show loss of the remaining allele in tumor cells. Both truncation mutations and missense mutations have been associated with prostate cancer, some of which alter enzyme activity.

There are at least eight viruses widely acknowledged to cause human cancers,

Hepatitis B (Hepatocellular carcinoma), Hepatitis C (Hepatocellular carcinoma), Epstein- Barr Virus (Burkitt's and Hodgkin's lymphomas), Human Papillomavirus (Cervical, Penile, Head and Neck cancer), HTLV-1 (Adult T-cell leukemia), HIV (Non-Hodgkin lymphomas), Kaposi's sarcoma-associated herpes virus (Kaposi's sarcoma), and

Polyomaviruses (Merkel cell carcinoma). Retroviruses in particular cause cancer, and their mechanisms of inducing oncogenesis fall roughly into three categories: (1) virally encoded oncogenes (e.g. src); (2) insertional activation of cellular proto-oncogenes (e.g. murine leukemia viruses (MuLV)); and (3) oncogenesis indirectly induced by viral proteins such as the TAX protein of HTLV-1 and the Env protein in Friend spleen focus- forming virus (SFFV), Avian hemangioma virus (AHV), Jaagsiekte sheep retrovirus

(JSRV), Enxootic nasal tumor virus (ENTV) and Mouse mammary tumor virus

(MMTV).

The recent discovery of Xenotropic MuLV-Related Virus (XMRV) in prostate cancer patients is notable because it leads to the intriguing hypothesis that XMRV is a new cancer causing virus. The initial discovery of XMRV sequences was made using a

DNA microarray (Virochip, UCSF) that contained ~11,000, 70-mer oligonucleotides sequences homologous to the most conserved sequences of -950 fully sequenced viral genomes (Urisman et al., 2006 PLoS Pathogens 2(3):e25). The authors found that approximately 40% of patients with prostate cancer who are homozygous for the R462Q variant of RNase L were XMRV positive, while only one of sixty six samples from RQ or RR patients were positive. Their conclusion was that human XMRV infection is linked to decreased RNase L activity, caused by an inherited polymorphic variant that causes a subtle defect in innate (interferon-dependent) antiviral immunity.

In addition to this initial report, a total of fourteen authentic integration sites were identified from nine patient tissues were selected that were XMRV positive by either PCR or RT-PCR (Kim et al, 2008 Journal of Virology 82(20): 9964-77). A subsequent study looked at sporadic prostate cancer patients in Germany (Fischer et al., J Clin Virol. 2008 43(3): 277-83. Using nested RT-PCR, a single positive case out of eighty seven individuals with prostate cancer was identified and a single XMRV positive case out of seventy individuals with benign prostate tissue was also identified. The authors note that only 6% of the population studied was of the RNase L QQ genotype, significantly lower than the 11-17% of QQ genotype reported in other prostate cancer series.

More recently, immune-staining was performed on radical prostatectomy specimens using a new polyclonal antibody generated by immunizing a rabbit with lysed viral particles. By this method, XMRV protein expression was found in 23% of 334 prostatectomy specimens with an additional 4% of specimens positive for XMRV DNA by PCR for a total incidence of 27% of prostate cancer patients positive for XMRV infection. In contrast to all previous reports, XMRV proteins were localized primarily to malignant epithelium (not stroma) and the rate of XMRV positivity was independent of RNase L genotype. See, Hong et al, 2009 J Virology 83(14): 6995-7003. The preceding in not intended to be an admission that any of the references cited above are prior art.

SUMMARY

The invention relates to XMRV compositions, therapeutic methods, and diagnostic methods related thereto. It has been discovered that XMRV infection results in neutralizing antibodies that can be detected by techniques disclosed herein. It has also been discovered that a XMRV gene is doubly spliced to provide mRNA with SEQ ID NO: 20 encoding OrO (SEQ ID NO: 21).

In certain embodiments, the invention relates to methods of determining whether a subject is infected with XMRV comprising analyzing a sample for the presence of an antibody to a XMRV envelope protein and correlating the presence of the antibody to

XMRV infection of the subject from which the sample was obtained.

In certain embodiments, the analyzing comprises mixing the sample and a viruslike particle comprising a XMRV envelope protein, and detecting an antibody bound to the envelope protein, wherein the virus-like particle comprises a lentiviral nucleic acid. In further embodiments, the lentiviral nucleic acid does not express a lentiviral envelope protein. In certain embodiments, detecting antibody bound to the XMRV envelope protein comprises measuring the ability of the virus-like particle to infect a cell, typically one that expresses Xprl .

In some embodiments, the invention relates to methods for detecting a neutralizing antibody against XMRV, the method comprising: 1) contacting a host cell comprising a reporter gene operatively associated with an lentiviral promoter with a sample comprising a replication deficient lentiviral-XMRV pseudovirus and a test antibody; and 2) measuring reporter gene activity, wherein inhibition of reporter gene activity compared to reporter gene activity with a control antibody indicates anti- pseudovirus activity thereby detecting a neutralizing antibody against XMRV. In further embodiments the lentiviral promoter is an HIV-1 long-terminal repeat sequence. In certain embodiments, the lentiviral-XMRV pseudovirus is HIV -XMRV pseudovirus. In certain embodiments, the reporter gene is a luciferase gene, a chloramphenicol acetyltransferase gene, a growth hormone gene, β-galactosidase gene, or a fluorescent protein gene.

In some embodiments, the invention relates to methods for detecting an immune response against XMRV, the method comprising: 1) contacting a host cell comprising a reporter gene operatively associated with an lentiviral promoter with a sample comprising a replication deficient lentiviral-XMRV pseudovirus and a biological sample derived from a mammal; and 2) measuring reporter gene activity, wherein inhibition of reporter gene activity compared to reporter gene activity with a control antibody indicates anti- pseudovirus activity thereby detecting an immune response against XMRV, wherein the lentiviral-XMRV pseudovirus expresses an XMRV surface protein.

In some embodiments, the invention relates to methods of producing a lentiviral- XMRV pseudovirus expressing an XMRV surface protein, the method comprising transfecting a host cell with a first plasmid comprising a modified lentiviral genome; and a second plasmid comprising an XMRV gene encoding an XMRV surface protein; and recovering recombinant pseudovirus.

For certain embodiments, the invention relates to compositions and methods for detecting an immune response against XMRV.

In one embodiment, the invention includes an assay that can detect a B cell mediated response directed against XMRV in a biological sample.

In another embodiment, the invention includes an assay that can detect a T cell mediated response directed against XMRV in a biological sample. Accordingly, the invention includes detecting and regulating XMRV specific T cells.

In one embodiment, the invention includes an assay that can detect neutralizing antibodies directed against XMRV in a biological sample. The biological sample can be derived from a mammal, preferably a human. The amount of neutralizing antibody detected in the biological sample can be correlated with the presence of XMRV as measured by DNA PCR and FISH analysis in a biological sample from the same mammal. It has been discovered that there is a high degree of concordance between these three methods (serology, PCR and FISH) demonstrating that infected mammals mount a detectable antibody response to XMRV.

For certain embodiments, the invention relates to an XMRV virus-like particle (VLP) that is capable of inducing an immune response in a mammal. It has been discovered that binding and neutralizing antibodies were detected in the sera of vaccinated mammals. In some instances, a recombinant vector was used to generate the XMRV VLP. Preferably, the adenoviral vector comprises XMRV genes including but not limited to env and gag genes.

In certain embodiments, the invention relates to a novel doubly spliced XMRV transcript. In certain embodiments, the invention relates to an isolated nucleic acid sequence (SEQ ID NO: 20) and a protein encoded thereby (SEQ ID NO: 21). In certain embodiments, the invention relates to an isolated polypeptide comprising SEQ ID NO: 21 without the precursor sequence(s) of the MXRV envelope proteins, e.g., SEQ ID NO: 48, SEQ ID NO: 49. In certain embodiments, the invention relates to an isolated nucleic acid comprising that encodes SEQ ID NO: 21 and does not encode the precursor sequences(s) of the envelope protein (gp 75 or pl5e). In certain embodiments, the invention relates to an isolated nucleic acid comprising SEQ ID NO: 41 that does not encode the precursor sequences(s) of the envelope protein (gp 75 or pl5e).

In some embodiments, the invention relates to an isolated polypeptide consisting essentially of SEQ ID NO: 21. In certain embodiments, the invention relates to an isolated polypeptide of less than 300, 200, 150, 100 amino acids comprising SEQ ID NO:

21. In some embodiments, the invention relates to an isolated polypeptide that has greater than 88%, 89% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98% similarity to Orf3. In some embodiments, the invention relates to an isolated polypeptide consisting essentially of SEQ ID NO: 21 and 20, 15, 10 or 5 or less amino acids on the N-terminal and/or C-terminal ends. In some embodiments, the invention relates to an isolated polypeptide consisting essentially of SEQ ID NO: 21 wherein 20, 15, 10 or 5 or less amino acids are removed from the N-terminal or C-terminal ends.

In certain embodiments, the invention relates to an isolated polypeptide with between 95 and 100, 200, or 300 amino acids comprising SEQ ID NO: 21 wherein 1, 2, or 3 of the amino acids in SEQ ID NO: 21 are substituted with a different amino acid, typically a conservative amino acid.

In certain embodiments, the invention relates to an isolated nucleic acid comprising a sequence encoding a polypeptide described herein, typically of less than 300, 200, 150, 100 amino acids comprising SEQ ID NO: 21. In further embodiments, the sequence comprises or consists essentially of SEQ ID NO: 20 or SEQ ID NO: 41.

In some embodiments, the invention relates to a recombinant vector comprising a sequence encoding a polypeptide of less than 300 amino acids comprising SEQ ID NO: 21. In further embodiments, the invention relates to a conjugate comprising a) a polypeptide consisting essentially of SEQ ID NO: 21 and b) a marker. In further embodiments, the marker is Myc, Calmodulin, FLAG, HA, His6, MBP, Nus, GST, GFP,

Thioredoxin, isopeptag, BCCP, S-tag, Softag 1, Softag 3, Strep-tag, or SBP-tag. In further embodiments, the marker is a dye, nucleic acid, or quantum dot. In further embodiments, the marker is not a polypeptide epitope.

In certain embodiments, the invention relates to a method of identifying OrO comprising mixing a sample with an antibody that has affinity for a polypeptide with SEQ ID NO: 21 but does not have affinity for precursor sequence(s) of the MXRV envelope proteins, e.g., SEQ ID NO: 48, SEQ ID NO: 49 and a second antibody that has affinity for precursor sequence(s) of the MXRV envelope proteins, e.g., SEQ ID NO: 48, SEQ ID NO: 49; and detecting the binding of the first antibody and correlating the absence of binding by the second antibody to the presence of OrO in the sample.

Preferably the first antibody is conjugated to a fluorescent marker and the second antibody is conjugated to a fluorescent marker. The fluorescence markers are typically different.

In certain embodiments, the invention relates to an isolated nucleic acid that hybridizes to SEQ ID NO: 20 wherein the nucleic acid does not substantially bind to the XMRV singly spliced transcript.

In certain embodiments, the invention relates to a conjugate comprising a) a nucleic acid that hybridizes to SEQ ID NO: 20 wherein the nucleic acid does not substantially bind to the XMRV singly spliced transcript and b) a marker. In further embodiments, the marker is fluorescent. In further embodiments, the marker is biotin, a polypeptide, fluorescent dye, or a quantum dot. In further embodiments, the marker is not a polynucleotide.

In some embodiments, the invention relates to a vaccine comprising a XMRV envelope protein, wherein the envelope protein is the transcription product of a singly or doubly spliced transcript of the XMRV gene. In some embodiments the vaccine further comprises a recombinant virus-like particle (VLP) comprising an XMRV envelope protein.

In certain embodiments, the invention relates to methods of determining whether a subject is infected with XMRV comprising assaying a sample for OrO and correlating the presence of OrO to XMRV infection. Typically assaying comprises detecting OrO protein by mass spectroscopy. In further embodiments, the assaying comprises, combining the sample and affinity markers for OrO protein and measuring markers in the marker bound sample. Typically the markers are antibodies for Orf3 protein. In further embodiments, the markers are fluorescent.

In certain embodiments, the assaying comprises the step of detecting expression of doubly spliced mRNA of XMRV in the sample by mixing the sample with a polynucleotide that hybridizes to doubly spliced mRNA of XMRV. In further embodiments, the polynucleotide is conjugated to a fluorescent marker. Further embodiments assaying comprises moving the sample through separation medium and detecting Orf3 protein or doubly spliced mRNA of XMRV.

In certain embodiments, the invention relates to treating or preventing an XMRV infection comprising administering a composition that interferes with Orf3 signaling or suppresses Orf3 expression in a subject at risk for, diagnosed with, exhibiting symptoms of an XMRV infection.

In certain embodiments, the invention relates to pharmaceutical compositions comprising a nucleic acid that interrupts expression of Orf3 transcription, wherein the nucleic acid is a siRNA of Orf3 such as those comprising a short sequence, typically between, 19 and 25 nucleotides, within SEQ ID NO: 20 or SEQ ID NO: 41.

In certain embodiments, the invention relates to pharmaceutical composition comprising an antibody or aptamer of Orf3.

BRIEF DESCRIPTION OF THE FIGURES

For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

Figure 1 shows a representative gel of bands resulting from second round of nested PCR using patient prostatic tissue DNA as template and XMRV-Env gene specific primers. Expected size of band was 217 bp. Each positive PCR product was sequenced to verify XMRV unique sequences.

Figure 2A and 2B show PCR and FISH analysis in prostatectomy tissue. Two fields of hematoxylin-eosin-stained prostatic tissue and corresponding XMRV FISH positives are shown for patient 177. Large panels show FISH positive cells (arrow). Smaller panels show magnified field of hematoxlyin-eosin stain and fluorescent image of XMRV FISH-positive cells. Similar findings were observed for all FISH-positive patients but absent in FISH-negative patients. All patient specimens were also negative for mouse mitochondrial DNA, ruling out contamination.

Figure 3A shows a diagram of a single-round reporter gene assay. 293T cells were co-transfected with pSG3Aenv and XRMV Env- or HIV Env-expression plasmids. Three days later, media was transferred to JC53BL-13 in presence or absence of serially diluted antisera. Two days later, cells were lysed and luciferase activity in measured.

Figure 3B shows data on detection of XMRV neutralizing antibodies in patient serum and receptor expression of reporter cells. Relative neutralization (percentage of control) calculated by dividing number of luciferase units at each serum dilution by values in wells containing no test serum and subtracting that value from values in wells containing no test serum. Samples tested in triplicate; error bars represent standard deviation.

Figure 3C shows detection of XPR1 receptor expression in JC53BL-13 cells.

Figure 4 is a graph depicting % neutralization of patient samples. Serum from 20 QQ patients, 10 RQ patients, and 10 RR patients analyzed for neutralizing activity.

Horizontal lines represent average percentage of neutralization of samples tested.

Figure 5 illustrates a schematic of 8,185 nt XMRV genome. Black boxes indicate ORFs encoding Gag, Gag-Pro-Pol, and Env polyproteins. The SD and SA sites correspond to the singly-spliced 3.2-kb Env and 1.2-kb doubly-spliced transcript. LTR regions (R, U5, U3) are indicated with boxes.

Figure 6 A shows data on RT-PCR of uninfected (lane 1) or infected DU145 cells at 6 hrs (lane 2), 6 days (lane 3), and 15 days (lane 4) after infection. RT-PCR of actin was used as a control.

Figure 6B shows data on RT-PCR of infected CHO (negative control), DU145, LNCaP, PC3, Pt-C, Pfl79T, Pt-N, Epl56T, lanes 1-8, respectively. RT-PCR of actin used as a control.

Figure 6C shows data of Northern blot, uninfected DU145 (lane 1) and DU145- C7 (lane 2) cell lines. Actin probe was used as a control. Figure 6D shows data of RT-PCR of DU145-C7 (lane 1), mock infected DU145 (lane 2), DU145 and LNCaP infected with XMRV-VP62 transfection medium (lanes 3 and 4, respectively).

Figure 7 illustrates the putative SA nucleotide sequence of doubly-spliced transcript (SEQ ID NO: 22).

Figure 8 A shows a schematic of VP62-Env-HA and expected HA-tagged proteins.

Figure 8B is a Western blot of mock transfected DU145 cells (lane 1) and DU145 cells transfected with untagged pVP62 (lane 2), used as negative controls. Presence of the expected gp75-FJA, pl5e-HA, and OrO -HA are demonstrated in DU145 cells at -75- kDa, ~20-kDa, and ~15-kDa, respectively (lane 3). OrO-HA was observed at a molecular weight of ~15-kDa rather than the predicted 11-kDa likely resulting from basic HA-tag residues and small molecular weight of OrO causing altered SDS-PAGE mobility.

Figure 8C is the ninety- five amino acid sequence of OrO (SEQ ID NO: 21). Candidate RNA-binding, NLS and NES residues are shown in red and underlined, respectively. The OrO sequence is a truncated version of in that found in the envelope protein derived XMRV singly spiced transcript.

Figure 8D is a Western blot using anti-GFP antibody to detect OrO-GFP. Lane 1, mock transfected DU145 cells, and lane 2, expression of the GFP protein from the pEGFP vector only. The presence of OrO-GFP is shown at 24 (lane 3), 48 (lane 4) and

72 hrs (lane 5) post-transfection.

Figure 9A shows data that the doubly spliced transcript of XMRV transforms NIH-3T3 cells. Mock transfected (lane 1), DU145-C7 (lane 2), pOrO (lane 3), pDSV (lane 4), and pEnv (lane 5) expression was confirmed by RT-PCR. (c)

Figure 9B shows the averaged results (n=20) from vector and NIH-3T3 cells alone (negative control), pDSV, and pOrO. Error bars represent standard errors of the mean. P-values were calculated comparing pDSV or pOrO to the negative controls using the 2-tailed Student's t-test.

Figure 10 depicts the nucleic acid sequence of the doubly spliced XMRV transcript (SEQ ID NO: 20). Figure 11 shows data on the production of infectious virus from pVP62-Env-HA. RT-PCR was performed to detect presence of viral RNA in DU145 transfected with pVP62-Env-HA (lane 2). Cultured trans fection medium was used to infect DU145 (lane 3) and LNCaP (lane 4) cell lines. Lane 1, mock transfected DU145 cells.

Figure 12A shows constructs used in assay experiments with pEGFP-N3 vector containing Orf3.

Figure 12B shows constructs used in assay experiments with pcDNA3.1(+) vector containing Orf3.

Figure 12C shows constructs used in assay experiments with full-length doubly- spliced transcript (DSV) containing flanking LTRs.

Figure 12D shows constructs used in assay experiments with Env.

Figure 13 shows primers that span the splice junction site of the doubly spliced variant.

Figure 14 shows the nucleic acid sequence within the doubly spliced transcript encoding Orf3 (between the start and stop codons, SEQ ID NO: 41).

Figure 15 shows the sequence of the polypeptide related to MXRV envelope protein (gp75) of the singly spliced transcript (SEQ ID NO: 48) without Orf 3 sequence.

Figure 16 shows the sequence of the polypeptide related to MXRV envelope protein (p15e) of the singly spliced transcript (SEQ ID NO: 49) without Orf 3 sequence.

DETAILED DESCRIPTION

Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.

It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

An "amino acid" as used herein is meant to include both natural and synthetic amino acids, and both D and L amino acids. "Standard amino acid" means any of the twenty L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid residues" means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source. As used herein, "synthetic amino acid" also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions. Amino acids contained within the peptides, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or

substitution with other chemical groups which can change a peptide's circulating half life without adversely affecting activity of the peptide. Additionally, a disulfide linkage may be present or absent in the peptides.

"About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

The term "antigen" or "Ag" refers to a molecule that provokes an immune response. The immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an "antigen" as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a "gene" at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.

"Antisense" refers particularly to the nucleic acid sequence of the non-coding strand of a double stranded nucleic acid molecule encoding a polypeptide, or to a sequence which is substantially homologous to the non-coding strand. As defined herein, an antisense sequence is complementary to the sequence of a double stranded nucleic acid molecule encoding a polypeptide. It is not necessary that the antisense sequence be complementary solely to the coding portion of the coding strand of the nucleic acid molecule. The antisense sequence may be complementary to regulatory sequences specified on the coding strand of a nucleic acid molecule encoding a polypeptide, which regulatory sequences control expression of the coding sequences.

The term "antibody," as used herein, refers to an immunoglobulin molecule which specifically binds to the epitope of an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunereactive portions of intact immunoglobulins. Antibodies are typically tetramers of

immunoglobulin molecules. The antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)₂, as well as single chain antibodies and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al, 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al, 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al, 1988, Science 242:423-426).

The term "cancer" as used herein is defined as disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like. "Chromatography" refers to processes used to purify individual components from mixtures by passing a mixture contained in a "mobile phase" through a "stationary phase," which separates the analyte to be measured from other components in the mixture. Ion exchange chromatography, liquid chromatography, normal-phase (NP) and reversed-phase chromatography (RP), affinity chromatography, and expanded bed adsorption (EBA) chromatograph all use separation mediums. In ion exchange chromatography, the separation medium is typically an ion exchange resin that carries charged functional groups which interact with oppositely charged groups of the compound to be retained. In affinity chromatography, the separation medium is typically a gel matrix, often of agarose, typically coupled with metals or molecules that bind with markers or tags such antigens, antibodies, enzymes, substrates, receptors, and ligands. Methods utilizing antibodies or antigens (epitopes) coupled to the separation medium is typically referred to as immunoaffinity chromatography and the separation medium is referred to as an immunoabsorbant.

Liquid chromatography (LC) is a separation technique in which the mobile phase is a liquid. Typical separation mediums for liquid column chromatography include silica gel, alumina, and cellulose powder. Liquid chromatography can be carried out under a relatively high pressure is referred to as high performance liquid chromatography (HPLC). HPLC is historically divided into two different sub-classes based on the polarity of the mobile and stationary phases. The technique in which the stationary phase is more polar than the mobile phase (e.g. toluene as the mobile phase, silica as the stationary phase) is called normal phase liquid chromatography (NPLC) and the opposite (e.g. water-methanol mixture as the mobile phase and C18 = octadecylsilyl as the stationary phase) is called reversed phase liquid chromatography (RPLC).

A "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.

A "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g. , amino acid residues in a protein export signal sequence).

"Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.

"Effective amount" or "therapeutically effective amount" are used

interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result. Such results may include, but are not limited to, the inhibition of virus infection as determined by any means suitable in the art.

As used herein "endogenous" refers to any material from or produced inside an organism, cell, tissue or system.

The term "epitope" as used herein is defined as a small chemical molecule on an antigen that can elicit an immune response, inducing B and/or T cell responses. An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly five amino acids and/or sugars in size. One skilled in the art understands that generally the overall three-dimensional structure, rather than the specific linear sequence of the molecule, is the main criterion of antigenic specificity and therefore distinguishes one epitope from another.

As used herein, the term "exogenous" refers to any material introduced from or produced outside an organism, cell, tissue or system.

The term "expression" as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.

"Expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the

recombinant polynucleotide.

As used herein, the term "fragment," as applied to a nucleic acid, refers to a subsequence of a larger nucleic acid. A "fragment" of a nucleic acid can be at least about 15 nucleotides in length; for example, at least about 50 nucleotides to about 100 nucleotides; at least about 100 to about 500 nucleotides, at least about 500 to about 1000 nucleotides, at least about 1000 nucleotides to about 1500 nucleotides; or about 1500 nucleotides to about 2500 nucleotides; or about 2500 nucleotides (and any integer value in between).

As used herein, the term "fragment," as applied to a protein or peptide, refers to a subsequence of a larger protein or peptide. A "fragment" of a protein or peptide can be at least about 20 amino acids in length; for example at least about 50 amino acids in length; at least about 100 amino acids in length, at least about 200 amino acids in length, at least about 300 amino acids in length, and at least about 400 amino acids in length (and any integer value in between).

"Homologous" as used herein, refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, men they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (eg., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous. By way of example, the DNA sequences 5'-ATTGCC-3' (SEQ ID N0.38) and 5'-TATGGC-3'(SEQ ID NO: 39) share 50% homology.

The term "immunoglobulin" or "Ig", as used herein is defined as a class of proteins, which function as antibodies. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody that is present in body secretions, such as saliva, tears, breast milk, gastrointestinal secretions and mucus secretions of the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response in most mammals. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in defense against bacteria and viruses. IgD is the immunoglobulin that has no known antibody function, but may serve as an antigen receptor. IgE is the immunoglobulin that mediates immediate hypersensitivity by causing release of mediators from mast cells and basophils upon exposure to allergen.

"Isolated" means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protem can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.

An "isolated nucleic acid" refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, i.e., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, i.e., the sequences adjacent to the fragment in a genome in which it naturally occurs. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, i.e., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (i.e., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.

As used herein, the term "marker" is used broadly to encompass a variety of types of molecules which are detectable through spectral properties (e.g. fluorescent markers or "fluorophores") or through functional properties (e.g. affinity markers). A representative affinity marker includes biotin, which is a ligand for avidin and streptavidin. An epitope marker or "epitope tag" is a marker functioning as a binding site for antibody. Since chimeric receptor proteins and antibodies can be produced by recombinant methods. Receptor ligands are effective affinity markers.

In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

The term "operably linked" refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

"Pseudotyped virus" as used herein refers to changing the plasmid encoding the expression of an envelope protein thereby changing the host range and tissue tropism of a viral vector.

"Parenteral" administration of an immunogenic composition includes, e.g., subcutaneous (s.c), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques. The term "polynucleotide" as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric "nucleotides." The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.

As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified

polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

"Pharmaceutically acceptable" refers to those properties and/or substances which are acceptable to the patient from a pharmacological/toxicological point of view and to the manufacturing pharmaceutical chemist from a physical/chemical point of view regarding composition, formulation, stability, patient acceptance and bioavailability. "Pharmaceutically acceptable carrier" refers to a medium that does not interfere with the effectiveness of the biological activity of the active ingredient(s) and is not toxic to the host to which it is administered. "Primer" refers to a polynucleotide that is capable of specifically hybridizing to a designated polynucleotide template and providing a point of initiation for synthesis of a complementary polynucleotide. Such synthesis occurs when the polynucleotide primer is placed under conditions in which synthesis is induced, i.e., in the presence of nucleotides, a complementary polynucleotide template, and an agent for polymerization such as DNA polymerase. A primer is typically single-stranded, but may be double-stranded. Primers are typically deoxyribonucleic acids, but a wide variety of synthetic and naturally occurring primers are useful for many applications. A primer is complementary to the template to which it is designed to hybridize to serve as a site for the initiation of synthesis, but need not reflect the exact sequence of the template. In such a case, specific hybridization of the primer to the template depends on the stringency of the hybridization conditions. Primers can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.

"Probe" refers to a polynucleotide that is capable of specifically hybridizing to a designated sequence of another polynucleotide. A probe specifically hybridizes to a target complementary polynucleotide, but need not reflect the exact complementary sequence of the template. In such a case, specific hybridization of the probe to the target depends on the stringency of the hybridization conditions. Probes can be labeled with, e.g., chromogenic, radioactive, or fluorescent moieties and used as detectable moieties.

As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.

The term "R A" as used herein is defined as ribonucleic acid.

The term "recombinant DNA" as used herein is defined as DNA produced by joining pieces of DNA from different sources.

The term "recombinant polypeptide" as used herein is defined as a polypeptide produced by using recombinant DNA methods. A "separation medium" refers to a stationary phase, gel, or adsorbent. In certain embodiments, the invention relates to analysis of samples using chromatographic processes or gel electrophoresis. Electrophoresis is a procedure which enables the sorting of molecules based on size and charge. An electromotive force (EMF) is used to move the molecules through the gel. The gel is typically a crosslinked polymer. When separating proteins or nucleic acids (DNA, R A, or oligonucleotides) the gel is usually composed agarose or acrylamide, and a cross-linker. Proteins are usually denatured in the presence of a detergent such as sodium dodecyl sulfate/sodium dodecyl phosphate (SDS/SDP) that coats the proteins with a negative charge. Proteins may be analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), by native gel electrophoresis, by quantitative preparative native continuous polyacrylamide gel electrophoresis (QPNC-PAGE), or by 2-D electrophoresis.

The term "similarity" between two polynucleotides or polypeptides refers to the number of matched nucleotides or amino acids in a sequence for the optimal comparison window divided by the total number of nucleotides or amino acids in the larger of the two sequences, i.e., ratio of matches to largest total length. For example, the Orf3 (SEQ ID NO: 21) sequence has 95 amino acids in common with envelope protein of XMRV of VP62. This protein has a total of 645 amino acids. See GenBank Accession Number: YP_512363. The similarity ratio is 95 divided by 645 - the similarity is 14.7%.

In another example, the OrO sequence has 94 amino acids in common with punitive envelope protein, EG622147, found in the cDNA collected from a house mouse. This punitive protein has a total of 325 amino acids. See GenBank Accession Number: AAH28259. The similarity ratio is 94 divided by 325 - the similarity is 28.9%

In another example, the OrO sequence has 84 amino acids in common with an envelope protein of the neuroblastoma derived Mycn v-myc myelocytomatosis viral related oncogene. This protein has a total of 110 amino acids. See GenBank Accession Number: AAA39832. The similarity ratio is 84 divided by 110 - the similarity is 76%.

In another example, the OrO sequence has 83 amino acids in common with conceptual translation of a mouse envelope protein of GenBank Accession Number AAA37563. This protein has a total of 84 amino acids. The ratio is 83 divided by 95, and the similarity is 87%. The term "therapeutic" as used herein means a treatment and/or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.

The term "treatment" as used within the context of the present invention is meant to include therapeutic treatment as well as prophylactic, or suppressive measures for the disease or disorder. Thus, for example, the term treatment includes the administration of an agent prior to or following the onset of a disease or disorder thereby preventing or removing all signs of the disease or disorder. As another example, administration of the agent after clinical manifestation of the disease to combat the symptoms of the disease comprises "treatment" of the disease. This includes for instance, prevention of XMRV propagation to uninfected cells of an organism.

The term "transfected" or "transformed" or "transduced" as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A "transfected" or "transformed" or "transduced" cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

The phrase "under transcriptional control" or "operatively linked" as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.

"Variant" as the term is used herein, is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively, but retains essential properties of the reference molecule.

Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical. A variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.

As used herein, "vaccination" is intended for prophylactic or therapeutic vaccination.

A "vector" is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.

Numerous vectors are known in the art including, but not limited to, linear

polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.

The term "virus" as used herein is defined as a particle consisting of nucleic acid (RNA or DNA) typically enclosed in a protein coat, with or without an outer lipid envelope, which is capable of replicating within a whole cell.

Compositions

Disclosed herein is an assay that can detect an immune response against XMRV. In one embodiment, the invention includes an assay that can detect neutralizing antibodies directed against XMRV in a biological sample. In another embodiment, the invention includes an assay that can detect a T cell mediated response directed against XMRV in a biological sample.

A component of the assay includes the use of a pseudotyped virus. Accordingly, in certain embodiments, the invention relates to a composition comprising a lentiviral- XMRV pseudovirus. Preferably, the lentivirus is HIV. By way of example, a pseudovirus expressing an XMRV surface antigen is constructed by transfecting a host cell with one or more plasmids comprising a nucleotide sequence encoding a necessary component of the pseudovirus. Generally the vectors are plasmid-based or virus-based, and are configured to carry the essential sequences for incorporating foreign nucleic acid, for selection (e.g., selection marker) and for transfer of the nucleic acid into a host cell.

Accordingly, the invention includes methods for generating a pseudovirus in several ways. In one embodiment, a host cell is transfected with multiple plasmids. The first plasmid comprises a nucleotide sequence encoding a modified lentiviral genome.

The modified lentiviral genome is replication-defective.

In further embodiments, a second plasmid comprises a nucleotide sequence that encodes an XMRV surface protein, typically, an envelope protein. The envelope protein(s) allows transduction of cells of human and other species.

The vector providing the nucleic acid sequence encoding viral envelope proteins is associated operably with regulatory sequences, e.g. , a promoter or enhancer. The regulatory sequence can be any eukaryotic promoter or enhancer, including for example, the Moloney murine leukemia virus promoter-enhancer element, the human

cytomegalovirus enhancer or the vaccinia P7.5 promoter, etc. In some cases, the promoter-enhancer elements are located within or adjacent to the LTR sequences.

In another embodiment, the invention relates to generating a lentiviral-XMRV pseudovirus by transfecting host cells with a single vector. Accordingly, the invention includes a plasmid comprising a nucleotide sequence encoding a modified lentivirus and an in-frame XMRV surface protein. For example, the plasmid can comprise a nucleotide sequence encoding a modified lentivirus and an XMRV surface protein under

transcriptional control of a single promoter. Alternatively, the plasmid can comprise a nucleotide sequence encoding a modified lentivirus and an XMRV surface protein under transcriptional control of separate promoters.

Using the information provided herein, the XMRV surface proteins can be produced by recombinant methods using standard techniques well known to those of skill in the art or produced by a host cell in vivo. For example, the sequences of XMRV can be used to engineer the desired pseudovirus. The nucleic acid sequence may be optimized to reflect particular codon "preferences" for various expression systems according to methods known in the art.

The biological activity of the pseudovirus of the invention is the ability of the lentiviral XMRV pseudovirus to infect human cells, either in vivo or in vitro. In some aspects, the biological activity refers to both the ability of the XMRV surface proteins to be incorporated into the HIV surface as well as infection of cells.

For certain embodiments, the invention also encompasses a cell type appropriate for transfection with the above plasmids. Recipient cells capable of expressing the gene products are transfected with the genes. The transfected recipient cells are cultured under conditions that permit expression of the incorporated genes such that when plasmid(s) encoding XMRV surface proteins are overexpressed in conjunction with the modified HIV-1 genome, with or without a reporter gene, they are co-assembled on the cell surface, essentially packaging XMRV surface proteins into HIV particles, creating a lentiviral XMRV pseudovirus. Infectious pseudotype virus is harvested directly from the culture medium.

Any cell or cell line that can be transduced with a lentiviral vector particle can be used in the invention. Examples of such cells include, but are not limited to: Jurkat cells (a human T cell line), H9 cells (human T-lymphoid cell line), A3.01 cells (human T- lymphoid cell line), C8166 cells (human T-lymphoid cell line), COS-7 cells (an African green monkey fibroblast cell line), human peripheral blood lymphocytes (PBLs), monkey PBLs, feline PBLs, a feline CD4+ T cell line, 293 cells (a human kidney fibroblast cell line), 293T cells (a human kidney fibroblast cell line), mammalian peripheral blood dendritic cells, mammalian hepatocytes, human mast cell progenitors, mammalian macrophages, mammalian follicular dendritic cells, mammalian epidermal Langerhans cells, mammalian megakaryocytes, mammalian microglia, mammalian astrocytes, mammalian oligodendroglia, mammalian CD8+ cells, mammalian retinal cells, mammalian renal epithelial cells, mammalian cervical cells, mammalian rectal mucosa cells, mammalian trophoblastic cells, mammalian cardiac myocytes, human

neuroblastoma cells, mammalian CD4+ cells, mammalian hematopoietic stem cells, mammalian glial cells, adult mammalian neural stem cells, mammalian neurons, mammalian lymphocytes, and mammalian fibroblasts. Lists of CD4+ and CD4- cell types which are infectable by HIV have been compiled (see, Rosenburg and Fauci, 1989, Adv. Immunol. 47:377-431; and Connor and Ho, 1992, in AIDS: etiology, diagnosis, treatment, and prevention, 3rd edition, Hellman and Rosenburg (eds) Lippincoft,

Philadelphia. Also see Vigna and Naldini, 2000, J. Gene Med. 5:308-316). Methods of introducing and expressing genes into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art. For example, the expression vector can be transferred into a host cell by physical, chemical, or biological means.

Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the nucleic acid, in order to confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, reverse transcription polymerase chain reaction (RT-PCR) and PCR; "biochemical" assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots).

Following the generation of the lentivirus XMRV pseudotyped virus, lentivirus XMRV pseudotype can be used in a wide range of experimental and/or therapeutic purposes.

With respect to therapeutic purposes, the lentivirus XMRV pseudovirus can be used for prostate cancer targeted therapy. The lentivirus XMRV pseudovirus of the present invention may be used in the prevention and/or treatment of any disease requiring targeting of prostate cancer.

In certain embodiments, the invention encompasses administration of the compositions to elicit over time a protective immune response. Thus, for certain embodiments, the invention allows for a single injection of such an XMRV lentivirus to possibly confer resistance to XMRV infection for a lifetime, i.e., vaccination.

Diagnostic Assay for XMRV

In certain embodiments, the invention relates to an assay that can identify an immune response against XMRV infection. In one aspect, the assay can be used to detect a B cell response against XMRV infection. In another aspect, the assay can be used to detect a T cell response against XMRV infection. In this aspect, the invention also includes a method of detecting XMRV-specific T cells. In one embodiment, the invention relates to an assay for detecting neutralizing antibodies directed against XMRV in a biological sample. The disclosure presented herein demonstrate that detection of XMRV neutralizing antibodies was found to correlate with other independent methods of detecting viral nucleotide sequences in prostatic tissue. The presence of host antibody response against XMRV demonstrates the applicability of a serologic test for prior or existing infection with XMRV.

In one embodiment, the invention is directed to a method for conducting an assay for detecting a neutralizing antibody against XMRV in a biological sample where the antibody is specific for (recognize and bind to) a target molecule derived from XMRV. Preferably, the target molecule is derived from XMRV Env. In some instances, the

XMRV Env is in the context of an HIV-1 virion that is pseudotyped with XMRV Env (e.g., XMRV -HIV). Thus, a primary target for neutralizing antibody is the XMRV envelope glycoprotein. However, the invention should not be limited to XMRP envelope glycoprotein. Rather, any epitope associated with XMRV can be used to generate a desirable XMRV-HIV pseudovirus. Accordingly, the neutralizing assay can be used to detect the presence of a predetermined target used to generate the XMRV-HIV pseudovirus.

In one embodiment, the invention involves preparing a serial dilution of a biological sample, which is preferably a sample taken from blood (serum) of a mammalian subject, and adding to each dilution a fixed amount of infectious units of pseudotyped virus in order to allow for the generation of a virus-antibody mixture. The virus-antibody mixture is then added to cells that are susceptible to HIV infection which has been engineered to contain an integrated reporter gene. Preferably, the integrated reporter gene is under control of an HIV-1 long-terminal repeat sequence. Therefore, the level of readout generated by the reporter gene is an indication of the amount of infectious virus. That is, reporter gene expression is directly proportional to the amount of pseudovirus used to infect the cells.

For determining XMRV neutralizing antibody, the level of readout generated by the reporter gene is an indication of the presence of neutralizing antibody. That is, relative neutralization can be calculated by dividing the number of reporter readout units in a test sample by the values containing control serum (e.g., no test serum) and subtracting that value from the values containing no test serum.

The assay to detect XMRV neutralizing antibody is a type of reporter gene assay, which involves measuring the level of reporter gene product upon contact of a test sample with a cell line having a reporter gene, to determine the amount of infectivity of the

XMRV-HIV pseudotype (ability of any remaining target molecules not neutralized by antibodies). The assay also include determining whether the test sample provides a lower reporter gene readout compared to the reporter gene readout from an otherwise identical sample having a control antibody or no antibody at all. If the test sample comprises neutralizing antibodies against XMRV, there is relatively less virus for infecting the cells, and therefore there is less readout of the reporter gene.

Neutralizing antibody assays are clinically important because it provides the ability to detect an immune response elicited against prior or existing XMRV infection. The neutralization assay method may be more accurate and more sensitive compared to prior art methods. The assay also is beneficial because only a small amount of antibody is needed in the assay for detecting XMRV neutralizing antibody.

In some instances, the neutralizing assay can be applicable to evaluating neutralizing antibodies generated in a mammalian subject treated with an XMRV vaccine. The neutralizing assay can be used to determine the degree of protection afforded by vaccination.

In certain embodiments, the sample which is assayed is a biological fluid of a mammalian subject, preferably a human subject, in which antibodies are present, such as blood. Most preferably the sample is serum.

In certain embodiments, the cell line used may be any mammalian cell line, preferably a human cell line. Preferably, the cell line is susceptible to HIV infection and engineered to contain an integrated reporter gene. Preferably, the integrated reporter gene is under control of an HIV-1 long-terminal repeat sequence. Preferred cell lines include but are not limited to, Jc53BL-13 cell line. Other applicable cell lines include, but are not limited to, cancer cell lines, myeloid, T-cell lymphoma, breast

adenocarcinoma cell lines, and prostate cancer cell lines. In certain embodiments, the reporter gene carried by the cell is a DNA molecule that includes a nucleotide sequence encoding a reporter gene product, i.e., marker, operatively linked to transcriptional control elements/sequences. Transcription of the reporter gene is controlled by these sequences. Preferably, the reporter gene is under control of an HIV-1 long-terminal repeat sequence. The activity of at least one or more of these control sequences is directly regulated by infectivity of the XMRV-HIV pseudovirus. This is because the reporter gene expression is stimulation upon at least the Tat protein of HIV-1, which is associated with HIV infection. The reporter gene expression read out directly correlates with amount of infections virus.

The transcriptional control sequences include but are not limited to promoters and other regulatory regions, such as enhancer sequences and repressor and activator binding sites, that modulate the activity of the promoter, or control sequences that modulate the activity or efficiency of the RNA polymerase that recognizes the promoter, or control sequences that are recognized by effector molecules. For example, modulation of the activity of the promoter may be effected by altering the RNA polymerase binding to the promoter region, or, alternatively, by interfering with initiation of transcription or elongation of the mRNA. Such sequences are herein collectively referred to as transcriptional control elements or sequences. In addition, the construct may include sequences of nucleotides that alter translation of the resulting mRNA, thereby altering the amount of reporter gene product expressed.

The reporter gene product, whose level is a measurement of infections virus, may be RNA or protein, as long as it is readily detectable. For instance, firefly luciferase, Gaussia luciferase and Metridia luciferase, enhanced green fluorescent protein (EGFP) and jellyfish aequorin are typical markers as reporter gene products. In the case of the enzyme firefly luciferase and jellyfish aequorin, the result of its enzymatic activity, light, is detected and measured using a luminometer, whereas in the case of EGFP, a fluorescence activated cell sorter or analyzer (FACS) can be used at an appropriate wavelength to detect and quantify the amount of EGFP expressed in a cell. Non- limiting examples of other suitable reporter gene products include dsRED, chloramphenicol acetyl transferase (CAT) other enzyme detection systems, such as β-galactosidase, bacterial luciferase, alkaline phosphatase, and bacterial or humanized β-lactamase. Methods of introducing and expressing genes into a cell are known in the art. In the context of an expression vector, the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art. For example, the expression vector can be transferred into a host cell by physical, chemical, or biological means.

Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection,

electroporation, and the like.

Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.

Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome {e.g., an artificial membrane vesicle).

In the case where a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo or in vivo). In another aspect, the nucleic acid may be associated with a lipid. The nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid. Lipid, lipid/DNA or lipid/expression vector associated compositions are not limited to any particular structure in solution. For example, they may be present in a bilayer structure, as micelles, or with a "collapsed" structure. They may also simply be interspersed in a solution, possibly forming aggregates that are not uniform in size or shape.

In certain embodiments, the invention relates to methods of identifying the OrO protein or OrO mRNA. One embodiment of the invention is directed to methods for detecting OrO translated in a translation system. See U.S. Patent Numbers 7,423,122, 7,563,598, and 7,524,941. A sample for evaluation of OrO mRNA can be expressed by translation in a cellular or cell-free translation system can be evaluated as a nascent protein and consequently, labeled, detected and isolated. In certain embodiments, the invention contemplates an assay wherein two or three markers (preferably N-terminal and C-terminal epitopes) are introduced into OrO and are detected by mass spectrometry.

In certain embodiments, the translational systems are grown in 13C depleted glucose (99.9% 12C), 15N depleted ammonium sulfate (99.95% 14N) and used to generate OrO with containing isotopically depleted amino acids. In certain embodiments the invention relates to methods, comprising introducing a nucleic acid sequence encoding OrO into an in vitro translation system comprising isotopically-depleted amino acids under conditions such that OrO is produced comprising isotopically-depleted amino acids; and determining the molecular mass of said OrO protein by mass spectrometry.

Typically the isotopically-depleted amino acids are C13- and/or N15-depleted.

Cell-free translation systems are commercially available and many different types and systems are well-known. Examples of cell-free systems include prokaryotic lysates such as Escherichia coli lysates, and eukaryotic lysates such as wheat germ extracts, insect cell lysates, rabbit reticulocyte lysates, frog oocyte lysates and human cell lysates.

Eukaryotic extracts or lysates may be preferred when the resulting protein is glycosylated, phosphorylated or otherwise modified. Some of these extracts and lysates are available commercially (Promega; Madison, Wis.; Stratagene; La Jolla, Calif;

Amersham; Arlington Heights, III; GIBCO/BRL; Grand Island, N.Y.). Less than 10 nano liters of a commercially available E. coli extract (E. coli T7 translation system, Promega, Madison, Wise.) are needed for analysis corresponding to less than 1 ng of synthesized protein. Membranous extracts, such as the canine pancreatic extracts containing microsomal membranes, are also available which are useful for translating secretory proteins. Mixtures of purified translation factors have also been used successfully to translate mRNA into protein as well as combinations of lysates or lysates supplemented with purified translation factors such as initiation factor- 1 (IF-1), IF-2, IF-

3, elongation factor T (EF-Tu), or termination factors.

In certain embodiments, the nascent protein is detected using misaminoacylated tRNA. A tRNA molecule is typically charged with an amino acid conjugated to a fluorescent marker to create a misaminoacylated tRNA. Typically, the amino acid lysine is coupled through an amide bond with the free nitrogen on the side chain to a dye. The misaminoacylated, or charged, tRNA can be formed by chemical, enzymatic or partly chemical and partly enzymatic techniques which place a fluorescent marker into a position on the tRNA molecule from which it can be transferred into a growing peptide chain. Markers may comprise native or non-native amino acids with fluorescent moeities, amino acid analogs or derivatives with fluorescent moities, detectable labels, coupling agents or combinations of these components with fluorescent moieties.

The misaminoacylated tRNA is introduced to the translation system such as a cell-free extract, the system is incubated and the fluorescent marker incorporated into nascent proteins. A variety of fluorescent compounds are contemplated, including fluorescent compounds that have been derivatized (e.g. with NHS) to be soluble (e.g.

NHS-derivatives of coumarin). Nonetheless, compared to many other fluorophores with high quantum yields, several BODIPY compounds and reagents have been empirically found to have the additional important and unusual property that they can be incorporated with high efficiency into nascent proteins for both UV and visible excited fluorescence detection. Virus-Like Particles

In certain embodiments, the invention relates to an XMRV virus-like particle (VLP) that can be used to elicit an immune response in a mammal. It has been discovered that binding and neutralizing antibodies can be detected in the sera of a vaccinated mammal. In some instances, adenoviral vectors were used to generate the

XMRV VLP. That is, production of VLP in vivo occurs upon immunization with an adenovirus caring XMRV genes is administered to a mammal. XMRV genes that are carried by the adenovirus include, but are not limited to, env and gag genes.

For certain embodiments, the invention relates to methods useful for generating an XMRV-VLP. In some instances, gene products can be administered to mammals using adenoviral gene vectors. The ability to target an adenoviral vector and to administer repeatedly a therapeutic adenoviral vector in a clinical setting is useful in improving treatment efficacy and in enabling the treatment of diseases.

In certain embodiments, the present invention can be practiced with any suitable animal. Preferably the present invention is practiced with a mammal, more preferably, a human. Additionally, the adenoviral gene vector can be administered to any suitable tissue of the mammal.

Any suitable method can be used to induce systemic neutralizing antibodies to the XMRV-VLP generated from the adenoviral gene vector. Desirably, an antigen associated with XMRV is provided to the mammal by way of the XMRV-VLP to produce systemic neutralizing antibodies to the XMRV-VLP.

It has been discovered that a XMRV-VLP disclosed herein induce an immune response against XMRV. For example, when XMRV-VLP was administered to a mammal, antibodies against XMRV were detected.

Accordingly, polypeptides, polynucleotides, vectors, host cells and virus-like particles disclosed herein may be used in eliciting an immune response to XMRV. In this context, the compositions can be used as a vaccine against XMRV infection.

Accordingly, in certain embodiments, the invention also provides a method of treating or preventing XMRV infection in a human or animal which comprises administering to the human or animal in need thereof an effective amount of a polypeptide, a polynucleotide, a vector, a host cell, and/or virus-like particle of the invention. The vaccine may be administered in a single dose schedule, or preferably in a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination may be with 1-10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example, at 1 to 4 months for a second dose, and if needed, a subsequent dose(s) after several months. The dosage regimen will also be, at least in part, determined by the need of the individual and be dependent upon the judgment of the practitioner.

Accordingly, for certain embodiments, the invention relates to a method for the prevention of and/or the treatment of XMRV infection that comprises administration of the desired XMRV associated antigen (whether it be in the form of a polypeptide, a polynucleotide, a vector, a cell or a virus-like particle) of the invention to a patient in need thereof.

For certain embodiments, the invention relates to a recombinant adenovirus capable of infecting non-dividing cells as well as methods and means for making same. The virus is useful for the in vivo and ex vivo transfer and expression of nucleic acid sequences. Preferably, the adenovirus is engineered to caring XMRV env and gag genes. The ability of the adenoviral vector to caring XMRV genes to produce neutralizing antibody in a mammal is useful as an anti-XMRV vaccine. Splice Variant of XMRV

With regard to certain embodiments, the invention is based on the discovery of a novel doubly spliced XMRV transcript produced early during replication. The data disclosed herein demonstrate the isolation and characterization of a novel doubly spliced XMRV transcript. In certain embodiments, the invention also includes novel PCR primers for identifying novel doubly spliced XMRV transcript in a biological sample and novel methods useful for identifying novel doubly spliced XMRV transcript in a cell or tissue of interest.

In certain embodiments, the invention relates to a novel nucleic acid for a doubly spliced XMRV transcript as set for in SEQ ID NO: 20 and a protein encoded thereby, OrO with an amino acid sequence set forth in SEQ ID NO: 21. While the data disclosed herein demonstrates that the doubly spliced XMRV transcript and protein of the present invention are expressed in human prostate carcinoma cells, the invention is not limited to these, or any other cells or tissues. This is because the skilled artisan, based upon the disclosure provided herein, would understand that the nucleic acids disclosed herein can be expressed in other cells and tissues. Moreover, one skilled in the art when armed with the teachings provided herein would readily appreciate that homologs and variants of the novel doubly spliced XMRV transcript may be present in other cells and tissues.

The isolated nucleic acid relating to the doubly spliced XMRV transcript should be construed to include an RNA or a DNA sequence, and any modified forms thereof, including chemical modifications of the DNA or RNA which render the nucleotide sequence more stable when it is cell free or when it is associated with a cell. Chemical modifications of nucleotides may also be used to enhance the efficiency with which a nucleotide sequence is taken up by a cell or the efficiency with which it is expressed in a cell. Any and all combinations of modifications of the nucleotide sequences are contemplated.

Further, any number of procedures may be used for the generation of mutant, derivative or variant forms of the doubly spliced XMRV transcript using recombinant DNA methodology well known in the art such as, for example, that described in

Sambrook et al. (2001, In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York).

In certain embodiments, the invention includes a nucleic acid associated with a doubly spliced XMRV transcript wherein a nucleic acid encoding a tag/marker polypeptide is covalently linked thereto. That is, in certain embodiments, the invention encompasses a recombinant nucleic acid wherein the nucleic acid encoding the tag polypeptide is covalently linked to the nucleic acid of the doubly spliced XMRV transcript. Such tag polypeptides are well known in the art and include, for instance, green fluorescent protein (GFP), myc, myc-pyruvate kinase (myc-PK), His₆, maltose binding protein (MBP), an influenza virus hemagglutinin tag polypeptide, a flag tag polypeptide (FLAG), isopeptag (Spy0128 residues 293-308: TDKDMTITFTNKKDAE, SEQ ID NO: 42), S-Tag (KETAAAKFERQHMDS, SEQ ID NO: 44 derived from pancreatic ribonuclease A), Softag 1 (SLAELLNAGLGGS, SEQ ID NO: 45), Softag 3

(TQDPSRVG, SEQ ID NO: 46), SBP-tag, (MDEKTTGWRGGHVVEG LAGELEQLRARLEHHPQGQREP, SEQ ID NO: 46), Strep-tag (WSHPQFEK, SEQ ID NO: 47) and a glutathione-S-transferase (GST) tag polypeptide. However, certain embodiments of the invention should in no way be construed to be limited to the nucleic acids encoding the above-listed tag polypeptides. Rather, any nucleic acid sequence encoding a polypeptide which may function in a manner substantially similar to these tag polypeptides should be construed to be contemplated. Further, addition of a tag polypeptide facilitates isolation and purification of the "tagged" protein such that the protein can be produced and purified readily.

Modified nucleic acid sequences, i.e., nucleic acid having sequences that differ from the nucleic acid sequences encoding naturally-occurring protein, are also contemplated, so long as the modified nucleic acid still encodes a protein having the same biological activity as the doubly spliced XMRV transcript. These modifications included those caused by point mutations, modifications due to the degeneracy of the genetic code or naturally occurring allelic variants, and further modifications that have been introduced by genetic engineering, i.e., by the hand of man.

Techniques for introducing changes in nucleotide sequences that are designed to alter the functional properties of the encoded proteins or polypeptides are well known in the art. Such modifications include the deletion, insertion, or substitution of bases, and thus, changes in the amino acid sequence. Changes can be made to increase the activity of a protein, to increase its biological stability or half-life, to change its glycosylation pattern, and the like. All such modifications to the nucleotide sequences encoding such proteins are contemplated.

Further, any number of procedures may be used for the generation of mutant, derivative or variant forms of nucleic acids disclosed herein using recombinant DNA methodologies well known in the art such as, for example, that described in Sambrook et al. (2001, In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York).

Procedures for the introduction of amino acid changes in a protein or polypeptide by altering the DNA sequence encoding the polypeptide are well known in the art and are also described in Sambrook et al. (2001, supra). Antisense Molecules, and Ribozymes

In certain situations, it may be desirable to inhibit expression of the doubly spliced XMRV transcript. The invention therefore includes compositions useful for inhibition of expression of the doubly spliced XMRV transcript. Thus, in certain embodiments, the invention includes an isolated nucleic acid complementary to a portion or all of a nucleic acid corresponding to the doubly spliced XMRV transcript which nucleic acid is in an antisense orientation to the doubly spliced XMRV transcript with respect to transcription.

One skilled in the art will appreciate that one way to decrease the levels of doubly spliced XMRV transcript and/or protein in a cell is to inhibit expression of the nucleic acid encoding the protein. Expression of the doubly spliced XMRV transcript may be inhibited using, for example, antisense molecules, and also by using ribozymes or double-stranded RNA as described in, for example, Wianny and Kernicka-Goetz (2000, Nature Cell Biol. 2:70-75).

Antisense molecules and their use for inhibiting gene expression are well known in the art (see, e.g., Cohen, 1989, In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRC Press). Antisense nucleic acids are DNA or RNA molecules that are complementary, as that term is defined elsewhere herein, to at least a portion of a specific mRNA molecule (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule thereby inhibiting the translation of genes.

The use of antisense methods to inhibit the translation of genes is known in the art, and is described, for example, in Marcus-Sakura (1988, Anal. Biochem. 172:289). Such antisense molecules may be provided to the cell via genetic expression using DNA encoding the antisense molecule as taught by Inoue (1993, U.S. Patent No. 5,190,931).

Alternatively, antisense molecules of the invention can be made synthetically and then provided to the cell. Antisense oligomers of between about 10 to about 30, and more preferably about 15 nucleotides, are preferred, since they are easily synthesized and introduced into a target cell. Synthetic antisense molecules include oligonucleotide derivatives known in the art which have improved biological activity compared to unmodified oligonucleotides (see Cohen, supra; Tullis, 1991, U.S. Patent No. 5,023,243, incorporated by reference herein in its entirety).

Ribozymes and their use for inhibiting gene expression are also well known in the art (see, e.g., Cech et al, 1992, J. Biol. Chem. 267: 17479-17482; Hampel et al, 1989, Biochemistry 28:4929-4933; Eckstein et al, International Publication No. WO 92/07065;

Altman et al., U.S. Patent No. 5,168,053, incorporated by reference herein in its entirety). Ribozymes are RNA molecules possessing the ability to specifically cleave other single- stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences encoding these RNAs, molecules can be engineered to recognize specific nucleotide sequences in an RNA molecule and cleave it (Cech,

1988, J. Amer. Med. Assn. 260:3030). A major advantage of this approach is that, because they are sequence-specific, only mRNAs with particular sequences are inactivated.

There are two basic types of ribozymes, namely, tetrahymena-type (Hasselhoff, 1988, Nature 334:585) and hammerhead-type. Tetrahymena-type ribozymes recognize sequences which are four bases in length, while hammerhead-type ribozymes recognize base sequences 11-18 bases in length. The longer the sequence, the greater the likelihood that the sequence will occur exclusively in the target mRNA species. Consequently, hammerhead-type ribozymes are preferable to tetrahymena-type ribozymes for inactivating specific mRNA species, and 18-base recognition sequences are preferable to shorter recognition sequences which may occur randomly within various unrelated mRNA molecules.

Isolated Polypeptides

In certain embodiments, the invention also includes an isolated polypeptide corresponding to the doubly spliced XMRV transcript, or a biologically active fragment thereof. In certain embodiments, the invention also provides for analogs of proteins or peptides of the polypeptide corresponding to the doubly spliced XMRV transcript.

Analogs may differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both.

For example, conservative amino acid changes may be made, which although they alter the primary sequence of the protein or peptide, do not normally alter its function.

Conservative amino acid substitutions typically include substitutions within the following groups:

glycine, alanine;

valine, isoleucine, leucine;

aspartic acid, glutamic acid;

asparagine, glutamine;

serine, threonine;

lysine, arginine;

phenylalanine, tyrosine.

Modifications (which do not normally alter primary sequence) include in vivo or in vitro chemical derivatization of polypeptides, e.g., acetylation, or carboxylation. Also included are modifications of glycosylation, e.g. , those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps; e.g., by exposing the polypeptide to enzymes which affect

glycosylation, e.g., mammalian glycosylating or deglycosylating enzymes. Also embraced are sequences which have phosphorylated amino acid residues, e.g. , phosphotyrosine, phosphoserine, or phosphothreonine.

Also included are polypeptides which have been modified using ordinary molecular biological techniques so as to improve their resistance to proteolytic degradation or to optimize solubility properties or to render them more suitable as a therapeutic agent. Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. The peptides of the invention are not limited to products of any of the specific exemplary processes listed herein.

In certain embodiments, the present invention should also be construed to encompass "mutants," "derivatives," and "variants" of the peptides disclosed herein (or of the DNA encoding the same) which are altered in one or more amino acids (or, when referring to the nucleotide sequence encoding the same, are altered in one or more base pairs) such that the resulting peptide (or DNA) is not identical to the sequences recited herein, but has the same biological property as the peptides disclosed herein, in that the peptide has biological/biochemical properties of Orf3.

Further, in certain embodiments, the invention should be construed to include naturally occurring variants or recombinantly derived mutants of the novel doubly spliced XMRV transcript, which variants or mutants render the protein encoded thereby either more, less, or similarly biologically active as the full-length clones.

Vectors

In other related aspects, the invention includes an isolated nucleic acid

corresponding to the doubly spliced XMRV transcript, wherein the nucleic acids is operably linked to a nucleic acid comprising a promoter/regulatory sequence such that the nucleic acid is capable of directing expression of the protein encoded by the nucleic acid. Thus, in certain embodiments, the invention encompasses expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2001, supra).

Expression of the doubly spliced XMRV transcript may be accomplished by generating a plasmid, viral, or other type of vector comprising the desired nucleic acid operably linked to a promoter/regulatory sequence, which serves to drive expression of the protein in cells in which the vector is introduced, as disclosed elsewhere herein.

Many promoter/regulatory sequences useful for driving constitutive expression of a gene are available in the art and include, but are not limited to, for example, the

cytomegalovirus immediate early promoter enhancer sequence, the SV40 early promoter, both of which were used in the experiments disclosed herein, as well as the Rous sarcoma virus promoter, and the like. Moreover, inducible and tissue specific expression of the nucleic acid encoding the receptor of the invention may be accomplished by placing the nucleic acid encoding the receptor, with or without a tag/marker, under the control of an inducible or tissue specific promoter/regulatory sequence. Examples of tissue specific or inducible promoter/regulatory sequences which are useful for this purpose include, but are not limited to the MMTV LTR inducible promoter, and the SV40 late

enhancer/promoter. In addition, promoters which are well known in the art which are induced in response to inducing agents such as metals, glucocorticoids, and the like, are also contemplated in the invention. Thus, it will be appreciated that, for certain embodiments, the invention includes the use of any promoter/regulatory sequence, which is either known or unknown, and which is capable of driving expression of the desired protein operably linked thereto. Expressing the Orf3 using a vector facilitates the isolation of large amounts of recombinantly produced protein.

Selection of any particular plasmid vector or other DNA vector is not a limiting factor and a wide plethora vectors are well-known in the art. Further, it is well within the skill of the artisan to choose particular promoter/regulatory sequences and operably link those promoter/regulatory sequences to a DNA sequence encoding a desired polypeptide. Such technology is well known in the art and is described, for example, in Sambrook, supra.

The invention also includes cells, viruses, proviruses, pseudovirus and the like, containing a nucleic acid corresponding to the novel doubly spliced XMRV transcript. The nucleic acid can be exogenously administered to a cell by a method which is well- known in the art. The nucleic acid can also be delivered to a cell, virus, or the like, by administering a vector comprising the nucleic acid to the cell, virus, or the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, e.g., Sambrook et al, supra.

Antibodies

The invention also includes an antibody that specifically binds a polypeptide corresponding to the novel doubly spliced XMRV transcript, or a biologically active fragment thereof.

In certain embodiments, the invention should not be construed as being limited solely one type of antibody. Rather, should be construed to include antibodies, as that term is defined elsewhere herein, that specifically bind to the doubly spliced XMRV transcript, or portions thereof. Further, in certain embodiments, the present invention should be construed to encompass antibodies, inter alia, that bind to the doubly spliced XMRV transcript and that are able to bind the doubly spliced XMRV transcript present on Western blots, in immunohistochemical staining of tissues thereby localizing Orf3 in the tissues, and in immunofluorescence microscopy of a cell transiently transfected with a nucleic acid encoding at least a portion of the polypeptide corresponding to the novel doubly spliced XMRV transcript.

One skilled in the art would appreciate, based upon the disclosure provided herein, that the antibody can specifically bind with any portion of the polypeptide corresponding to the novel doubly spliced XMRV transcript and the polypeptide can be used to generate antibodies specific therefor. However, in certain embodiments, invention is not limited to using the full-length polypeptide corresponding to the novel doubly spliced XMRV transcript as an immunogen. Rather, one contemplates using an immunogenic portion of the polypeptide corresponding to the novel doubly spliced

XMRV transcript to produce an antibody that specifically binds with the polypeptide corresponding to the novel doubly spliced XMRV transcript, i.e., immunizing an animal using an immunogenic portion, or antigenic determinant, of the polypeptide

corresponding to the novel doubly spliced XMRV transcript.

The antibodies can be produced by immunizing an animal such as, but not limited to, a rabbit or a mouse, with a protein, or a portion thereof, or by immunizing an animal using a protein comprising at least a portion of the polypeptide corresponding to the novel doubly spliced XMRV transcript. One skilled in the art would appreciate, based upon the disclosure provided herein, that smaller fragments of these proteins can also be used to produce antibodies that specifically bind the polypeptide corresponding to the novel doubly spliced XMRV transcript.

The skilled artisan would appreciate, based upon the disclosure provided herein, certain embodiments of the invention encompasses antibodies that neutralize and/or inhibit XMRV infectivity.

Certain embodiments of the invention encompass polyclonal, monoclonal, synthetic antibodies, and the like. One skilled in the art would understand, based upon the disclosure provided herein, that the crucial feature of the antibody is that the antibody bind specifically with the polypeptide corresponding to the novel doubly spliced XMRV transcript, i.e., recognizes the polypeptide corresponding to the novel doubly spliced XMRV transcript of the invention, or a biologically active fragment thereof (e.g., an immunogenic portion or antigenic determinant thereof), on Western blots, in immunostaining of cells, and immunoprecipitates the protein using standard methods well-known in the art.

Moreover, the antibody can be used to detect and or measure the amount of protein present in a biological sample using well-known methods such as, but not limited to, Western blotting and enzyme-linked immunosorbent assay (ELISA). The antibody can also be used to immunoprecipitate and/or immuno-affinity purify their cognate antigen using methods well-known in the art. Thus, by administering the antibody to a cell or to the tissue of an animal, or to the animal itself, the interactions between XMRV and its cognate receptor are therefore inhibited such that the infectivity of XMRV is also inhibited.

In some embodiments, the invention relates to pharmaceutical compositions comprising OrO antibodies and methods of administering these antibodies to treat subject diagnosed with XMRV.

In another embodiment, a monoclonal antibody is obtained from the non-human animal, and then modified, e.g., humanized, deimmunized, chimeric, may be produced using recombinant DNA techniques known in the art. A variety of approaches for making chimeric antibodies have been described. See, e.g., U.S. Patent No. 4,816,567 and U.S. Patent No. 4,816,397. Humanized antibodies may also be produced, for example, using transgenic mice that express human heavy and light chain genes, but are incapable of expressing the endogenous mouse immunoglobulin heavy and light chain genes. Winter describes an exemplary CDR-grafting method that may be used to prepare the humanized antibodies described herein (U.S. Patent No. 5,225,539). All of the CDRs of a particular human antibody may be replaced with at least a portion of a non-human CDR, or only some of the CDRs may be replaced with non-human CDRs. It is only necessary to replace the number of CDRs required for binding of the humanized antibody to a predetermined antigen.

Humanized antibodies or fragments thereof can be generated by replacing sequences of the Fv variable domain that are not directly involved in antigen binding with equivalent sequences from human Fv variable domains. Exemplary methods for generating humanized antibodies or fragments thereof are provided by U.S. Patent No.

5,585,089; U.S. Patent No. 5,693,761; U.S. Patent No. 5,693,762; U.S. Patent No. 5,859,205; and U.S. Patent No. 6,407,213. Those methods include isolating,

manipulating, and expressing the nucleic acid sequences that encode all or part of immunoglobulin Fv variable domains from at least one of a heavy or light chain. Such nucleic acids may be obtained from a hybridoma producing an antibody against a predetermined target, as described above, as well as from other sources. The recombinant

DNA encoding the humanized antibody molecule can then be cloned into an appropriate expression vector.

In certain embodiments, a humanized antibody is optimized by the introduction of conservative substitutions, consensus sequence substitutions, germline substitutions and/or backmutations. An antibody or fragment thereof may also be modified by specific deletion of human T cell epitopes or "deimmunization" by the methods disclosed in U.S. Patent No. 7,125,689 and U.S. Patent No. 7,264,806. Briefly, the heavy and light chain variable domains of an antibody can be analyzed for peptides that bind to MHC Class II; these peptides represent potential T-cell epitopes. For detection of potential T-cell epitopes, a computer modeling approach termed "peptide threading" can be applied, and in addition a database of human MHC class II binding peptides can be searched for motifs present in the VH and VL sequences. These motifs bind to any of the 18 major MHC class II DR allotypes, and thus constitute potential T cell epitopes. Potential T-cell epitopes detected can be eliminated by substituting small numbers of amino acid residues in the variable domains, or preferably, by single amino acid substitutions. Typically, conservative substitutions are made. Often, but not exclusively, an amino acid common to a position in human germline antibody sequences may be used. The V BASE directory provides a comprehensive directory of human immunoglobulin variable region sequences. These sequences can be used as a source of human sequence, e.g., for framework regions and CDRs. Consensus human framework regions can also be used, e.g., as described in U.S. Patent No. 6,300,064.

Nucleic Acid Interference of Orf3 Expression

In certain embodiments, the invention relates to compounds, compositions, and methods useful for modulating Orf3 expression using short interfering nucleic acid (siNA) molecules. Particular embodiments of the invention relate to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of Orf3.

RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) sometimes referred to as post-transcriptional gene silencing or RNA silencing. The presence of long dsRNAs in cells is thought to stimulate the activity of a ribonuclease III enzyme referred to as Dicer. Dicer is thought to be involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs). Short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control. The RNAi response is thought to feature an endonuclease complex containing a siRNA, commonly referred to as an RNA- induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence homologous to the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the guide sequence of the siRNA duplex. In addition, RNA interference is thought to involve small RNA (e.g., micro-RNA or miRNA) mediated gene silencing, presumably though cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences. As such, siNA molecules can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional level or post- transcriptional level.

RNAi has been studied in a variety of systems. Elbashir et al, 2001, Nature, 411,

494, describe RNAi induced by introduction of duplexes of synthetic 21 -nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells. Recent work in Drosophila embryonic lysates has revealed certain preferences for siRNA length, structure, chemical composition, and sequence that mediate efficient RNAi activity. These studies have shown that 21 nucleotide siRNA duplexes are typical when using two 2-nucleotide 3'-terminal nucleotide overhangs. Substitution of 3'-terminal siRNA nucleotides with deoxy nucleotides was shown to be tolerated. Other studies have indicated that a 5 '-phosphate on the target-complementary strand of an siRNA duplex is beneficial for siRNA activity and that ATP is utilized to maintain the 5 '-phosphate moiety on the siRNA. siRNA molecules lacking a 5'-phosphate are active when introduced exogenously.

A siNA can be unmodified or chemically-modified. A siNA can be chemically synthesized, expressed from a vector or enzymatically synthesized. Various chemically- modified synthetic short interfering nucleic acid (siNA) molecules are capable of modulating OrO expression or activity in cells by RNA interference (RNAi).

In one embodiment, the invention relates to a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of OrO, wherein said siNA molecule comprises about 15 to about 35 base pairs.

In some embodiments, the invention relates to methods of treating a subject infected with MXRV by administering a pharmaceutical composition with a double stranded nucleic acid with one strand comprising SEQ ID NO: 34 or SEQ ID NO: 35. In certain embodiments, the invention relates to treating a subject infected with XMRV comprising administering the pharmaceutical composition in combination with an OrO antibody.

In some embodiments, the invention relates to nucleic acids obtained by endo- ribonuclease prepared siRNA (esiRNA). A representative endo-ribonuclease is naturally isolated or recombinant bacterial RNase III. Upon purification, one uses the enzyme to generate esiRNAs. One can generate double stranded RNA of OrO mRNA by in vitro transcription. See. Yang et al, (2002), Proc. Natl. Acad. Sci. USA 99(15): 9942-9947. One uses the RNase III to digest the transcripts into smaller fragments. One runs the digested RNA molecules on a gel and RNA duplexes of 15-30 nucleotides are isolated.

In some embodiments, the invention relates to methods of treating a subject diagnosed an XMRV infection by administering a pharmaceutical composition with a heterogeneous mixture of siNAs that are homologous to the OrO mRNA sequence or fragment thereof. In certain embodiments, the fragments have greater than 150 or 200 nucleotides. In certain embodiments, the mixture is obtained by digesting a double stranded RNA having

SEQ ID NO: 20 or SEQ ID NO: 41. In certain embodiment, nucleic acids disclosed herein are expressed in a recombinant vector in vivo contained in the pharmaceutical product. Representative recombinant vectors include plasmids, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, and lentiviral vectors.

Synthesis of Nucleic Acid Molecules

Small nucleic acid motifs ("small" refers to nucleic acid motifs no more than 100 nucleotides in length, preferably no more than 80 nucleotides in length, and most preferably no more than 50 nucleotides in length; e.g., individual siNA oligonucleotide sequences or siNA sequences synthesized in tandem) are preferably used for exogenous delivery. The structure of these molecules increases the ability of the nucleic acid to invade targeted regions of protein and/or RNA structure.

One synthesizes oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides) using protocols known in the art as, for example, described in U.S. Patent No. 6,001,311. The synthesis of oligonucleotides typically makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'- end and phosphoramidites at the 3 '-end. In a non- limiting example, small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 micro mol scale protocol with a 2.5 min coupling step for 2'-0-methylated nucleotides and a 45 second coupling step for 2'-deoxy nucleotides or 2'-deoxy-2'-fluoro nucleotides. Alternatively, syntheses at the 0.2 micro mol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, Calif.) with minimal modification to the cycle. A 33-fold excess of 2'-0-methyl phosphoramidite and a 105- fold excess of S-ethyl tetrazole can be used in each coupling cycle of 2'-0-methyl residues relative to polymer-bound 5'-hydroxyl. A 22-fold excess of deoxy

phosphoramidite and a 70-fold excess of S-ethyl tetrazole mop can be used in each coupling cycle of deoxy residues relative to polymer-bound 5'-hydroxyl.

Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and oxidation solution is 16.9 mM 12, 49 mM pyridine, 9% water in THF (PerSeptive Biosystems, Inc.). S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-1,2-benzodithiol-3-one 1,1 -dioxide, 0.05 M in acetonitrile) is used.

Deprotection of the DNA-based oligonucleotides is performed as follows: the polymer-bound trityl-on oligonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 40% aqueous methylamine (1 mL) at 65 degrees for 10 minutes. After cooling to -20 degrees, the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCN:H20/3 : 1 : 1 , vortexed and the supernatant is then added to the first supernatant. The combined supernatants, containing the oligonucleotide, are dried.

Alternatively, the nucleic acid molecules can be synthesized separately and joined together post-synthetically, for example, by ligation or by hybridization following synthesis and/or deprotection.

A siNA molecule can also be assembled from two distinct nucleic acid strands or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the R A molecule.

The nucleic acid molecules can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2'-amino, 2'-C-allyl, 2'-fluoro, 2'-0-methyl, 2'-H). siNA constructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography and re-suspended in water.

Chemically synthesizing nucleic acid molecules with modifications (base, sugar and/or phosphate) can prevent their degradation by serum ribonucleases, which can increase their potency. See e.g., U.S. Patent No. 5,652,094, U.S. Patent No. 5,334,711, and U.S. Patent No. 6,300,074. All of the above references describe various chemical modifications that can be made to the base, phosphate and/or sugar moieties of the nucleic acid molecules described herein. Modifications that enhance their efficacy in cells, and removal of bases from nucleic acid molecules to shorten oligonucleotide synthesis times and reduce chemical requirements are desired. In one embodiment, nucleic acid molecules include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex. A single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucleotides in nucleic acid molecules results in both enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands. In another embodiment, nucleic acid molecules include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA

"locked nucleic acid" nucleotides such as a 2',4'-C methylene bicyclo nucleotide (see for example U.S. Patent No. 6,639,059, U.S. Patent No. 6,670,461, U.S. Patent No.

7,053,207).

In another embodiment, the invention features conjugates and/or complexes of siNA molecules. Such conjugates and/or complexes can be used to facilitate delivery of siNA molecules into a biological system, such as a cell. The conjugates and complexes provided may impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules. In general, the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers. These compounds are expected to improve delivery and/or localization of nucleic acid molecules into a number of cell types originating from different tissues, in the presence or absence of serum (see U.S. Patent No. 5,854,038). Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.

In yet another embodiment, siNA molecules having chemical modifications that maintain or enhance enzymatic activity of proteins involved in RNAi are provided. Such nucleic acids are also generally more resistant to nucleases than unmodified nucleic acids. Thus, in vitro and/or in vivo the activity should not be significantly lowered.

In another aspect a siNA molecule comprises one or more 5' and/or a 3'-cap structure, for example on only the sense siNA strand, the antisense siNA strand, or both siNA strands. By "cap structure" is meant chemical modifications, which have been incorporated at either terminus of the oligonucleotide. See, for example, Adamic et al., U.S. Patent No. 5,998,203. These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and may help in delivery and/or localization within a cell. The cap may be present at the 5 '-terminus (5 '-cap) or at the 3 '-terminal (3 '-cap) or may be present on both termini. In non-limiting examples, the 5'-cap includes, but is not limited to, glyceryl, inverted deoxy abasic residue (moiety); 4',5 '-methylene nucleotide; l-(beta- D-erythrofuranosyl) nucleotide, 4'-thio nucleotide; carbocyclic nucleotide; 1,5- anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3, 4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted nucleotide moiety; 3'-2'-inverted abasic moiety; 1 ,4-butanediol phosphate; 3'- phosphoramidate; hexylphosphate; aminohexyl phosphate; 3 '-phosphate; 3'- phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety.

Non- limiting examples of the 3 '-cap include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety), 4',5'-methylene nucleotide; l-(beta-D- erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; l,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1 ,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide;

phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; 3,4- dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5 '-5 '-inverted nucleotide moiety; 5 '-5 '-inverted abasic moiety; 5'-phosphoramidate; 5 '-phosphorothioate; 1 ,4- butanediol phosphate; 5'-amino; bridging and/or non-bridging 5'-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non bridging

methylphosphonate and 5'-mercapto moieties (for more details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925).

By the term "non-nucleotide" is meant any group or compound which can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity. The group or compound is abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks a base at the l'-position.

In one embodiment, the invention features modified siNA molecules, with phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions.

Pharmaceutical Compositions of Nucleic Acid Molecules

The following protocols can be utilized for the delivery of nucleic acid molecules. A siNA molecule can be adapted for use to prevent or treat cancers and other

proliferative conditions and/or any other trait, disease or condition that is related to or will respond to the levels of OrO in a cell or tissue, alone or in combination with other therapies. For example, a siNA molecule can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations. U.S. Patent No. 6,395,713 and U.S. Patent No. 5,616,490 further describe general methods for delivery of nucleic acid molecules.

Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as

biodegradable polymers, hydrogels, cyclodextrins (see for example U.S. Patent No.

7,141,540 and U.S. Patent No. 7,060,498), poly(lactic-co-glycolic)acid (PLGA) and

PLCA microspheres (see for example U.S. Patent No. 6,447,796), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (U.S. Patent No. 7,067,632). In another embodiment, the nucleic acid molecules can also be formulated or complexed with polyethyleneimine and derivatives thereof, such as polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine-polyethyleneglycol-tri-N-acetylgalactosamine (PEI-PEG-triGAL) derivatives.

In one embodiment, a siNA molecule is complexed with membrane disruptive agents such as those described in U.S. Patent No. 6,835,393. In another embodiment, the membrane disruptive agent or agents and the siNA molecule are also complexed with a cationic lipid or helper lipid molecule, such as those lipids described in U.S. Patent No. 6,235,310.

Embodiments of the invention feature a pharmaceutical composition comprising one or more nucleic acid(s) in an acceptable carrier, such as a stabilizer, buffer, and the like. The oligonucleotides can be administered (e.g., RNA, DNA or protein) and introduced into a subject by any standard means, with or without stabilizers, buffers, and the like, to form a pharmaceutical composition. When it is desired to use a liposome delivery mechanism, standard protocols for formation of liposomes can be followed. The compositions can also be formulated and used as tablets, capsules or elixirs for oral administration, suppositories for rectal administration, sterile solutions, suspensions for administration by injection, and the other compositions known in the art.

Embodiments of the invention also feature the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer a method for increasing the circulation and accumulation of in target tissues. The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA. See U.S. Patent No. 5,820,873 and U.S. Patent No. 5,753,613. Long-circulating liposomes are also likely to protect from nuclease degradation.

Compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.

Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil. Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions can also contain one or more preservatives, for example ethyl, or n- propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.

Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents and flavoring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an anti -oxidant such as ascorbic acid Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present.

In one embodiment, a siNA molecule is designed or formulated to specifically target cells that express Xprl . For example, various formulations and conjugates can be utilized to specifically target endothelial cells or tumor cells, including PEI-PEG-Xprl antibody and other conjugates known in the art that enable specific targeting to Xprl expressing cells.

Alternatively, certain siNA molecules can be expressed within cells from eukaryotic promoters. Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The activity of such nucleic acids can be augmented by their release from the primary transcript by an enzymatic nucleic acid. See U.S. Patent No. 5,795,778, and U.S. Patent No. 5,837,542. In certain embodiments, the invention relates to RNA molecules expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constructed based on, but not limited to, lentivirus, adeno-associated virus, retrovirus, adenovirus, or alphavirus. In another embodiment, pol III based constructs are used to express nucleic acid molecules (see for example U.S. Patent No. 5,902,880 and U.S. Patent No.

6,146,886). The recombinant vectors capable of expressing the siNA molecules can be delivered as described above, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the siNA molecule interacts with the target mRNA and generates an RNAi response. Delivery of siNA molecule expressing vectors can be systemic, such as by intravenous or intra-muscular administration, by administration to target cells ex -planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell. In certain embodiments, the invention relates to an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the instant invention. The expression vector can encode one or both strands of a siNA duplex, or a single self- complementary strand that self hybridizes into an siNA duplex. The nucleic acid sequences encoding the siNA molecules of the instant invention can be operably linked in a manner that allows expression of the siNA molecule.

In certain embodiments, the invention relates to an expression vector comprising: a) a transcription initiation region (e.g., eukaryotic pol I, II or III initiation region); b) a transcription termination region (e.g., eukaryotic pol I, II or III termination region); and c) a nucleic acid sequence encoding at least one of the siNA molecules of the instant invention, wherein said sequence is operably linked to said initiation region and said termination region in a manner that allows expression and/or delivery of the siNA molecule. The vector can optionally include an open reading frame (ORF) for a protein operably linked on the 5' side or the 3'-side of the sequence encoding the siNA; and/or an intron (intervening sequences).

Transcription of the siNA molecule sequences can be driven from a promoter for eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III (pol III). Transcripts from pol II or pol III promoters are expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type depends on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby. Prokaryotic

RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells. More specifically,

transcription units such as the ones derived from genes encoding U6 small nuclear (snRNA), transfer RNA (tRNA) and adenovirus VA RNA are useful in generating high concentrations of desired RNA molecules such as siNA in cells. See U.S. Patent No.

5,624,803 and U.S. Patent No. 5,672,501. The above siNA transcription units can be incorporated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated virus vectors), or viral RNA vectors. Aptamers

In certain embodiments, aptamers are contemplated as molecules that interfere with Orf3 signaling. Oligonucleotides can be developed to target Orf3. SELEX

("Systematic Evolution of Ligands by Exponential Enrichment") is a combinatorial chemistry technique for producing oligonucleotides of either single-stranded DNA or

RNA that specifically bind to a target. Standard details on generating aptamers can be found in U.S. Patent No. 5,475,096, and U.S. Patent No. 5,270,163.

The SELEX process provides a class of products which are referred to as nucleic acid ligands or aptamers, each having a unique sequence, and which has the property of binding specifically to a desired target compound or molecule. Each SELEX-identified nucleic acid ligand is a specific ligand of a given target compound or molecule. The SELEX process is based on the fact that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets. The SELEX method applied to the application of high affinity binding involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific high affinity nucleic acid ligands to the target molecule.

The basic SELEX method has been modified to achieve a number of specific objectives. For example, U.S. Patent No. 5,707,796 describes the use of the SELEX process in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. Patent No. 5,763,177 and U.S. Patent No. 6,011,577 describe a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. Patent No. 5,580,737 describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, which can be non-peptidic, termed Counter-SELEX. U.S. Patent No. 5,567,588 describes a SELEX-based method which achieves efficient partitioning between oligonucleotides having high and low affinity for a target molecule.

The SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples include U.S. Patent No. 5,660,985 and U.S. Patent No. 5,580,737.

The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Patent No. 5,637,459 and U.S. Patent No. 5,683,867. These applications allow the combination of the broad array of shapes and other properties, and the efficient amplification and replication properties, of oligonucleotides with the desirable properties of other molecules.

EXPERIMENTAL

Embodiments of the invention are described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

Example 1 : Detection of XMRV Infection in Human Cancer Patients

The experiments disclosed herein were conducted to explore whether the recently discovered retrovirus XMRV is present in prostate cancer tissues and to determine whether patients that have previously been infected with this virus develop serologically detectable evidence of prior infection.

The materials and methods employed in the experiments disclosed herein are now described.

Sample preparation

Peripheral blood DNA : Blood was collected in the operating room at the time of surgery in heparin vacutainers and stored at 4 °C. Preparation of the DNA was carried out using the Qiagen Flexigene Kit according to recommended protocol. The DNA was aliquoted and stored at -20 °C.

Serum: Blood was collected in the operating room at the time of surgery in vacutainers and stored at 4 °C. The vacutainers are centrifuged at 4000 x g for 20 min, 4°C to separate the serum from remaining contents. The serum was then aliquoted into multiple tubes and stored at -80 °C.

Tissue: Prostate tissue was divided into subsections and a portion of the sections was placed in optical coherence tomography (OCT), frozen in liquid N₂ and then stored in liquid N₂. The remaining sections are formalin fixed and paraffin embedded.

Genotyping

Patients were genotyped for the R462Q (1385G→A)RNASEL variant using a premade TAQMAN genotyping assay (Applied Biosystems, Foster City, CA) on DNA isolated from peripheral blood. Five nanograms of genomic DNA were assayed according to the manufacturer's protocol in the Emory Biomarker Service Center.

Four hundred and twenty DNA samples from prostate cancer patients who underwent prostatectomy were analyzed for the R462Q RNase L variant. 187 (45 %) men were found to be homozygous wildtype (RR), 185 (44 %) men were heterozygous (RQ), and 48 (11%) were homozygous mutant (QQ).

Tissue DNA Preparation

OCT embedded prostate tissue was serial sliced in 15 micron sections, combining 10 sections per eppendorf tube for on average 12 tubes and stored at -80°C. Every other tube was thawed and the samples were washed by adding 1 mL PBS, vortexing, briefly centrifuging at 13,000 x g, followed by removal of the supernatant. DNA was prepared using Qiagen's QIAmp DNA Mini Kit according to manufacturer's protocol. Nested PCR

Tissue DNA was analyzed the AmpliTaq Gold Kit (Applied Biosystems) for the presence of XMRV using nested PCR. The first round PCR consisted of 0.25-2.0 ug DNA, IX Buffer, 2.5 mM MgCl₂, 0.25 uM each dNTP (Roche), 200 nM

6200R:CCCATGATGATGATGGCTTCCAGTATGC (SEQ ID NO: 1), 200 nM

5922f:GCTAATGCTACCTCCCTCCTGG (SEQ ID NO: 2), 2.5 units of Taq under the conditions: 94 °C for 5 min followed by 40 cycles of 94 °C for 30 sec, 54.4 °C for 30 sec, 72 °C for 45 sec and ending with 72 °C for 2 min. The second round of PCR consisted of 5 uL of the first round PCR product, IX Buffer, 2.5 mM MgCl₂, 0.25 uM each dNTP, 200 nM 5942f:GGGGACGATGACAGACACTTTCC (SEQ ID NO: 3), 200 nM 6159r: CACATCCCCATTTGCC ACAGTAG (SEQ ID NO: 4), 2.5 units of Taq under the conditions 94 °C for 5 min followed by 40 cycles of 94 °C for 30 sec, 51 °C for 30 sec, 72 °C for 45 sec and ending with 72 °C for 2 min. Both first and second round products were run on a 3 % TAE agarose gel. Positive bands for first and second round PCR are 278 bp and 217 bp respectively.

DNA from prostate tissue was analyzed for the presence of XMRV by nested

PCR utilizing primers to the envelope region of XMRV with a final expected size of 217 base pairs for the second round of PCR. DNA from eleven patients was analyzed and the results shown in Table 1. A representative gel showing the size and quality of the PCR bands is shown in Figure 1. All bands that were approximately 217 base pairs were excised, the DNA was purified and then sequenced to verify determine XMRV status. If no band was visible after PCR, the samples were marked as negative. In some cases, negative samples demonstrated faint bands at approximately 217 base pairs but sequence analysis determined to be non-viral sequences. All samples that were homologous to the XMRV envelope DNA were determined to be positive. Table 1 : Correlation of XMRV positive and negative patient samples between DNA PCR, FISH and % Neutralization

Sequencing

Bands from DNA agarose gels that were the correct size were excised from the agarose and the DNA purified using a Qiagen QIAquick gel Extraction Kit according to recommended protocol. ssPCR was performed on the purified DNA using BigDye Terminator v3.1 Sequencing Kit (AB). Briefly, purified DNA, 0.16 uM primer (either 5942F or 6159R), and IX BigDye were reacted under the following conditions: 96 C for 1 min followed by 25 cycles of 96 C for 10 sec, 55 C for 5 sec, 60 C for 4 min. After purification using Centri Sep 96 (Princeton Separations, Adelphia, NJ), samples were sequenced on an ABI Prism 3100 Genetic Analyzer and basic nucleotide Blast performed.

Fluorescence in-situ hybridization (FISH) assay

Template to generate probe of FISH assay was generated by excising XMRV cDNA from pXMRV (Silverman RH, PNAS 2007) using Not I and Hind III restriction enzymes (New England Biolabs). Digested XMRV template was purified (Qiagen gel purification kit) and used for subsequent nick translation procedure to generate

SpectrumGreen dUTP labeled probe. Nick translation was performed according to manufacturer's protocol (Abbot Molecular Inc., Des Plaines, Illinois, USA). Baked slides containing 4 μιη sections of prostatic tissues were deparaffinized with xylene, rehydrated and treated with Target Retrieval solution (Dako, Denmark) for 40 min at

95°C. Slides were cooled for 20 minutes and then treated with 1 :5000 dilution of Proteinase K (Dako) in 50 mM Tris-HCl, pH 7.6, for 20 minutes. Slides were rinsed in water to remove proteinase K and hybridized overnight in a ThermoBrite hybridizer (Abbot Molecular) at 37°C with XMRV specific probe. After soaking slides in 2X SSC pH 5.3, co vers lips were removed and samples were washed in high stringency 0.0 IX

SSC, 0.4% NP-40 solution at 75°C, for 5 mins. FISH samples were counterstained with Vectashield mounting media (Vector Laboratories, Inc. Burlingame, CA) containing DAPI. As a positive control, tissue sections were also probed with TelVysion 3q

SpectrumOrange labeled probe that is specific for a single human chromosome arm. FISH images were visualized using Axioplan 2 imaging microscope (Zeiss) using 100X objective. XMRV nucleic acid images were acquired using green (488nm) and DAPI filters. SpectrumOrange was visualized using Texas red filter (data not shown). The Z- stack images were acquired using MetaSystems Isis software. Slides were subsequently counterstained with H&E stain and cell morphology of FISH positive cells was analyzed at 40X and 100X magnifications using a Nikon Eclipse E600 microscope.

Samples were analyzed by FISH to ascertain the presence of XMRV in formalin fixed and paraffin embedded tissue. The presence of XMRV as determined by FISH directly correlated with the presence of XMRV as determined by nested PCR (Table 1). Representative picture of XMRV FISH positives are shown in Figures 2 A and 2B.

Viruses and cell line

In order to pseudotype the XMRV envelope onto non-infectious HIV-1 virus particles, 293T cells were co-transfected with pSG3AEnv and pDP-XMRV-Env plasmids and virus containing cell media vas collected after 48 hours of infection. Resulting XMRV-HIV pseudo virus contained p24 level that is comparable with control HIV-1 pseudovirus (hereafter called NL4.3-HIV) caring HIV-1 envelope glycoprotein from HIV-1B NL4.3 virus and core from HIV-1B SG3 virus. Infectivity of XMRV-HIV and NL4.3-HIV pseudoviruses was compared by detection of beta-galactosidase expression 48 hours after infection of Jc53BL-13 cells.

Jc53BL-13 cell line (NIH AIDS Research and reference reagent program catalog no. 8129, TZM-bl), is CXCR4-positive HeLa cell clone that was engineered for successful HIV infection. Jc53BL-13 cells express CD4 and CCR5 and contain integrated reporter genes for firefly luciferase and Escherichia coli β-galactosidase under control of an HIV-1 long-terminal repeat sequence (Piatt et al., 1998 J Virol 72: 2855-64; Meng et al, 2002 Nat Med 8: 150-6; Wei et al, 2002 Antimicrob Agents Chemother 46: 1896-905). Reporter gene expression is stimulated upon activation with Tat protein of

HIV. That read out has been shown to directly correlate with amount of infections virus present in media. Jc53-BL-13 cell were grown in DMEM supplemented with 10% FBS (Cellgro, Mediatech Inc., Manassas, VA). RT-PCR

RNA isolated from TZM-B1 cells was used as templates to synthesize Xprl cDNAs using Superscript II (invitrogen), which were then amplified by PCR using the Go7a DNA Polymerase (Promega) at 94°C for 4 min, then 30 sec at 94°C, 30 sec at 58°C, and 45 sec at 72°C for 30 cycles, and finally for 10 min at 72°C in a reaction that contains the XPRlout-F (5 ' C ACTGGTGTTACT ACGCTG3 ' ; SEQ ID NO: 5) and

XPRlout-R (5 'GCAACAAAGTTGTAGAGGT3 '; SEQ ID NO: 6) primers. In addition, a set of universal primers was used to PCR amplify the β-actin gene as a control.

Neutralization assay

Heat-inactivated human sera were assayed for NAb activity against HIV-1 virions pseudotyped with XMRV Env using a single-round pseudotype reporter assay disclosed in Li et al, 2006 J Virol 80: 5211-8. Briefly, JC53BL-13 cells were plated and cultured overnight. A total of 2,000 infectious units of pseudotyped virus were combined with fivefold dilutions of heat-inactivated test serum and incubated for 1 h at 37°C. Heat- inactivated human serum from healthy donor was added as necessary to maintain a constant overall concentration. The virus-antibody mixture was then added to JC53BL-13 cells, and after 2 days, the cells were lysed, and the luciferase activity of each well was measured using a luciferase assay reagent (Promega, Madison, WI) and Synergy HT luminometer (Bio-Tek, Winooski, VT). Background luminescence was determined in uninfected wells and subtracted from all experimental wells. Cell viability and toxicity were monitored by basal levels of luciferase expression and by visual inspection.

Relative neutralization (percentage of control) was calculated by dividing the number of luciferase units at each serum dilution by the values in wells containing no test serum and subscribing that value from the values in wells containing no test serum.

The results of the experiments presented in this Example are now described.

Serum Analysis

Prior to the present disclosure, the immune responses to XMRV have not been characterized. To evaluate immune responses against XMRV, a single-round reporter gene assay was developed to quantitate neutralizing antibodies (NAbs) in infected patient sera.

The schematic presentation is shown in Figure 3A. Briefly, co-transfection of an XMRV Env plasmid with an Env-deficient HIV-1 proviral plasmid in 293T cells produced an XMRV-HIV pseudovirus that efficiently infected TZM-Bl cells, resulting in the expression of tat-responsive reporter genes. XPR1 gene coding for scavenger GPCR receptor that was identified as a receptor for XMRV (Dong et al., 2007 PNAS 104: 1655-

60) was expressed in TZM-Bl cells as shown by RT-PCR. XMRV-HIV pseudovirus was compared with HIV pseudovirus that were used as a control for production, infectivity and specificity in the reaction with monoclonal antibodies (MAbs). The yield of virus was detected by p24 ELISA, and XMRV-HIV pseudovirus was produced in comparable amount with HIV pseudovirus. However, infectivity of XMRV-HIV pseudovirus was higher than control HIV pseudovirus, possibly due to codon optimizations made in XMRVenv gene. Infectious units for both viruses were determined using staining of PGal expressing cells. Reporter gene expression was directly proportional to the amount of pseudovirus used to infect the TZM-Bl cells. For XMRV neutralization, 83A25 MAbs was used because it moderately neutralizes MuLV and interacts with antigenic epitope on

MuLV envelope glycoprotein that according to sequence analysis is present on XMRV envelope. XMRV-HIV virus was neutralized by 83A25 MAbs and was not neutralized by HIV specific MAbs (B12); at the same time HIV was neutralized by B12 MAbs and was not neutralized by 83A25 MAbs (Figure 3E). Thus, the results demonstrate the successful development of an assay that can be used in neutralization assay for testing human or animal sera for presence of neutralizing antibodies. The assay is partly based on replication of a deficient virus (XMRV-HIV).

Sera from 40 prostate cancer patients that were divided on three groups based on their genetic differences in RNAseL gene were analyzed. In each group, patients that present XMRV specific neutralizing activity in their sera were observed (Figure 4). A direct correlation was found between nested PCR positives, FISH positive with QQ patients that were found to have neutralizing antibodies.

Concordance of Multiple Methods for Detecting XMRV Infection in Prostate Cancer Patients

XMRV is a novel gamma-retrovirus originally cloned from human prostate tissue and found in up to 27% of patients with prostate cancer treated with radical

prostatectomy. Prior to the present disclosure, there was no clinical test that detects current or prior infection with this virus. The mode of transmission of the virus is unknown. Because of the lack of a diagnostic test, the true incidence of infection in either patients or control populations has not been determined. There is no method to screen either blood donors or tissue donors for infection and no data regarding whether the virus can be transmitted by blood transfusion or tissue transplantation. In order to answer the basic questions of incidence of infection, mode of transmission and association with disease robust clinical assays for the virus or the immunologic response to previous viral infection are needed.

PCR of XMRV-specific sequences were performed on banked frozen prostate tissue derived from patients that had undergone radical prostatectomy for the treatment of prostate cancer. In a subset of these patients, confirmatory FISH analysis was done on adjacent sections to directly visualize the presence or absence as well as cellular localization of XMRV nucleotide sequences. In addition, viral-like particles expressing the XMRV envelope proteins that were capable of single round infection but replication deficient was developed for application of a serologic test for prior infection with XMRV. A fluorescent cell infection assay was developed to test selected patients' serum for the presence of antibodies capable of neutralizing XMRV infection in that assay.

The present disclosure provides evidence for the presence of neutralizing antibodies in the serum of patients that also have evidence of proviral sequences inserted in the host genome and XMRV viral nucleotides in prostatic tissue by FISH analysis. In the patients that were determined to not have XMRV nucleotide sequences, the serum assay was similarly negative. The FISH analysis presented herein generally supports the claim that XMRV infection is found in prostatic stromal cells.

Prostate cancer specimens were found to be positive for XMRV DNA sequences by PCR and confirmed by FISH of adjacent sections. Patients with prior infection were found to have high titers of neutralizing antibodies in their serum. A strong correlation existed between DNA and FISH positive patients and high titers of neutralizing antibodies.

Reports suggest that there is a substantial discordance between viral nucleotide positivity and viral protein positivity, an apparent contradiction that does not have an adequate explanation. One would expect that if there is actively replicating virus in malignant prostatic epithelium, then all such patients would also have XMRV nucleotide sequences easily detectible, yet it was found that of the 6% of patients that were positive by PCR, only 4% were positive by immunohistochemistry and that of the 23% positive by immunohistochemistry, only 2% were positive by PCR.

The results presented herein suggest that a clinically useful serologic test for prior infection with XMRV can be developed. This is in concordance with other known retroviral infections, specifically HIV. While the assay used in this example involves the inhibition of infection of target cells by viral-like particles with the XMRV envelope protein expressed on their surface, it also suggests that more standard serologic tests for antibodies against specific viral antigens can be developed. Without wishing to be bound by any particular theory, it is believed that an assay to measure T-cell response can be developed and be useful in the clinic.

The results presented herein provides evidence that XMRV is indeed a novel gamma-retrovirus capable of infection humans and that at least some patients with prostate cancer have also been infected with XMRV. The disclosure presented herein is the first to report serologic evidence of infection and that serology correlates with tissue based assays. The concordance of three independent means of detecting infection adds confidence to the assertion that this recently discovered virus is real and related to human disease.

Example 2: XMRV Virus-Like Particles (VLP)

The following experiments were designed to investigate XMRV immunogenicity. Briefly, mice were vaccinated with a combination of plasmid DNA and adenovirus vectors expressing XMRV env and gag genes as well as XMRV virus-like particles.

Mice were also immunized with XMRV virus-like particles (VLP) that had the size and morphology expected for type C retroviruses and comparable to XMRV virions, as indicated by electron microscopy.

Using ELISA and neutralization assays, binding and neutralizing antibodies were detected in the sera of vaccinated mice. A single-round infection reporter gene assay was used for detection of neutralizing antibodies against HIV-1. The reporter gene assay allows for a high through put screening of experimental models and human sera for the presence of neutralizing antibodies to XMRV. The results demonstrate immunogenicity of XMRV and the use of adenoviral vectors for the development of a vaccine to XMRV.

Plasmids, viruses and cell lines

Codon optimized sequences of XMRV env and gag were synthesized by

GenScript Corporation (Piscataway, NJ) and cloned into pUC57 vector. Then, Env sequence was cloned into first cassette of pDPl Shuttle vector using Agel and Xbal restriction enzymes and gag sequence was cloned into the second cassette of the same vector using EcoRI and Hindlll; then, pDP shuttle vector was recombined with pAdEasy- 1 or pAd5/3Easy vectors which then were transfected into 293 Ad cells using

Lipofectamine 2000 to produce adenoviruses 5A4.2 and 3A4.2 respectively. The titers of viral stocks were detected by TCID50 in 293 Ad cells. HeLa cells were grown in DMEM supplemented with 10% FBS (CellGro). For infection, the cell media were replaced with DMEM supplemented with 2% FBS and containing 10 MOI of 5A4.2 adenovirus and incubated for 16 hours to allow virus adsorption and then was replaced with fresh growth media. Culture media was collected after 48 hours of infection, passed through a 0.45- μιη filter (Whatman, Florham Park, NJ) and concentrated 1000 times by

ultracentrifugation at 25,000 g through 20% sucrose in PBS buffer. Purified VLP were stored in aliquots after total protein concentration was detected. VLP were used for immunization of mice, for coating ELISA plates, and for immunobloting. Dul45 c7 cells were used to produce infectious XMRV. Cells were grown in DMEM media with 10%> FBS and XMRV virus was isolated from culture media as was described for VLP production.

Immunization

Group of 10 Balb/c mice (Charles River) were primed first with DNA (25 μg of pDP 1 -XMRV plasmid per mouse) and then boosted with 2x 10⁹ virus particles of adenoviruses per mouse. First boost was made on day 22 after prime with 5A4.2 serotype 5 adenovirus. The second boost was made on day 50 with 3A4.2 chimeric adenovirus that had knob region substituted by serotype 3 knob region (Kawakami et al., 2003 Cancer Res 63: 1262-9), which is believed to eliminate the boosting of anti adenoviral response. Mice were then boosted once again on day 100 with 7.5 μg of

XMRV VLP per mouse. Group of control mice were primed with the same amount of empty plasmid and boosted with adenoviruses expressing beta-Galactosidase gene.

Neutralization assay

Mouse sera were assayed for neutralizing antibody (NAb) activity against HIV-1 virions pseudotyped with XMRV Env using a single-round pseudotype reporter assay described herein. Briefly, JC53BL-13 cells were plated and cultured overnight. A total of 2,000 infectious units of pseudotyped virus were combined with fivefold dilutions of heat-inactivated test serum and incubated for 1 hour at 37°C. Noninfectious heat- inactivated mouse serum was added as necessary to maintain a constant overall concentration. The virus-antibody mixture was then added to JC53BL-13 cells, and after 2 days, the cells were lysed, and the luciferase activity of each well was measured using a luciferase assay reagent (Promega, Madison, WI) and a Synergy HT luminometer (Bio- Tek, Winooski, VT). Background luminescence was determined in uninfected wells and subtracted from all experimental wells. Cell viability and toxicity were monitored by basal levels of luciferase expression and by visual inspection. Relative neutralization (percentage of control) was calculated by dividing the number of luciferase units at each serum dilution by the values in wells containing no test serum and subscribing that value from the values in wells containing no test serum.

Immunoassays

For detection of XMRV specific antibodies in mouse sera, indirect ELISA was performed. Immuno-plates (Nalge Nunc Int, Rochester, NY) were coated with 3 μg/ml of XMRV VLP in CB2 buffer according manufacture protocol (Immunochemistry Technologies LLC, Bloomington, MN) and incubated with serial dilutions of mouse sera. Specific antibodies were detected with goat anti-mouse HRP-conjugated IgG (H+D) (Southern Biotech, Birmingham, AL) and OPD substrate (Thermo Science, Rockford, IL). Mouse polyclonal antibodies were purified from mouse sera using Nab Protein A/G Spin Kit (Thermo Scientific, Rockford, IL) that allows small-scale affinity purification of antibodies from serum.

Extracellular p24 was measured using the Alliance HIV-1 p24 ELISA kit (Perkin- Elmer) according to the manufacturer's instructions. Cell-free supernatants from infected cultures were harvested and stored at -80°C prior to quantification.

Immunoblotting of either XMRV or XMRV VLP proteins was performed as described as disclosed in Dong et al, 2008 PLoS 3 :e3144. Virus concentrated from Dul45 c7 cell media or purified VLP were separated by 12% SDS-PAGE, transferred to Immun-Blot PVDF membrane (Bio-Rad, Hercules, CA), blocked with 5% BSA in TBS-T buffer and probed with R187 anti-gag monoclonal antibody as was described Urisman et al., 2006 PLoS Pathog 2:e25. After incubation with secondary antibody, HRP- conjugated anti-ret IgG (Southern Biotech), protein bands were visualized with enhanced chemiluminescence detection reagents (Amersham Pharmacia). Flow cytometry

For flow cytometry analysis of XMRV Env gene expression, HeLa cells infected with 10 MOI of adenoviral vector for 48 hours were permeabilized with

Cytofix/Cytoperm (BD Bioscience) at 4°C for 20 min. After washing three times with Perm Wash Buffer (BD Bioscience), the cells were incubated with a 1 : 10 dilution of

83A25 cell culture media at 4°C for 30 min. Cells were washed again and incubated with 1 :200 diluted FITC- conjugated goat anti-rat IgG (Southern Biotech, Birmingham, AL) at 4°C for 30 min. The cells then were washed and analyzed on FACSCalibur flow cytometer (BD Bioscience). Data was acquired with CellQuest software and analyzed with FlowJo version 8.8.6 software.

The results of the experiments presented in this Example are now described.

XMRV-HIV pseudovirus

The experiments were designed to develop an assay for detection of the anti- XMRV neutralizing antibodies (Nab). Without wishing to be bound by any particular theory, it is believed that a primary target for Nab would be the XMRV envelope glycoprotein. To test that, the XMRV envelope was pseudotyped onto non-infectious HIV-1 virus particles and the Jc53BL-13 cell line was infected resulting in a pseudovirus. Jc53BL-13 is a CXCR4-positive HeLa cell clone that was engineered for successful HIV infection. Jc53BL-13 cells express CD4 and CCR5 and contain integrated reporter genes for firefly luciferase and Escherichia coli β-galactosidase under control of an HIV-1 long-terminal repeat sequence (Meng et al, 2002 Nat Med 8: 150-6; Piatt et al, 1998 J Virol 72: 2855-64; Wei et al, 2002 Antimicrob Agents Chemother 46: 1896-905.

Reporter gene expression is stimulated upon activation with Tat protein of HIV-1. That read out has been shown directly correlates with amount of infections virus present in media. To prove that XMRV-HIV pseudovirus has a requirement for infecting Jc53BL- 13 cells, the expression of XPR-1 transcript, a putative receptor for XMRV, has been shown in Jc53BL-13 cells using RT-PCR with primers disclosed in Dong et al, 2007 PNAS 104: 1655-60. Infectivity of XMRV-HIV and NL4.3 -HIV pseudoviruses was compared by detection of beta-galactosidase expression 48 hours after infection of

Jc53BL-13 cells. Infectivity of XMRV-HIV pseudovirus appeared to be 250 times more infectious then control HIV-1 pseudovirus (hereafter called NL4.3 -HIV) caring HIV-1 envelope glycoprotein from HIV-1B NL4.3 and core from HIV-1B SG3 strains respectively. The difference can be explained by codon optimizations that have been made in XMRV Env gene. The production efficiency based on HIV-1 p24 protein amount was similar between XMRV-HIV pseudovirus and control NL4.3-HIV pseudovirus. Thus, the results demonstrate the possibility to pseudotype XMRV envelope onto HIV-1 virus particles. The results also demonstrate the ability to evaluate the production of resulted replication deficient XMRV-HIV pseudovirus.

An XMRV-SIV virus caring GFP reporter gene is described in Hong et al., 2009 J Virol 83: 6995-7003). However, XMRV-HIV pseudovirus activates the reporter gene expression in trans, an approach minimizes unspecific reporter gene expression and is more suitable for quantitative detection of Env-dependent infectivity. XMRV-HIV pseudovirus disclosed herein showed high infectivity, thus allowing future adaptation of existing HIV-1 neutralization assay for the use against XMRV.

XMRV-HIV neutralization assay

The single-round reporter gene assay is broadly used for detection of neutralizing antibodies in HIV-1 infected patient sera (Li et al., 2006 J Virol 80: 5211-8; Montefiori, 2009 Methods Mol Biol 485: 395-405). In order to adapt this method for detection of neutralizing antibodies to XMRV, the specificity of virus antibody interaction first has to be shown. Monoclonal antibodies 83A25 (83A25 MAb) that neutralize several MLV was used. Based on sequence identity between MLV and XMRV viruses, it was expected that 83A25 MAb would recognize epitope located at amino acid position 393- 426 of putative XMRV envelope sequence. Indeed, XMRV (83A25 MAb) dose- dependently neutralized XMRV-HIV pseudovirus, but had no effect on infectivity of

NL4.3-HIV pseudovirus. At the same time, B12 monoclonal antibodies that interact with HIV-1 NL4.3 envelope glycoprotein did neutralize NL4.3-HIV pseudovirus and did not neutralize XMRV-HIV pseudovirus. Thus, XMRV-HIV pseudo virus-based single round infection neutralization assay can be used for detection of neutralizing antibodies against XMRV envelope glycoprotein. This method utilizes the high through put protocol and can be used to screen human sera and plasma for the presence of anti-XMRV antibody or for studying humoral immune response to XMRV in animal models.

VLP production

To study XMRV immunogenicity in a mouse model, an adenoviral vector that expressed XMRV env and gag genes was developed. HeLa cells were infected with 10 MOI (PFU/Cell) of each adenovirus and expression of XMRV gag protein was detected by immunoblotting analysis with R187 MAb described in Dong et al, 2007 PNAS 104: 1655-60. Expression of the envelope glycoprotein was detected using indirect flow cytometry analysis with 83A25 MAb. It was shown that the infection of cells with adenovirus caring both env and gag genes of HIV- 1 leads to the production of virus like particles (VLP) (Luo et al, 2003 Virus Res 92: 75-82). Consequently, XMRV VLP production was expected upon infection with adenovirus expressing XMRV protein. HeLa cells were infected as described elsewhere herein and VLP production was detected by transmission electron microscopy (EM). VLP budding was observed ; it was comparable with XMRV budding from DU145 c7 cells that produce infectious virus (Dong et al, 2007 PNAS 104: 1655-60). This is a first demonstration of XMRV virus budding that is surface type and feather confirms similarity of XMRV with other type C gammaretro virus. Also, accumulation of VLP in vacuoles of cells infected with adenovirus was observed. The type of budding of VLP expressed from adenovirus is different from XMRV virus budding. That phenomena was also observed for expression of HIV VLP from adenovirus vectors and can be due to extreme over-expression of specific viral proteins from adenoviral vectors. The size of virus particles, produced in DU145 c7 cells, is comparable with that observed in the culture media of 22Rvl cells (Knouf et al, 2009 J Virol 83 : 7353-6) and Dul45 cells transfected with full-length

XMRV molecular clone. Based on EM data, the production of VLP in vivo was expected upon immunization with adenovirus caring XMRV env and gag genes; that should mimic XMRV infection for the mouse immune system. Immunization of mice and detection of antibodies against XMRV

Group of mice were primed with plasmid DNA containing XMRV env and gag genes, and then were boosted with adenoviruses on days 22 and 50 after prime.

Production of total and neutralizing antibodies was detected shortly after first boost and then decreased. After second boost, the neutralizing activity increased by 20% comparing with amount detected after first boost; however, total amount of XMRV specific antibodies still was low. Mice were then boosted once again on day 100 with 7.5 μg of purified XMRV VLP per mouse and the amount of binding and neutralizing antibodies increased 6 and 3 folds, respectively, and remained high. Sera from immunized and control animals collected 10 days after VLP boost was compared for binding and neutralizing antibody. Immune sera had two fold higher binding activity and almost 5 fold higher neutralizing activity then control sera. Smilingly, less difference in the binding and neutralizing antibody production between control and immune serum could be because the binding antibody was measured against whole VLP that detect unspecific response in control serum. Specificity of immune serum was shown in neutralization assay against XMRV -HIV pseudovirus and NL4.3-HIV control pseudovirus. Immune sera did not react with NL4.3-HIV control pseudovirus, but neutralized XMRV -HIV pseudovirus. Since the only difference between two

pseudoviruses is envelope protein, neutralizing activity detected in immune serum should be directed against XMRV envelope glycoprotein.

Characterization of polyclonal antibody against XMRV

To further prove that neutralizing activity of serum was due to stimulation of anti- XMRV antibody, polyclonal antibody was purified from immune and control sera using affine chromatography micro columns. Polyclonal antibody had 5 folds increase in binding comparing with control antibody and demonstrated 30% neutralization in 10 μg/ml concentration. Thus, delivery of XMRV env and gag stimulated humoral immune response in mice that lead to the production of anti-XMRV neutralizing antibodies.

Further optimization of the immunization regiment may be useful in the development of an anti-XMRV vaccine. The ability of XMRV env and gag proteins to induce immune response in mice is a first demonstration of XMRV immunogenicity. The results presented herein demonstrate development of an anti-XMRV vaccine that can be therapeutic against XMRV related malignancy in patients with prostate cancer as are other

gammaretroviruses in their natural hosts. At the same time, availability of high through put method for detection of anti-XMRV antibody in diagnostic settings is beneficial for sera-epidemio logical investigation of XMRV distribution among patients with prostate cancer and in general population. Example 3: XMRV Spliced Variant

Much of the studies done thus far on XMRV have been centered on the presence of XMRV in prostate cancer patients. The exact replication and regulatory mechanism of XMRV in host cells have not been explored. The results presented wherein demonstrate the finding of a novel doubly spliced XMRV transcript produced early during replication and higher in levels compared to Env species of transcript. RT-PCR and sequencing analysis of XMRV cDNA revealed that the novel doubly spliced variant of XMRV is 1.2 kb in size and this finding is further corroborated through northern blot analysis. Results presented herein also show through protein expression studies and mass spectrometry analysis of XMRV infected cells that the doubly spliced transcript encodes for a protein. Without wishing to be bound by any particular theory, it is believed that the protein produced by the doubly spliced transcript of XMRV may be involved in regulatory functions and provide the link between the virus and prostate tumorigenesis.

Cells/virus and infection

The DU 145 cell line derived from human prostate carcinoma cells (ATCC) was grown and maintained at 37°C with 5% C0₂, in Eagle's Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml) and streptomycin (100 μg/ml). The DU 145-C7 and 22Rvl prostate epithelial carcinoma cell lines (ATCC) stably expressing XMRV were grown and maintained at 37°C with 5% C0_2, in RPMI-1640 medium containing 10% FBS, penicillin (100 U/ml) and streptomycin (100 μ§/ιη1). XMRV for infection was derived from culture medium of DU 145-C7 cell lines, filtered using 0.45 μιη filters.

DU 145 cells were grown to 80% confluency in 60 mm culture plates and infected with XMRV from DU 145-C7 culture medium. Briefly, cell were washed twice with PBS and infected with 300 μΐ of XMRV virus containing culture medium. Cells were incubated for 3 hours with MEM without serum. After 3 hours, cells were washed twice with PBS and cells were allowed to grow in recommended growth medium. Cells were harvested at different times points after infection and RNA preparations were carried out. RNA isolation, reverse transcriptase for RT-PCR, and PCR amplification

Total intracellular RNA was extracted from cells using RNAzol B reagent (RNA- Bee, AMS Biotechnology) according to the manufacturer's protocol. First-strand cDNA synthesis was done according to manufacturer's protocol (Invitrogen life technologies). Briefly, 3 μg of total RNA, 50 μΜ oligo dT and 10 mM dNTP mix in a total reaction volume of 10 μΐ was incubated at 65°C for 5 mins. The following components were subsequently added and the reaction was carried out at 50°C for 50 mins: 2 μΐ 10X RT buffer, 4 μΐ 25 mM MgCl₂, 2 μΐ 0.1M DTT, 1 μΐ RNaseOUT (40 U/μΙ) and 1 μΐ

Superscript III (200 U/μΙ). The reaction was terminated at 85°C for 5 mins, treated with RNase H (according to manufacturer's protocol) and stored in -20°C until it was ready to be used for PCR amplification.

For PCR amplification, cDNA from DU 145 (control) and DU 145 infected cells was used as template for a PCR reaction to detect presence of XMRV Env transcript. Forward and reverse primers used in this reaction are 5' ACC GTC GGG AG/GCC CTC CAA GCA G 3' (SEQ ID NO: 7) (nt 195-205/5488-5500) and 5' TTA TTC ACG TGA TTC CAC TTC TTC 3' (SEQ ID NO: 8) (nt 7668-7691) respectively. The forward primer spans the published first splice site of XMRV Env transcript. PCR reaction was carried out using Taq polymerase (NEB) using the following conditions: 94°C for 4 mins, then 30 cycles of 94°C for 30 sec, 59°C for 40 sec, 72°C for 2 mins, and finally followed by an incubation at 72°C for 10 mins.

Other RT-PCR reactions were carried out using different primer pairs to confirm presence of novel splice junction and the sequence of doubly spliced variant. The conditions used for the PCR reaction were as described above with changes in elongation time to 1 min. The primers pairs used are as follows: Fl 5'

GCGCCAGTCATCCGATAGACTGAG 3 ' (SEQ ID NO: 9) (nt 1-24) and R7366 5' CAGCATTCTTCTTTTAGCCTTTCCAGCGAGG 3' (SEQ ID NO: 10) (nt 5529- 5642/7350-7366); F5629 5 ' CCTCGCTGGAAAGGCTAAAAGAAGAATGCTG 3 '

(SEQ ID NO: 11) (nt 5629-5642/7350-7366) and R8581 5' TTG CAA ACA GCA AAA GGC TTT ATT GG 3 ' (SEQ ID NO: 12) (nt 8159-8185); and F5497 5 ' GCA GTA CAA CAA GAG GTC TGG 3 ' (SEQ ID NO: 13) (nt 5497-5517) and R7691 5 ' TTA TTC ACG TGA TTC CAC TTC TTC 3' (SEQ ID NO: 8) (nt 7668-7691). Primers F5629 and R7366 were designed to span the second splice site of the novel doubly spliced variant.

Other forward primers used to map start site of doubly spliced variant transcripts. The reverse primer R7691 (shown above) was used in combination with each of the forward primers. Additionally, primer pairs F5497 and R7691 (as shown above) were used to detect presence of doubly spliced variant in 22Rvl prostate epithelial cells harboring XMRV.

Northern blot analysis of XMRV genomic and subgenomic RNA

For Northern gel analysis, equivalent amounts of RNA were denatured with Formaldehyde Loading Dye (Ambion) for 15 mins at 65°C and placed on ice

immediately. The denatured RNA was electrophoresed in a 1.5% agarose gel made in

NorthernMax Denaturing Gel Buffer containing formaldehyde (Ambion) and MOPS Gel Running Buffer (Ambion). After electrophoresis, the RNAs were transferred to a nylon membrane by capillary action overnight using NorthernMax Transfer Buffer (Ambion) as the transfer medium. After transfer, the nylon membrane was irradiated with a UV Crosslinker Lamp (look at company). The membrane was prehybridized for at least 30 minutes with NorthernMax Ultrahyb Buffer (Ambion) at 42°C. XMRV specific DNA probe, corresponding to the first 1100 nucleotides of the virus genome was generated using Rediprime II DNA labeling system (GE Healthcare). Approximately 15 ng probe was labeled with 50 μα of [a-³²P]dCTP (3000 mCi/mmol); New England Nuclear, Boston, MA) according to manufacturer's protocol. The DNA probe was denatured at

100°C for 5 min and added to the blot in NothernMax Ultrahyb Buffer and hybridization was allowed to proceed at 42°C overnight. After hybridization, the membrane was washed once at room temperature in Low- Stringency Wash Solution 1 (Ambion) for 10 mins and twice in High-Stringency Wash Solution 2 (Ambion) for 15 mins each at 42°C. Washed membranes were wrapped in plastic and exposed to X-ray film at -70°C using intensifying screens.

Cloning of GFP and FLAG epitope tagged and non-tagged putative variant protein

The sequence of XMRV doubly spliced variant transcript was entered into NCBFs Open Reading Frame (ORF) finder program, and putative ORFs for the doubly spliced variant were predicted. Two ORFs were chosen to be epitope tagged; one that was translated from +2 frame (64 amino acids in length) and the other from +3 frame (95 amino acids in length). Two constructs, each bearing a GFP and FLAG epitope at the C- terminus of the predicted proteins were produced in pcDNA 3.1(+) vector system

(Invitrogen). The PCR primers used to make these constructs are 5' GCA AAG CTT GCG CCA GTC ATC CGA TAG ACT GAG TCG 3 ' (SEQ ID NO: 17) (forward primer), 5' CGA TCT AGA TCA CTT ATC GTC GTC ATC CTT GTA ATC CGT GAT TCC ACT TCT TCT GGA TC 3' (SEQ ID NO: 18) (reverse primer for the putative 64 amino acid protein) and 5' CGA TCT AGA TCA CTT ATC GTC GTC ATC CTT GTA ATC TTC ACG TGA TTC CAC TTC TTC TGG 3' (SEQ ID NO: 19) (reverse primer for the putative 95 amino acid protein). Hind III and Xba I restriction sites

(underlined) were introduced into the forward and reverse primers, respectively. FLAG- epitope tag sequences are denoted in bold letters. PCR reaction was carried out using the following conditions: 94°C for 4 mins, then 30 cycles of 94°C for 30 sec, 59°C for 40 sec, 72°C for 1 min, and finally followed by an incubation at 72°C for 10 mins. The PCR products were gel purified (0.7% agarose) using a Qiagen gel extraction kit and digested with Hind III and Xba I. The gel purified (Qiagen gel purification kit) PCR products were ligated into pcDNA expression vector (Invitrogen) digested with the same enzymes. The resulting constructs were named "pcDNA-ORF2-FLAG" and pcDNA-ORF3- FLAG", respectively. Transfection cells and western blot analysis

Sixty mm culture plates of 100% confluent DU 145 cells were transfected with 10 μg of pcDNA-ORF2-FLAG and pcDNA-ORF3-FLAG using Lipofectamine 2000 following the manufacturer's recommended protocol (Invitrogen life technologies). pcDNA vector only was used as a negative control. The cells were incubated with the transfection mixture for at least 4 hours after which transfection mixture was removed and replaced with MEM supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml) and streptomycin (100 μg/ml).

Cells were harvested 3 days post-transfection using RIP A buffer (10 mM Tris- HC1 pH 7.4, 150 mM NaCl, 3 mM EDTA, 1% Triton X-100, 0.1% SDS, and 0.5%

DOC). An equal volume of the post-nuclear fraction from transfected lysates was mixed with 2X SDS loading buffer (100 mM Tris-HCl pH6.8, 20 mM dithiothreitol, 4% SDS, 0.2%) bromophenol blue, and 20%> glycerol) and resolved by electrophoresis on 15% SDS polyacrylamide gels. Proteins were transferred onto PVDF membrane (name of company) using IX transfer buffer (100 ml 10X transfer buffer [250 mM Tris, 1.92M glycine], at 100V for 1 hour in a mini -Protean II apparatus (Biorad). Following transfer, the membranes were blocked overnight with 5% non-fat milk powder in TBS (20 mM Tris-HCl, pH 7.5 and 175 mM NaCl). The blot was probed with mouse anti-FLAG monoclonal antibody (Sigma) (1 : 1000 dilution) in antibody dilution buffer (1% non-fat milk powder, 0.02% sodium nitrate in TBS buffer [20 mM Tris-HCl, pH 7.5 and 175 mM

NaCl]). After addition of primary antibodies, membrane was washed 3 times for 10 minutes each with 0.05% T-TBS (0.05% Tween-20 sorbitol in IX TBS). Secondary anti- mouse antibody (find out company) conjugated with HRP, diluted in antibody dilution buffer was used to detect the presence of FLAG epitope tagged protein. Once again, membrane was washed 3 times for 10 minutes each with 0.05% T-TBS and bound antibodies were detected with SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific, Pierce Protein Research Products).

Immunofluorescence assay

The intracellular localization of GFP -tagged protein from doubly spliced transcript was analyzed by immunofluorescence (IF A). Briefly, DU 145 cells were plated onto 18 mm glass coverslips placed in 35 mm plates (1 :20 ml dilution). Cells were transfected with pcDNA-ORF2-FLAG and pcDNA-ORF3-FLAG. Seventy two hours post transfection, the cells were fixed with 4% paraformaldehyde in PBS for 30 min at 4°C and permeabilized with PBS-0.25% saponin for 10 min at room temperature. The coverslips were removed from the culture dishes, washed again with PBS, and blocked by incubation with PBS, 2% BSA, 0.25% saponin for 30 min at room temperature.

Primary mouse anti-FLAG antibody (Sigma) (1 :500 dilution) in PBS, 0.1 % BSA, 0.25% saponin were placed on the coversiip and incubated for 1 hour at room temperature. After washing three times in PBS, secondary mouse anti-F!TC antibody diluted (1 : 1000) in PBS, 0.1% BSA, 0.25% saponin were added and incubated for 30 minutes at room temperature. Following washing with PBS, the coverslips were mounted on glass slides using Vectashield mounting media containing DAPI (name of company). The cells were visualized using a Zeiss Axiopian 2 imaging system at 100X magnification. GFP transfected cells were visualized using

Mass Spectrometry

200 ul of DU 145-C7 cell supernatant was used to infect DU 145 cells. Cells were grown for 5 days postinfection and protein lysate was isolated. 200 ug of protein lysate from DU 145 infected and uninfected cells were run on a ID SDS PAGE and stained by silver stain and Coomassie Brilliant Blue stain. Bands around the expected variant size were cut from the gel and digestied with trypsin. Digested proteins were analyzed by ion-trap mass spectrometry and XMRV specific peptide sequences were identified. Polyclonal and Monoclonal Ab Production

Specific antiserum was raised by immunizing rabbits with synthetic peptides corresponding to regions from the putative doubly spliced variant protein. This polyclonal antiserum was then employed to investigate expression of the putative protein in vitro. ELISA

ELISAs were developed to identify Abs against novel viral Ags and the viral Ags alone. To detect double spliced variant viral Ag, polyclonal Abs were coated to 96-well plates, washed to remove unbound Ab, and then incubated with cell culture lysate, human sera, or cell supernatant from XMRV infected cells. Plates were washed, and monoclonal

Ab was added to the wells. The plates were washed again. For detection, the wells were incubated with anti-human IgG Ab conjugated to HRP.

To identify Abs against viral protein, purified variant protein was bound to 96- well plates and washed to remove unbound Ag. Human samples were added to the wells, and washed to remove unbound particles. The wells were then incubated with anti- human IgG Ab conjugated to HRP for detection.

Example 4: T Cell Responses Against XMRV in Prostate Cancer Patients and

Experimental Vaccine Models

Prostate cancer is the most common form of non-skin cancer in U.S. men.

Epidemiologic studies indicate that infection and inflammation may play a role in the development of prostate cancer. A search for viral nucleic acids in prostate cancers led to the identification of xenotropic murine leukemia virus-related virus (XMRV) in -10% of samples tested. Based on sequence analysis, it was observed that XMRV is closely related with mouse exogenous gammaretroviruses that are known to cause leukemias and lymphomas in different host species. Recent analysis of large cohort of patients with different stages of prostate cancer as well as healthy men revealed the prevalence of XMRV in malignant epithelial and association with more aggressive tumors.

Experiments were designed to characterize humoral immunity to XMRV. As discussed elsewhere herein, a neutralization assay for detecting the presence of neutralizing antibodies (NAbs) in prostate cancer patient and animal model sera has been developed. Such an assay provides an immunological footprint of XRMV.

In order to expand upon the immunological information obtained from the neutralization assay, experiments were designed to identify and characterize HLA- and MHC-restricted T cell dominant epitopes against XMRV in prostate cancer patients and a murine vaccination model, respectively. Without wishing to be bound by any particular theory, it is believed that XMRV-specific T cells (and epitopes associated therewith) are useful in the further understanding of basic XMRV immunogenicity.

XMRV-specific T cells (and epitopes associated therewith) can be the basis for the development of novel diagnostics and be informative in the design of a prophylactic and/or therapeutic XMRV vaccine. Defining immunodominant T cell epitopes is useful in the development of a tetramer technology-approach for the highly specific and sensitive detection of XMRV-specific T cells in humans and animal models.

Example 5 : XMRV transcripts in experimentally infected human prostatic cell lines Based on RT-PCR products generated from various primer sets (Table 2), it was identified that the doubly spliced transcript lacks internal portions of both the Gag/Pol and Env coding regions (Figure 5), and so resembled the multiply-spliced transcripts encoding viral accessory proteins that typify more complex retroviruses, such as human immunodeficiency viruses (HIV) and human T-lymphotropic virus (HTLV). Using RT- PCR with primers spanning the Env coding region, this internally truncated RNA was readily discernible in DU145 prostate cancer cells at 6 hours (firs), 6 days, or 15 days after XMRV infection (Figure 6A), and also was detected at significant but varying relative concentrations within six other epithelial or fibroblastic cell lines derived from either cancerous or non-cancerous human prostatic tissues (Figure 6B). All of the foregoing cell lines express surface Xprl, a receptor for XMRV. Northern blot (Figure

6C) confirmed expression of the full-length genomic (8.1-kb) and singly-spliced (3.2-kb) viral RNAs, and of the 1.2-kb novel transcript in DU145-C7 cells, which harbor an integrated XMRV pro virus and shed infectious XMRV particles.

A plasmid that contains the VP62-strain XMRV provirus was transfected into the prostate cancer cell line LNCaP. Supernatant containing XMRV from the transfected cells were used to infect fresh cultures of LNCaP and DU145 cells. Short Env-related transcripts were then RT-PCR-amplified (Figure 6D), gel-purified, and sequenced.

Multiple amplimers from both host cell lines revealed a unique, 1 ,207-base viral transcript that initiated at the promoter in the 5 '-long terminal repeat (LTR) but lacked the major 5' intron (bases 205-5477) of the Gag/Pol coding region and, in addition, lacked bases 5642-7350 from the Env coding region (SEQ ID NO: 20, Figure 10). The 5' and 3' boundaries of this latter deletion were identical among amplimers and appeared to represent non-canonical splice donor (SD) and splice acceptor (SA) junctions, respectively, of a novel intron (Figure 7). Retroviral introns typically have non-canonical SD and SA sites and are spliced inefficiently in vivo, a property that may facilitate alternative splicing and may also promote viral replication by preserving the supply of full-length genomic transcripts. In particular, the identified SA closely matches the consensus acceptor branchpoint sequence 5'-YNCURAY-3' (where R = purine and Y = pyrimidine, SEQ ID NO: 43) (Figure 7, underlined) with an appropriately situated adenosine at residue 7326 within the Env coding region that could support RNA lariat formation, as well as a candidate suboptimal polypyrimidine tract (Figure 7, box) located ten bases downstream.

The sequence of the transcript was found to harbor seven potential open reading frames (ORFs). Six of these ORFs are predicted to encode polypeptides unrelated to any known XMRV protein, but mass spectrometry analysis of extracts from infected DU145 cells failed to identify fragments of any of these six hypothetical polypeptides (data not shown). The remaining ORF predicts an 11-kDa protein (provisionally named OrO) that initiates at an internal methionine (amino acid 551) of the Env reading frame and extends through the C-terminal half (95 amino acids) of the transmembrane (TM) domain. To verify whether OrO was produced in infected cells, we inserted a DNA cassette encoding an in-frame influenza hemagglutinin (HA) epitope marker at the C-terminus of the Env coding region of the cloned VP62-strain provirus, transfected this tagged provirus (pVP62-Env-HA) transiently into DU145 cells, and analyzed cytoplasmic extracts for HA-tagged proteins by western blot. We detected expression of tagged proteins corresponding to both the full-length, unprocessed Env (gp75) and its processed TM derivative (pl5e), as well as a third protein of the molecular mass predicted for HA- tagged OrO (Figure 8A and 8B), suggesting that OrO protein itself is produced endogenously in XMRV-infected cells. It is important to note that viruses produced from this HA-tagged provirus remained fully capable of infecting susceptible target cells (Figure 11).

The 95-amino-acid sequence of OrO includes a potential arginine-rich RNA- binding domain (Figure 8C, red), a trait that is also shared by the Revl2, Reml3, Rexl4, and Reel 5 viral proteins of various complex retroviruses that function to bind and facilitate the movement of unspliced and singly-spliced RNAs out of the cell nucleus. Orf3 also contains candidate NLS and NES signals (Figure 8C, underlined) resembling those that together mediate shuttling of proteins between the nucleus and cytoplasm.

To explore the subcellular localization of Orf3, DU145 cells were transfected with an expression plasmid encoding only a fusion of Orf3 with green fluorescent protein (pOrf3-GFP). This fusion protein (Figure 12A) appeared stable in transiently transfected DU145 cells (Figure 8D) and localized to either the nucleus or the cytoplasm of the cells at different times after transfection as identified when counterstained with DAPI and visualized using fluorescence microscopy. The pattern of subcellular localization of the Orf3-GFP distribution suggests that this protein may possess properties that facilitate its movement in and out of the nucleus, similar to those of the mouse mammary tumor virus (MMTV) Rem protein.

Although several studies have identified XMRV infection in prostate cancer cells, any mechanistic link to prostate tumorigenesis has yet to be established. To explore the phenotypic effects of Orf3 expression, NIH-3T3 fibroblasts were transfected with plasmid expression vectors encoding either the singly-spliced Env cDNA (pEnv), the doubly-spliced transcript (pDSV), or only its third exon encoding Orf3 (pOrf3) (Figure 12B, 12C, and 12D). Upon repeated testing, both the pDSV and the pOrf3 constructs induced robust cellular transformation, evidenced by a loss of contact inhibition in monolayer cultures and by colony formation (anchorage -independent growth) in soft agar, whereas the pEnv and vector alone did not. RNA expression from the transfected pOrf3, pDSV, and pEnv constructs were confirmed by RT-PCR (Figure 9A). The frequency of cell transformation was significantly greater for the pDSV or pOrf3 as compared to vector alone or to non-transfected cells (Figure 9B).

XMRV encodes an Orf3 protein corresponding to the C-terminal half of XMRV Env transmembrane (TM) domain. Its mRNA is derived from the singly-spliced Env- encoding mRNA through excision of a non-canonical secondary intron within the Env coding region, which is the region of the XMRV genome most divergent from that of MuLVl . XMRV thus can produce at least one multiply-spliced mRNA, a defining characteristic of complex retroviruses that enables them to encode auxiliary or regulatory proteins in addition to virion structural components. An analogous pattern of splicing in MMTV RNA allows production of Rem, a truncated Env derivative involved in transporting unspliced and incompletely spliced viral mRNAs out of the nucleus. OrO also exhibits autonomous transforming activity. While potent oncogenic activity is known to be associated with the Env proteins of other retroviruses, OrO is the first example of an XMRV gene product with cellular transforming activity. Its existence implies that the diversity of transcripts and proteins from XMRV is greater than previously supposed, and it suggests a mechanism by which XMRV infection might contribute directly to the genesis of a subset of prostate cancers.

Cells and XMRV virus production and infection

Cell lines were grown and maintained as described in Bhosle, S. et al, J Virol 84 (13), 6288-6296 (2010). XMRV for infections was derived from DU145-C7 cells.

XMRV virus equivalent to approximately 34 units/mL of MuLV RT was used in the infections in the presence of polybrene. RNA and protein preparations were prepared using RNAzol B reagent (RNA-Bee, AMS Biotechnology) and CelLytic M (Sigma) lysis reagent, respectively.

RT-PCR and northern blot

cDNA synthesis was performed according to manufacturer's instruction

(Invitrogen). PCR using HiFi Platinum Taq (Invitrogen) forward and reverse primers used are listed in Table 2. Total cellular RNA (20μg) was used to perform northern blot analysis according to the manufacturer's instructions (Ambion) using a radiolabeled XMRV specific DNA probe corresponding to the first 1,100 nucleotides (nt) of the viral genome.

Generation of DSV, VP62-Env-HA, and pOrO-GFP

DSV was generated through fusion of 2 RT-PCR fragments. HA-epitope tag (YPYDVPDYA, SEQ ID NO: 40) was introduced in-frame into the C-terminus of Env gene of VP62 using overlapping PCR. GFP at the C-terminus of OrO was produced in pEGFP-N3 (Clontech). Primer pairs used to generate these RT-PCR fragments and constructs are shown in Table 2.

Subcellular localization

Cells were transiently transfected with pOrO-GFP using Lipofectamine 2000 as recommended by the manufacturer (Invitrogen). Subcellular localization was observed at 24, 48, and 72 hrs post-transfection using an Olympus BX61 fluorescence microscope. DAPI (Invitrogen) was used to visualize the cellular nuclei. Western blot

Transfections of plasmids were performed using Lipofectamine 2000 as recommended by the manufacturer (Invitrogen). Protein lysates were prepared 2 days post-transfection, separated by SDS-PAGE, and transferred onto nitrocellulose membranes. Blots were probed with rabbit anti-HA antibody (Santa Cruz), rabbit anti- GFP antibody (Santa Cruz), or monoclonal anti-actin antibody (Sigma). Secondary anti- rabbit HRP antibody (Santa Cruz) was used to detect the presence of HA and GFP epitope tagged proteins, and secondary anti-mouse HRP antibody (Santa Cruz) was used to detect actin. Transformation

The Env, DSV, and OrO cDNAs were ligated into pcDNA3.1(+) using Zero Blunt® TOPO® PCR (Invitrogen) and verified by sequencing. NIH-3T3 cells (ATCC) were cultured in 6-well plates 24 hrs before transfection at 60-70% confluence.

Transfection used Fugen-6:DNA ratio of 3 : 1 (Roche). Independent experiments were performed two times with three different plasmid preps for each construct.

Approximately 24 hrs after transfection, the medium was changed to selection medium containing 800 μg/ml of G418 and cultured for 2-3 weeks until the non-transfected cells were completely killed in selection medium. Soft agar assay for colony formation was performed by culturing approximately 10,000 transfected NIH-3T3 cells / well in 1 ml of 3.5% agar + lx RPMI + 10% FCS in 6-well plates with solid base layer made by 1.5 ml of 5% agar +lx RPMI+10% FCS. Cells were fed 1-2 times per week with culture media for 20-30 days. Cells transfected with vector alone and wells containing only base and top agar layers were used as controls. Cells were stained with crystal violet or left unstained and then observed using brightfield microscopy.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

1. A method determining whether a subject is infected with XMRV comprising analyzing a sample for the presence of an antibody to a XMRV envelope protein and correlating the presence of the antibody to XMRV infection of the subject from which the sample was obtained.

2. The method of Claim 1, wherein the analyzing comprises mixing the sample and a virus-like particle comprising a XMRV envelope protein, and detecting an antibody bound to the envelope protein.

3. The method of Claim 2, wherein the virus-like particle comprises a lentiviral nucleic acid.

4. The method of Claim 3, wherein the lentiviral nucleic acid does not express the lentiviral envelope protein.

5. The method of Claim 2, wherein detecting antibody bound to the XMRV envelope protein comprises measuring the ability of the virus-like particle to infect a cell that expresses Xprl .

6. A method for detecting a neutralizing antibody against XMRV, the method comprising: 1) contacting a host cell comprising a reporter gene operative ly associated with an lentiviral promoter with a sample comprising a replication deficient lentiviral- XMRV pseudovirus and a test antibody; and 2) measuring reporter gene activity, wherein inhibition of reporter gene activity compared to reporter gene activity with a control antibody indicates anti-pseudovirus activity thereby detecting a neutralizing antibody against XMRV.

7. The method of claim 1, wherein said lentiviral promoter is an HIV-1 long-terminal repeat sequence.

8. The method of claim 6, wherein said lentiviral-XMRV pseudovirus is HIV-XMRV pseudovirus.

9. The method of claim 6, wherein the reporter gene is a luciferase gene, a

chloramphenicol acetyltransferase gene, a growth hormone gene, β-galactosidase gene, or a fluorescent protein gene.

10. A method for detecting an immune response against XMRV, the method comprising: 1) contacting a host cell comprising a reporter gene operatively associated with an lentiviral promoter with a sample comprising a replication deficient lentiviral-XMRV pseudovirus and a biological sample derived from a mammal; and 2) measuring reporter gene activity, wherein inhibition of reporter gene activity compared to reporter gene activity with a control antibody indicates anti-pseudovirus activity thereby detecting an immune response against XMRV.

11. The method of Claim 10, wherein said immune response is a T cell mediated response.

12. The method of Claim 10, wherein said immune response is a B cell mediated response.

13. A composition comprising a lentiviral-XMRV pseudovirus capable of infecting a cell.

14. The composition of claim 13, wherein the lentiviral-XMRV pseudovirus expresses an XMRV surface protein.

15. The composition of claim 14, wherein the XMRV surface protein is Env.

16. A method of producing a lentiviral-XMRV pseudovirus expressing an XMRV surface protein, the method comprising transfecting a host cell with a first plasmid comprising a modified lentiviral genome; and a second plasmid comprising an XMRV gene encoding an XMRV surface protein; and recovering recombinant pseudo virus.

17. A vaccine comprising a XMRV envelope protein, wherein the envelope protein is the transcription product of a singly or doubly spliced transcript of the XMRV Env gene.

18. The vaccine of claim 17 further comprising a recombinant virus-like particle (VLP) comprising an XMRV envelope protein.

19. An isolated polypeptide consisting essentially of SEQ ID NO: 21.

20. An isolated polypeptide of less than 300 amino acids comprising SEQ ID NO: 21.

21. An isolated nucleic acid comprising a sequence encoding a polypeptide of less than 300 amino acids comprising SEQ ID NO: 21.

22. The isolated nucleic acid of Claim 21, wherein the sequence is SEQ ID NO: 20.

23. A recombinant vector comprising a sequence encoding a polypeptide of less than 300 amino acids comprising SEQ ID NO: 21.

24. A conjugate comprising a) a polypeptide consisting essentially of SEQ ID NO: 21 and b) a marker.

25. The conjugate of Claim 24, wherein the marker is Myc, Calmodulin, FLAG, HA, His6, MBP, Nus, GST, GFP, Thioredoxin, isopeptag, BCCP, S-tag, Softag 1, Softag 3, Strep-tag, or SBP-tag.

26. An isolated nucleic acid that hybridizes to SEQ ID NO: 20 wherein the nucleic acid does not substantially bind to the XMRV singly spliced transcript.

27. A conjugate comprising a) a nucleic acid that hybridizes to SEQ ID NO: 20 wherein the nucleic acid does not substantially bind to the XMRV singly spliced transcript and b) a marker.

28. The conjugate of Claim 27, wherein the marker is fluorescent.

29. A method of determining whether a subject is infected with XMRV comprising assaying a sample for OrO and correlating the presence of OrO to XMRV infection.

30. The method of Claim 29, wherein assaying comprises detecting OrO protein.

31. The method of Claim 30, wherein the OrO protein is detected by mass spectroscopy.

32. The method of Claim 29, wherein the assaying comprises, combining the sample and affinity markers for OrO protein and measuring markers in the marker bound sample.

33. The method of Claim 32, wherein the markers are antibodies for OrO protein.

34. The method of Claim 32, wherein the markers are fluorescent.

35. The method of Claim 29, wherein the assaying comprises the step of detecting expression of doubly spliced mRNA of XMRV in the sample.

36. The method of Claim 29, wherein the assaying comprises, mixing the sample with a polynucleotide that hybridizes to doubly spliced mRNA of XMRV.

37. The method of Claim 36, wherein the polynucleotide is conjugated to a fluorescent marker.

38. The method of Claim 29, wherein assaying comprises moving the sample through separation medium and detecting OrO protein or doubly spliced mRNA of XMRV.

39. A pharmaceutical composition comprising nucleic acid that interrupts expression of Orf3 transcription.

40. The pharmaceutical composition of Claim 39, wherein the nucleic acid is a siRNA of Orf3.

41. A pharmaceutical composition comprising an antibody or aptamer of Orf3.

42. A method of treating or preventing a XMRV infection comprising administering a pharmaceutical composition comprising a nucleic acid that interrupts expression of Orf3 transcription to a subject in need thereof.

43. A method of treating of preventing an XMRV infection comprising administering a pharmaceutical composition comprising an antibody or aptamer of Orf3 to a subject in need thereof.