WO2011035045A1 - Compositions à base de canal ionique et utilisations de celles-ci - Google Patents

Compositions à base de canal ionique et utilisations de celles-ci Download PDF

Info

Publication number
WO2011035045A1
WO2011035045A1 PCT/US2010/049149 US2010049149W WO2011035045A1 WO 2011035045 A1 WO2011035045 A1 WO 2011035045A1 US 2010049149 W US2010049149 W US 2010049149W WO 2011035045 A1 WO2011035045 A1 WO 2011035045A1
Authority
WO
WIPO (PCT)
Prior art keywords
ion channel
peptide
composition
binding
fused
Prior art date
Application number
PCT/US2010/049149
Other languages
English (en)
Inventor
Selena Bartlett
Antonello Bonci
Carolina Haass-Koffler
Mohammed Naeemuddin
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Publication of WO2011035045A1 publication Critical patent/WO2011035045A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • This application relates to compositions, research tools, and methods of use for drug discovery.
  • the invention relates to chimera proteins used to identify modulators of biological activity mediated through transmembrane proteins.
  • proteins Numerous biological processes are controlled through proteins with domains that span one or more membranes within a cell. These proteins are active in every organ system and regulate various systems responsible for physiological systems. Such proteins control and/or mediate specific cellular functions and signaling pathways; movement of certain molecules in and out of the cell, e.g., sodium, potassium or calcium; or other physiological processes that are caused by external stimuli and/or cell-to-cell interactions, such as inflammation and immunological activation. Thus, they present a wide range of opportunities as therapeutic targets in areas including central nervous system disorders, cardiac dysfunction, inflammation, cancer, diabetes, obesity and pain.
  • Ion channels represent a class of membrane spanning protein pores that mediate the flux of ions in a variety of cell types. Their critical physiological roles include control of the electrical potential across the membrane, mediation of ionic and fluid balance, facilitation of neuromuscular and neuronal transmission, rapid transmembrane signal transduction, and regulation of secretion and contractility. All mammalian cells rely on the regulated movement of inorganic ions across cell membranes to perform essential physiological functions.
  • the ion channels that permit these physiological changes are proteinaceous pores consisting of one or multiple subunits, each containing two or more membrane-spanning domains. Most ion channels have selectivity for specific ions, primarily Na + , K + , Ca 2+ , or CI " , by virtue of physical preferences for size and charge. Electrochemical forces, rather than active transport, drive ions across membranes; thus a single channel may allow the passage of millions of ions per second.
  • compositions of the invention are chimera proteins that in essence recreate and/or potentiate one or more protein:protein interactions that occur in vivo in the modulation of biological processes.
  • the chimera compositions comprise 1) a peptide having an N-terminal extracellular domain from an ion channel, a transmembrane region from an ion channel, and an intracellular signaling domain from an ion channel and 2) a peptide corresponding to a protein that associates with an ion channel complex in the modulation of a biological process.
  • the second peptide is fused to the first peptide, and preferably to the N-terminal extracellular domain of the first peptide, and allows functional expression of the ion channel, including where necessary proper assembly in a cellular membrane.
  • the chimera composition allows the ion channel to adopt the appropriate conformational configuration and preserves the ion channel activity. The chimera thus has preserved physiological activity in functional assays, including assays in mammalian cells, and is useful in the identification or investigation of ion channel activity.
  • the chimera compositions comprise a substantially complete amino acid sequence of a particular ion channel, and thus the first peptide comprises an N-terminal extracellular domain, transmembrane region, and an intracellular signaling domain corresponding to a single ion channel.
  • the second peptide of the chimera fusion corresponds to a protein that associates with the particular ion channel in the modulation of a biological process.
  • the second peptide comprises all or a portion of a protein that binds to the relevant ion channel portion of the first peptide and/or facilitates association of the specific protein complex that modulates activity of the ion channel, either through direct binding to the first peptide or through binding of a protein complex partner that binds to both the first and second peptide of the chimera composition.
  • Both the first and the second peptide may include amino acid sequence variants that are naturally occurring (e.g., due to genetic polymorphisms within a population) or that are added to confer a desirable characteristic to the composition (e.g., mutations introduced to increase stability, to aid in production, and/or to aid in isolation of the composition).
  • compositions of the invention may be created using recombinant technology, or they may be associated following expression of the proteins using synthetic or biological linkers.
  • the composition is produced as a single recombinant protein in a cell.
  • Certain ion channels are composed of two or more subunits that assemble in a membrane to create the ion channel pore.
  • the chimera composition may recreate the functional interaction of a specific subunit of the ion channel
  • the first peptide of the chimera composition may correspond to portions of a single subunit of the ion channel.
  • the first protein may comprise an a subunit of a voltage-gated ion channel, which generally has six transmembrane regions; the first peptide may comprise essentially the sequence of the subunit, and the second peptide may correspond to a binding protein (or a portion or variation thereof) that associates with the channel upon assembly of the channel in vivo.
  • the chimera compositions comprise 1) a peptide having an N-terminal extracellular domain from an ion channel subunit, a transmembrane region from an ion channel subunit, and an intracellular signaling domain from an ion channel subunit and 2) a peptide corresponding to a protein that associates with an ion channel complex in the modulation of a biological process.
  • the second peptide is fused to the first peptide, and preferably to the N-terminal extracellular domain of the first peptide, and allows functional expression of the subunit and the assembly of this fused subunit with other subunits of the desired ion channel in cells.
  • the fused subunit assembles with other ion channel subunits and adopts the appropriate conformational configuration in a manner that preserves the ion channel activity.
  • the chimera thus has preserved signaling activity in functional ion channel assays, including assays in mammalian cells, and is useful in the identification or investigation of ion channel activity.
  • the chimera compositions comprise a substantially complete amino acid sequence of a particular ion channel subunit, and thus the first peptide comprises an N-terminal extracellular domain, transmembrane region, and an intracellular signaling domain corresponding to a single ion channel subunit.
  • the second peptide of the chimera fusion corresponds to a protein that associates with the particular ion channel in the modulation of a biological process.
  • the chimera compositions comprise the N-terminal extracellular domain of a subunit of an ion channel that can assemble with multiple combinations of other subunits in the assembly of the ion channel. This may be useful to identify binding partners that modulate multiple isoforms or tissue- or neuron- specific forms of the ion channel.
  • the composition of the invention comprises two or more ion channel subunits individually fused with N-terminal peptides, where the two subunits assemble with or without other subunits into one ion channel.
  • the chimera compositions comprise a first ion channel subunit associated with a first N-terminal peptide, and a second ion channel subunit associated with a second N-terminal peptide. This may be useful to identify binding partners that modulate the ion channel via binding to separate binding proteins available on different subunits of the ion channel, and to ensure selectivity of a modulator with specific tissue-, process- or neuron-specific combinations of subunits.
  • the ion channel can be designed to have sufficient numbers and types of terminal peptides to provide a constitutively active ion channel.
  • the first peptide of the chimera composition may correspond to all or a relevant portion of an ion channel or ion channel subunits involved in a biological process.
  • the second peptide(s) may comprise all or a portion of a protein that binds to the relevant ion channel subunit in its signaling complex and/or facilitate association of the specific protein complex that modulates activity of the ion channel.
  • the invention comprises two ion channel subunits, each fused with a binding partner for a specific ion channel that comprises the two subunits following assembly of the ion channel in the membrane.
  • This composition comprises two peptides corresponding to a first ion channel subunit and a second ion channel subunit that assemble with one another in the creation of a functional ion channel in a membrane.
  • Both the first and second subunits are fused to a binding partner that associates in a binding complex with the ion channel and involved in modulation of ion channel activity in a biological process.
  • the binding partner on the two subunits is the same, while in other aspects the binding partners fused to the first and second subunits are two different binding partners that each modulate ion channel activity.
  • composition is as a research tool specifically for the discovery and development of therapeutic products (e.g., small molecules) for modulation of a biological process involved in a disease, disorder and/or physiological behaviors such as cognition or memory.
  • therapeutic products e.g., small molecules
  • the research tool may be useful in various aspects of drug discovery and investigation, including without limitation the initial identification of a drug candidate, the confirmation of activity of a drug candidate; and the identification of activity in an existing pharmaceutical product.
  • composition is as a diagnostic tool specifically used to detect the presence or absence of molecules necessary for the modulation of a biological process involved in a disease or disorder.
  • the invention includes research tools comprising the compositions of the invention, and uses of such research tools in identification, investigation and/or confirmation of activity of binding partners that are useful as therapeutic agents.
  • the present invention thus encompasses binding partners that are isolated using the method of the invention and uses of such binding partners in either a therapeutic or a diagnostic setting.
  • the invention provides a research tool for the identification and/or confirmation of activity of an agent with binding to sites on one portion of the chimera, e.g., a binding partner that binds to one or more epitopes of a single peptide within the chimera (e.g., an epitope on the ion channel peptide of the chimera).
  • the binding partner is capable of binding to sites on two distinct portions of the chimera proteins, e.g., binding to a first epitope on the ion channel peptide of the chimera and a second epitope on the second peptide.
  • the invention is directed to assays for identification of ion channel activity that comprise the chimera proteins of the invention.
  • Use of the research tools of the invention can in essence recreate one or more ion channel interactions that occur in vivo in the modulation of a biological process, thus potentiating selective binding of binding partners that require the association of two or more members of the ion channel signaling complex to modulate activity.
  • the present invention provides assays that are research tools for identification of a drug candidate for modulation of a biological process involving signaling through an ion channel.
  • These assays comprise providing the chimera compositions of the invention, testing one or more binding partners for modulation of the functional activity of the research tool composition, and isolating the binding partners that display the desired change in functional activity of the research tool composition.
  • the binding partners that display the desired change in functional activity of the research tool composition become drug candidates for the biological process involving ion channel activity.
  • the research tool compositions can comprise an intracellular signaling domain and/or a transmembrane domain that correspond to the same ion channel as the N-terminal extracellular domain, or the compositions may comprise sequences from two or more ion channels.
  • the research tool composition of the assay corresponds to a substantially complete amino acid sequence of an ion channel.
  • the invention is directed to assays for identification of ion channel activity that comprise the chimera proteins of the invention.
  • Use of the research tools of the invention can in essence recreate one or more ion channel interactions that occur in vivo in the modulation of a biological process, thus potentiating selective binding of binding partners that require the association of two or more members of the ion channel signaling complex to modulate activity.
  • the ion channels that may be useful in the design of the compositions of the present invention include sodium channels, potassium channels, calcium channels and chloride channels.
  • the ion channel is an acetylcholine receptor, and specifically nicotinic acetylcholine receptors.
  • the ion channel of the chimera composition corresponds to an ion channel involved in neuronal signal transmission, including ion channels involved in the transmission of pain, including nociceptic pain, neuropathic pain, or a combination thereof.
  • FIG. 1 illustrates the structural elements of the construct used to create the CRF-B P_H AHua7 chimera.
  • antibody is intended to include any polypeptide chain- containing molecular structure with a specific shape that fits to and recognizes an epitope, where one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope.
  • antibody should be construed as covering any specific binding member or substance having a binding domain with the required specificity.
  • this term covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or wholly or partially synthetic.
  • bispecific antibodies may be conventional bispecific antibodies, which can be manufactured in a variety of ways (Holliger and Winter, 1993), e.g., prepared chemically or from hybrid hybridomas, or may be any of the bispecific antibody fragments mentioned above. It may be preferable to use scFv dimers or diabodies rather than whole antibodies. Diabodies and scFv can be constructed without an Fc region, using only variable domains, potentially reducing the effects of anti-idiotypic reaction. Other forms of bispecific antibodies include the single chain "Janusins" described in Traunecker et al, (1991). Such antibodies also include CRAbs, which are chelating antibodies which provide high affinity binding to an antigen. D. Neri, et al. J. Mol. Biol, 246, 367-373, and dual-variable domain antibodies as described in Wu C et al., Nat Biotechnol. 2007 Nov;25(l l): 1290-7. Epub 2007 Oct 14.
  • aptamer refers to any subsequence of nucleic acid or protein, selected from a large random sequence-pool, used to bind to a target molecule
  • binding partner is any molecule that is complementary to one or more regions on a chimera composition of the invention via association by chemical or physical means.
  • the binding partner may be a compound that facilitates binding of the composition with other members of a protein signaling complex, or a compound that interferes with the association of a known binding pair.
  • binding partners that can be investigated and/or identified using this invention include, but are not restricted to: peptides, proteins (including derivatized or labeled proteins); antibodies or fragments thereof; small molecules; ap tamers; carbohydrates and/or other non-protein binding moieties; derivatives and fragments of a naturally- occurring binding partners; peptidomimetics; and pharmacophores.
  • biological process includes both normal physiological processes, such as cognition, memory, neuroprotection, etc. as well as pathological processes, e.g. those involved in diseases and conditions such as depression, addiction, defective apoptotic activity, and the like.
  • complementary refers to the topological compatibility or interactive structure of interacting surfaces of a composition of the invention and a binding partner.
  • the composition of the invention and its identified binding partners can be described as complementary, and furthermore, the contact surface characteristics are each complementary to each other.
  • Preferred complementary structures have binding affinity for each other and the greater the degree of complementarity the structures have for each other the greater the binding affinity between the structures.
  • diagnostic tool refers to any composition or assay of the invention used in order to carry out a diagnostic test or assay on a patient sample.
  • the composition of the invention may be considered an analyte specific reagent, and as such may form part of a diagnostic test regulated by a federal or state agency.
  • the use of the compositions of the invention as a diagnostic tool is not intended to be related to any use of the composition in the development of therapeutic agents.
  • epitopope refers to the portion of the composition of the invention which is delineated by the area of interaction with a binding partner.
  • the term "fused" when referring to a chimera of the invention refers to any mechanistic, chemical, or recombinant mechanism for attaching a specific ion channel and/or ion channel subunit to a member of the ion channel signaling complex.
  • the fusion of the second peptide to the first peptide may be a direct fusion of the sequences, with the second peptide directly adjacent to the first peptide, or it may be an indirect fusion, e.g., with intervening amino acid sequences such as an identifier or epitope tag sequence, a domain, a functional peptide or a larger protein.
  • the two peptides may be fused following co-expression in the cell, using high affinity binding sequences between the two peptides, such as biotin and avidin or strepavidin.
  • the two peptides are fused following expression of the ion channel in the cell and synthetic tethering of the second peptide to the N-terminus of the first ion channel peptide.
  • peptide refers to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • peptidomimetic refers to a protein-like chain designed to mimic a peptide. They typically arise from modification of an existing peptide in order to alter the molecule's properties. For example, they may arise from modifications to change a molecule's stability, biological activity, or bioavailability.
  • the term "pharmacophore” is used herein in an unconventional manner.
  • conventional means a geometric and/or chemical description of a class or collection of compounds
  • the term means a compound that has a specific biochemical activity or binding property conferred by the 3-dimensional physical shape of the compound and the electrochemical properties of the atoms making up the compound.
  • the term “pharmacophore” is a compound and not a description of a collection of compounds which have defined characteristics. Specifically, a “pharmacophore” is a compound with those characteristics.
  • search tool refers to any composition or assay of the invention used for scientific enquiry, academic or commercial in nature, including the development of pharmaceutical and/or biological therapeutics.
  • the research tools of the invention are not intended to be therapeutic or to be subject to regulatory approval; rather, the research tools of the invention are intended to facilitate research and aid in such development activities, including any activities performed with the intention to produce information to support a regulatory submission.
  • small molecule refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals.
  • Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
  • binding partner e.g., protein, nucleic acid, antibody, etc.
  • binding partner e.g., protein, nucleic acid, antibody, etc.
  • the binding partner will bind to a composition of the invention at least two times the background and will not substantially bind in a significant amount to other proteins present in the sample.
  • specific binding will be at least twice background signal or noise and more typically more than 10 to 100 times background.
  • the binding partner binds to its particular "target" molecule and does not bind in a significant amount to other molecules present in the sample.
  • a "target” or “target protein” as used herein includes any ion channel, including a subunit, portion or portions of an ion channel, or any member of an ion channel signaling complex that comprises one or more epitopes to which a binding partner selectively binds.
  • the terms “treat,” “treatment,” “treating,” and the like refer to obtaining a desired pharmacologic and/or physiologic effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse affect attributable to the disease.
  • Treatment covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, e.g., causing regression of the disease, e.g., to completely or partially remove symptoms of the disease.
  • the present invention is based on the use of novel, protein-based chimera compositions that in essence recreate the interaction of an ion channel and one or more of the proteins that normally interact with ion channels in controlling their activity.
  • the compositions of the invention can re-create functional activity of an ion channel in a cellular setting, and potentiate modulation of the ion channel by providing an ion channel and at least other one member of the ion channel protein complex in the correct location in a membrane.
  • Use of the compositions of the invention as research tools provides high- throughput cell-based screening assays to identify molecules that interact with ion channels based in part on their known naturally- occurring partners.
  • Providing a molecule with an inherent interaction between at least one subunit of the ion channel complex and a second molecule that modulates the ion channel activity in a biological process greatly enhances identification of other members of the ion channel complex and/or binding partners that can somehow modify signaling through the ion channel complex.
  • the present invention chimeras having a binding complex member fused to the virtually any ion channel or ion channel subunit, and preferably to the N-terminus of the channel and/or the subunit.
  • the second peptide of the chimera corresponds to a large binding complex member.
  • the invention described herein sets forth a more general approach to creating novel compositions and assays for understanding complex transmembrane signaling, an approach which takes advantage of the similarity in structures of ion channels and/or their subunits and the ability of cells to somehow appropriately insert these chimera receptors across membranes despite the presence of large peptides fused to ion channels or ion channel subunits.
  • chimera compositions that in effect recreate at least one binding interaction of a complex removes one level of variability in creating the complex in vivo, and enhances the ability to identify binding partners that interact with one or both of these components in the signaling process.
  • this invention overcomes the inherent difficulty in identifying molecules that disrupt the interaction of receptor complexes with their binding partners.
  • These chimera proteins can be used in in vitro assays or in ex vivo assays, as these proteins can be produced in stable cell lines and/or isolated as membrane fragments.
  • the chimera compositions of the invention are especially useful as research tools to identify binding partners that enhance signaling through ion channel complexes, or to identify binding partners that inhibit the appropriate protein complex interactions necessary for ion channel activity.
  • Assays utilizing the chimera compositions of the invention allow testing of not just binding to ion channels and/or other proteins in signaling complexes, but to also identify the effect binding partners have on functional cellular activity resulting from ion channel complexes.
  • the ability to identify binding partners that display the desired change in functional activity is a great advantage of the invention, and will accelerate the identification and development of drug candidates having the desired changes in such biological processes.
  • the assay can be used to identify different effects of the functional activity of the ion channel, and may be used to identify drug candidates that are antagonists, partial agonists and/or agonists of the ion channel according to the need presented by the particular biological processes.
  • Ion channels are attractive therapeutic targets for the biologies of the invention due to their involvement in such numerous and diverse physiological processes. Ion channels figure in a wide variety of biological processes that involve rapid changes in cells, such as neural activity, cardiac, skeletal, and smooth muscle contraction, epithelial transport of nutrients and ions, T-cell activation and pancreatic beta-cell insulin release. Channel opening, or "gating" is tightly controlled by changes in voltage, ligand binding, or by other mechanisms depending on the subclass of channel. Examples of different channels that may be modulated using the methods of the invention thus include voltage-gated channels, ligand-gated channels, and other-gated channels, as described in more detail in the following sections.
  • ion channels that can be useful in design of the chimera compositions are the voltage-gated channels. These channels open and close in response to membrane potential, and are involved in numerous processes in excitable cells, such as neurons, as well as performing important functions in non-excitable cells, such as the regulation of secretory, homeostatic, and mitogenic processes. Reproducing ion channel signaling, and the ability to potentiate this signaling by providing chimeras with ion channel signaling complex members, can facilitate understanding of biological processes utilizing ion channel activity and modulation of such biological processes.
  • the family of voltage-gated sodium channels contains at least nine members, and is largely responsible for action potential creation and propagation.
  • the pore-forming a subunits are very large (up to 4,000 amino acids) and consist of four homologous repeat domains (TIV) each comprising six transmembrane segments (S1-S6) for a total of 24 transmembrane segments.
  • TIV homologous repeat domains
  • the members of this family also co-assemble with auxiliary ⁇ subunits, each spanning the membrane once. Since both a and ⁇ subunits are extensively glycosylated, the chimeras of the invention can optionally be modified to either facilitate or prevent glycosylation, depending upon the desired effect.
  • the family of voltage-gated calcium channels contains 10 members, though these members are known to co-assemble with ⁇ 2 ⁇ , ⁇ , and ⁇ subunits.
  • the a subunits of voltage-gated calcium channels have an overall structural resemblance to a subunits of the sodium channels, and are equally large. These channels play an important role in linking muscle excitation with contraction as well as neuronal excitation via transmitter release.
  • the family of voltage-gated potassium channels contains almost 40 members, which are further divided into 12 subfamilies.
  • the a subunits have six transmembrane segments, homologous to a single domain of the sodium channels. Correspondingly, they assemble as tetramers to produce a functioning channel. These channels are known mainly for their role in repolarizing the cell membrane following action potentials.
  • TRP transient receptor potential
  • TRPV vanilloid receptors
  • TRPM melastatin
  • TRPP polycystins
  • TRPML mucolipins
  • TRP A ankyrin transmembrane protein 1
  • Yet another class of voltage-gated ion channels that may be used in design of the chimera compositions of the invention includes hyperpolarization-activated cyclic nucleotide- gated channels.
  • the opening of these channels is due to hyperpolarization rather than the depolarization required for other cyclic nucleotide-gated channels.
  • These channels are also sensitive to the cyclic nucleotides cAMP and cGMP, which alter the voltage sensitivity of the channel's opening.
  • These channels are permeable to the monovalent cations K + and Na + .
  • There are 4 members of this family all of which form tetramers of six-transmembrane a subunits. As these channels open under hyperpolarizing conditions, they function as pacemaking channels in the heart, particularly the SA node.
  • Yet another class of voltage-gated ion channels that may be used in design of the chimera compositions of the invention includes voltage-gated proton channels, which open with depolarization in a strongly pH-sensitive manner. These channels only open when the electrochemical gradient is outward, such that their opening will only allow protons to leave cells. Their function thus appears to be acid extrusion from cells, or to allow proton flux to balance the electron movement such as that produced during a respiratory burst.
  • Ligand-gated ion channels also known as ionotropic receptors, activate or inactivate depending on binding of ligands to the extracellular domain of the channel. Ligand binding causes a conformational change in the structure of the channel protein that ultimately leads to the opening of the channel gate and subsequent ion flux across the plasma membrane.
  • ligand-gated ion channels include the cation-permeable "nicotinic" acetylcholine receptor, ionotropic glutamate-gated receptors and ATP-gated P2X receptors, and the anion-permeable ⁇ -aminobutyric acid-gated GABA A receptor.
  • Ca 2+ channels are also ligand-gated ion channels.
  • the ion channel used in the chimera compositions of the invention are nicotinic acetylcholine receptors, which are gated ion channels that open in response to acetylcholine binding.
  • ion channels can also be used in design of the chimera compositions of the invention. These channels include ion channels activated or inactivated using other methods, such as by second messengers from the inside of the cell membrane, rather as from outside, as in the case for ligands.
  • This class includes potassium channels such as the inward-rectifier potassium channel family, which allow potassium to flow into the cell in an inwardly rectifying manner.
  • This family is composed of 15 official and 1 unofficial members and is further subdivided into 7 subfamilies based on homology. These channels are affected by intracellular ATP, PIP 2 , and G-protein ⁇ subunits. They are involved in important physiological processes such as the pacemaker activity in the heart, insulin release, and potassium uptake in glial cells. They contain only two transmembrane segments, corresponding to the core pore-forming segments of the Ky and Kc a channels, and their a subunits form tetramers.
  • Additional families of other-gated ion channels are the calcium-activated potassium channels, which includes 8 members are activated by intracellular Ca 2+ and; two-pore-domain potassium channel family, which includes 15 members and form what is known as leak channels: light-gated channels like rhodopsin, which is directly opened by the action of light; cyclic nucleotide- gated (CNG) channels, which are characterized by activation due to the binding of intracellular cAMP or cGMP; and the hyperpolarization-activated, cyclic nucleotide-gated (HCN) channels.
  • CNG cyclic nucleotide- gated
  • HCN hyperpolarization-activated, cyclic nucleotide-gated
  • the chimeras comprise proteins fused to voltage-gated ion channels. Insulin has been shown to participate in modulation of voltage-gated potassium channels. Studies have shown that the insulin inhibitory effect on K(+) channels is not due to a change in the activation or inactivation of current-voltage profiles; rather, evidence suggests that the change is mediated through association with erg-like channels. Similar observations were observed concerning the insulin inhibitory effect on slow voltage-activated K(+) currents. Thus, chimeras comprising K(+) channels and an erg-like channel would provide compositions for control of insulin effects on K(+) channel activity.
  • the chimera compositions of the invention comprise a binding protein fused to a ligand-gated ion channel subunit.
  • chimera compositions may be based on nerve terminal 2+
  • GABA A Receptors which modulate Ca influx and glutamate release. Long P, J Biol Chem. 2009 Mar 27;284(13):8726-37. Epub 2009 Jan 13.
  • GABA A is a particularly important pharmacological target, as it is known to have distinct allosteric binding sites for benzodiazepines, barbiturates, ethanol, inhaled anaesthetics, furosemide, kavalactones, neuroactive steroids, and picrotoxin. Santhakumar Vet al., Alcohol 41 (3): 211-21; Johnston GAR (1996, Pharmacology and Therapeutics 69 (3): 173-198. Ligands thus may display selective binding to particular subsets of receptors comprising specific subunits.
  • compositions of the invention having different ligands fused to specific GABA A subunits can identify the GABA A receptor combinations that are prevalent in particular brain areas and elucidate which subunit combinations may be responsible for GABA A receptor activity in different biological processes.
  • Such compositions are valuable research tools to identify drug candidates that modulate specific GABA A activities.
  • Use of selective ligands as binding proteins in the chimera compositions may facilitate identification of drug candidates that can dissociate desired therapeutic effects from unintended effects on other processes, thus minimizing undesirable side effects.
  • compositions of the invention are based on N-methyl- D-aspartate (NMDA) receptors, which are involved in the induction and maintenance of central sensitization during pain states as well as mediation of peripheral sensitization and visceral pain.
  • NMDA N-methyl- D-aspartate
  • Petrenko AB et al., Anesth Analg 2003;97:1108-1116 NMDA receptors are composed of NR1, NR2 (A, B, C, and D), and NR3 (A and B) subunits, which determine the functional properties of native NMDA receptors.
  • the active NMDA receptors form a heterotetramer comprised of two NR1 and two NR2 subunits, with two obligatory NR1 subunits and two regionally localized NR2 subunits; NR3 A and B subunits have an inhibitory effect on receptor activity. Stephenson FA (2006). Biochem. Soc. Trans. 34 (Pt 5): 877-81. Multiple receptor isoforms with distinct brain distributions and functional properties arise by selective splicing of the NR1 transcripts and differential expression of the NR2 subunits.
  • a number of binding proteins can be used to potentiate selective NMDA receptor activity, including connexins (Alev C et al., Proc Natl Acad Sci U S A. 2008 Dec 30;105(52):20964-9. Epub 2008 Dec 18), IGF-BP 1-6 (Zumkeller and M Westphal Mol Pathol. 2001 Aug;54(4):227-9), fatty acid binding proteins (FABPs) (Owada et al., Eur J Neurosci. 2006 Jul;24(l): 175-87) and interleukin-beta l(Zhang et al., Biochem Biophys Res Commun. 2008 Aug 8;372(4):816-20. Epub 2008 Jun 2.).
  • chimera compositions of the invention may comprise such binding proteins fused to NMDA.
  • IL- 1 ⁇ interleukin-lbeta
  • NMDA N-methyl-D-aspartate
  • IL- ⁇ increasing the neuronal excitability by inhibition of ChTX-sensitive K(Ca) channels activated by Ca(2+) influx through both NMDA receptors and voltage-gated Ca(2+) channels
  • IL- ⁇ is used as a modulating protein with an NMDA- based subunit.
  • the NMDA binding proteins in the chimera compositions are transmembrane receptors which have been identified as modulating proteins.
  • NMDA signaling has been shown to be dependent upon the interaction of NMDA and other transmembrane receptors, including but not limited to IGF-R1 (Zheng WH and Quirion, J Biol Chem. 2009 Jan 9;284(2): 855-61. Epub 2008 Nov 3.), voltage-gated calcium channels (Christie and Jahr Neuron. 2008 Oct 23;60(2):298-307), low-density lipoprotein receptors (Samson AL J Neurochem. 2008 Nov;107(4):1091-101.
  • Chimeras of the invention thus may also include NMDA receptors fused with such modulatory transmembrane receptors.
  • the a-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (also known as AMPA receptor, AMPAR, or quisqualate receptor) is a non-NMDA-type ionotropic transmembrane receptor for glutamate that mediates fast synaptic transmission in the central nervous system (CNS).
  • AMPARs are found in many parts of the brain and are the most commonly found receptor in the nervous system.
  • the chimera compositions of the invention may comprise multiple different binding proteins fused to AMPARs, including AMPA signaling binding partners such as the associated transmembrane AMPA regulatory proteins (TARPs) (Soto et al., Nat Neurosci. 2009 Mar;12(3):277-85.
  • AMPA signaling binding partners such as the associated transmembrane AMPA regulatory proteins (TARPs) (Soto et al., Nat Neurosci. 2009 Mar;12(3):277-85.
  • the invention also comprises C-terminal chimeras with a protein fused to the C-terminal region of an ion channel subunit.
  • intracellular channel-associated proteins may play an important role in ion channel activity, not only in anchoring the ion channel to its specific position in the membrane but also in localizing protein tyrosine kinases and phosphatases to the vicinity of the ion channel.
  • Ligand-gated ion channels in particular are among the most precisely localized of membrane proteins, primarily due to their extensive associations with specific scaffolding and cytoskeletal proteins.
  • various docking, adaptor, or scaffolding proteins or fragments thereof may be fused to the C-terminal region of an ion channel subunit to assist in placement of the ion channel and/or recruitment of a potential signaling partner.
  • scaffolding and adaptor proteins are implicated in organizing ion channels into signaling complexes and regulating function by coupling the channels to protein kinases.
  • Prominent families of scaffolding proteins known to interact with ion channels includes the MAGUK family of proteins, the AKAP family of proteins, and the GKAP family of proteins, amongst others (Hibino, H et al., EMBO J 19: 78-83, 2000). Many of these proteins are involved in directing protein associations apart from ion channels as well, and evidence supports their role in the intracellular localization of several types of channels and proper organization of ion channels at key locations including neuronal synapses.
  • a chimera comprising a potassium channel subunit and a scaffold protein such as PSD-95 could be used to examine the placement of a particular ion channel and regulation and/or activity of the specifically localized channel.
  • scaffolding proteins that associate with voltage-gated and ligand-gated families of channels (Ponting, CP, et al., Bioessays 19: 469-479, 1997, Sheng, M, and Pak DT, Annu Rev Physiol 62: 755-778, 2000; Davis MJ et al., Am J Physiol Heart Circ Physiol 281: H1835-H1862, 2001, each of which is incorporated by reference herein), and the C-terminal chimeras of the invention are intended to encompass these and other intracellular proteins that associate with ion channels in specific cell types to mediate various biological processes.
  • the chimera may include both an N-terminal peptide and a C-terminal peptide.
  • the chimeras of the invention thus also include such molecules with peptides that affect both extracellular signaling complexes and intracellular association of the ion channel.
  • an ion channel subunit may have an extracellular signaling peptide fused to its N-terminus, and an anchoring or scaffold peptide fused to its C-terminal domain.
  • Such dual chimeras may, for example, assist the proper positioning of the chimera in the membrane or to ensure the association of members of signaling complexes both outside and within the cell.
  • compositions of the invention are used to identify binding partners that are drug candidates for treatment of disease associated with ligand-gated ion channels, such as those that mediate conditions such as addiction.
  • the following are exemplary chimera compositions that may be amenable to therapeutic intervention using ion channel-based binding partners of the compositions of the invention.
  • the invention is not meant to be limited to such examples; rather, use of a single example is presented so as to better elucidate the aspects of the invention without obscuring the basic elements of the novelty of the invention. This specific example demonstrates the mechanistic approach of the invention and is not meant in any way to limit the invention's scope.
  • nAChRs nicotinic acetylcholine receptors
  • nAChRs nicotinic acetylcholine receptors
  • nAChRs are ligand-gated channels involved in numerous processes. They are a member if the "cys-loop" ligand-gated ion channels composed of five protein subunits surrounding a central pore that gates cation flux. Each subunit contains four transmembrane regions of approximately 20 amino acids.
  • the 17 known nAChR subunits assemble into a variety of pharmacologically distinct receptor subtypes, and the subunit composition of these ion channels is variable across different tissue types.
  • nAChRs are involved in signal transduction upon binding of the neurotransmitter acetylcholine, choline, or exogenous ligands, such as nicotine, and are expressed at the neuromuscular junction and in the nervous system and several non- neuronal cell types. nAChRs are implicated in a range of physiological functions and pathophysiological conditions related to muscle contraction, learning and memory, reward, motor control, arousal, and analgesia, and therefore present an important target for drug research.
  • alpha-7 nicotinic acetylcholine receptor (a7-nAChR) is well known as a potent calcium ionophore that, in the brain, has been implicated in excitotoxicity and hence in the underlying mechanisms of neurodegenerative disorders such as Alzheimer's disease.
  • Two peptides derived from the C-terminus of acetylcholinesterase have been shown to alter the receptor binding properties of a7-nAChR for its familiar ligands, including both acetylcholine and the alternative endogenous agonist choline.
  • these peptides also induce upregulation of a7-nAChR mRNA and protein expression, as well as enhancing receptor trafficking to the plasma membrane.
  • Bond CE et al., 2009 Upregulation of al Nicotinic Receptors by Acetylcholinesterase C- Terminal Peptides.
  • T-AChE accumulates in amyloid plaques, where it enhances ⁇ fibril formation and exacerbates the neurotoxic effects of ⁇ Alvarez A et al., (1998) J Neurosci 18: 3213-3223; Berson A et al., (2008) Brain 131: 109-119; Inestrosa NC et al., (2008) FEBS J 275: 625-632.
  • the C-terminal domain of T-AChE may undergo proteolytic cleavage in vivo. Jean L et al., (2007) PLoS ONE 2:http://www.plosone.org/article/info:doi/ 10.1371/journal.pone.0000652.
  • the chimera of the invention provides nAChR with N-terminal peptides fused to one or more subunits.
  • the use of such chimera compositions can differentiate interactions between different nAChR binding partners and the receptor and their impact on calcium flux. Multiple chimera compositions can be created to identify the changes in activity that result from the binding of specific peptides to the nAChR.
  • using chimera compositions with different N-terminal binding peptides can distinguish between inhibitors of nAChR that have activity in the presence of different binding proteins.
  • Chimera compositions of the invention that can be used to investigate the activity of the nAChR and identify inhibitors and/or potentiaters of its activity.
  • These chimeras may include: 1) an N-terminal T30 peptide from T-AchE, and a subunit of the nAChR; 2) an N-terminal amyloid-beta ( ⁇ ) peptide and a subunit of the nAChR; 3) an N-terminal acetylcholine peptide and a subunit of the nAChR; and 4) an N-terminal choline peptide and a subunit of the nAChR.
  • a chimera composition may comprise two or more of these compositions, e.g. one subunit comprising an N-terminal amyloid-beta ( ⁇ ) peptide and one subunit comprising an N- terminal acetylcholine peptide.
  • the ion-channel based chimeras of the invention can be useful in numerous therapeutic settings, including but not limited to the following:
  • neuropathic pain is caused by a primary lesion or dysfunction in the nervous system. It can be subdivided into peripheral and central neuropathic pain depending on where the lesion or dysfunction has occurred.
  • All stages of the pain pathway involve ion channels which are located at the nociceptor peripheral terminals and are the first to detect the pain causing stimuli (heat, pressure, tissue damage etc.) and transmit them further.
  • ion channel activity may lead to pathological states such as allodynia (pain resulting from an abnormal response to common stimulus, such as touching sunburned skin) and hyperalgesia (an excessive response to noxious stimuli).
  • pathological states such as allodynia (pain resulting from an abnormal response to common stimulus, such as touching sunburned skin) and hyperalgesia (an excessive response to noxious stimuli).
  • Chronic inflammation can also trigger on-going nociceptive pain via ion channel activity, causing debilitation in a patient beyond that caused by the inflammation, e.g., the tissue destruction associated with many of diseases involving chronic inflammation.
  • Nociceptive pain occurs when nociceptors are stimulated in response to substances that are released from damaged or inflamed tissue. Many ion channels are located at the nociceptor peripheral terminal, affecting neuron excitability after injury and as a result affecting pain sensation. Voltage gated, Na and Ca channels, TRP, ASIC, ligand gated ion channels, P2X, NMDA, AMPA and Kainate receptors are just some of the ion channels involved in the pathogenesis of pain.
  • Neuropathic pain lasts long after apparent healing of the damaged tissues and frequently it turns into chronic pain which serves little if any protective effect. Neuropathic pain can actually interfere with the restoration of normal function after injury or disease. Peripheral neuropathic pain may result from disease, while central neuropathic pain is usually caused by damage to the spinal cord or the brain. Ion channels are involved in transduction of neuropathic pain as well as nociceptive pain, an are thus excellent targets for treatment of neuropathic pain such as post-herpetic neuralgia.
  • ion channels are recognized as potential therapeutic targets in the treatment of numerous diseases involving the central nervous system.
  • potassium channels are recognized contributors to the pathology of Alzheimer's disease, Parkinson's disease, epilepsy, stroke, brain tumors, brain/spinal cord ischemia, schizophrenia, and migraine.
  • certain ion channel blocking agents including calcium ion influx inhibitors, or, more commonly, calcium channel blockers, are used as a prophylactic to prevent migraines.
  • ⁇ _42 allows calcium uptake and induces neuritic abnormality in a dose- and time- dependent fashion, and electrophysiological recordings demonstrate the presence of single channel currents.
  • ⁇ _42 allows calcium uptake and induces neuritic abnormality in a dose- and time- dependent fashion, and electrophysiological recordings demonstrate the presence of single channel currents.
  • rapid neuritic degeneration was observed at both physiological nanomolar and micromolar concentrations, and these effects are prevented by zinc (an ⁇ channel blocker) and by the removal of extracellular calcium, but are not prevented by antagonists of putative ⁇ cell surface receptors.
  • Lin H., et al., FASEB J. (2001) Nov;15(13):2433-44 Thus, targeting such receptors and preventing the calcium uptake responsible for neuronal death in AD patients could lead to improved therapeutic solutions for this patient population.
  • the movement of ions across cardiac cell membranes generates the electrical potentials that activate the heart.
  • the electrophysiologic processes of the heart are determined by excitatory stimuli that result in rapid depolarization and slow repolarization, thereby generating action potentials in individual myocytes.
  • Specific ionic currents controlled by ion channel activity generate such action potentials, and thus modulation of ion channels in cardiac tissue can be used to modulate pathological processes of cardiac disease.
  • a variety of cardiac pathological conditions may be treated and/or prevented by the use of one or more compounds able to selectively inhibit certain cardiac ionic currents.
  • the pathological conditions that may be treated and/or prevented by the present invention may include, but are not limited to, arrhythmias such as the various types of atrial and ventricular arrhythmias.
  • arrhythmias such as the various types of atrial and ventricular arrhythmias.
  • early repolarising currents correspond to those cardiac ionic currents which activate rapidly after depolarization of membrane voltage and which effect repolarisation of the cell.
  • potassium currents may include, but are not limited to, the transient outward current I tol such as Kv4.2 and Kv4.3), and the ultrarapid delayed rectifier current (I KUT ) such as Kvl.5, Kvl.4 and Kv2.1).
  • I tol such as Kv4.2 and Kv4.3
  • I KUT ultrarapid delayed rectifier current
  • Kvl.5, Kvl.4 and Kv2.1 Kvl.5, Kvl.4 and Kv2.1
  • It o2 calcium dependent transient outward current
  • compositions of the invention include, but are not limited to, arrhythmias such as the various types of atrial (supraventricular) and ventricular arrhythmias.
  • arrhythmias such as the various types of atrial (supraventricular) and ventricular arrhythmias.
  • compositions or binding partners of such compositions may be especially useful in treating and/or preventing atrial fibrillation and ventricular fibrillation.
  • compositions and/or binding partners of the present invention can be used to treat conditions such as a reduction in cardiac action potential duration and/or changes in action potential morphology, premature action potentials, high heart rates and may also include increased variability in the time between action potentials and an increase in acidity due to ischemia or inflammation. Changes such as these are observed during conditions of myocardial ischemia or inflammation (Janse & Wit, Physiol. Rev. 69(4): 1049-169, October 1989), and those conditions that precede the onset of arrhythmias such as atrial fibrillation (Pichlmaier et al. Heart 80(5):467-72, November 1998). Under conditions described above for cardiac arrhythmias in general, there is an increase in acidity of the cardiac milieu from the normal physiological pH (i.e., the pH of the milieu is lower than normal).
  • ion channels have been found to be overexpressed in a variety of tumors, and have been found to contribute to the physiology of the neoplastic cell.
  • compositions and binding partners of the invention may be useful for treatment of oncology by binding to multiple proteins in ion channel- comprising macromolecular complexes that modulate intracellular pathways.
  • An example with implications for oncology is the interaction between integrin receptors and ion channels.
  • Work dating back to the early nineties (Becchetti et al., Proc Biol Sci. 1992 Jun 22;248(1323):235-40; Schwartz et al., J Biol Chem. 1993 Sep 25;268(27): 19931-4) shows that integrin-mediated cell adhesion to the extracellular matrix is often accompanied by ion channel activation, with ensuing effects on cell differentiation, migration, and other aspects of developmental physiology.
  • the ion channels of the compositions of the invention may be based on polymorphisms or variants of ion channels. Because voltage-gated channels underlie the nerve impulse and because ligand-gated channels mediate conduction across the synapses, channels are especially prominent components of the nervous system. Indeed, most of the offensive and defensive toxins that organisms have evolved for shutting down the nervous systems of predators and prey (e.g., the venoms produced by spiders, scorpions, snakes, fish, bees, sea snails and others) work by plugging ion channel pores. Certain ion channels are known to be widely involved with neural function and are important in specific biological functions such as pain.
  • ion channel variants may induce quite unintended toxicity side effects following the administration of drugs for completely unrelated indications.
  • Individual responses to drug treatment vary due to a variety of factors, and the specific gene variants underlying this variability to drug response include variation in ion channel genes.
  • Variants in the pharmacodynamic pathways involving mutations and more common single nucleotide polymorphisms in genes that encode cardiac ion channels can determine why certain patients respond better than others do to various treatment. Furthermore, these gene variants can hold the key to understanding why individuals have very serious side effects, including even sudden death, when they are taking medication for relatively minor causes.
  • compositions of the invention may be used to identify drug candidates that are tailored to specific patient populations to reflect the polymorphic nature of ion channels within these populations.
  • all proposed drugs nowadays must pass a channel safety screening before they can be approved for use in human therapy. Being able to test drugs in a potentiated system comprising compositions of the invention with specific polymorphisms within the ion channel genes may identify patient populations that will have an adverse effect to certain medications prior to any clinical trial activity.
  • VKCDB the voltage-gated potassium channel database
  • LGICdb the voltage-gated potassium channel database
  • binding affinity The strength of the interaction of a binding partner with a composition can be characterized by its "binding affinity" to a given binding site or epitope.
  • antibodies are characterized by their "binding affinity" to a given binding site or epitope. Every antibody is comprised of a particular 3 -dimensional structure of amino acids, which binds to another structure referred to as an epitope or antigen.
  • the selective binding of a binding partner to a composition is a simple bimolecular, reversible reaction, not unlike the binding of an antibody to its antigen.
  • the reaction can be analyzed by standard kinetic theory. Assuming a single binding site the reaction is represented by the equation I as follows:
  • brackets denote concentration in moles per liter or liters per mole.
  • a typical value for the binding affinity K a which is also referred to as "K” and is the "affinity constant" which for a typical antibody is in a range of from about 10 5 to about 10 11 liters per mole.
  • the K a is the concentration of free antigen needed to fill half the binding sites of the antibody present in solution with the antigen. If measured in liters per mole a higher K a (e.g. 10 11 ) or higher affinity constant indicates a large volume of solvent, a very dilute concentration of free antigen, and as such indicates the antibody has a high binding affinity for the epitope.
  • K a is measured in moles per liter a low K a (e.g. 10 "11 ) indicates a less concentrated solution of the free antigen needed to occupy half of the antibody binding sites, and as such a high binding affinity.
  • equation III the units for K are liters per mole. Typical values in liters per mole are in a range of from about 10 5 to about 10 11 liters per mole.
  • K [Ag] where the units for K are in moles per liter, and the typical values are in a range of 10 "6 to 10 "12 moles per liter.
  • binding characteristics of an antibody to an antigen can be defined using terminology and methods well defined in the field of immunology. So, too, can the binding characteristics of a ligand to its target can be defined. The binding affinity or "K" of a ligand can be precisely determined.
  • binding affinity does not necessarily translate to a highly effective drug.
  • the candidates showing a wide range of binding affinities may be tested to determine if they obtain the desired biochemical/physiological response.
  • binding affinity is important, some drug candidates with high binding affinity are not effective drugs and some drug candidates with low binding affinity are effective drugs.
  • the functional assessment of any binding partners identified or investigated using the compositions of the invention is thus a critical part of any drug design to ensure the drug candidate meets the desired specifications.
  • the chimera compositions of the invention are useful as either research or diagnostic tools in functional assays, including: assays used to understand physiological processes; assays to identify new binding partners (including drug candidates) that selectively bind to ion channels, subunits of ion channels and/or proteins in ion channels signaling complexes and modulate specific signaling processes; and assays to test known compounds (including synthetic, recombinant or naturally-occurring compounds) for their effect on ion channel activity, and the like. It is known in the pharmaceutical arts that binding affinity to a target and efficacy do not necessarily correlate, and that identification of functional changes conferred by a binding partner is a much better predictor of efficacy than binding affinity alone.
  • the chimera compositions of the invention are especially powerful in identification of binding partners with functional activity rather than just affinity, as the chimeras not only can recreate functional activity of ion channels but also provide potentiation of the signaling pathway through preexisting interaction of the ion channel and at least one binding partner.
  • compositions of the present invention include biochemical assays which can be correlated with in vivo efficacy for a physiological process, ex vivo cell-based assays for measurement of a physiological process, in vivo assays for direct or indirect measurement of a physiological process, etc.
  • the functional assays of the invention are any assays that correlate with in vivo modulation of a process.
  • Examples of cell-based assays for use with the present invention include, but are not limited to, high throughput binding screening; assays to measure cell proliferation, death necrosis and/or apoptosis; flow cytometry assays; metabolic assays measuring labeling or turnover; phase and fluorescence microscopy; receptor phosphorylation and/or turnover; cell signaling assays; immunohistochemistry studies; reporter gene assays, and subcellular fractionation and localization.
  • FLIPR to detect changes in intracellular calcium concentration
  • CACO to predict human oral absorption of drug compounds
  • cell-based ELISA assays to detect and quantify cellular proteins including post-translational modifications associated with cell activation
  • [ 35 GTPyS] binding assays PathHunterTM beta-arrestin technology, SureFireTM MAPkinase assays; PathHunterTM MAP kinase assays; and radioligand binding assays
  • automated patch-clamp analysis assays such as IonFlux (Fluxion, S. San Francisco, CA) or those available at MDS Pharma Services (King of Prussia, Pennsylavania).
  • platform Automated patch-clamp platform; one channel assays such as FASTPatch and ScreenPatch (ChanTest, Rockville, Maryland).
  • Biochemical assays can also be used to correlate binding with efficacy in the methods of the invention. These include, but are not limited to, spectrophotometric assays, fluorometric assays, calorimetric assays, chemiluminescent assays, radiometric assays, chromatographic assays, colorimetric assays, and substrate specificity inhibitor kinase assays.
  • luciferase assays in which firefly luciferase protein catalyzes luciferin oxidation and light is generated in the reaction, and which is frequently used as a report gene for measuring promoter activity or transfection efficiency; electrophoresis; gas-liquid chromatography; Forster resonance energy transfer (FRET); and use and detection of activation by RASSLs
  • in vivo assays are utilized to provide a correlation of binding affinity with efficacy in modulating a target.
  • in vivo functional assays are radiolabelling assays, fluorescent protein expression assays, in vivo capture assays, NMR spectroscopy, or assays specifically designed to identify efficacy in an animal model of a pathological process.
  • therapeutics need to be initially tested in in vivo models due to the complex physiological parameters involved with efficacy.
  • Assays that are useful for this purpose include, but are not limited to, biochemical methods for analysis of protein phosphorylation, FRET and terminal restriction fragment (TRF) format assays such as DelphiaTM (Perkin Elmer, Waltham, MA), fluorescence polarization assays, fluorescence quenching assays, mobility shift assays, array assays including bead-based array assays, and cell-based assays.
  • CRF terminal restriction fragment
  • Drugs targeting ion channels generally have fallen into two categories: agonists, which are drugs that mimic the actions of endogenous binding partners stimulate ion channels, and antagonists, which have no intrinsic activity of their own but which block activation of the ion channels by agonists.
  • agonists can be distinguished as full agonists, partial agonists, and inverse agonists, each with its own sets of advantage and disadvantages as therapeutics.
  • a full agonist is a drug that produces the same maximal effect as the endogenous ligand ⁇ e.g., a neurotransmitter or hormone).
  • the mechanism of action of the activation of certain ion channels is generally an allosteric mechanism, with the extracellular binding of the ligand ⁇ e.g., acetylcholine or nicotine) causing a structural change at a distant place in the channel unit.
  • Partial agonists are drugs that bind to ion channels in a manner that produces less of an effect than full agonists, and may be useful when the goal is to create an effect that is attenuated compared to the effect of endogenous ligand binding. Partial agonists can antagonize full agonists. As a consequence, partial agonists exhibit duality in that they bind to ion channels in a manner similar to both an agonist and an antagonist.
  • Partial agonists are therapeutically important because of their dual nature. In the absence of an agonist, the partial agonist can stimulate the receptor - however, if an ion channel is exposed to a full agonist, the partial agonist will sit on the receptor and compete for the binding sites, causing less full agonist activity. In the presence of the endogenous neurotransmitter, partial agonists limit its ability to activate receptors. This is pharmacologically important, as the blockade of the stimulatory effects of agonists like nicotine without using an antagonist could have quite negative consequences.
  • Inverse agonists are also able to block the effects of full agonists at ion channels but they also induce opposite effects on the same multi-transmembrane receptor as full agonists.
  • agonists like the benzodiazepines e.g., diazepam
  • inverse agonists at this receptor cause hyper-excitability and even seizures.
  • the inherent activity of an inverse agonist is dependent on the receptor having some level of constitutive basal activity (Kenakin T, Bond R, Bonner T: Definition of pharmacological receptors. Pharmacol Rev 1992; 44:351-362).
  • a human CRF-BP_Human Alpha7 nicotinic acetylcholine receptor subunit (a7-nAChR) chimera was produced by initial cloning of the first peptide and second ion channel subunit peptide into a pcDNA 3.1 vector.
  • the map of the vector produced for the expression of the CRF-BP_HAHu-a7-nAChR chimera is shown in Figure 1. Construction of this plasmid is as described below.
  • a pcDNA13 vector (Invitrogen, Carlsbad, CA) and a cDNA clone of CRF-BP (Origene, Rockville, Maryland) were digested with BamHI and Xhol (NEB, Ipswich, MA), and the digested DNA was run on a 1.2% agarose gel at 70 volts for 50 minutes. The desired fragments were purified using a Qiagen (Valencia, CA) Gel Extraction Kit. Following elution in water, the two DNA components were ligated to insert the CRF-BP oligonucleotide into the vector, which was recircularized following insertion and ligation.
  • a cDNA clone encoding the Hu-a7-nAChR protein was amplified using the following primers:
  • ATACTCGAGTATCCTTAGCACGTGCCTGA forward and ATATCTAGATAGAAGGCACAGTCGAGG (reverse).
  • An Xhol digestion site in the forward primer and an Xbal digestion site in the reverse primer are shown in bold.
  • 1.5 ⁇ (approximately 70ng) of human cDNA was used as template DNA in the PCR reaction, and 2.0 ⁇ of each primer at a concentration of 5 ⁇ .
  • the DNA was amplified using 0.2 ⁇ Highfidelity Taq at Su/ ⁇ in a total volume of 50 ⁇ . PCR conditions were 30 cycles of 94°C for 30 seconds, 61°C for 30 seconds and 68°C for 30 seconds, followed by a final extension at 68°C for 5 minutes.
  • the PCR products were then purified using PCR purification kit from Qiagen (Valencia, CA).
  • the purified Hu-a7-nAChR DNA and the His tag-containing pcDNA 3.1 vector were both digested with Xho I and Xbal (NEB, Ipswich, MA), and the desired fragments gel purified using a Qiagen (Valencia, CA) Gel Extraction Kit.
  • the digested PCR product and vector DNA were ligated using T4 DNA ligase.
  • the ligation reaction included 1 ⁇ purified vector DNA, 2 ⁇ purified Hu-a7-nAChR DNA, 2 ⁇ 10X ligase buffer, 1 ⁇ T4 DNA ligase (NEB, Ipswich, MA)and 14 ⁇ water.
  • the ligation reaction mixture was incubated at 16°C overnight, followed by incubation at 65°C for 20 minutes. It was stored at 4°C until further use as described below.
  • the resulting plasmid contains DNA encoding CFR-BP 5' to both the ssHA fragment and the Hu-a7-nAChR coding region.
  • the Hu-a7-nAChR coding region is in-frame with the CFR-BP, so that any protein created using this plasmid will result in a protein having the CFR-BP component at its N-terminus, and the Hu-a7-nAChR portions in frame and at the carboxy-terminus.
  • Example 2 Transfection of Human Cells with the Expression Plasmid
  • the plasmid containing the ion channel subunit fusion chimera was then transfected into HEK 293 cells for expression of the protein, confirmation of the appropriate insertion into the membrane, and functionality of the chimera in mammalian cells.
  • HEK 293 cells were placed in a 12 well plate with DMEM with 10% fetal bovine serum (FBS) in each of the wells. Immediately prior to transfection, each well was examined to confirm approximately 90-95% confluency of the cells in the wells. The DMEM was carefully aspirated from the wells, and replaced with fresh DMEM/10% FBS.
  • FBS fetal bovine serum
  • Example 2 The final DNA plasmid preparation created in Example 1 was then diluted in ⁇ of Opti-MEM (reduced serum) and gently mixed. Lipofectamine 2000 which had been likewise diluted in ⁇ of Opti-MEM. The Lipofectamine was incubated at room temperature for 5 minutes, and then combined with the diluted DNA. This was mixed gently and incubated at room temperature for 20 minutes.
  • Opti-MEM reduced serum
  • the expression of the chimera clones in the cell lines was determined using CRF-BP mouse monoclonal antibody against full length CRF-BP (human origin). 50 ⁇ g of cell lysate was loaded per well on 4-20% Tris-Glycine gel from Invitrogen (Carlsbad, CA).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention porte sur de nouvelles compositions à base de canal ionique, sur des procédés de traitement, sur des outils de recherche et sur l'utilisation de ceux-ci dans l'identification et le développement de nouveaux produits thérapeutiques et/ou diagnostique. Les compositions selon l'invention sont des protéines chimères qui en essence recréent et/ou potentialisent une ou plusieurs interactions de complexe protéique qui se produisent in vivo dans la modulation de processus biologiques.
PCT/US2010/049149 2009-09-17 2010-09-16 Compositions à base de canal ionique et utilisations de celles-ci WO2011035045A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US24343709P 2009-09-17 2009-09-17
US61/243,437 2009-09-17

Publications (1)

Publication Number Publication Date
WO2011035045A1 true WO2011035045A1 (fr) 2011-03-24

Family

ID=43759011

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/049149 WO2011035045A1 (fr) 2009-09-17 2010-09-16 Compositions à base de canal ionique et utilisations de celles-ci

Country Status (1)

Country Link
WO (1) WO2011035045A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020123098A1 (en) * 2000-09-19 2002-09-05 Millennium Pharmaceuticals, Inc. 55063, a novel human NMDA family member and uses thereof
US20030170760A1 (en) * 1999-02-01 2003-09-11 Cadus Pharmaceutical Corp. Cell based signal generation
US20050063989A1 (en) * 2003-09-22 2005-03-24 Commissariat A L'energie Atomique Ion channel hybrid proteins as electrical sensors and use thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030170760A1 (en) * 1999-02-01 2003-09-11 Cadus Pharmaceutical Corp. Cell based signal generation
US20020123098A1 (en) * 2000-09-19 2002-09-05 Millennium Pharmaceuticals, Inc. 55063, a novel human NMDA family member and uses thereof
US20050063989A1 (en) * 2003-09-22 2005-03-24 Commissariat A L'energie Atomique Ion channel hybrid proteins as electrical sensors and use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BOUZAT ET AL: "Coupling of agonist binding to channel gating in an ACh-binding protein linked to an ion channel", NATURE, vol. 430, 19 August 2004 (2004-08-19), pages 896 - 900 *
GRUTTER ET AL.: "A chimera encoding the fusion of an acetylcholine-binding protein to an ion channel is stabilized in a state close to the desensitized form of ligand-gated ion channels", C. R. BIOL., vol. 328, no. 3, March 2005 (2005-03-01), pages 223 - 234 *

Similar Documents

Publication Publication Date Title
Huang et al. Interaction of the Ca2+-sensing receptor with the inwardly rectifying potassium channels Kir4. 1 and Kir4. 2 results in inhibition of channel function
Tinoco et al. Investigating endogenous peptides and peptidases using peptidomics
Guidolin et al. Receptor-receptor interactions as a widespread phenomenon: novel targets for drug development?
Rouget et al. Identification of a novel snake peptide toxin displaying high affinity and antagonist behaviour for the α2‐adrenoceptors
Chen et al. Individual phosphorylation sites at the C-terminus of the apelin receptor play different roles in signal transduction
KR20190059312A (ko) Gdf15-유사 생물학적 활성의 조절제에 대한 스크리닝 방법
Alam et al. C-terminal processing of GABARAP is not required for trafficking of the angiotensin II type 1A receptor
Macháčková et al. Converting insulin-like growth factors 1 and 2 into high-affinity ligands for insulin receptor isoform A by the introduction of an evolutionarily divergent mutation
US8552152B2 (en) Compositions and methods for modulating dopamine neurotransmission
Choi et al. The activation mechanism of the insulin receptor: a structural perspective
Antolik et al. The tetratricopeptide repeat domains of rapsyn bind directly to cytoplasmic sequences of the muscle-specific kinase
AU2004292013A1 (en) Methods for screening using CTGF and TRKA receptor for the identification of compounds for use in treatment of fibrosis
Marrs et al. N-cadherin modulates voltage activated calcium influx via RhoA, p120-catenin, and myosin–actin interaction
Wang et al. Pharmacological evaluation of melanocortin 2 receptor accessory protein 2 on axolotl neural melanocortin signaling
Mahapatra et al. The trans-Golgi proteins SCLIP and SCG10 interact with chromogranin A to regulate neuroendocrine secretion
US20060035285A1 (en) Method for identifying modulators of human orexin-2 receptor
US20220273751A1 (en) Gpcr heteromer inhibitors and uses thereof
WO2005121356A1 (fr) Nouveau procédé de recherche par criblage
WO2011035045A1 (fr) Compositions à base de canal ionique et utilisations de celles-ci
KR100971270B1 (ko) 이피에프 수용체 에세이, 화합물 및 치료학적 조성물
Neal Jr et al. Binding and GTPγS autoradiographic analysis of preproorphanin precursor peptide products at the ORL1 and opioid receptors
US20110027909A1 (en) Chimera Compositions and Methods of Use
de Sousa Moreira CHARACTERIZATION OF PROTEIN-PROTEIN INTERACTIONS INVOLVING G PROTEIN-COUPLED RECEPTOR 143 BY COMPUTATIONAL AND PHARMACOLOGICAL METHODS
WO2020047475A1 (fr) Dépistage de médicament d'inhibiteurs fgf23-fgfr4
Lee et al. Renal autocrine neuropeptide FF (NPFF) signaling regulates blood pressure

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10817842

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10817842

Country of ref document: EP

Kind code of ref document: A1