WO2011034131A1 - Agent for the prevention or treatment of inflammatory bowel disease - Google Patents

Abstract

Disclosed is an agent for the prevention or treatment of inflammatory bowel disease, which comprises as the active ingredient a polypeptide that has a sequence being at least 70% identical to that of human paraoxonase and that has at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allyl esterase activity, and active oxygen-consuming activity.

Description

Preventive or therapeutic agent for inflammatory bowel disease

The present invention relates to a protein preparation. More specifically, the present invention relates to a preventive or therapeutic agent for inflammatory bowel diseases such as ulcerative colitis and Crohn's disease.

Inflammatory bowel disease is a general term for chronic diseases that cause inflammation of unknown origin mainly in the gastrointestinal tract, and typical diseases include ulcerative colitis and Crohn's disease.
Ulcerative colitis is a disease whose main lesion is mucosal damage of the large intestine, but its etiology is still unknown. At present, genetic factors and environmental factors are intricately intertwined, and some antigens are thought to be involved in the onset and the persistence of inflammation by causing excessive immune responses in the intestinal tract through the immune-competent cells of the gastrointestinal tract. ing.
As a symptom of ulcerative colitis, the mucous membrane of the large intestine is fragile and easily bleeds, but sputum and ulcer are formed in the mucous membrane, and patients usually complain of symptoms such as abdominal pain and mucous stool.

The typical subjective symptoms of ulcerative colitis are bloody stool, mucous stool, diarrhea, or bloody diarrhea, but it depends on the extent and severity of the lesion. In light cases, blood stool is small and often not accompanied by diarrhea, but if it becomes more severe, watery diarrhea and hemorrhage mixed tomato ketchup-like or fecal mass and blood in exudate and mucus It becomes. Other symptoms include abdominal pain, fever, loss of appetite, weight loss and anemia. In addition, it is often accompanied by extraintestinal complications such as arthritis, urinary calculi, iritis or conjunctivitis, pancreatitis or hyperamylaseemia.

When starting drug therapy for ulcerative colitis, it is important to understand the severity of the case. The basis of pharmacotherapy is combination therapy. In many cases, remission can be introduced and maintained in remission with a 5-aminosalicylic acid (5-ASA) preparation and a corticosteroid as a reference drug. However, because some cases experience exacerbations and repeated flare-ups, azathioprine or 6-mercaptopurine (6-MP), intestinal preparation, leukocyte removal therapy, and cyclosporine may be used. However, there is no established medical treatment for ulcerative colitis.

Also, Crohn's disease is mainly seen in young people, consists of granulomatous inflammatory lesions with ulcers and fibrosis, and can occur in any part of the digestive tract from the oral cavity to the anus. The clinical picture varies depending on the site and extent of the lesion. Systemic symptoms such as fever, malnutrition, anemia, and systemic complications such as arthritis, iritis, and liver damage can occur.

As a symptom of Crohn's disease, the lesion affects the entire layer from the mucous membrane of the digestive tract to the serosa, and abdominal pain, diarrhea, weight loss, fever, and anal lesion are common. Crohn's disease occurs with bowel obstruction, bowel perforation, and major bleeding. It also lacks abdominal symptoms and may develop with anal lesions or fever. Non-gastrointestinal complications include anemia, hypoproteinemia, ankylosing spondylitis, mouth after, erythema nodosum, pyoderma gangrenosum, iritis, and growth disorders.

There is no established medical treatment for Crohn's disease. For this reason, the purpose of treatment is to control the activity of the disease to maintain remission and increase the patient's quality of life. For this purpose, drug therapy, nutrition therapy, and surgical therapy are combined to maintain nutritional status, suppress symptoms, and prevent inflammation from recurring / recurring. For this reason, a preparation with higher efficacy and higher safety is desired.

On the other hand, paraoxonase 1 (PON1) is a representative enzyme of the enzyme family called paraoxonase (hereinafter sometimes abbreviated as “PON”). The activity common to PON is lactone hydrolysis activity, and PON1 hydrolyzes a wide range of substrates such as lactones, esters, eg, organic phosphates such as paraoxon.

There are many reports on the relationship between PON1 levels in vivo and diseases.
For example, in vivo, PON1 is synthesized in the liver and exists in blood in association with apoA-I on high density lipoprotein (HDL) particles. PON1 is known to suppress the progression of arteriosclerosis by inhibiting the oxidation of low density lipoprotein (LDL) (Non-patent Document 1). However, there is still no report that PON1 is effective as a preventive or therapeutic agent for inflammatory bowel diseases such as ulcerative colitis and Crohn's disease.

An object of the present invention is to provide an effective preventive or therapeutic agent for inflammatory bowel diseases such as ulcerative colitis and Crohn's disease.

In order to solve the above-mentioned problems, the present inventors have conducted research and obtained the following knowledge.
(i) By administering PON1 to an animal model of ulcerative colitis induced by sodium dextran sulfate (DSS), dysfunction or inflammation of the large intestine was suppressed.
(ii) Colonic dysfunction or inflammation was suppressed by administering PON1 to a Crohn's disease model animal induced by 2,4,6-trinitrobenzenesulfonic acid (TNBS).

(iii) Even if PON1 variant (C284A variant of Example 16 and K84E / R306Q variant of Example 17) is administered to the Crohn's disease model animal, the dysfunction of the large intestine is the same as when PON1 is administered And inflammation was suppressed. The PON1 variant is a polypeptide having lactonase activity and paraoxonase activity, like PON1.
(iv) Even if the polypeptide of SEQ ID NO: 8 (Example 19) or the polypeptide of SEQ ID NO: 10 (Example 20) called evolution PON1 (ePON1), which is a derivative of PON1, is administered to the Crohn's disease model animal In the same manner as when PON1 was administered, dysfunction and inflammation of the large intestine were suppressed. The ePON1 is a polypeptide having a sequence identity of 70% or more with human PON1 and having lactonase activity, paraoxonase activity, allylesterase activity, and active oxygen scavenging activity like PON1.

(v) PON1 variant (D269E variant of Example 21) having paraoxonase activity and reactive oxygen scavenging activity and not having lactonase activity and allylesterase activity is administered to the Crohn's disease model animal In the same manner as in the case of administration of PON1, colonic dysfunction and inflammation were suppressed.
(vi) Administration of the PON1 variant (H115 / 134Q variant of Example 22) having active oxygen scavenging activity and not having lactonase activity, paraoxonase activity and allylesterase activity to the Crohn's disease model animal Even so, colonic dysfunction and inflammation were suppressed as in the case of administration of PON1.
In the present specification, a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, added or substituted in the amino acid sequence of PON1 is also referred to as a PON1 variant.

The present invention has been completed through further research based on the above findings, and provides the following preventive or therapeutic agents for inflammatory bowel diseases such as ulcerative colitis and Crohn's disease.

Item 1. Effective with a polypeptide having at least 70% sequence identity with human paraoxonase and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity and active oxygen scavenging activity A preventive or therapeutic agent for inflammatory bowel disease comprising as a component.
Item 2. Item 2. The preventive or therapeutic agent for inflammatory bowel disease according to Item 1, wherein the polypeptide is the following polypeptide (a), (b), or (c).
(a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1, 6, 8 or 10
(b) selected from the group consisting of an amino acid sequence in which one or more amino acids are deleted, added or substituted in SEQ ID NO: 1, 6, 8 or 10 and consisting of lactonase activity, paraoxonase activity and allylesterase activity A polypeptide having at least one activity
(c) a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, added or substituted in SEQ ID NO: 1, 6, 8, or 10 and having active oxygen scavenging activity; Item 3. The preventive or therapeutic agent for inflammatory bowel disease according to Item 1 or 2, wherein the polypeptide is a polypeptide having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, and allyl esterase activity.
Item 4. Item 3. The preventive or therapeutic agent for inflammatory bowel disease according to Item 1 or 2, wherein the polypeptide is a polypeptide having active oxygen scavenging activity and having no lactonase activity, paraoxonase activity, and allylesterase activity.
Item 5. Item 5. The preventive or therapeutic agent according to any one of Items 1 to 4, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease.
Item 6. Item 6. The preventive or therapeutic agent according to any one of Items 1 to 5, which is an injection.
Item 7. A prophylactic or therapeutic agent for ulcerative colitis comprising paraoxonase as an active ingredient.
Item 8. A preventive or therapeutic agent for Crohn's disease comprising paraoxonase as an active ingredient.
Item 9. A polypeptide having at least 70% sequence identity with human paraoxonase and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity and active oxygen scavenging activity A method for preventing or treating inflammatory bowel disease, comprising administering to an animal.
Item 10. Item 10. The method for prevention or treatment according to Item 9, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease.
Item 11. Selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity, and active oxygen scavenging activity, having 70% or more sequence identity with human paraoxonase for the prevention or treatment of inflammatory bowel disease A polypeptide having at least one activity.
Item 12. Item 12. The polypeptide according to Item 11, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease.

The present invention also provides the following preventive or therapeutic agents for ulcerative colitis or Crohn's disease.
Item 1a. A prophylactic or therapeutic agent for ulcerative colitis comprising paraoxonase as an active ingredient.
Item 2a. Item 2. The preventive or therapeutic agent for ulcerative colitis according to item 1a, wherein the paraoxonase is the following polypeptide (a) or (b):
(a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1
(b) a polypeptide comprising a sequence of amino acids in which one or more amino acids are deleted, added or substituted in SEQ ID NO: 1 and having lactonase activity or paraoxonase activity; Item 3. Prophylactic or therapeutic agent for ulcerative colitis according to item 1a or 2a, which is an injection.
Item 4a. A preventive or therapeutic agent for Crohn's disease comprising paraoxonase as an active ingredient.
Item 5a. Item 4. The preventive or therapeutic agent for Crohn's disease according to Item 4a, wherein the paraoxonase is the following polypeptide (a) or (b).
(a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1
(b) a polypeptide comprising a amino acid sequence in which one or more amino acids are deleted, added, or substituted in SEQ ID NO: 1 and having lactonase activity or paraoxonase activity 6a. The preventive or therapeutic agent for Crohn's disease according to Item 4a or 5a, which is an injection.

ADVANTAGE OF THE INVENTION According to this invention, the pharmaceutical which can prevent or treat an inflammatory bowel disease especially ulcerative colitis, Crohn's disease, etc. effectively was provided.
According to the present invention, inflammation and tissue damage of the colonic mucosa due to ulcerative colitis are suppressed, and symptoms such as diarrhea or bleeding are effectively improved.

According to the present invention, inflammation and tissue damage of the colonic mucosa due to Crohn's disease are suppressed, and symptoms such as weight loss, diarrhea or bleeding are effectively improved.
Furthermore, the medicament of the present invention is safe without causing any side effects.

1A, B, C and D are diagrams showing SDS-PAGE gels of PON1 obtained in Examples 1, 4, 6 and 8, respectively. 2A, B, C and D are diagrams showing the results of Western blotting of PON1 obtained in Examples 1, 4, 6 and 8, respectively. FIG. 3 is a diagram showing the results of measuring DAIettscore and conducting Dunnett test in order to examine the preventive or therapeutic effect of PON1 against ulcerative colitis. FIG. 4 is a diagram showing the results of measuring DAIettscore and conducting Dunnett test in order to examine the preventive or therapeutic effect of PON1 against ulcerative colitis. FIG. 5 is a diagram showing the results of measuring DAI score and conducting Dunnett test in order to examine the preventive or therapeutic effect of PON1 on Crohn's disease. FIG. 6 is a diagram showing the results of measuring DAI score and conducting Dunnett test in order to examine the preventive or therapeutic effect of PON1 on Crohn's disease. FIG. 7 is a diagram showing the results of measuring DAI score and conducting Dunnett test in order to examine the preventive effect of PON1 on Crohn's disease. FIG. 8 is a diagram showing the results of measuring the macroscopic score and conducting the Dunnett test in order to examine the preventive effect of PON1 on Crohn's disease. FIG. 9 is a diagram showing the results of measuring DAI score and conducting Dunnett test in order to examine the therapeutic effect of PON1 on Crohn's disease. FIG. 10 is a diagram showing the results of measuring the macroscopic score and performing Dunnett's test in order to examine the therapeutic effect of PON1 on Crohn's disease. FIG. 11A shows the results of SDS-PAGE of the C284A variant of PON1 obtained in Example 16, and FIG. 11B shows the results of Western blotting of the C284A variant of PON1. FIG. 12A is a diagram showing the results of SDS-PAGE of the K84E / R306Q variant of PON1 obtained in Example 17, and FIG. 12B is a diagram showing the results of Western blotting of the K84E / R306Q variant of PON1. It is. FIG. 13 is a diagram showing the results of measuring DAI score and conducting Dunnett test in order to examine the preventive or therapeutic effect of PON1 and PON1 variants on Crohn's disease. FIG. 14 is a diagram showing the results of measuring the macroscopic score and performing Dunnett's test in order to examine the preventive or therapeutic effect of PON1 and PON1 variants on Crohn's disease. FIG. 15A is a diagram showing the results of SDS-PAGE of ePON1-G2E6 obtained in Example 19, and FIG. 15B is a diagram showing the results of Western blotting of ePON1-G2E6. FIG. 16A is a diagram showing the results of SDS-PAGE of ePON1-G3C9 obtained in Example 20, and FIG. 16B is a diagram showing the results of Western blotting of ePON1-G3C9. FIG. 17A is a diagram showing the results of SDS-PAGE of the D269E variant of PON1 obtained in Example 21, and FIG. 17B is the SDS-PAGE of the H115 / 134Q variant of PON1 obtained in Example 22. It is a figure which shows the result. FIG. 18 is a diagram showing the results of measuring DAI score and conducting Dunnett test in order to examine the preventive or therapeutic effect of ePON1 and PON1 variants against Crohn's disease. FIG. 19 is a diagram showing the results of measuring the macroscopic score and performing Dunnett's test in order to examine the preventive or therapeutic effects of ePON1 and PON1 variants on Crohn's disease.

Hereinafter, the present invention will be described in detail.
The preventive or therapeutic agent for inflammatory bowel disease of the present invention has 70% or more sequence identity with human paraoxonase (human PON), and lactonase activity, paraoxonase activity, allylesterase activity, and elimination of active oxygen. A polypeptide having at least one activity selected from the group consisting of activities is contained as an active ingredient.
The polypeptide which is an active ingredient of the present invention is a polypeptide having one or more activities of lactonase activity, paraoxonase activity, allyl esterase activity and active oxygen scavenging activity. The polypeptide which is an active ingredient of the present invention preferably has at least active oxygen scavenging activity.

As human PON, human PON1 is preferable. That is, a preferred active ingredient in the present invention has at least one sequence identity with human PON1 and at least one selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity, and active oxygen scavenging activity. A polypeptide having activity. Human PON1 is preferably a polypeptide consisting of the amino acid sequence of SEQ ID NO: 6.

<Active ingredient>
<PON>
PON is mentioned as an active ingredient of the preventive or therapeutic agent for inflammatory bowel disease of the present invention. PON includes PON1, PON2, PON3, and the like. Moreover, although the origin species in particular of PON are not restrict | limited, Human origin PON is preferable.
Among them, human-derived PON1 is preferable, (a) a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, (b) consisting of an amino acid sequence in which one or more amino acids are deleted, added, or substituted in SEQ ID NO: 1, and A polypeptide having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity and allyl esterase activity, or (c) one or more amino acids in SEQ ID NO: 1 have been deleted, added or substituted A polypeptide having an amino acid sequence and having active oxygen scavenging activity is more preferred. As the polypeptide (b), a polypeptide having an amino acid sequence in which one or more amino acids are deleted, added, or substituted in SEQ ID NO: 1 and having lactonase activity or paraoxonase activity is also preferable.
In the present specification, “one or more” is preferably 1 to 10, more preferably 1 to 5, even more preferably 1 to 3, particularly preferably 1 to 2, and most preferably 1. is there.

As an active ingredient in the present invention, (a) a polypeptide consisting of the amino acid sequence of SEQ ID NO: 6, (b) an amino acid sequence in which one or more amino acids are deleted, added or substituted in SEQ ID NO: 6, and lactonase A polypeptide having at least one activity selected from the group consisting of activity, paraoxonase activity and allylesterase activity, or (c) an amino acid wherein one or more amino acids are deleted, added or substituted in SEQ ID NO: 6 A polypeptide comprising a sequence and having active oxygen scavenging activity is also preferred. The amino acid sequence of SEQ ID NO: 6 is a sequence obtained by cleaving methionine at position 1 in the amino acid sequence of SEQ ID NO: 1, that is, the amino acid sequence at positions 2 to 355 in the amino acid sequence of SEQ ID NO: 1. When PON1 is produced in vivo or by a cultured cell system, PON1 is usually synthesized outside the cell, and then the methionine at position 1 is cleaved inside the cell and secreted outside the cell. Specifically, for example, in the case of human PON1, a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 is usually synthesized in the cell, and then the methionine at position 1 is cleaved in the cell and secreted outside the cell. The polypeptide of SEQ ID NO: 6 is obtained.

<PON1 derivative>
Furthermore, in the preventive or therapeutic agent for inflammatory bowel disease of the present invention, a PON1 derivative artificially produced by a molecular evolution engineering technique is also preferred as the active ingredient polypeptide. As the PON1 derivative, evolution PON1 described in Aharoni, A. et al., Proc. Natl. Acad. Sci. USA 101 (2), 482-487 (2004) (evolution PON1, also referred to as ePON1 in this specification). Polypeptides also referred to as) are preferred. ePON1 performs random homologous recombination (family shuffling) on mouse, human, rat and rabbit cDNAs (each with homology of 80% or more) by molecular evolution engineering to create a chimeric cDNA library. It is a PON1 derivative selected as a clone suitable for expression in heterologous E. coli. The PON1 derivative in the present invention preferably has one or more of paraoxonase activity, lactonase activity, and allylesterase activity, like human PON1. Further, the PON1 derivative in the present invention preferably has active oxygen scavenging activity. Specifically, as PON1 derivatives, G2E6 (SEQ ID NO: 8), G3C9 (SEQ ID NO: 10), G3H8 (the amino acid sequence of G3H8 is registered in GenBank as Accession No. AAR95985), G1A5 (G1A5 amino acid) The sequence is registered in GenBank with Accession No. AAR95981), G1C4 (the amino acid sequence of G1C4 is registered in GenBank, Accession No. AAR95982 is registered), G2D6 (the amino acid sequence of G2D6 is registered in GenBank, EPON1 registered in Accession No. AAR95983). The amino acid sequence of G2E6 (SEQ ID NO: 8) and the amino acid sequence of G3C9 (SEQ ID NO: 10) are shown in Aharoni, A. et al., Proc. Natl. Acad. Sci. USA 101 (2), 482-487 (2004). Are listed. The DNA sequence encoding G2E6 is shown in SEQ ID NO: 7, and the DNA sequence encoding G3C9 is shown in SEQ ID NO: 9, respectively.

Particularly preferred PON1 derivatives in the present invention include (a) a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 8 (hereinafter referred to as ePON1-G2E6) or a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10 (ePON1- (B3) from the group consisting of an amino acid sequence in which one or more amino acids are deleted, added, or substituted in SEQ ID NO: 8 or 10, and consisting of lactonase activity, paraoxonase activity and allylesterase activity A polypeptide having at least one selected activity, or (c) a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, added or substituted in SEQ ID NO: 8 or 10, and having active oxygen scavenging activity Peptides are more preferred.
The PON1 derivatives ePON1-G2E6 and ePON1-G3C9 are called human PON1 derivatives because they are within the range in which the amino acid sequence homology with human PON1 is not lost.

Examples of the “range where homology is not lost” include those having sequence identity of, for example, about 70% or more, more preferably about 75% or more, further preferably about 80% or more, and particularly preferably about 82% or more. It is done. Amino acid sequence identity is determined using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; allow gaps; matrix = BLOSUM62; filtering = OFF) Can be calculated with
For example, the sequence identity with human PON1 determined by this method is 82% for ePON1-G2E6 and 85% for ePON1-G3C9.

A polypeptide having 70% or more sequence identity with human PON as an active ingredient in the present invention is preferably human PON (preferably human PON1, more preferably polypeptide of SEQ ID NO: 6), preferably about 75% or more, More preferably, it is about 80% or more, more preferably about 82% or more, more preferably about 85% or more, further preferably about 90% or more, further preferably about 95% or more, particularly preferably about 98% or more, most preferably Preferably have about 99% or more sequence identity.

A polypeptide having 70% or more sequence identity with human PON as an active ingredient in the present invention is, for example, (A) the amino acid sequence at positions 36 to 47 in the amino acid sequence of human PON1 represented by SEQ ID NO: 1, (B ) Amino acid sequence at positions 347-353, (C) amino acid sequence at positions 219-248, (D) amino acid sequence at positions 152-165, (E) amino acid sequence at positions 56-69, and (F) positions 320-330 It is preferable to have at least one of the amino acid sequences. More preferably, it has (A) and (B), more preferably it has (A) to (C), and even more preferably, it has (A) to (D). Particularly preferred are those having the above (A) to (E), and most preferred are those having the above (A) to (F). A polypeptide having such a sequence as a common sequence is suitable as an active ingredient in the present invention. As a polypeptide having such a common sequence, (a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1, 6, 8 or 10; (b) SEQ ID NO: 1, 6, 8 or 10; ) And (B) (preferably (A) to (C), more preferably (A) to (D), still more preferably (A) to (E), particularly preferably (A) to (D). F)) at least one selected from the group consisting of amino acid sequences in which one or more amino acids are deleted, added, or substituted in a sequence other than the common sequence, and consisting of lactonase activity, paraoxonase activity, and allylesterase activity And (c) SEQ ID NO: 1, 6, 8 or 10 above, (A) and (B) (preferably (A) to (C), more preferably (A) (D), more preferably amino acids in which one or more amino acids are deleted, added, or substituted in a sequence other than the common sequence of (A) to (E), particularly preferably (A) to (F)) A polypeptide having a sequence and having an active oxygen scavenging activity is preferred.

For example, in SEQ ID NO: 8 or 10, consisting of an amino acid sequence in which one or more amino acids are deleted, added, or substituted in a sequence other than the common sequence of (A) to (F), and lactonase activity, paraoxonase As the polypeptide having at least one activity selected from the group consisting of activity and allyl esterase activity, the aforementioned G3H8 (GenBank, Accession No. AAR95985), G1A5 (GenBank, Accession No. AAR95981), G1C4 (GenBank, Accession No. EPON1 such as G2D6 (GenBank, Accession No. AAR95983) is preferable. These polypeptides also have active oxygen scavenging activity.

The polypeptide that is an active ingredient in the present invention is preferably a polypeptide having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, and allylesterase activity.
Examples of such a polypeptide include (a) a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1, 6, 8, or 10, and (b) one or more of SEQ ID NO: 1, 6, 8, or 10 A polypeptide having an amino acid sequence in which an amino acid is deleted, added, or substituted and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, and allylesterase activity is preferred. The polypeptide preferably further has active oxygen scavenging activity.

As the active ingredient in the present invention, a polypeptide having active oxygen scavenging activity and not having lactonase activity, paraoxonase activity, and allylesterase activity can also be suitably used. Examples of such a polypeptide include, for example, an amino acid sequence in which one or more amino acids are deleted, added, or substituted in SEQ ID NO: 1, 6, 8 or 10, and have active oxygen scavenging activity, and lactonase activity Polypeptides having no paraoxonase activity and allyl esterase activity are preferred. For example, in the amino acid sequence of SEQ ID NO: 1, methionine at position 1 is deleted, and histidine at positions 115 and 134 is substituted with another amino acid (for example, glutamine), thereby having reactive oxygen scavenging activity and lactonase Polypeptides having no activity, paraoxonase activity and allyl esterase activity can be obtained.

In the present invention, having lactonase activity means having an activity of hydrolyzing γ-thiobutyrolactone.
Specifically, having lactonase activity is the reaction of 4-mercaptobutyric acid produced by hydrolysis of γ-butyrolactone with the reaction of 4-mercaptobutyric acid with 5,5′-dithiobis (2-nitrobenzoic acid). The product 5-thio-2-nitrobenzoic acid can be confirmed by detecting the change in absorbance at 450 nm as an indicator.
More specifically, in the measurement method using a homocysteine thiolactonase activity measurement kit “Alfresa Auto HTLase” (Alfresa Pharma), when the homocysteine thiolactonase activity is confirmed, judge.

In the present invention, having paraoxonase activity means having an activity of hydrolyzing paraoxon.
Specifically, having paraoxonase activity can usually be confirmed by detecting paranitrophenol produced by hydrolysis of paraoxon using a change in absorbance at 405 nm as an indicator.
When paraoxonase activity is confirmed, it is determined to have paraoxonase activity.

In the present invention, having allyl esterase activity means having an activity of hydrolyzing phenyl acetate.
Specifically, having allyl esterase activity can be confirmed by detecting phenol, which is usually generated by hydrolysis of phenyl acetate, using a change in absorbance at 270 nm as an indicator.
When allyl esterase activity is confirmed, it determines with having allyl esterase activity.

In the present invention, having active oxygen scavenging activity means having activity of scavenging hydrogen peroxide, which is active oxygen.
The active oxygen scavenging activity can be measured according to the method of Root and Metcalf. The method of Root and Metcalf is described in J Clin Invest 60, 1266-1279 (1977).
Specifically, the sample is reacted with a known amount of hydrogen peroxide, and the remaining hydrogen peroxide is measured. The remaining amount of hydrogen peroxide can be confirmed by detecting the change in fluorescence intensity (excitation wavelength: 366 nm, emission wavelength: 460 nm) as an index by converting reduced scopoletin that emits fluorescence into an oxidized form by the action of horseradish peroxidase.
When the active oxygen scavenging activity is confirmed, the active oxygen scavenging activity is determined.

Protein content (protein content) can usually be determined by an absorbance method. Specifically, when the absorbance of the protein solution (measurement wavelength: 280 nm) is 1, the protein concentration is usually 1 mg / mL. Therefore, the preparation is appropriately diluted with distilled water, and the absorbance a at a measurement wavelength of 280 nm is measured. The protein content of the preparation is obtained by multiplying the obtained absorbance a by the dilution factor.

The polypeptide which is the active ingredient of the present invention can be obtained by purification from various mammals, or by chemical synthesis or a known genetic engineering technique.
For example, PON can be purified from plasma, liver, kidney, lung and brain intima of various mammals by combining known protein purification methods. Moreover, human-derived PON1 consisting of the amino acid sequence of SEQ ID NO: 1 and human-derived PON1 consisting of the amino acid sequence of SEQ ID NO: 6 can be purified from human plasma or chemically synthesized. Furthermore, as shown in the Examples below, it can also be produced by cell culture using the recombinant PON1 gene. PON1 derivatives such as a polypeptide consisting of the amino acid sequence of SEQ ID NO: 8 and a polypeptide consisting of the amino acid sequence of SEQ ID NO: 10 are described in, for example, Proc. Natl. Acad. Sci. USA 101 (2), 482-487 (2004). It can be made according to the methods described. In this document, an E. coli expression system is used, but it can also be prepared using animal cells (CHO-K1 cells) as described in Examples below. In addition to CHO-K1, NSO, SP2 / 0, CHO DG44, HEK293, and PER.C6 are listed as animal cells used for the production of polypeptides such as PON and PON1 derivatives that are the active ingredients of the present invention. It is not limited to. In addition, for example, a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, added, or substituted in SEQ ID NO: 1, 6, 8 or 10 is known PON as shown in the examples. Alternatively, it can be prepared by a known genetic engineering technique based on the gene sequence of ePON1.
The polypeptide obtained by the above method may be further purified and used by a commonly performed method.
Examples of the treatment in purification include treatment with a denaturing agent such as urea, surfactant, etc., ultrasonic treatment, treatment with enzyme digestion, salting out or solvent precipitation, dialysis, centrifugation, ultrafiltration, gel filtration, SDS- Examples thereof include, but are not limited to, PAGE, isoelectric focusing, ion exchange chromatography, hydrophobic chromatography, affinity chromatography, and reverse phase chromatography.

<Pharmaceutical formulation>
The preparation is usually a parenteral administration agent, but can also be an oral administration agent. Since the active ingredient of the medicament of the present invention is a protein, the dosage form is preferably a parenteral administration agent that is easily absorbed. Examples of parenteral agents include injections, inhalants, patches, suppositories and the like. Among these, an injection is more preferable.

<Injection>
Examples of the injection include intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, and drip injection. The injection is usually a liquid such as an aqueous solution or a suspension, or may be a lyophilized preparation. For injections, the active ingredient polypeptide is appropriately mixed with pharmaceutically acceptable additives (diluents, pH adjusters, tonicity agents, surfactants, stabilizers, etc.) by conventional means in preparations, etc. To be prepared. For example, an injection can be prepared by dissolving, suspending or emulsifying a polypeptide such as PON which is an active ingredient in a sterile aqueous or oily liquid (carrier for injection) which is usually used for injection. Examples of the aqueous liquid for injection include isotonic solutions containing physiological saline, glucose and other adjuvants. Suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, propylene glycol, polyethylene glycol), nonionic surfactant (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor) oil)) etc. may be used together. Examples of the oily liquid include sesame oil and soybean oil. As a solubilizer, benzyl benzoate, benzyl alcohol, or the like may be used in combination. The freeze-dried preparation is used by dissolving in a solution such as distilled water for injection and physiological saline at the time of use.
The content of the active ingredient in the injection is, for example, usually about 0.01 μg / mL to 1 g / mL, preferably about 0.1 μg / mL to 100 mg / mL in terms of the dry weight of the polypeptide as the active ingredient. mL, more preferably about 1 μg / mL to 50 mg / mL.

<Inhalant>
Examples of the inhalant include aerosols, inhalation powders, inhalation liquids (for example, inhalation solutions, inhalation suspensions, etc.), capsule inhalants and the like. The inhalation solution may be used in the form of being dissolved or suspended in water or other suitable medium at the time of use.

Inhalants can be manufactured according to conventional methods. For example, it is produced by making a polypeptide such as PON as an active ingredient into a dry powder or dissolved in a liquid to form a liquid, blended with an inhalation propellant, a carrier, or both, and filled into a suitable inhalation container. The When the polypeptide is pulverized, it can be made into a fine powder together with lactose, starch, magnesium stearate and the like to form a uniform mixture or granulated to prepare a powder. In addition, when the polypeptide is liquefied, the polypeptide may be dissolved in a liquid carrier such as water, physiological saline, or buffer.

Examples of the inhalable propellant include conventionally known propellants such as alternative chlorofluorocarbons, liquefied gas propellants (for example, fluorinated hydrocarbons, liquefied petroleum, diethyl ether, dimethyl ether, etc.), compressed gases (for example, soluble gases (for example, carbon dioxide) Gas, nitrous oxide gas, etc.), insoluble gas (for example, nitrogen gas, etc.), etc. are used.

In the inhalant, an additive may be further blended as necessary. As an additive, in the case of an inhalation solution, an antiseptic (benzalkonium chloride, paraben, etc.), a coloring agent, a buffering agent (sodium phosphate, sodium acetate, etc.), an isotonic agent (for example, sodium chloride, Concentrated glycerin and the like), thickeners (for example, carboxyvinyl polymer and the like), absorption accelerators and the like. In the case of powders for inhalation, lubricants (eg, magnesium stearate, light anhydrous silicic acid, talc, sodium lauryl sulfate, etc.), flavoring agents (eg, citric acid, menthol, glycyrrhizin ammonium salt, glycine, orange) Powders, etc.), binders (eg starch, dextrin, methylcellulose, hydroxypropylcellulose, polyvinylpyrrolidone, polyethylene glycol, sucrose, etc.), excipients (eg sucrose, lactose, glucose, mannitol, sorbit, maltose, cellulose, etc.) ), Coloring agents, preservatives (eg, sodium benzoate, sodium bisulfite, methylparaben, propylparaben, etc.), stabilizers (eg, citric acid, sodium citrate, etc.), absorption enhancers (bile salts, chitosan, etc.) ) And the like.

In the case of an inhalation solution, the content of the active ingredient in the inhalant is, for example, about 0.01 μg / mL to 1 g / mL, preferably about 0.1 μg in terms of the dry weight of the polypeptide as the active ingredient. / ML to 100 mg / mL, more preferably about 1 μg / mL to 50 mg / mL. In the case of a powder for inhalation, it is about 0.01 to 20% by weight, preferably about 0.1 to 10% by weight, more preferably about 0.1 to 10% by weight in the preparation in terms of the dry weight of the active ingredient polypeptide. May be about 0.5 to 5% by weight.

<Patch>
Examples of the patch include a plaster, a poultice, a tape, a plaster and the like in which a base containing a polypeptide which is an active ingredient is supported on a support. Bases include sodium alginate, gelatin, corn starch, tragacanth gum, methyl cellulose, hydroxyethyl cellulose, carboxymethyl cellulose, xanthan gum, carrageenan, mannan, agarose, dextrin, carboxymethyl starch, polyvinyl alcohol, sodium polyacrylate, methoxyethylene-maleic anhydride Polymers such as copolymer, polyvinyl ether, polyvinyl pyrrolidone, carboxyvinyl polymer, hydroxypropylcellulose, hydroxypropylmethylcellulose, pullulan; hydrocarbons such as white petrolatum, yellow petrolatum, paraffin, ceresin wax, microcrystalline wax; gelation Hydrocarbons (for example, the trade name Plastibase, Bristol-Myers Squii Manufactured by the company); higher fatty acids such as stearic acid; higher alcohols such as cetanol, octyldodecanol and stearyl alcohol; polyethylene glycol (eg, Macrogol 4000); propylene glycol, glycerin, dipropylene glycol, 1,3-butylene glycol And polyhydric alcohols such as concentrated glycerin; fatty acid esters such as monooleic acid ester and stearic acid glyceride; and phosphate buffer. Furthermore, additives such as dissolution aids, inorganic fillers, pH adjusters, humectants, preservatives, thickeners, antioxidants, and cooling agents may be added.
The content of the polypeptide as the active ingredient in the base is, for example, usually about 0.01 to 20% by weight, preferably about 0.1 to 10% by weight, in terms of the dry weight of the polypeptide. Preferably, it may be about 0.5 to 5% by weight.

<Suppository>
Suppositories are prepared by mixing the active ingredient polypeptide with a commonly used suppository base. The content of the polypeptide as the active ingredient in the suppository is, for example, usually about 0.01 to 20% by weight, preferably about 0.1 to 10% by weight, more preferably, in terms of the dry weight of the polypeptide. May be about 0.5 to 5% by weight.

<Oral administration agent>
Examples of the orally administered agent include powders, granules, tablets, tablets, pills, capsules, chewable agents, emulsions, solutions, syrups, intestinal solvents and the like. Of these, enteric solvents are preferred. Solid preparations are prepared by blending the above active ingredients with pharmaceutically acceptable carriers and additives. For example, excipients such as sucrose, lactose, glucose, starch, mannitol; binders such as gum arabic, gelatin, crystalline cellulose, hydroxypropylcellulose, methylcellulose; disintegrants such as carmellose, starch; anhydrous citric acid Stabilizers such as sodium laurate and glycerol are blended. Further, it may be coated or encapsulated with gelatin, white sugar, gum arabic, carnauba wax or the like. The liquid preparation is prepared, for example, by dissolving or dispersing the above active ingredient in water, ethanol, glycerin, simple syrup, or a mixture thereof.
The content of the polypeptide as the active ingredient in the oral administration agent is, for example, usually about 0.01 to 20% by weight, preferably about 0.1 to 10% by weight, more preferably, by dry weight of the polypeptide. It may be about 0.5 to 5% by weight.

<How to use>
The amount of the prophylactic or therapeutic agent for inflammatory bowel disease of the present invention varies depending on the disease, the symptom of the subject, age, etc. For example, the daily dose of the polypeptide as the active ingredient is the dry weight. Is preferably about 0.1 μg / kg to 500 mg / kg, more preferably about 1 μg / kg to 100 mg / kg, and even more preferably about 10 μg / kg to 50 mg / kg. It is particularly preferably about 10 μg / kg to 10 mg / kg. This amount is preferably administered in 1 to 3 divided doses per day or administered continuously by infusion.

<Target>
The subject to which the prophylactic or therapeutic agent for inflammatory bowel disease of the present invention is administered is an animal that has developed inflammatory bowel disease or an animal that may develop inflammatory bowel disease. More preferred are animals that have developed inflammatory bowel disease. Examples of animals include mammals such as humans, dogs, cats, monkeys, rats, mice, cows, pigs and horses. Preferably, it is a human.
In the present invention, “prevention” includes avoidance of onset, suppression of onset rate, suppression of progression of symptoms, and the like. “Treatment” includes healing, relieving or ameliorating symptoms, and the like.

Examples of the inflammatory bowel disease in the present invention include ulcerative colitis and Crohn's disease. A preferred embodiment of the preventive or therapeutic agent of the present invention is a prophylactic or therapeutic agent for ulcerative colitis, or a prophylactic or therapeutic agent for Crohn's disease.

Effective with a polypeptide having at least 70% sequence identity with human paraoxonase and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity and active oxygen scavenging activity The preventive or therapeutic agent for ulcerative colitis contained as a component is one of the preferred embodiments of the present invention. Effective with a polypeptide having at least 70% sequence identity with human paraoxonase and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity and active oxygen scavenging activity A preventive or therapeutic agent for Crohn's disease contained as a component is also one preferred embodiment of the present invention. As the polypeptide which is an active ingredient, the above-described PON, PON1 derivative and the like are preferable.

<Preventive or therapeutic agent for ulcerative colitis>
The amount of the prophylactic or therapeutic agent for ulcerative colitis of the present invention varies depending on the symptom and age of the subject, but the daily dose of the polypeptide as the active ingredient is usually about 0 in terms of dry weight. It is preferably 1 μg / kg to 500 mg / kg, more preferably about 1 μg / kg to 100 mg / kg, even more preferably about 10 μg / kg to 50 mg / kg, about 10 μg / kg to Particularly preferred is 10 mg / kg. This amount is preferably administered in 1 to 3 divided doses per day or administered continuously by infusion.
The use target of the prophylactic or therapeutic agent for ulcerative colitis is preferably a patient with ulcerative colitis. Moreover, it is suitable for the prevention of intestinal obstruction, intestinal perforation, toxic megacolon, colon cancer and the like, which are listed as complications of ulcerative colitis.
That is, the present invention also includes a method for preventing or treating ulcerative colitis, wherein the polypeptide such as PON described above is administered to a mammal, particularly a human (human).

<Preventive or therapeutic agent for Crohn's disease>
The amount of the prophylactic or therapeutic agent for Crohn's disease of the present invention varies depending on the symptom and age of the subject, but the daily dose of the polypeptide as the active ingredient is usually about 0.1 μg in terms of dry weight. / Kg to 500 mg / kg, more preferably about 1 μg / kg to 100 mg / kg, even more preferably about 10 μg / kg to 50 mg / kg, about 10 μg / kg to 10 mg / kg. Particularly preferred is kg. This amount is preferably administered in 1 to 3 divided doses per day or administered continuously by infusion.
Crohn's disease patients are suitable for the use of the agent for preventing or treating Crohn's disease. In addition, it is suitable for the prevention of intractable fistula and anal fissure listed as complications of Crohn's disease, arthritis, iritis, gangrenous pyoderma and erythema nodosum mentioned as extra-intestinal complications.

That is, the present invention also includes a method for preventing or treating Crohn's disease, in which a polypeptide such as PON described above is administered to a mammal, particularly a human (human).

A polypeptide having at least 70% sequence identity with human paraoxonase and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity and active oxygen scavenging activity A method for preventing or treating inflammatory bowel disease administered to animals is also encompassed in the present invention. Inflammatory bowel disease includes ulcerative colitis or Crohn's disease. The polypeptide, its preferred embodiment, administration method and the like are the same as those in the aforementioned preventive or therapeutic agent for inflammatory bowel disease.

Selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity, and active oxygen scavenging activity, having 70% or more sequence identity with human paraoxonase for the prevention or treatment of inflammatory bowel disease A polypeptide having at least one activity is also encompassed by the present invention. Inflammatory bowel disease includes ulcerative colitis or Crohn's disease. The polypeptide and preferred embodiments thereof, the method of using the polypeptide, and the like are the same as those in the aforementioned preventive or therapeutic agent for inflammatory bowel disease.

Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited thereto.

<Example 1>
(Purification of human paraoxonase 1 from plasma)
Using human plasma from which hepatitis virus and other pathogenic microorganisms were substantially removed as a raw material, fraction IV-1 was obtained by a human plasma corn cryogenic ethanol fractionation method. Fraction IV-1 was dissolved in 20 mM phosphate buffer containing 150 mM sodium chloride in a cold room at 2-8 ° C. Furthermore, centrifugation was performed at 1200 g, 4 ° C., and 10 minutes, and the protein component of the supernatant was recovered. Further, the collected supernatant was centrifuged at 30000 g at 4 ° C. for 50 minutes to recover the intermediate solution layer (upper layer: lipid layer, lower layer: precipitate).

Next, the recovered solution was loaded on Superdex 200 (GE-Healthcare) equilibrated with 20 mM phosphate buffer (pH 6.8 to 7.4). Next, elution was carried out using the same solution as that used for equilibration, and the first peak in UV 280 nm measurement was fractionated as a polymer region fraction. This solution was loaded on a Poros 50 Micron （HQ (manufactured by Applied Biosystems) equilibrated with 20 mM phosphate buffer (pH 6.8 to 7.4), washed with a solution similar to that used for equilibration, and then washed with 0. Elution was performed with 20 mM phosphate buffer (pH 6.8 to 7.4) containing 4 M sodium chloride. Next, this eluate was replaced with 20 mM phosphate buffer (pH 6.8 to 7.4) using a centrifugal ultrafiltration membrane (Millipore) having a molecular weight cut off of 10,000 to obtain a 30 mL concentrated solution. The resulting concentrated solution was loaded onto Poros 50 HS (Applied Biosystems) equilibrated with 20 mM phosphate buffer (pH 6.8 to 7.4) to obtain an unadsorbed fraction. This unadsorbed fraction was loaded on CHT ceramic hydroxyapatite Type II 40 μm (manufactured by Bio-Rad) equilibrated with 20 mM phosphate buffer (pH 6.8 to 7.4), washed with the same solution as equilibrated, and further After sequentially washing with 20 mM phosphate buffer (pH 6.8 to 7.4) and 0.1 M phosphate buffer (pH 6.8 to 7.4) containing 0.5 M sodium chloride, 0.4 M phosphate buffer Elution was performed with the solution (pH 6.8 to 7.4). Next, this eluate was replaced with a 20 mM phosphate buffer (pH 6.8 to 7.4) using a centrifugal ultrafiltration membrane (Millipore) having a molecular weight cut off of 10,000 to obtain a 1 mL concentrated solution. . Next, a PON1 antibody column was prepared by binding 200 μg of anti-human PON1 antibody (Cosmo Bio) to 1 mL of HiTrapHiNHS-activated HP (GE Healthcare), and the concentrated solution containing PON1 was added to 20 mM phosphate buffer. The PON1 antibody column equilibrated at (pH 6.8 to 7.4) was loaded, washed with a solution similar to that used for equilibration, and eluted with 2M glycine hydrochloride (pH 3.0) to obtain a solution containing PON1. . Next, this solution was immediately neutralized to pH 6.8 to 7.4 with 0.5 M Tris-HCl buffer (pH 9.5 to 10.5), and a centrifugal ultrafiltration membrane having a molecular weight cut off of 10,000 (Millipore) The solution was replaced by injecting a 20 mM phosphate buffer solution containing 150 mM sodium chloride and ultrafiltration. Subsequently, aseptic filtration was performed using a sterile filtration filter (Millipore) having a pore size of 0.22 μm, and paraoxonase 1 preparation (pH: 7.3, OD (wavelength 280 nm): 0.3, liquid volume 200 μL) It was.

<Example 2>
(Construction of expression vector for recombinant human paraoxonase 1)
For the human paraoxonase 1 gene, a pCR4-TOPO vector containing a human paraoxonase 1 gene mutant was obtained from OPEN BIOSYSTEMS (Clone ID 30915169), and a normal human paraoxonase 1 gene was obtained by mutagenesis PCR. Converted to and obtained.
Next, by the PCR method using the forward primer consisting of the base sequence of ttgctagcccccgaccatggcgaagctg (SEQ ID NO: 2) and the reverse primer consisting of the reverse primer consisting of the base sequence of ttgcggccgctcattagtggtggtggtggtggtgcttttcgaactgcgggtggctccagagctcacagtaaagagc (SEQ ID NO: 3) to the para-side of the human oxoase An NheI restriction enzyme site, a 6 × His tag sequence, a NotI restriction enzyme site, and a stop codon were added to the 5 ′ end side. This fragment was digested with the restriction enzymes NheI and NotI, and ligated to the gene amplification expression vector pcDNA3.1-(+)-dhfr, which was also digested with the restriction enzymes NheI and NotI, using T4 DNA ligase, A recombinant human paraoxonase 1 expression vector was constructed.

The expression vector pcDNA3.1-(+)-dhfr for gene amplification is obtained by inserting a mouse dhfr expression cassette into a pcDNA3.1-(+) vector (manufactured by Invitrogen) as an expression vector. The mouse dhfr gene expression cassette was cloned by PCR using pSV2-dhfr (ATCC 37146) as a template. At this time, the forward primer was cccacgtgtcgcgacaattagtcagcaaccatagtcc (SEQ ID NO: 4), and the reverse primer was cccacgtgtcgcgaggacaaaccacaactagaatgc (SEQ ID NO: 5). The obtained PCR fragment was cloned into a pCR-2.1 vector (manufactured by Invitrogen) by the TA cloning method to prepare a vector pCR-2.1-dhfr in which the dhfr gene added with NruI was cloned. Then, the obtained vector pcDNA3.1-(+) and vector pCR-2.1-dhfr were digested with restriction enzyme Nru I, and the respective fragments were ligated to prepare expression vector pcDNA3.1-dhfr.
This expression vector has a neomycin resistance gene expression cassette as a drug selection marker and a dhfr gene expression cassette for gene amplification. Geneticin, G418, neomycin sulfate or the like is generally used as a selective drug for a neomycin resistance gene, and methotrexate is generally used as a drug for gene amplification using a dhfr gene expression cassette.

<Example 3>
(Expression using 293F cells)
Using the recombinant human paraoxonase 1 expression vector obtained in Example 2, using the freestyle 293 gene transfer system (Invitrogen) according to the attached manual of the kit, transient expression was performed, and the recombinant human A culture supernatant containing paraoxonase 1 was prepared. The culture supernatant was prepared by mixing and culturing the expression strain and the medium according to the Freestyle 293 gene introduction system package insert.

<Example 4>
(Preparation of preparation containing human paraoxonase 1 from culture supernatant of recombinant human paraoxonase 1 expression strain (293F cells))
293F cell culture supernatant expressing and secreting human paraoxonase 1 and 20 mM phosphate buffer (pH 6.6 to 7.0) containing 1 M sodium chloride are mixed in equal amounts, and after stirring, a 0.45 μm filter ( The precipitate was removed by Millipore). This filtrate was loaded on His trap HP (GE Healthcare) equilibrated with 20 mM phosphate buffer (pH 6.8 to 7.4) containing 0.5 M sodium chloride in advance. Next, washing was performed using the same solution as that for equilibration, and further washing was performed with 20 mM phosphate buffer (pH 7.0 to 7.5) containing 0.5 M sodium chloride and 25 mM imidazole. Finally, the His trap HP adsorption fraction was eluted with 20 mM phosphate buffer (pH 7.0 to 7.5) containing 0.5 M sodium chloride and 500 mM imidazole. Next, the eluate of the His trap HP adsorption fraction was concentrated using a centrifugal ultrafiltration membrane (Millipore) having a molecular weight cut off of 10,000, and equilibrated with 20 mM phosphate buffer containing 150 mM sodium chloride. / 60 (manufactured by GE Healthcare) and elution was carried out using a solution similar to that used for equilibration to obtain a 0.6 mg / mL paraoxonase 1 solution. Subsequently, aseptic filtration was performed using a sterile filtration filter (Millipore) having a pore size of 0.22 μm to obtain a paraoxonase 1 preparation.

The results of analyzing the paraoxonase 1 preparation obtained in Example 4 are shown in Table 1. The paraoxonase 1 protein content was measured by an absorbance method. Allyl esterase activity was measured using ARYLESTERASE / PARAOXONASE ASSAY KIT (manufactured by ZeptoMetrix). The pH was measured by the Japanese Pharmacopoeia, and the endotoxin content was measured using Endospecy (manufactured by Seikagaku Corporation). The properties were confirmed visually.

The thus obtained preparation can be used as an injection solution as it is.

<Example 5>
(Construction of stable expression strain using CHO / DG44 cells)
The recombinant human paraoxonase 1 expression vector obtained in Example 2 was introduced into CHO / DG44 cells by electroporation (Gen Pulser II; manufactured by Bio-Rad).
One day after gene introduction, the cells were cultured in a selective medium containing 1 mg / mL concentration of G418 to obtain a recombinant human paraoxonase 1 stable expression strain into which the present expression vector was introduced. Next, selective culture was repeated in a medium in which the concentration of methotrexate was successively increased to obtain a gene amplified clone, DG44 / PON1-His CL45. Specifically, the concentration was increased in the order of a 50 nM methotrexate-containing medium, a 250 nM methotrexate-containing medium, and a 1,000 nM methotrexate-containing medium, and finally cloning was performed by a limiting dilution method.
A culture supernatant containing the recombinant human paraoxonase 1 was prepared by culturing DG44 / PON1-His CL45 and EX-CELL302 medium (manufactured by SAFC) in a 2 L or 15 L culture tank.

<Example 6>
(Preparation of preparation containing human paraoxonase 1 from culture supernatant of recombinant human paraoxonase 1 expression strain (CHO / DG44 cells))
The precipitate was removed from the culture supernatant of CHO / DG44 cells expressing and secreting human paraoxonase 1 using a 0.45 μm filter (Millipore). This filtrate was loaded onto Ni Sepharose HP (GE Healthcare) equilibrated with 20 mM phosphate buffer (pH 6.8 to 7.4) containing 0.5 M sodium chloride in advance. Next, washing was performed using the same solution as that used for equilibration, and further washing was performed with 20 mM phosphate buffer (pH 7.0 to 7.5) containing 0.5 M sodium chloride and 35 mM imidazole. Finally, elution was performed using 20 mM phosphate buffer (pH 7.0 to 7.5) containing 0.5 M sodium chloride and 500 mM imidazole. The eluate of the Ni Sepharose HP adsorption fraction was replaced with 20 mM phosphate buffer (pH 6.8 to 7.4) using a centrifugal ultrafiltration membrane (Millipore) with a molecular weight cut off of 10,000, and then 20 mM phosphorus. Loaded on CHT ceramic hydroxyapatite Type II 40 μm (Bio-Rad) equilibrated with acid buffer. Next, the unadsorbed fraction and the 20 mM phosphate buffer (pH 7.0 to 7.5) elution fraction containing 1 M sodium chloride were used to centrifuge the ultrafiltration membrane (Millipore) with a molecular weight cut off of 10,000. After replacing with 20 mM phosphate buffer (pH 6.8 to 7.4), it was loaded onto Poros 50 HS (Applied Biosystems) equilibrated with 20 mM phosphate buffer (pH 6.8 to 7.4). Next, the unadsorbed fraction was concentrated using a centrifugal ultrafiltration membrane (Millipore) having a molecular weight cut-off of 10,000, and equilibrated with 20 mM phosphate buffer containing 150 mM sodium chloride, Superdex200 16/60 (GE Healthcare ). Elution was carried out using the same solution as that used for equilibration, and the eluate was concentrated to contain 3.9 mg / mL of paraoxonase 1 using a centrifugal ultrafiltration membrane (Millipore) having a molecular weight cut off of 10,000. . Next, aseptic filtration was performed using a sterile filtration filter (manufactured by Millipore) having a pore size of 0.22 μm to obtain a paraoxonase 1 preparation.

Table 2 shows the results of analysis on the paraoxonase 1 preparation obtained in Example 6. In addition, paraoxonase 1 protein content was measured by the absorbance method, homocysteine thiolactonase activity was measured using Alfresa Auto HTLase (manufactured by Alfresa Pharma), and allylesterase activity was measured using ARYLESTERASE / PARAOXONASE ASSAY KIT (manufactured by ZeptoMetrix). ). The pH was measured by the Japanese Pharmacopoeia, and the endotoxin content was measured using Endospecy (manufactured by Seikagaku Corporation). The properties were confirmed visually.

The thus obtained preparation can be used as an injection solution as it is.

<Example 7>
(Construction of cells expressing human paraoxonase 1)
(Construction of human PON1-expressing cells)
For the cDNA of human PON1, the sequence disclosed in NCBI GenBank Accession Number BC074719 was used. Human PON1 cDNA was inserted under the control of the hCMV-MIE promoter of pEE12.4, which is an expression vector for animal cells, to construct pEE12.4-hPON1, which is a human PON1 (hPON1) expression vector. pEE12.4-hPON1 was introduced into CHO-K1 cells by electroporation, and cultured under methionine sulfoximine (MSX) selection to obtain a transformant. The obtained transformant (hereinafter abbreviated as “human PON1-expressing cell”) was used for the following examples.

<Example 8>
(Purification of human paraoxonase 1)
Human PON1-expressing cells were cultured using CD-CHO medium (Invitrogen) as an initial medium to produce human paraoxonase 1. The culture conditions were pH 7.1 and 37 ° C., and CHO CD Efficient Feed B (manufactured by Invitrogen) was fed at 40 mL / L / day from the fifth day to the ninth day. The culture supernatant collected on the 10th day of culture was filtered through a 0.45 μm filter, and then subjected to the following purification.

The solution after filtration with a 0.45 μm filter is loaded onto a strong anion exchanger column (UNO Sphere Q; manufactured by Bio-Rad Laboratories), and the column contains 0.15 M sodium chloride and 1 mM calcium chloride. After washing with 25 mM Tris-HCl solution (pH 7.5), elution was performed with 25 mM Tris-HCl solution (pH 7.5) containing 0.25 M sodium chloride and 1 mM calcium chloride. The solution was loaded onto a hydroxyapatite column (CHT Ceramic Hydroxyapatite Type I, Bio-Rad Laboratories), washed with 25 mM Tris-HCl solution (pH 7.5), and then 0.1 M phosphate buffer (pH 7.5). ) To elute the fraction containing human PON1. The solution was ultrafiltered using a 30K ultrafiltration membrane, and the solvent was replaced with 20 mM Tris-HCl solution (pH 7.2) containing 1 mM calcium chloride. The solution was loaded onto a strong cation exchanger column (UNO Sphere S; manufactured by Bio-Rad Laboratories), and the non-adsorbed fraction was collected. The solution was ultrafiltered using a 30K ultrafiltration membrane to concentrate the protein, and the solvent was exchanged with a 25 mM Tris-HCl solution (pH 7.5) containing 0.15 M sodium chloride and 1 mM calcium chloride. . The solution was subjected to sterile filtration with a 0.22 μm filter to obtain a paraoxonase 1 preparation.

Table 3 shows the results of analysis on the paraoxonase 1 preparation obtained in Example 8. The paraoxonase 1 protein content was measured by an absorbance method. Homocysteine thiolactonase activity was measured using Alfresa Auto HTLase (manufactured by Alfresa Pharma), and paraoxonase activity was measured according to Journal of Lipid Research Vol. 41, 2000 p1358-1363. The pH was measured by the Japanese Pharmacopoeia, and the endotoxin content was measured using Endospecy (manufactured by Seikagaku Corporation). The properties (appearance) were confirmed visually.

The thus obtained preparation can be used as an injection solution as it is.

<Example 9>
(Purification result)
For each paraoxonase 1 obtained in Examples 1, 4, 6 and 8, non-reduced or reduced samples were subjected to electrophoresis on a SDS-polyacrylamide 5-20% gradient gel to perform silver staining or CBB staining. went. The results are shown in FIGS. 1A to 1D. FIG. 1A is a diagram showing the results of silver staining of the paraoxonase 1 preparation (non-reduced sample) prepared in Example 1. FIG. 1B is a diagram showing the results of CBB staining of the paraoxonase 1 preparation (reduced sample) prepared in Example 4. FIG. 1C shows the results of CBB staining of the paraoxonase 1 preparation (reduced sample) prepared in Example 6. FIG. 1D is a diagram showing the results of CBB staining of the paraoxonase 1 preparation (non-reduced sample) prepared in Example 8. The arrow in FIG. 1A indicates paraoxonase 1. In FIGS. 1A to 1D, the left lane is a molecular weight marker.
For each of the paraoxonase 1 preparations obtained in Examples 1, 4, 6 and 8, this sample was subjected to SDS-PAGE, the protein on the gel was transferred to a PVDF membrane (manufactured by ATTO), and mouse anti-human para A primary reaction was performed using oxonase 1 antibody (PON-5D-1, manufactured by BML). Subsequently, a secondary reaction was performed using an HRP-labeled anti-mouse immunoglobulin antibody (manufactured by KPL), and color was developed by the TMB method. The results are shown in FIGS. 2A to 2D. FIG. 2A is a western blotting diagram of the paraoxonase 1 preparation (non-reduced sample) prepared in Example 1. FIG. 2B is a western blotting diagram of the paraoxonase 1 preparation (reduced sample) prepared in Example 4. FIG. 2C is a western blotting diagram of the paraoxonase 1 preparation (reduced sample) prepared in Example 6. FIG. 2D is a western blot diagram of the paraoxonase 1 preparation (non-reduced sample) prepared in Example 8.
As shown in FIGS. 1 and 2, a band presumed to be paraoxonase 1 was purified, and this band was stained by Western blot using the mouse anti-human paraoxonase 1 antibody.

Paraoxonase 1, which is an active ingredient of the paraoxonase 1 preparation obtained in Examples 1, 4, 6, and 8, is a sequence in which the methionine at position 1 is deleted from the amino acid sequence of SEQ ID NO: 1, that is, SEQ ID NO: A polypeptide consisting of the amino acid sequence shown in FIG.

<Example 10>
(Confirmation of preventive or therapeutic effect on ulcerative colitis 1)
Twenty 8-week-old male C57BL / 6J mice (manufactured by Japan SLC) were prepared for the experiment. Fifteen of them were given a 2% dextran sulfate sodium (DSS) solution in drinking water from Day 0 to Day 7 for preparation of an ulcerative colitis model.
Recombinant human paraoxonase 1 prepared in Example 8 was administered intravenously once daily on days 0 to 7 at a dose of 1 mg / kg (PON1 1 mg / kg administration group; n = 5). In another group, 5-aminosalicylic acid (5-ASA; SIGMA), which is the main drug of commercially available ulcerative colitis, at a dose of 100 mg / kg (5-ASA 100 mg / kg administration group; n = 5), Day 0 to 7 was orally administered once daily. Five mice administered with only 2% DSS solution served as a control group.
In addition, 5 mice that did not receive the 2% DSS solution and the PON1 preparation or the 5-ASA preparation were used as a normal group. That is, the normal group is a group of mice that were not administered any of the 2% DSS solution, the PON1 preparation, and the 5-ASA preparation.

The disease activity index score (DAI score; Disease index score) was measured once a day on days 0 and 3-8. DAI score is weight loss (0 points: less than 1%, 1 point: less than 1-5%, 2 points: less than 5-10%, 3 points: less than 10% -20%, 4 points: more than 20%), feces The test was composed of 3 items (0 points: no abnormality, 2 points: soft stool, 4 points: diarrhea) and fecal bleeding (0 points: no abnormality, 2 points: occult blood, 4 points: bleeding), and was evaluated with a maximum of 12 points.

On day 8 after the start of the animal experiment, the large intestine tissue was collected after the animal was sacrificed by carbon dioxide anesthesia inhalation. Then, the colon tissue is incised in the longitudinal direction, the contents are washed away in physiological saline, and the mucosa is observed under a microscope. Macroscopic score (0 point: no abnormality, 1 point: hyperemia, mucosal thickening) 2 points: hyperemia, mucosal thickening, bleeding, 3 points: ulcer or inflammation at 1 site, 4 points: ulcer or inflammation at 2 sites, 5 points: ulcer or inflammation of 2 cm or more) were measured . Mean ± standard error was calculated for each score.

Statistical analysis of DAI score and Macroscopic score shows Dunnett's test (SAS preclinical package version 5.00.010720, Windows (registered trademark) version SAS system release 8.02) for the effect of PON1 administration group or 5-ASA administration group on the control group. TS level 02M0 (SAS Institute Japan)). A risk rate of less than 5% (*) and a risk rate of less than 1% (**) were determined to be significant.
The results are shown in FIG. In FIG. 3, a white circle is a normal group; a black circle is a control group; a triangle is a PON1 1 mg / kg administration group; a square is a 5-ASA 100 mg / kg administration group.

As shown in FIG. 3 and Table 4, the DAI score and Macroscopic score were increased in the control group compared to the normal group.
However, symptoms such as inflammation or ulceration of the large intestine or weight loss, diarrhea or bleeding observed in the control group were significantly suppressed in the PON1 administration group. This experiment confirmed the prevention and treatment effect of ulcerative colitis by the PON1 preparation. In the PON1 preparation administration group, no side effects that were considered to be due to the PON1 preparation administration were observed.

<Example 11>
(Confirmation of preventive or therapeutic effect for ulcerative colitis 2)
Twenty-four 8-week-old male C57BL / 6J mice (manufactured by Japan SLC) were prepared for the experiment. Eighteen of them received a 2% dextran sulfate sodium (DSS) solution in drinking water from Day 0 to 5 for preparation of an ulcerative colitis model.
Recombinant human paraoxonase 1 prepared in Example 8 was administered intravenously once daily on days 0 to 5 at a dose of 0.01 mg / kg (PON1 0.01 mg / kg administration group; n = 6). . In another group, 5-aminosalicylic acid (5-ASA; SIGMA), which is the main drug of commercially available ulcerative colitis, at a dose of 100 mg / kg (5-ASA 100 mg / kg administration group; n = 6), Day 0 to 5 was administered orally once daily. Six mice administered with only 2% DSS solution served as a control group.
In addition, 6 mice that did not receive the 2% DSS solution and the PON1 preparation or the 5-ASA preparation were used as a normal group. That is, the normal group is a group of mice that were not administered any of the 2% DSS solution, the PON1 preparation, and the 5-ASA preparation.

The disease activity index score (DAI score) was measured once a day on Day 0, 1, 2, 4, and 5. Evaluation items and criteria for the DAI score are the same as in Example 10.
On Day 5 after the start of the animal experiment, the animals were sacrificed by a large amount of carbon dioxide anesthesia. Mean ± standard error was calculated for each score.

Statistical analysis on the DAI score was performed by Dunnett test in the same manner as in Example 10 with respect to the effect of the PON1 administration group or the 5-ASA administration group with respect to the control group. A risk rate of less than 5% (*) was determined to be significant.
The results are shown in FIG. In FIG. 4, a white circle is a normal group; a black circle is a control group; a triangle is a PON1 0.01 mg / kg administration group; a square is a 5-ASA 100 mg / kg administration group.

As shown in FIG. 4, an increase in the DAI score was observed in the control group compared to the normal group.
However, symptoms such as inflammation or ulceration of the large intestine or weight loss, diarrhea or bleeding observed in the control group were significantly suppressed in the PON1 administration group. This experiment confirmed the prevention and treatment effect of Crohn's disease by the PON1 preparation. In the PON1 preparation administration group, no side effects that were considered to be due to the PON1 preparation administration were observed.

<Example 12>
(Confirmation of prevention or treatment effect for Crohn's disease 1)
Twenty-eight 8-week-old male Balb / c mice (manufactured by Japan SLC) were prepared for the experiment. Twenty-one of them were intrarectally administered with a 2,4,6-trinitrobenzenesulfonic acid (TNBS) solution at a dose of 2.0 mg / mouse on Day 0 for the creation of a Crohn's disease model.
Recombinant human paraoxonase 1 prepared in Example 8 was administered intravenously once daily on days 0 to 2 at a dose of 1 mg / kg (PON1 1 mg / kg administration group; n = 7). In another group, 5-ASA (5-aminosalicylic acid; SIGMA), which is the main agent of commercially available Crohn's disease drug, was administered at a dose of 100 mg / kg (5-ASA 100 mg / kg administration group; n = 7) on Day 0-2. A single oral dose was administered daily. Seven mice administered with only the TNBS solution served as a control group.
In addition, 7 mice that did not receive the TNBS solution and the PON1 preparation or the 5-ASA preparation were used as a normal group. That is, the normal group is a group of mice that were not administered any of the TNBS solution, the PON1 preparation, and the 5-ASA preparation.

A disease activity index score (DAI score) was measured once a day from Day 0 to 3. Evaluation items and criteria for the DAI score are the same as in Example 10.
On Day 3 after the start of the animal experiment, the large intestine tissue was collected after the animal was sacrificed by a large inhalation of carbon dioxide anesthesia. Thereafter, the macroscopic score was measured by the same method and standard as in Example 10. Mean ± standard error was calculated for each score.

In the statistical analysis of the DAI score and the macroscopic score, Dunnett's test was performed in the same manner as in Example 10 for the effect of the PON1 administration group or the 5-ASA administration group with respect to the control group. A risk rate of less than 5% (*) and a risk rate of less than 1% (**) were determined to be significant.
The results are shown in FIG. In FIG. 5, a white circle is a normal group; a black circle is a control group; a triangle is a PON1 1 mg / kg administration group; a square is a 5-ASA 100 mg / kg administration group.

As shown in FIG. 5 and Table 5, an increase in the DAI score and Macroscopic score was observed in the control group compared to the normal group.
However, symptoms such as colon inflammation and ulceration, weight loss, diarrhea or bleeding observed in the control group were significantly suppressed in the PON1 administration group. This experiment confirmed the prevention and treatment effect of Crohn's disease by the PON1 preparation. In the PON1 preparation administration group, no side effects that were considered to be due to the PON1 preparation administration were observed.

<Example 13>
(Confirmation of preventive or therapeutic effect for Crohn's disease 2)
For the experiment, 42 male C57BL / 6J mice (manufactured by Nippon SLC Co., Ltd.) 8 weeks old were prepared. To 36 of them, a TNBS solution was administered intrarectally at a dose of 2.0 mg / mouse on Day 0 for the creation of a Crohn's disease model.
0.01 mg / kg of the recombinant human paraoxonase 1 prepared in Example 8 (PON1 0.01 mg / kg administration group; n = 6), 0.1 mg / kg (PON1 0.1 mg / kg administration group; n = 6) 1 mg / kg (PON1 1 mg / kg administration group; n = 6), 10 mg / kg (PON1 10 mg / kg administration group; n = 6) at intravenous doses on Days 0 to 3 every day. Administered once. In another group, 5-ASA (5-aminosalicylic acid; SIGMA), which is the main agent of commercially available Crohn's disease drug, was administered at a dose of 100 mg / kg (5-ASA 100 mg / kg administration group; n = 6) on Day 0-3. A single oral dose was administered daily. Six mice that received only the TNBS solution served as a control group.
In addition, 6 mice that did not receive the TNBS solution and the PON1 preparation or the 5-ASA preparation were used as a normal group. That is, the normal group is a group of mice that were not administered any of the TNBS solution, the PON1 preparation, and the 5-ASA preparation.

The disease activity index score (DAI score; Disease index score) was measured once a day on days 0 to 4. Evaluation items and criteria for DAI score are the same as those in Example 10.

On Day 4 after the start of the animal experiment, the large intestine tissue was collected after the animal was sacrificed by carbon dioxide anesthesia inhalation. Thereafter, the macroscopic score was measured by the same method and standard as in Example 10. Mean ± standard error was calculated for each score.
In the statistical analysis of the DAI score and the macroscopic score, Dunnett's test was performed in the same manner as in Example 10 for the effect of the PON1 administration group or the 5-ASA administration group with respect to the control group. A risk rate of less than 5% (*) and a risk rate of less than 1% (**) were determined to be significant.
The results are shown in FIG. In FIG. 6, a white circle is a normal group; a black circle is a control group; a black square (♦) is a PON1 0.01 mg / kg administration group; a white square (◇) is a PON1 0.1 mg / kg administration group; a black triangle is PON1 1 mg / kg. kg administration group; white triangle is PON1 10 mg / kg administration group; square (■) is 5-ASA 100 mg / kg administration group.

As shown in FIG. 6 and Table 6, the DAI score and Macroscopic score were increased in the control group compared to the normal group.
However, symptoms such as inflammation or ulceration of the large intestine or weight loss, diarrhea or bleeding observed in the control group were significantly suppressed in a dose-dependent manner in each PON1 administration group. This experiment confirmed the prevention and treatment effect of Crohn's disease by the PON1 preparation. In the PON1 preparation administration group, no side effects that were considered to be due to the PON1 preparation administration were observed.

<Example 14>
(Confirmation of preventive effect against Crohn's disease 1)
Twenty-five 8-week-old male C57BL / 6 mice (manufactured by Japan SLC) were prepared for the experiment.
The recombinant human paraoxonase 1 prepared in Example 8 was administered at a dose of 1 mg / kg (PON1 1 mg / kg administration group; n = 5), or 10 mg / kg (PON1 10 mg / kg administration group; n = 5). A single dose was administered intravenously to 5 mice each. In another group, 5-ASA (5-aminosalicylic acid; SIGMA), which is the main drug of Crohn's disease drug, was administered at a dose of 100 mg / kg (5-ASA 100 mg / kg administration group; n = 5) on Day 0-3. A single oral dose was administered daily.

In the PON1 1 mg / kg administration group, the PON1 10 mg / kg administration group and the 5-ASA 100 mg / kg administration group, a TNBS solution was administered once in the rectum at a dose of 100 mg / kg 30 minutes after administration of PON1 or 5-ASA. Administered.
Five mice administered only with the TNBS solution served as a control group.
In addition, 5 mice that did not receive any of the TNBS solution, the PON1 preparation, and the 5-ASA preparation were used as a normal group.

The disease activity index score (DAI score; Disease index score) was measured once a day on days 0 to 4. Evaluation items and criteria for DAI score are the same as those in Example 10.

After starting the animal experiment, the large intestine tissue was collected in Day IV 4 after the animal was sacrificed by a large inhalation of carbon dioxide anesthesia. Thereafter, the macroscopic score was measured by the same method and standard as in Example 10. Mean ± standard error was calculated for each score.

In the statistical analysis of the DAI score and the macroscopic score, Dunnett's test was performed in the same manner as in Example 10 for the effect of the PON1 administration group or the 5-ASA administration group with respect to the control group. A risk rate of less than 5% (*) was determined to be significant.
The results are shown in FIGS. 7 and 8 (*: P <0.05 in FIGS. 7 and 8). In FIG. 7, the white circle is the normal group; the black circle is the control group; the triangle is the 5-ASA 100 mg / kg administration group; the square (■) is the PON1 1 mg / kg administration group; the square (♦) is the PON1 10 mg / kg administration group . The number of dead individuals in each group was as follows.
-Day 2: 1 control group, 1 5-ASA group-Day 4: 5-ASA group 1

As shown in FIG. 7 and FIG. 8, the DAI score and Macroscopic score were increased in the control group as compared to the normal group.
However, symptoms such as inflammation of the large intestine, tissue damage such as ulcer, weight loss, diarrhea, and bleeding observed in the control group were significantly suppressed in the PON1 10 mg / kg administration group. By this experiment, the preventive effect of Crohn's disease by the PON1 preparation was confirmed. In the PON1 preparation administration group, no side effects that were considered to be due to the PON1 preparation administration were observed.

<Example 15>
(Confirmation of therapeutic effect on Crohn's disease 1)
Twenty 8-week-old male C57BL / 6 mice (manufactured by Japan SLC) were prepared for the experiment. Fifteen of them were given a single dose of TNBS solution at a dose of 100 mg / kg in the rectum on Day 0 for the creation of a Crohn's disease model.

Four hours after administration of the TNBS solution (symptoms are relatively mild), the recombinant human paraoxonase 1 prepared in Example 8 was administered at a dose of 10 mg / kg (single administration group after 4 hours of PON1, n = 5). Single intravenous administration.
In another group, 24 hours after administration of the TNBS solution (severe symptoms), 10 mg / kg of the recombinant human paraoxonase 1 prepared in Example 8 (PON1 24 hours daily administration group; n = 5) The dose was intravenously administered daily on Days 1-3.
Five mice administered only with the TNBS solution served as a control group.
In addition, 5 mice that were not administered with either the TNBS solution or the PON1 preparation were used as a normal group.

The disease activity index score (DAI score; Disease index score) was measured once a day on days 0 to 4. Evaluation items and criteria for DAI score are the same as those in Example 10.

After starting the animal experiment, the large intestine tissue was collected in Day IV 4 after the animal was sacrificed by a large inhalation of carbon dioxide anesthesia. Thereafter, the macroscopic score was measured by the same method and standard as in Example 10. Mean ± standard error was calculated for each score.

In the statistical analysis on the DAI score and the macroscopic score, Dunnett's test was performed in the same manner as in Example 10 on the effects of the single administration group after 4 hours of PON1 and the daily administration group after 24 hours of PON1 with respect to the control group. A risk rate of less than 5% (*) was determined to be significant.
The results are shown in FIGS. 9 and 10 (*: P <0.05 in FIGS. 9 and 10). In FIG. 9, a white circle is a normal group; a black circle is a control group; a triangle is a single administration group 4 hours after PON1; and a square is a daily administration group 24 hours after PON1. In addition, the data of Day1 of the daily administration group 24 hours after PON1 are data immediately before PON1 is administered.
The number of dead individuals in each group was as follows.
-Day 2: 2 control groups-Day 3: PON1 24 hours daily administration group 1-Day 4: 1 control group, PON1 4 hours single administration group, PON1 24 hours daily administration group 1

As shown in FIGS. 9 and 10, the DAI score and Macroscopic score were increased in the control group as compared to the normal group.
However, when the symptoms such as inflammation of the large intestine, tissue damage such as ulcer, weight loss, diarrhea, and bleeding are relatively mild compared to the control group (4 hours after administration of TNBS solution), the symptoms are caused by a single administration of PON1. Significantly suppressed (single administration group 4 hours after PON1). Furthermore, even if the symptom was severe at Day 1 (24 hours after administration of the TNBS solution), a gradual improvement tendency was gradually observed by administering PON 1 every day thereafter (PON1 24 hours after administration daily group).
This experiment confirmed the therapeutic effect of Crohn's disease with the PON1 preparation. In the PON1 preparation administration group, no side effects that were considered to be due to the PON1 preparation administration were observed.

<Example 16>
In the amino acid sequence of human paraoxonase 1 (SEQ ID NO: 1), a polypeptide (C284A variant) comprising an amino acid sequence in which the methionine at position 1 was deleted and the cysteine at position 284 was replaced with alanine was prepared.

(Construction of human paraoxonase 1 (C284A) variant expressing cells)
(Construction of cells expressing human PON1 (C284A))
In the cDNA of human PON1 (C284A), a point mutation was introduced using Geneitor Site-Directed Mutagenesis Systems (manufactured by Invitrogen) using the sequence disclosed in NCBI GenBank Accession Number BC074719 as a template, and a cysteine at position 284 is encoded. What substituted the base pair by the base pair which codes alanine was used. Human PON1 (C284A) cDNA was inserted under the control of the hCMV-MIE promoter of pEE12.4, an expression vector for animal cells, and pEE12.4-hPON1 (C284A), an expression vector for human PON1 (C284A) (hPON1). ) Was built. A transformant was obtained by introducing pEE12.4-hPON1 (C284A) into CHO-K1 cells by electroporation and culturing under methionine sulfoximine (MSX) selection. The obtained transformant (hereinafter abbreviated as “human PON1 (C284A) -expressing cell”) was used for the experiments of the following Examples.

(Purification of C284A variant of recombinant human paraoxonase 1)
A C284A variant of recombinant human paraoxonase 1 was purified in the same manner as in Example 8 except that the human PON1 (C284A) -expressing cell was used instead of the human PON1-expressing cell. A C284A variant preparation of oxonase 1 was obtained.

The obtained C284A modified preparation of recombinant human paraoxonase 1 was analyzed in the same manner as in Example 8. Specifically, the C284A variant protein content of the recombinant human paraoxonase 1 was measured by an absorbance method. The homocysteine thiolactonase activity was measured using Alfresa® Auto® HTLase (manufactured by Alfresa Pharma). Paraoxonase activity was measured according to the method described in Journal of Lipid, Reaserch, Vol. 41, 2000, p1358-1363. Allyl esterase activity was measured using ARYLESTERASE / PARAOXONASE ASSAY KIT (manufactured by ZeptoMetrix). The pH was measured according to the Japanese Pharmacopoeia. The properties (appearance) were confirmed visually. The results are shown in Table 7.

The thus obtained preparation could be used as an injection solution as it was.

(Purification result)
A reduced sample was prepared for the C284A variant of the recombinant human paraoxonase 1 obtained in Example 16, and subjected to electrophoresis on SDS-polyacrylamide 5-20% gradient gel in the same manner as in Example 9. CBB staining was performed. The result is shown in FIG. 11A. The left lane is a molecular weight marker.
In addition, for the C284A variant of the recombinant human paraoxonase 1, the protein on the gel was transferred to a PVDF membrane (manufactured by ATTO) after SDS-PAGE, and the anti-human paraoxonase 1 antibody (PON- 4C-1 (manufactured by BML) was used for the primary reaction. Next, a secondary reaction was performed using an HRP-labeled anti-mouse immunoglobulin antibody (manufactured by KPL), and color was developed by the TMB method. The results of Western blotting of this C284A variant (reduced sample) are shown in FIG. 11B.
As shown in FIGS. 11A and 11B, a band presumed to be a C284A variant of human paraoxonase 1 was purified, and this band was stained by Western blot using the anti-human paraoxonase 1 antibody. This confirmed that a C284A variant of human paraoxonase 1 was obtained.

<Example 17>
A polypeptide comprising an amino acid sequence in which amino acid sequence of human paraoxonase 1 (SEQ ID NO: 1) is deleted, wherein methionine at position 1 is deleted, lysine at position 84 is replaced with glutamic acid, and arginine at position 306 is replaced with glutamine. (K84E / R306Q variant) was prepared.

(Construction of human paraoxonase 1 (K84E / R306Q) variant expressing cells)
(Construction of human PON1 (K84E / R306Q) expressing cells)
In the cDNA of human PON1 (K84E / R306Q), a point mutation was introduced using Genesite Site-Directed Mutagenesis Systems (manufactured by Invitrogen) using the sequence disclosed in NCBI GenBank Accession Number BC074719 as a template, and lysine at position 84 was introduced. A base pair encoding the glutamic acid was substituted for the base pair encoding, and a base pair encoding arginine at position 306 was replaced with a base pair encoding glutamine. The human PON1 (K84E / R306Q) cDNA is inserted under the control of the hCMV-MIE promoter of pEE12.4, an expression vector for animal cells, and pEE12.4-hPON1 (human PON1 (K84E / R306Q) expression vector). K84E / R306Q) was constructed. A transformant was obtained by introducing pEE12.4-hPON1 (K84E / R306Q) into CHO-K1 cells by electroporation and culturing under methionine sulfoximine (MSX) selection. The obtained transformant (hereinafter abbreviated as “human PON1 (K84E / R306Q) -expressing cell”) was used for the experiments of the following Examples.

(Purification of K84E / R306Q variant of recombinant human paraoxonase 1)
A modified K84E / R306Q of recombinant human paraoxonase 1 was purified in the same manner as in Example 8 except that the human PON1 (K84E / R306Q) -expressing cell was used instead of the human PON1-expressing cell. A K84E / R306Q modified preparation of recombinant human paraoxonase 1 was obtained.

The obtained recombinant human paraoxonase 1 K84E / R306Q modified preparation was analyzed in the same manner as in Example 16. The results are shown in Table 8.

The thus obtained preparation could be used as an injection solution as it was.

(Purification result)
For the K84E / R306Q variant of the recombinant human paraoxonase 1 obtained in Example 17, a reduced sample was prepared and electrophoresed on a SDS-polyacrylamide 5-20% gradient gel in the same manner as in Example 9. And CBB staining was performed. The result is shown in FIG. 12A. The left lane is a molecular weight marker.
The K84E / R306Q variant of the recombinant human paraoxonase 1 was subjected to Western blotting in the same manner as in Example 16. The result of Western blotting of this K84E / R306Q variant (reduced sample) is shown in FIG. 12B.
As shown in FIGS. 12A and 12B, a band presumed to be a K84E / R306Q variant of human paraoxonase 1 was purified, and this band was stained by Western blot using the anti-human paraoxonase 1 antibody. . This confirmed that a K84E / R306Q variant of human paraoxonase 1 was obtained.

<Example 18>
(Confirmation of preventive or therapeutic effect for Crohn's disease 3)
Twenty-five 8-week-old male C57BL / 6 mice (manufactured by Japan SLC) were prepared for the experiment. Twenty of them were given a single intrarectal dose of TNBS solution at a dose of 100 mg / kg on Day 0 to create a Crohn's disease model.

The recombinant human paraoxonase 1 C284A modified preparation or the recombinant human paraoxonase 1 K84E / R306Q modified preparation prepared in Examples 16 and 17 was each 10 mg / kg (C284A 10 mg / kg administration group; n = 5, K84E / R306Q 10 mg / kg administration group; n = 5), each of 5 mice was administered as a single intravenous dose. Similarly, the recombinant human paraoxonase 1 prepared in Example 8 was administered intravenously once to 5 animals at a dose of 10 mg / kg (PON1 10 mg / kg administration group; n = 5).
Five mice administered only with the TNBS solution served as a control group.
In addition, 5 mice that did not receive any of the TNBS solution, the PON1 preparation, and the PON1 modified preparation were used as a normal group.

The disease activity index score (DAI score; Disease index score) was measured once a day from Day 0 to 2. Evaluation items and criteria for DAI score are the same as those in Example 10.

On day 3 after the start of the animal experiment, the colon tissue was collected after slaughtering the animal by carbon dioxide anesthesia inhalation. Thereafter, the macroscopic score was measured by the same method and standard as in Example 10. Mean ± standard error was calculated for each score.

In the statistical analysis on the DAI score and the macroscopic score, Dunnett's test was performed in the same manner as in Example 10 for the effect of the PON1 administration group or the variant administration group with respect to the control group. A risk rate of less than 5% (*) and a risk rate of less than 1% (**) were determined to be significant.
The results are shown in FIGS. 13 and 14 (in FIG. 13, *: P <0.05, ** P <0.01). In FIG. 13, a white circle is a normal group; a black circle is a control group; a triangle is a PON1 10 mg / kg administration group; a square (■) is a C284A 10 mg / kg administration group; a square (♦) is a K84E / R306Q 10 mg / kg administration group. .
The number of dead individuals in each group was as follows.
・ Day 3: One control group

As shown in FIG. 13 and FIG. 14, an increase in DAI score and Macroscopic score was observed in the control group compared to the normal group.
However, symptoms such as inflammation of the large intestine, tissue damage such as ulcer, weight loss, diarrhea and bleeding observed in the control group were significantly suppressed in the PON1 variant administration group. The degree of suppression was similar to that in the PON1 administration group. From this experiment, the effect of preventing or treating Crohn's disease by the PON1 preparation was confirmed in the same way in the PON1 modified preparation. In the PON1 preparation administration group and the PON1 modified preparation, no side effects that were considered to be caused by the administration of the PON1 preparation or the PON1 modified preparation were observed.

<Example 19>
The human PON1 derivative ePON1-G2E6 (SEQ ID NO: 8) was prepared.

(Construction of cells expressing human PON1 derivative (ePON1-G2E6))
An artificial base sequence (Invitrogen, SEQ ID NO: 7) encoding the amino acid sequence (SEQ ID NO: 8) disclosed in NCBI GenBank Accession Number AAR95984 optimized for expression in CHO cells was used as ePON1-G2E6 cDNA. .
The ePON1-G2E6 cDNA was inserted into the animal cell expression vector pEE12.4 under the control of the hCMV-MIE promoter to construct the ePON1-G2E6 expression vector pEE12.4-AY499191. pEE12.4-AY499191 was introduced into CHO-K1 cells by electroporation, and cultured under methionine sulfoximine (MSX) selection to obtain transformants. The obtained transformant (hereinafter abbreviated as “ePON1-G2E6-expressing cell”) was used for the following examples.

(Purification of ePON1-G2E6)
The ePON1-G2E6-expressing cells were cultured using CD-CHO medium as an initial medium to produce the human paraoxonase 1 derivative ePON1-G2E6. The culture conditions were pH 7.1 and 37 ° C., and CHO CD Efficient Feed B was fed at 40 mL / L / day from the fifth day to the ninth day. The culture supernatant collected on the 10th day of culture was filtered through a 0.45 μm filter, and then subjected to the following purification.

The solution after filtration with a 0.45 μm filter was loaded onto a strong anion exchanger column (UNO Sphere Q), and the column was loaded with 25 mM Tris-HCl solution (pH 7.5) containing 0.15 M sodium chloride and 1 mM calcium chloride. After washing in 5), elution was performed with a 25 mM Tris-HCl solution (pH 7.5) containing 0.25 M sodium chloride and 1 mM calcium chloride. The solution was replaced with a 20 mM Tris-HCl solution (pH 7.2) containing 1 mM calcium chloride by ultrafiltration using a 30 K ultrafiltration membrane. The solution was loaded onto a strong cation exchanger column (UNO Sphere S), and the non-adsorbed fraction was collected. The solution was ultrafiltered using a 30K ultrafiltration membrane to concentrate the protein, and the solvent was replaced with a 25 mM Tris-HCl solution (pH 7.5) containing 0.15 M sodium chloride and 1 mM calcium chloride. . The solution was subjected to aseptic filtration with a 0.22 μm filter to obtain an ePON1-G2E6 preparation.

The ePON1-G2E6 preparation obtained in Example 19 was analyzed in the same manner as in Example 16. The results are shown in Table 9.

The thus obtained preparation could be used as an injection solution as it was.

(Purification result)
A reduced sample was prepared for ePON1-G2E6, which is the human PON1 derivative obtained in Example 19, and was subjected to electrophoresis on an SDS-polyacrylamide 5-20% gradient gel in the same manner as in Example 9 to perform CBB staining. went. The result is shown in FIG. 15A. The left lane is a molecular weight marker.
The ePON1-G2E6 was subjected to Western blotting in the same manner as in Example 16. The result of Western blotting of this ePON1-G2E6 (reduced sample) is shown in FIG. 15B.
As shown in FIGS. 15A and 15B, a band presumed to be ePON1-G2E6 was purified, and this band was stained by Western blot using the anti-paraoxonase 1 antibody. This confirmed that ePON1-G2E6 was obtained.

<Example 20>
The human PON1 derivative ePON1-G3C9 (SEQ ID NO: 10) was prepared.

(Construction of cells expressing human PON1 derivative (ePON1-G3C9))
An artificial base sequence (Invitrogen, SEQ ID NO: 9) encoding the amino acid sequence (SEQ ID NO: 10) disclosed in NCBI GenBank Accession Number AAR95986 optimized for expression in CHO cells was used as ePON1-G3C9 cDNA. .
The ePON1-G3C9 cDNA was inserted into the animal cell expression vector pEE12.4 under the control of the hCMV-MIE promoter to construct the ePON1-G3C9 expression vector pEE12.4-AY499193. A transformant was obtained by introducing pEE12.4-AY499193 into CHO-K1 cells by electroporation and culturing under methionine sulfoximine (MSX) selection. The obtained transformant (hereinafter abbreviated as “ePON1-G3C9-expressing cell”) was used for the following examples.

(Purification of ePON1-G3C9)
ePON1-G3C9-expressing cells were cultured and purified in the same manner as in Example 19 to prepare an ePON1-G3C9 preparation.

The ePON1-G3C9 preparation obtained in Example 20 was analyzed in the same manner as in Example 16. The results are shown in Table 10.

The thus obtained preparation could be used as an injection solution as it was.

(Purification result)
A reduced sample was prepared for ePON1-G3C9, which is the human PON1 derivative obtained in Example 20, and subjected to electrophoresis on an SDS-polyacrylamide 5-20% gradient gel in the same manner as in Example 9 to perform CBB staining. went. The result is shown in FIG. 16A. The left lane is a molecular weight marker.
The ePON1-G3C9 was subjected to Western blotting in the same manner as in Example 16. The result of Western blotting of this ePON1-G3C9 (reduced sample) is shown in FIG. 16B.
As shown in FIGS. 16A and 16B, a band presumed to be ePON1-G3C9 was purified, and this band was stained by Western blot using the anti-paraoxonase 1 antibody. This confirmed that ePON1-G3C9 was obtained.

<Example 21>
In the amino acid sequence of human paraoxonase 1 (SEQ ID NO: 1), a polypeptide (D269E variant) comprising an amino acid sequence in which methionine at position 1 was deleted and aspartic acid at position 269 was replaced with glutamic acid was prepared.

(Construction of human paraoxonase 1 (D269E) variant expressing cells)
(Construction of cells expressing human PON1 (D269E))
In the cDNA of human PON1 (D269E), a point mutation was introduced using Geneitor Site-Directed Mutagenesis Systems (manufactured by Invitrogen) using the sequence disclosed in NCBI GenBank Accession Number BC074719 as a template to encode aspartic acid at position 269. The base pair to be replaced with a base pair encoding glutamic acid was used. Human PON1 (D269E) cDNA was inserted under the control of the hCMV-MIE promoter of pEE12.4, an expression vector for animal cells, and pEE12.4-hPON1 (D269E), an expression vector for human PON1 (D269E) (hPON1). ) Was built. A transformant was obtained by introducing pEE12.4-hPON1 (D269E) into CHO-K1 cells by electroporation and culturing under methionine sulfoximine (MSX) selection. The obtained transformant (hereinafter abbreviated as “human PON1 (D269E) -expressing cell”) was used for the experiments of the following Examples.

(Purification of D269E variant of recombinant human paraoxonase 1)
A modified D269E variant of recombinant human paraoxonase 1 was purified in the same manner as in Example 8 except that the human PON1 (D269E) -expressing cell was used instead of the human PON1-expressing cell. A modified D269E formulation of oxonase 1 was obtained.

The obtained D269E modified preparation of recombinant human paraoxonase 1 was analyzed in the same manner as in Example 8. Specifically, the D269E modified protein content of the recombinant human paraoxonase 1 was measured by an absorbance method. The homocysteine thiolactonase activity was measured using Alfresa® Auto® HTLase (manufactured by Alfresa Pharma). Paraoxonase activity was measured according to the method described in Journal of Lipid, Reaserch, Vol. 41, 2000, p1358-1363. Allyl esterase activity was measured using ARYLESTERASE / PARAOXONASE ASSAY KIT (manufactured by ZeptoMetrix). The pH was measured according to the Japanese Pharmacopoeia. The properties (appearance) were confirmed visually. The results are shown in Table 11.

<Example 22>
In the amino acid sequence of human paraoxonase 1 (SEQ ID NO: 1), a polypeptide (H115 / 134Q variant) consisting of an amino acid sequence in which methionine at position 1 is deleted and histidines at positions 115 and 134 are each replaced with glutamine ) Was produced.

(Construction of human paraoxonase 1 (H115 / 134Q) variant expressing cells)
(Construction of cells expressing human PON1 (H115 / 134Q))
In the cDNA of human PON1 (H115 / 134Q), point mutations were introduced using Geneitor Site-Directed Mutagenesis Systems (manufactured by Invitrogen) using the sequence disclosed in NCBI GenBank Accession Number BC074719 as a template, positions 115 and 134. A base pair encoding a histidine at the position was replaced with a base pair encoding glutamine. Human PON1 (H115 / 134Q) cDNA is inserted under the control of the hCMV-MIE promoter of pEE12.4, an expression vector for animal cells, and pEE12.4, a human PON1 (H115 / 134Q) (hPON1) expression vector. -HPON1 (H115 / 134Q) was constructed. A transformant was obtained by introducing pEE12.4-hPON1 (H115 / 134Q) into CHO-K1 cells by electroporation and culturing under methionine sulfoximine (MSX) selection. The obtained transformant (hereinafter abbreviated as “human PON1 (H115 / 134Q) -expressing cell”) was used for the following experiments.

(Purification of H115 / 134Q variant of recombinant human paraoxonase 1)
A modified H115 / 134Q variant of recombinant human paraoxonase 1 was purified in the same manner as in Example 8 except that the human PON1 (H115 / 134Q) -expressing cell was used instead of the human PON1-expressing cell. An H115 / 134Q variant preparation of recombinant human paraoxonase 1 was obtained.

The obtained H115 / 134Q modified preparation of recombinant human paraoxonase 1 was analyzed in the same manner as in Example 21. The results are shown in Table 12.

(Purification result)
A non-reduced sample was prepared for the D269E variant of the recombinant human paraoxonase 1 obtained in Example 21 and the H115 / 134Q variant of the recombinant human paraoxonase 1 obtained in Example 22. In the same manner as in Example 9, electrophoresis was performed on SDS-polyacrylamide 5-20% gradient gel, and CBB staining was performed. FIG. 17A shows the result of CBB staining of the D269E variant, and FIG. 17B shows the result of CBB staining of the H115 / 134Q variant. In FIG. 17A and FIG. 17B, the left lane is a molecular weight marker.

<Example 23>
(Confirmation of preventive or therapeutic effect on Crohn's disease 4)
For the experiment, 45 8-week-old male C57BL / 6 mice (manufactured by Japan SLC) were prepared. Forty of them, a TNBS solution was administered once at a dose of 100 mg / kg in the rectum on Day 0 for the creation of a Crohn's disease model.

The ePON1-G2E6 preparation and the ePON1-G3C9 preparation prepared in Example 19 and Example 20 were intravenously administered daily on days 0 to 2, respectively, at a dose of 1 mg / kg or 10 mg / kg, respectively. G2E6 1 mg / kg administration group; n = 5, G2E6 10 mg / kg administration group; n = 5, G3C9 1 mg / kg administration group; n = 5, G3C9 10 mg / kg administration group; n = 5). Similarly, the H115 / 134Q modified preparation of recombinant human paraoxonase 1 prepared in Example 21 and Example 22 or the D269E modified preparation of recombinant human paraoxonase 1 at a dose of 10 mg / kg. 5 animals each were intravenously administered daily on Day 0-2 (H115 / 134Q 10 mg / kg administration group; n = 5, D269E 10 mg / kg administration group; n = 5). Furthermore, the recombinant human paraoxonase 1 prepared in Example 8 was intravenously administered to 5 mice at a dose of 10 mg / kg on days 0 to 2 every day (PON1 10 mg / kg administration group; n = 5).
In addition, 5 mice that were not administered any of the TNBS solution, the PON1 preparation, and the PON1 modified preparation were used as a normal group.

The disease activity index score (DAI score; Disease index score) was measured once a day on days 0 to 3. Evaluation items and criteria for DAI score are the same as those in Example 10.

On day 3 after the start of the animal experiment, the colon tissue was collected after slaughtering the animal by carbon dioxide anesthesia inhalation. Thereafter, the macroscopic score was measured by the same method and standard as in Example 10. Mean ± standard error was calculated for each score.

In the statistical analysis on the DAI score and the macroscopic score, Dunnett's test was performed in the same manner as in Example 10 for the effect of the PON1 administration group or the variant administration group with respect to the control group. A risk rate of less than 5% (*) and a risk rate of less than 1% (**) were determined to be significant.
The results are shown in Tables 13 and 14, and FIGS. Table 13 shows the results (mean ± standard error) of Dunnett's test for the DAI score of each group. A plot of the results shown in Table 13 is the graph shown in FIG. In FIG. 18, (◯) is normal group; (●) is control group; (▲) is PON1 10 mg / kg administration group; (■) is ePON1-G2E6 1 mg / kg administration group; (□) is ePON1-G2E6 10 mg (♦) is the ePON1-G3C9 1 mg / kg administration group; (◇) is the ePON1-G3C9 10 mg / kg administration group. (X) is H115 / 134Q 10 mg / kg administration group; (*) is D269E 10 mg / kg administration group. Table 14 shows the results (mean ± standard error) of Dunnett's test for the macroscopic score of each group. A plot of the results shown in Table 14 is the graph shown in FIG. In Table 13, Table 14, FIG. 18 and FIG. 19, *: P <0.05, ** P <0.01. The number of dead individuals in each group was as follows.
-Day 3: 2 control groups

As shown in Table 13, Table 14, FIG. 18 and FIG. 19, an increase in the DAI score and Macroscopic score was observed in the control group compared to the normal group.
However, symptoms such as inflammation of the large intestine, tissue damage such as ulcer, weight loss, diarrhea, and bleeding observed in the control group are the PON1 administration group, the ePON1-G2E6 administration group and the PON1-G3C9 administration group, PON1 It was significantly suppressed in the H115 / 134Q administration group and the D269E administration group, which are variants. From this experiment, the prevention and treatment effect of Crohn's disease by the PON1 preparation was confirmed in the same way in the PON1 derivative preparation and the PON1 modified preparation. In the PON1 preparation administration group, the PON1 derivative preparation administration group, and the PON1 variant preparation administration group, no side effects that were considered to be due to the administration of these preparations were observed.

<Example 24>
(Measurement result of active oxygen scavenging activity)
Recombinant human paraoxonase 1 preparation prepared in Example 8, C284A variant preparation of recombinant human paraoxonase 1 prepared in Example 16, ePON1-G2E6 preparation obtained in Example 19, Example EPON1-G3C9 preparation obtained in Example 20, D269E modified preparation of recombinant human paraoxonase 1 obtained in Example 21, H115 / 134Q of recombinant human paraoxonase 1 obtained in Example 22 For the modified preparation, the active oxygen scavenging activity was measured.

The active oxygen scavenging activity was measured according to the method of Root and Metcalf (J Clin Invest 60, 1266-1279 (1977)). Specifically, 50 μL of hydrogen peroxide (Wako Pure Chemical Industries, Ltd.) prepared in a 4 μM aqueous solution and 50 μL of a sample prepared in a protein concentration of 4.1 mg / mL were reacted at 37 ° C. for 10 minutes, and then adjusted to 86.24 nM. Horseradish peroxidase (Wako Pure Chemical Industries, Biochemical) 50 μL and scopoletin (Wako Pure Chemical Industries) prepared to 8 μM were added, and further reacted at 37 ° C. for 5 minutes, followed by fluorescence intensity (excitation wavelength 366 nm, emission wavelength) 460 nm) was measured.
For measurement of fluorescence intensity, Tecan's microplate reader, Infinity M200, was used. 20 mM Tris-HCl, 150 mM NaCl, 2 mM CaCl ₂ , pH 7.4 buffer was used for sample preparation, and 50 mM PBS, pH 7.4 was used for other reagent preparations. The results are shown in Table 15.

Examples of the preparation of the present invention include the following preparations. However, the present invention is not limited by these formulation examples.

Formulation Example 1 (Production of injection)
Human albumin was added as a stabilizer to the recombinant human paraoxonase 1 preparation obtained in Example 8, and the pH was adjusted to 7.5. After sterilization filtration, the vial was filled and freeze-dried to prepare an injection.
In the same manner as described above, a preparation containing the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 8 obtained in Example 19 or the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10 obtained in Example 20 Can be formulated as an injection.

A polypeptide which is an active ingredient of the present invention such as PON can be suitably used as a prophylactic or therapeutic agent for ulcerative colitis, which is an inflammatory bowel disease, and as an active ingredient for the prophylaxis or treatment of Crohn's disease.

Claims (12)

1. Effective with a polypeptide having at least 70% sequence identity with human paraoxonase and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity and active oxygen scavenging activity A preventive or therapeutic agent for inflammatory bowel disease comprising as a component.
2. The prophylactic or therapeutic agent for inflammatory bowel disease according to claim 1, wherein the polypeptide is the following polypeptide (a), (b) or (c).
   (a) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1, 6, 8 or 10
   (b) selected from the group consisting of an amino acid sequence in which one or more amino acids are deleted, added or substituted in SEQ ID NO: 1, 6, 8 or 10 and consisting of lactonase activity, paraoxonase activity and allylesterase activity A polypeptide having at least one activity
   (c) a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, added or substituted in SEQ ID NO: 1, 6, 8, or 10 and having active oxygen scavenging activity
3. The preventive or therapeutic agent for inflammatory bowel disease according to claim 1 or 2, wherein the polypeptide is a polypeptide having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity and allyl esterase activity.
4. 3. The prophylactic or therapeutic agent for inflammatory bowel disease according to claim 1 or 2, wherein the polypeptide is a polypeptide having active oxygen scavenging activity and having no lactonase activity, paraoxonase activity and allylesterase activity.
5. The preventive or therapeutic agent according to any one of claims 1 to 4, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease.
6. The preventive or therapeutic agent according to any one of claims 1 to 5, which is an injection.
7. An agent for preventing or treating ulcerative colitis containing paraoxonase as an active ingredient.
8. -A preventive or therapeutic agent for Crohn's disease containing paraoxonase as an active ingredient.
9. A polypeptide having at least 70% sequence identity with human paraoxonase and having at least one activity selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity and active oxygen scavenging activity A method for preventing or treating inflammatory bowel disease, comprising administering to an animal.
10. The method for prevention or treatment according to claim 9, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease.
11. Selected from the group consisting of lactonase activity, paraoxonase activity, allylesterase activity, and active oxygen scavenging activity, having 70% or more sequence identity with human paraoxonase for the prevention or treatment of inflammatory bowel disease A polypeptide having at least one activity.
12. The polypeptide according to claim 11, wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease.

Images