WO2011022809A1 - Fusarium and fusarium mycotoxin biocontrol - Google Patents
Fusarium and fusarium mycotoxin biocontrol Download PDFInfo
- Publication number
- WO2011022809A1 WO2011022809A1 PCT/CA2010/001253 CA2010001253W WO2011022809A1 WO 2011022809 A1 WO2011022809 A1 WO 2011022809A1 CA 2010001253 W CA2010001253 W CA 2010001253W WO 2011022809 A1 WO2011022809 A1 WO 2011022809A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mycoparasitica
- graminearum
- fusarium
- adon
- plants
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/50—Isolated enzymes; Isolated proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Definitions
- the present invention relates to novel biocontrol agents, related compositions with mycocidal effect and uses thereof.
- the present agent has a mycocidal effect on fungi of the genus Fusarium.
- the present invention further relates to the isolated fungal inoculant, genes, proteins and/or organisms as well as uses, methods, compositions, involving the same.
- Fusarium is a filamentous fungus widely distributed on plants and in the soil. Certain Fusarium species are plant pathogens. For example, Fusarium oxysporum, causes Fusarium wilt disease in more than a hundred species of plants. It does so by colonizing the plant xylem which can result in blockage and breakdown. When this occurs symptoms such as leaf wilting and yellowing appear in the plant eventually leading to the plant's death. This condition was the primary cause of the decline and disappearance of the Gros Michel banana cultivar from markets around the world. Recently a new strain has begun attacking plants of the dominant Cavendish cultivar leading to fears that, in the absence of a solution, this cultivar will too disappear from world markets.
- Fusarium root rot is a major cause of seedling mortality in forest nurseries and also causes reduced survival after outplanting during the first growing season.
- the disease is caused by several Fusarium species and is common in many parts of the world. The disease is a particular problem in Western Canada and the United States and also in the North Central and Southern States.
- Pine pitch canker - caused by the fungus Fusarium circinatum - is a serious disease of pine trees and a threat to the forest industry in particularly in the US and New Zealand. Radiata or Monterey pine is highly susceptible to the disease with mortality rates in mature trees reaching 80% in some areas of California.
- Fusarium Head Blight also known as 'ear blight' or 'scab'
- FHB Fusarium Head Blight
- Corn and maize can be affected by a similar condition known as 'ear rot'. The aforementioned condition can reduce the yield and grade of the crop, and can potentially contaminate the grain with mycotoxins. It is estimated that FHB costs the cereal industry almost $5 billion annually. In recent years, FHB has proved a significant and growing problem for the commercially important wheat and barley crops in Western Canada.
- Fusarium oxysporum and Fusarium avenaceum have been identified as the two species primarily associated with FHB in Canada wherein yields in some affected fields have been reduced by 30% or more.
- FHB and ear rot harvested grain is often contaminated with mycotoxins such as deoxinivalenol (DON) trichothecenes associated with feed refusal, general digestive disorders, diarrhea, hemorrhages.
- DON deoxinivalenol
- 3 -ADON toxigenic 3-acetyldeoxynivalenol
- graminearum under both laboratory and field conditions-represents an additional threat for corn, maize and wheat production worldwide.
- Fusarium spp. can opportunistically infect animals and can be the causative agents of superficial and/or systemic infections in humans. Fusaria are one of the most drug-resistant fungi making Fusaria infections difficult to treat and invasive infections can prove fatal.
- the present invention relates to a novel ascomyceteous fungus, Sphaerodes mycoparasitia identified as strain IDAC 301008-01 and alternatively as strain SMCD2220-01, that has a mycoparasitic and antimycotoxin effect.
- mycotoxic proteins have been isolated from S. mycoparasitia strain IDAC 301008-01. Uses, methods, compositions, sequences, and products are also disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS
- Figure 1 is a micrograph showing Sphaerodes mycoparasitica cultures after two weeks of incubation on (A) Modified Leonian's agar and (B) Potato dextrose agar-upper sides, (C) and (D) - down sides;
- Figure 2 is a micrograph showing Sphaerodes mycoparasitica ascospore germination, showing single-polar and double-polar germination patterns as well as hyphal anastomosis (arrow) formation pattern;
- Figure 3 is a micrograph showing Sphaerodes mycoparasitica: (A) Ascoma, (B) Hyaline seta arising from the neck (arrow), (C) Reticulate ascospores (arrows), (D) Smooth ascospore (arrow), (E) Triangular ascospore (arrow), (F) Phialides produced on ascoma surrounding hyphae, (G) Ampulliform phialide arising from the surface of ascoma peridial wall, (H) Formation of mature and starting ascomata, (I) Formation of hook-like structures by S.
- Figure 4 is a micrograph showing Sphaerodes mycoparasitica ascospores showing the conspicuous wall ornamentation and prominent irregular longitudinal ribs (arrows); (B) shows Sphaerodes quadrangular is ascospores. Bar scales 5 pm;
- Figure 5(a) is a micrograph showing inhibition of mycelial growth of (A) Fusarium oxysporum and (B) Fusarium graminearum by extracellular proteins recovered from a Sphaerodes mycoparasitica culture; 5(b) is a chart showing the percent inhibition of mycelial growth of A) Fusarium oxysporum and (B) Fusarium graminearum by S. mycoparasitica extracellular proteins;
- Figure 6 is a FPLC chromatogram showing the fl and f2 extracellular proteins recovered from a Sphaerodes mycoparasitica culture
- FIG. 7 is micrograph of SDS-PAGE gels of purified extracellular proteins recovered from a Sphaerodes mycoparasitica culture.
- Lane M contains marker proteins.
- Lane 1 contains the purified protein from peak fl .
- Lane 2 contains the purified protein from peak f2;
- Figure 8 are micrographs showing the inhibition of F. oxysporum spore germination (A- a-b) and F. graminearum spore germination (B- 1-b) by purified proteins fl and £2 compared to controls (A-c and B-c);
- Figure 9 is a chart showing the level of 3-ADON degradation by Sphaerodes mycoparasitica in potato-dextrose broth analysed by HPLC;
- Figure 10 is a schematic illustration of a system for growing wheat plants in a container (4 x 4 x 16 cm) with different layers of soil-less growing mixes;
- Figure 12 are charts showing standard linear curves for (A) Sphaerodes mycoparasitica (in the range of 3.8 x 10 2 to 3.8 x 10 '2 ng in ten-hold decreasing manner); (B) Fusarium graminearum 3-ADCIN (in the range of 2.7 x 10 3 to 2.7 x 10 " ' ng in ten-hold decreasing manner); (C) Trichoderma harzianum T-22 (in the range of 7.0 x 10 2 to 7.0 x 10 "2 ng in ten-hold increasing manner);
- Figure 13 is a chart showing RT-PCR sigmoidal coloured curves for Sphaerodes mycoparasitica (SMCD 2220-01), with 0.025 fluorescence line, in the ranges of 3.8 x 102 to 3.8 x 10-2 ng in a ten-hold decreasing manner;
- Figure 14 are charts showing quantities of genomic DNAs for (A) F. graminearum (Fgra); (b) S. mycoparasitica (SM); and (C) Trichoderma harzanium (T-22) monitored in spring wheat roots using genus-specific quantification real-time PCR. All values were means of 6 replicates. Error bars indicate SD;
- Figure 15 is a chart showing real-time fluorescence curves of tri5 gene sequences amplified by using Tox5- 1/2 primer set from total DNA extracted from dual-culture assays of Fusarium graminearum strains and pre-inoculated Sphaerodes mycoparasitica SMCD2220-01 (SNI) or singly grown F. graminearum 3-ADON and 15-ADON chemotypes;
- Figure 16 are micrographs of Sphaerodes mycoparasitica ascomata and ascospores: (A) formation of S. mycoparasitica ascomata on a colony of F. avenaceum (Arrows indicate that ascomata were produced near or surrounding the Fusarium culture); (B) production of numerous S. mycoparasitica ostiolated perithecia being produced on a F. oxysporum colony (Arrows indicate pericthecia were formed on the Fusarium isolate); (C) ungerminated dark-brownish reticulated S. mycoparasitica ascospore; (D) germinating ascospore of S. mycoparasitica in F.
- Figure 17 is a chart showing spore germination patterns of Sphaerodes mycoparasitica biotrophic mycoparasitic fungus with spores isolated from a F. oxysporum colony. Single ( ⁇ ) and two ( ⁇ ) polar germination in a F. avenaceum-f ⁇ trate suspension; and Single ( ⁇ ) and two (E) polar germination in a F. oxysporum-f ⁇ trate suspension.
- I Id suspension
- 2 Id suspension plus Id on PDA incubation
- 3 3d suspension
- 4 3d suspension plus Id on PDA incubation. Each incubation day for S.
- Id suspension spores suspended for Id in different suspension treatments
- Id sus+PDA spores suspended for Id in suspension treatment and then inoculated onto PDA medium for an additional day
- 3d suspension spores suspended for 3d in different suspension treatments
- 3d sus+PDA spores suspended for 3d in suspension treatment and then inoculated onto PDA medium for an additional day
- Figure 19 are charts showing linear mycelial growths of (A) Fusarium graminearum chemotype 3, and (B) Fusarium graminearum chemotype 15 in dual-culture assays challenged with Sphaerodes mycoparasitica in co-inoculation (same day) (""*"") and pre-inoculation (1 day prior to Fusarium inoculation) ( ⁇ • ⁇ » ⁇ ) treatments as well as control (without mycoparasite) ( ⁇ ) for 5 days;
- Figure 20 are micrographs of interactions between F. graminearum 3-ADON (Fgra3) and 15-ADON (Fgral5) chemotypes on slide culture assays with S. mycoparasitica (S) biotrophic mycoparasitic fungus: (A) Single mycelium of S. mycoparasitica, (B) F. graminearum mycelium with red complex, (C) Absorption of red complex from F. graminearum by S. mycoparasitica (arrow), (D) Excretion of red complex in crystal-forms (arrows) by S. mycoparasitica from mycelium interacting with F. graminearum chemotype 3 only, (E) Formation of series of hook- like structures by S.
- Figure 22 are charts of the standard curves of Fusarium graminearum chemotype 3 and 15 genomic DNA concentration standards versus cycle threshold (Ct) with PCR reactions performed in triplicate using primer sets;
- FIG 23 is a schematic illustration of the experimental set-up for dual-culture assays used to acquire F. graminearum chemotype 3-ADON or 15-ADON mycelial plugs for DNAs extraction.
- the sampling zone (S-zone) indicates the 0.5 x 1.5 cm 2 sample area situated approximately 0.2 cm behind the interaction zone (I-zone).
- the I-zone represents the interaction or contact zone between F. graminearum (Fgra) and S. mycoparasitica (SM);
- Figure 24 is a chart showing real-time fluorescence curves of F. graminearum sequences amplified using Fgl6NF/R primer set from total DNA extracted from dual-culture assays of F. graminearum strains and pre-inoculated Sphaerodes mycoparasitica (SM), or singly grown F. graminearum cultures of chemotype 3 and 15;
- SM Sphaerodes mycoparasitica
- Figure 25 is a chart showing comparisons between different concentrations of DNA from F. graminearum chemotype 3 and 15 amplified with Tox5-l/2 (tri5 gene specific) and Fgl6NF/R (F. graminearum-speci ⁇ c) primer sets.
- Fungal DNAs were extracted from 5 d dual-culture assays pre-inoculated with S. mycoparasitica for 1 d. With T-test at P - 0.05, for the comparison between S. mycoparasitica treated and non-treated F. graminearum chemotype 3 and 15 for Tox5-l/2 and Fgl6NF/R primer sets, respectively. (Log 10 transformed for DNA amplified with Tox5-l/2 primers);
- FIG 27 are charts showing gene expression of different Tri genes for F. graminearum chemotype 3 (3-ADON producer) and F. graminearum chemotype 15 (15-ADON producer) in in vitro assays with three separate treatments: (A) T ⁇ 4 gene; (B) Tri5 gene; (C) Tri6 gene; and (D) Tri 10 gene.
- B3 S. mycoparasitica + 3-ADON producing F. graminearum
- F3 Folicur + 3-ADON producing F. graminearum
- T3 T. harzianum + 3-ADON producing F. graminearum
- Bl 5 S. mycoparasitica + 15-ADON producing F.
- Figure 28 are charts showing gene expression of PKS genes for F. graminearum chemotype 3 (3-ADON producer) and F. graminearum chemotype 15 (15-ADON producer) in in vitro assays with three separate treatments: (A) PKS4 and (B) PKSB.
- B3 S. mycoparasitica + 3-ADON producing F. graminearum
- F3 Folicur + 3-ADON producing F. graminearum
- T3 T. harzianum + 3-ADON producing F. graminearum
- Bl 5 S. mycoparasitica + 15-ADON producing F. graminearum
- Fl 5 Folicur + 15-ADON producing F.
- Tl 5 T. harzianum + 15-ADON producing F. graminearum.
- Figure 29 is a micrograph of thin liquid chromatography (TLC) analysis for zearalenone (ZEA) extracted from six separate treatments.
- B3 S. mycoparasitica + 3-ADON producing F. graminearum
- F3 Folicur + 3-ADON producing F. graminearum
- T3 T. harzianum + 3 -ADON producing F. graminearum
- Fl 5 Folicur + 15-ADON producing F. graminearum
- Tl 5 T. harzianum + 15-ADON producing F. graminearum
- Bl 5 S. mycoparasitica + 15-ADON producing F. graminearum
- ZEA Standard of zearalenone;
- Figure 30 is a chart showing the ratio of F. graminearum chemotype challenged with Folicur fungicide to F. graminearum alone control produced for all four different mycotoxins - ZEA, DON, 3 ADON and 15 ADON. Legends indicate F. graminearum 3-ADON chemotype with Folicur ( ⁇ ) and F. graminearum 15-ADON chemotype with Folicur (D);
- Figure 31 is a chart showing relative AUR gene expression in Fusarium strains after co- culturing with biological and chemical agents.
- Figure 32 is a chart showing changes in AUR gene expression evidenced by the color of fungal hyphae.
- Ds #71232B Red and highly virulent, tolerant at 80 0 C for 4 hours
- Es #4E040B Moderately red and moderately virulent, tolerant 40 0 C for 4 hours
- Bs #A86608 White and non virulent, susceptible 40 0 C for 4 hours;
- Figure 33 are charts showing the effects of inoculating a Fr ⁇ wr ⁇ -susceptible barley cultivar with F. graminearum, S. mycoparasitica, and treating F. graminearum-infected barley with different concentrations of S. mycoparasitica on: (A) height of the plants; (b) average number of spikes per plant; and (C) the average weight of 5 spikes;
- Figure 34 are charts showing the effects of inoculating a Fusarium-susceptible wheat cultivar with F. graminearum, S. mycoparasitica, and treating F. gr amine arum-infected wheat with different concentrations of S. mycoparasitica on: (A) height of the plants; (B) average number of spikes per plant; and (C) the average weight of 5 spikes;
- Figure 35 is a chart comparing the biocontrol effects of S. mycoparasitica on the severity of Fusarium head blight symptoms with the protection provided by a commercial fungicide
- Figure 37 is a chart showing the effects of S. mycoparasitica (B) and Folicur fungicide (FoI) treatments on F. graminearum chemotype 3 -ADON genomic DNA detected in barley spikes employing RT-PCR. Treatments were: Fus - F. graminearum; B-Fus - S. mycoparasitica with F. graminearum; Fol-Fus - Folicur fungicide with F. graminearum;
- Figures 4OA and 4OB are micrographs of intracellular parasitism by Sphaerodes inside F. equiseti (arrows), and 4OC and 4OD are micrographs of intracellular hyphae produced by Sphaerodes inside F. equiseti with hook-shaped contact structure (arrows).
- 4OA and 4OB were captured under light microscopy; whereas in 4OC and 4OD hyphae were stained with lactofuchsin and images were captured under fluorescent and confocal laser microscopy, respectively.
- Scale bars 5 ⁇ m; and
- Figure 41 is a chart showing average hyphal diameters of parasitized and non-parasitized F. equiseti cells ( ⁇ ) and F.
- Sphaerodes mycoparasitica (Ascomycetes, Melanosporales), has been isolated from isolates of Fusarium avenaceum, Fusarium graminearum and Fusarium oxysporum originating from wheat or asparagus fields.
- the species is characterized by a unique combination of ascospore size, shape (fusiform and triangular) and wall ornamentation (reticulate and smooth).
- conidia are produced from simple phialides on the surface of ascoma peridial wall, on ascoma surrounding hyphae, and on irregularly branched conidiophores arising from hyphae. S.
- mycoparasitica has a phialidic anamorph and produces simple phialides on the surface of ascoma peridial wall or scattered irregularly on ascoma surrounding the hyphae, and on conidiosphores. S. mycoparasitica forms hook-like structures parasitizing living hyphae of Fusarium.
- the 1266bp DNA sequence from the large subunit ribosomal RNA gene (LSU) of S. mycoparasitica is given in SEQ ID NO: 1.
- SSU small subunit ribosomal RNA gene
- Sphaerodes mycoparasitica may be useful as an anti-fungal agent.
- S. mycoparasitica may be used to treat, ameliorate, or otherwise control infections of Fusarium fungi.
- S. mycoparasitica seems particularly useful for treating, ameliorating or otherwise control infections of Fusarium avenaceum, Fusarium graminearum, and/or Fusarium oxysporum and improving plant health or growth.
- S. mycoparasitica may be used as a prophylactic agent to diminish the chance of a fungal infection, particularly a Fusarium infection, from occurring.
- S. mycoparasitica may be used for treating plants affected by Fusarium Wilt Disease or Fusarium Head Blight. S. mycoparasitica may be used for hindering such conditions from spreading or as a prophylactic measure to diminish the risk of such conditions from occurring.
- S. mycoparasitica may be isolated from suitable sources.
- S. mycoparasitica may be isolated from F. graminearum or F. avenaceum isolates originating from wheat fields by the method described in Vujanovic V, et. al. Can. J. Microbiol. 48(9): 841-847 (2002).
- S. mycoparasitica is also available deposited with International Depositary Authority of Canada (IDAC301008-01).
- S. mycoparasitica may be used to treat, ameliorate, or otherwise control infections of Fusarium fungi.
- S. mycoparasitica may be applied in any suitable manner to the organism in need of treatment.
- S. mycoparasitica isolates may be used directly or they may be further processed into soil-applied granular-based, peat-based, seed-applied, or anthesis-applied liquid-based inoculants.
- S. mycoparasitica may be produced via fermentation and formulated into a pesticide composition.
- a suitable fermentation process includes, selection of fermentation medium (solid state or submerged), concentration of fermentation constituents, oxygen transfer, incubation temperature, time of harvest and post harvest treatments. The aim is to establish the optimum conditions to ensure an abundant, stable, and efficacious mycoparasitic, microbial population.
- S. mycoparasitica When formulating S. mycoparasitica into a pesticide composition, care should be taken to selected ingredients that: (i) ensure stability during production, processing and storage, (ii) assist application, (iii) protect the pesticide from unfavourable environmental conditions, and (iv) promote pesticidal activity at the target. Exposure to inactivated host/pathogen or its compounds may improve the activity of S. mycoparasitica.
- the formulations disclosed herein will usually comprise (i) an active ingredient, (ii) carriers - often an inert material used to support and deliver the densely populated active ingredient to the target, and optionally (iii) adjuvants - compounds that: promote and sustain the function of the active ingredient by protection from UV radiation, that ensure rain fastness on the target, and that retain moisture or protect against desiccation, or promote the spread and dispersal of the biopesticide using standard agriculture equipments such as those disclosed by Hynes and Boyetchko (2006, Soil Biology & Biochemistry 38: 845-84).
- the present invention provides a primer set, SmyITSF/R (SmylTSF is SEQ ID NO: 4 and SmyITSR is SEQ ID NO: 5), useful for identifying S. mycoparasitica.:
- the present primer is selective for S. mycoparasitica and can be used to assess and quantify the fungus in industrial products, plant materials, seed samples, and environmental samples by using PCR and RT-PCR technologies.
- the SmyITSF/R primer set can be used for quantitative real-time PCR technology for analyzing gene expression, in fungal pathogens detection, and in quantification of fungi in living plants.
- the SmyITSF/R primer set was tested with SMCD2220-01, seven Fusarium species, nine different ascomycetous fungal isolates, two zygomycete fungi, and three basidiomycetous fungal strains.
- this primer set only amplified SMCD2220-01, not the other fungi. Root biomass, total biomass, root length, total length, and seed germination of F. graminearum infected spring wheat were significantly increased with the treatments of S. mycoparasitica, as compared to inoculation with F. graminearum.
- SmyITSF/R specific primer was used for S. mycoparasitica in combination with F. graminearum-Fgl2NF/R and Trichoderma-TGP4-F/R as a control, within which the primer showed high accuracy in assessing biocontrol-pathogen-plant interactions.
- the present invention provides an antifungal agent comprising extracellular protein extracts from S. mycoparasitica. Two proteins were isolated from the total protein extract, one having a molecular weight of 13 kDa and one having a molecular weight of 50 kDa. The present invention provides an antifungal agent comprising one or both of these proteins. Conventional molecular biological techniques may be used to isolate, characterize and produce the present proteins. For example, in order to identify the gene(s) for the present proteins, S. mycoparasitica could be challenged with F. oxysporum filtrates and upregulated mRNA isolated by standard Northern Blot. cDNA can be produced from the mRNA by Reverse Transcriptase PCR (RT-PCR). The cDNA can be amplified, purified and inserted into an appropriate vector. This vector may be inserted into an appropriate host cell.
- RT-PCR Reverse Transcriptase PCR
- Cloning and expression may focus on isolation of genes coding for antimicrobial proteins by designing primers for identified proteins. Isolated genes may be cloned in suitable expression vectors (yeast or bacteria) with suitable/efficient promoters in order to generate industrial strains for large-scale production of the concerned proteins. These vectors can be purchased from Promega, Invitrogen, Clontech, or other companies. The cloned genes may be tested for their protein expression, and the expressed proteins will be purified (using His-tag or other columns).
- Purified proteins may be tested against plant-pathogenic fungi for their antifungal activity by disc-plate assay and/or microtitre plate assay methods (e.g., Drummond and Waigh, 2000, Recent Research Developments in Phytochemistry.4:143-152). Then, rDNA technologies, involving gene mutation or addition of enhancers, introns or protein-specific promoters (GA inducible), or addition deletion may be used to enhance the production of proteins.
- disc-plate assay and/or microtitre plate assay methods e.g., Drummond and Waigh, 2000, Recent Research Developments in Phytochemistry.4:143-152).
- rDNA technologies involving gene mutation or addition of enhancers, introns or protein-specific promoters (GA inducible), or addition deletion may be used to enhance the production of proteins.
- Selected genes may be transformed into wheat and barley to create a transgenic lines with antifungal activity against pathogenic fungi using techniques known to those skilled in these arts (e.g., Sanghyun et.al., 200,8 J. Expt. Botany, 59, 2371-2378; Dennis et. al., 2007. Plant Cell Reports. 26: 631-639).
- S. mycoparasitica has demonstrated an ability to degrade the deoxynivalenol (DON) mycotoxin.
- the present invention provides a method of degrading acetyldeoxynivalenol, especially 3-acetyldeoxynivalenol.
- S. mycoparasitica could be challenged with pure DON and upregulated mRNA isolated by standard Northern Blot. Reverse Transcriptase PCR could be used to identify the gene(s) for the upregulated proteins, an appropriate cDNA construct could then be inserted into an appropriate vector for protein production. Further, recombinant DNA Technology could be applied to create transgenetic plants with antimycotoxin properties.
- the present invention provides antifungal compositions comprising S. mycoparasitica, isolates, cultures, or proteins thereof.
- the present invention also provides a method of controlling a fungal disease of a plant, and a method for mycotoxin detoxification, which methods comprise applying to the locus of the plant S. mycoparasitica, isolates, cultures, or proteins thereof, collectively hereinafter referred to as the 'antifungal agent'.
- compositions of the invention may, for example, be applied to the seeds of the plants, to the growth medium (e.g. soil or water), or to the foliage of the plants.
- the growth medium e.g. soil or water
- the present invention provides a composition comprising the antifungal agent and an agriculturally acceptable carrier or diluent, which will ensure stability and performance of the final product.
- Carrier or diluent should compatible with the active ingredient, agriculturally acceptable, have a good absorptive capacity and a suitable bulk density, allowing easy particle dispersion and attachment.
- compositions herein may be applied, as in aqueous sprays, granules and dust formulations in accordance with established practice in the art.
- An aqueous spray is usually prepared by mixing a wettable powder or emulsifiable concentrate formulation of a compound of the invention with a relatively large amount of water to form a dispersion.
- Wettable powders may comprise a finely divided mixture of the antifungal agent, a solid carrier, and a surface-active agent.
- the solid carrier is usually chosen from among attapulgite clays, kaolin clays, montmorillonite clays, diatomaceous earths, finely divided silica, purified silicates, or combinations thereof.
- Surfactants which may be useful herein have wetting, penetrating, and/or dispersing ability. They are typically present in an amount of from about 0.5% to about 10% by weight.
- Surfactants herein may be chosen from, for example, alkylbenzenesulfonates, alkyl sulfates, naphthalenesulfonates and condensed naphthalenesulfonates, sulfonated lignins, and non-ionic surfactants.
- Emulsifiable concentrates may comprise the antifungal agent of the invention in a liquid carrier, the carrier being a mixture of a water-immiscible solvent and a surfactant.
- Solvents that may be useful herein include aromatic hydrocarbon solvents such as the xylenes, alkylnaphthalenes, petroleum distillates, terpene solvents, ether-alcohols, organic ester solvents or suitable combinations thereof.
- compositions of the invention When a composition of the invention is to be applied to plant debris or litter, in order to control of the source of contamination and inoculant dispersion, or to the soil, as for pre-emergence protection, granular formulations or dusts are sometimes more convenient than sprays.
- the antifungal agents herein are encapsulated into alginate pellets.
- the pellets may be prepared in any suitable manner. For example, one useful method is described in Harveson et. al., (2002, Plant Disease; Vol. 86, No. 9 1025-1030).
- compositions herein may comprise other active substances useful in an antifungal agent.
- the compositions herein may comprise other antifungal agents such as Trichoderma, sulfur, neem oil, rosemary oil, jojoba oil, Bacillus subtilis, allylamines (e.g. terbinafine, antimetabolites (e.g. flucytosine), azoles (e.g. ketoconazole, itraconazole), echinocandins (e.g. caspofungin), polyenes (e.g. amphotericin B), systemic agents (e.g. griseofluvin), or combinations thereof.
- antifungal agents such as Trichoderma, sulfur, neem oil, rosemary oil, jojoba oil, Bacillus subtilis, allylamines (e.g. terbinafine, antimetabolites (e.g. flucytosine), azoles (e.g. ketoconazole, itraconazole), echinocandins (e.
- compositions herein may contain from about 0.1% to about 95%, by weight, of the antifungal agent and from about 0.1% to about 95%, by weight, of the carrier and/or surfactant.
- the direct application to plant seeds prior to planting may be accomplished in some instances by mixing either a powdered solid compound of the invention or a dust formulation with seed to obtain a substantially uniform coating which is very thin and represents only one or two percent by weight or less, based on the weight of the seed.
- a non-phytotoxic solvent such as methanol is conveniently employed as a carrier to facilitate the uniform distribution of the compound of the invention on the surface of the seed.
- compositions herein may be useful in the treatment of fungal infections in plants. Consequently, the compositions herein may comprise S. mycoparasitica, isolates, cultures, or proteins thereof and a pharmaceutically acceptable carrier.
- Significant improvement in percentage of spore germinations were obtained for the spores suspended in Fus ⁇ rium-f ⁇ trates.
- Trichoderm ⁇ h ⁇ rzi ⁇ num (RootShield ® available from BioWorks Inc., Victor, NY, USA; RootShield is a registered trademark of BioWorks Inc.), Penicillium bil ⁇ ii (JumpStart ® available from Novozymes Biologicals Ltd., Saskatoon, SK, CA; JumpStart is a registered trademark of Philom Bios Inc.), and Ch ⁇ etomium globosum had no impact on germination. Ascospores suspended in F. ⁇ ven ⁇ ceum-f ⁇ tratQ, showed double-polar germination pattern. On the other hand, when suspended in F.
- the present invention provides a method of sporulating S. mycop ⁇ r ⁇ sitic ⁇ by exposing them to F. ⁇ ven ⁇ ceum or F. oxysporum, or filtrates, extracts, or compositions thereof.
- the present invention provides a method for producing an antifungal composition comprising S. mycop ⁇ r ⁇ sitic ⁇ or isolates, cultures, genes or proteins thereof.
- the method comprises:
- the method may further comprise any of the following optional steps:
- Myclobutanil-agar (MBA) medium was used for selective isolation of various Fusarium taxa and associated biotrophic mycoparasites from Canadian agriculture fields using the method described in Vujanovic V, et. al. (2002, Can. J. Microbiol. 48(9): 841-847). Sphaerodes was recovered occasionally from F. graminearum and abundantly from F. avenaceum isolates originating from wheat fields in Saskatchewan; it was also isolated from Fusarium oxysporum from asparagus fields in Quebec, Canada. A monosporal, single culture of the mycoparasite was obtained from each Fusarium species according to the method proposed by Harveson & Kimbrough (2001, Int. J Plant Sci. 162(2) :403 -410).
- Biotrophic interactions between Sphaerodes and Fusarium strains were examined with the slide culture method proposed by Jordan & Barnett (1978, Mycologia 70(2):300-312). Morphological studies of ascomata, ascospores, mycelia, and anamorphic structures were performed after two weeks of incubation (21° C - 22° C) under a Carl Zeiss Axioskop2 with a Carl Zeiss AxioCam ICcI camera. Fungal materials for microscopic observation were mounted in lactofuchsin and lactophenol cotton blue dyes. DNA extraction, amplification and sequencing
- SMCD 2220-01 on F. avenaceum from wheat SMCD 2220-02 on F. graminearum from wheat
- SMCD 2220-03 on F. oxysporum from asparagus were cultured on PDA medium at 21 0 C for a week prior to DNA extraction.
- Genomic DNA was extracted with the DNeasy ® Plant Mini Kit (Qiagen Inc., Mississauga, ON, CA; DNEasy is a registered trademark of Qiagen GmbH Corp, Hilden, Fed. Rep. Germany).
- LSU large subunit rDNA fragments were amplified using primer sets NS1/NS6 using techniques known to those skilled in these arts (e.g., Gardes & Bruns, 1993, Molecular Ecology 2: 113-118; White et ah 1990, PCR Protocols: a guide to methods and application: 315-322. Academic Press, New York) and LS1/LR5 (e.g., Hausner et al. 1993, Canadian Journal of Botany 71 : 52-63; Rehner & Samuels, 1995, Canadian Journal of Botany 73 (Suppl. 1): S816-S823; Zhang & Blackwell, 2002, Mycological Research 106: 148-155).
- LS1/LR5 e.g., Hausner et al. 1993, Canadian Journal of Botany 71 : 52-63; Rehner & Samuels, 1995, Canadian Journal of Botany 73 (Suppl. 1): S816-S823; Zhang & Blackwell, 2002, My
- Target regions of fungal genomic DNA samples were amplified using polymerase chain reaction (PCR) in a 25 ⁇ l reaction mixture containing 2.5 ⁇ l of 1 OX buffer, 5 ⁇ l of Q buffer, 0.5 ⁇ l 1OmM dNTPs, l ⁇ l of each primer, 0.13 ⁇ l of 0.625 unit of Taq DNA Polymerase, 2 ⁇ l of extracted fungal DNA, and 12.87 ⁇ l of sterilized ultra-pure Millipore water.
- the Qiagen Taq PCR core kits were purchased from Qiagen Inc., Mississauga, ON, CA. Purified DNA PCR products were sequenced.
- Taxonomy Sphaerodes mycoparasitica Vujanovic, sp. nov. ( Figures 1-5) [MycoBank no: MB 515144], in the International Depositary Authority of Canada as Sphaerodes mycoparasitica strain IDAC 301008-01. Coloniae in agaro potato dextrosum lentior crescents, 4.0 cm ad 7d, floccose, pallido-brunneis. Hyphis septatis, ramosis, anastomosantibus, laevibus, palide fulvis, 2.5-5.0 ⁇ m diam compositum.
- Peridium membranaceous 3-6-layered, 8-10 ⁇ m thick, translucent, pale yellow to light brown, composed by cells of 8-15 ⁇ m diam. disposed in textura angularis.. Asci 8-spored, clavate, 50-75 X 17-25 ⁇ m, rounded at apex, without apical structures, thin-walled and evanescent when mature. Paraphyses absent.
- S 1 . mycoparasitica strain IDAC 301008-01 has a unique combination of features shown in Figure 3.
- the ascomata height is generally less than 250 ⁇ m with a conical to cylindrical neck (Figure 3A).
- the setae length is generally less than 40 ⁇ m ( Figure 3B) and the spore length is generally less than 23 ⁇ m ( Figure 3C).
- the spores show a conspicuous wall ornamentation and prominent irregular longitudinal ribs indicated by the arrows in Figure 4A.
- the spores of Sphaerodes quadrangular is shown in Figure 4B for comparison.
- S. mycoparasitica strain IDAC 301008-01 spores occaisonally show a triangular shape ( Figures 3D and 3E).
- S. mycoparasitica strain IDAC 301008-01 forms hook-like structures for parasitizing living hyphae of Fusarium ( Figures 31 and 3J).
- Sphaerodes mycoparasitica (SMCD 2220-01) 21 0 C isolates were cultured in potato dextrose broth (PDB) culture media. About 3 ml of culture were transferred to 250 ml Ehrlenmeyer flasks containing 50 ml PDB growth medium. The flasks were incubated for 7 days on a rotary shaker (150 rpm) at room temperature.
- PDB potato dextrose broth
- Disc diffusion assay Antifungal activities of extracellular protein extracts were tested under sterile conditions by radial disc plate diffusion assay as described by Roberts & Selitrennikoff (1986, Biochim. Biophys. Acta, 880: 161-170). The assay of the isolated protein for antifungal activity toward F. oxysporum and F. graminearum was carried out in petri plates containing potato dextrose agar. Mycelial plugs from actively growing fungal plates were placed in the center of the petri plates and sterile filter paper discs (5-mm diameter of Whatman ® filter paper no. 1) were placed on the agar surface at a distance of 0.5 cm away from the rim of the mycelial colony.
- FPLC Fast protein liquid chromatography
- Proteins were fractionated through Superdex 75 GL 10/30 column using FPLC AKTA ® purifier system (GE Healthcare, Biosciences AB, CA: AKTA is a registered trademark of GE Healthcare Bio-Sciences AB Ltd., Uppsala, Sweden) according to the manufacturer's instructions.
- the column was previously equilibrated with sterile water and with 50 niM sodium phosphate buffer, pH 7.0 containing 0.15 M NaCl, followed by protein injection (about 500 ⁇ L) and elution of proteins with the same buffer with flow rate of 1.0 ml/min. Fractions of 0.8 ml were collected in each tube.
- SDS-PAGE SDS-PAGE (12%) of proteins recovered from FPLC fractions was performed according to the method of Laertunli (1970, Nature 227: 680-685). All peaks giving FPLC fractions were pooled and recovered by precipitation in 1 :4 volume of chilled acetone and kept at -20 0 C overnight. After centrifugation at 12,000 g for 10 min, precipitated proteins (pellets) were dissolved in minimum amount (30 ⁇ L) of assay buffer. Proteins were analyzed by SDS-PAGE having 5% stacking gel (pH 6.8) and
- Microtitre plate assay Percentage inhibition of spore germination was performed by microtitre plate assay method (Ghosh, 2006, Ann. Bot. 98: 1145-1153; Yadav et al. 2007, J. Med. Microbiol. 56: 637-644) to test the antifungal activity of proteins recovered from FPLC fractions. The possible toxicity of the fractionated proteins was tested by a percentage growth inhibition assay using the F. oxysporum and F. graminearum. The in vitro antifungal activities of fractionated proteins were determined in 96- well microtiter plates.
- microplate wells 10 ⁇ l of potato dextrose broth (PDB; BD Biosciences, Mississauga, ON, CA) was mixed with 3 ⁇ l of spore suspensions of F. oxysporum and F. graminearum. An aliquot of 7 ⁇ L of different peak containing proteins fractions were added to suspensions in microtitre plates (12-8 wells). Water 25 and buffer were used as negative controls. The microtitre plate was then incubated at room temperature in dark. Observations were made for inhibition in spore germination in both untreated and treated wells after 24 h using inverted and fluorescent microscope.
- PDB potato dextrose broth
- the number of germinated and non-germinated spores and percentage of area covered by mycelia in microscope were used to determine the percentage of growth inhibition.
- the fl and f2 protein-containing peaks had inhibitory effects on spore germination after 24 hrs compared to the control treatment.
- SMCD 2220-01 Active growing mycelia of S. mycoparasitica
- PDA Potato 10 Dextrose Broth
- Wet mycelium 0.1 g were resuspended in 1 ml of PDA medium supplemented 100 ⁇ g/mL 3-ADON (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) and incubated for 10 days.
- a 0.2cm 2 plug S. mycoparasitica was incubated in ImI PDB containing 3-ADON at a 15 concentration of 100 ⁇ g at RT for 7 days. The sample was analysed for DON degradation by TLC and HPLC assays.
- 3-ADON was extracted by the method disclosed by Vasavada and Hsieh (1987, Appl. Micro. Biotechnol. 26: 517-521).
- the spent medium in sampled flasks was filtered through the Whatman ® filter paper avoiding the mycelia.
- 3-ADON was extracted from the medium by three 10 ml volumes of ethyl acetate.
- the mixture of the medium and solvent was vigorously shaken and allowed to stand for 5 min for separation of phases.
- the organic phase was siphoned off and passed through sodium sulfate to remove residual water.
- the solvent was allowed to evaporate at room temperature. The residue was redissolved in acetonitrile for analysis.
- TLC Thin layer chromatography
- a Water's HPLC with : 250 x 4.60 mm id Prodigy 5 ⁇ ODS (3) 10OA, 5 ⁇ micron Ci 8 column (Phenomenex Inc., Torrance, CA USA) and a photodiode-array (PDA) detector was used with a gradient solvent system (water-acetonitrile containing 0.005% (v/v) trifluoracetic acid). The PDA detector measured the UV spectrum (200-600 nm). Samples were dissolved in acetonitrile and 20 ⁇ l was loaded onto the column using an automatic injector.
- the DON was eluted with solvent as a mobile phase at a rate of 1 ml min '1 3-ADON obtained from Sigma- Aldrich (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) was used as a standard. The results are shown in Figure 9. The sample with S. mycoparasitica contained a much reduced level of 3-ADON.
- Potato dextrose agar PDA
- Potato dextrose broth PB
- Yeast extract MAA
- Malt extract agar MEA
- Agar Agar
- Peptone purchased from BD Biosciences (Mississauga, ON, CA) .
- Streptomycin sulphate, Neomycin sulphate, and other reagents of analytic grade were from Sigma-Aldrich Canada Ltd. (Oakville, ON, CA) .
- mycoparasitica mycoparasitic fungal isolate was separated from their F. oxysporum host, and monosporium cultures were achieved according to methods described by Harveson RM, Kimbrough JW, (2001, Int. J. Plant Sci. 162: 403-410) with few modifications. Mature perithecia were picked up, suspended, and shaked in 2-ml sterilized water blanks. The spores-suspension was then spread on PDA plates. After few minutes, with the assistance of a Carl Zeiss Stemi 1000 dissecting microscope, individual spores were removed and transferred to PDA supplemented with 100 ml/1 of Fusarium filtrate. All fungal isolates were maintained in the culture collection of the Saskatchewan Microbial Collection and Database, Canada (SMCD).
- SMCD Saskatchewan Microbial Collection and Database, Canada
- MLA Modified Leonian's Agar
- Sphaerodes mycoparasitica strain SMCD 2220-01 was found to sporulate on or when inoculated together with Fusarium species, such as F. avenaceum and F. oxysporum. S. mycoparasitica was observed to produce approximately the same amount of ascomata on both F. oxysporum and F. avenaceum. S. mycoparasitica was not found to produce fruiting bodies on other Fusarium or fungal strains such as F. proliferatum, F. sporotrichioides, P. bilaai, T. harzianum, and C. globosum. In the contact zone between these biotrophic mycoparasites and Fusarium species, hook-shaped contact structures were formed. Effects of heat and cold treatments on Sphaerodes spore germination
- Aqueous ascospore suspensions were heat-shocked at 6O 0 C and 65 °C for 20 min, and cold-treated at 4°C, -2O 0 C, and -70 0 C for 5 min and 20 min.
- the heat- and cold-shocked spores were then transferred and inoculated onto WA and PDA for 1 day and 3 days. The readings of spore germination were checked daily. Spores not subjected to heat and cold treatments were used as control.
- Aqueous spore suspensions were transferred and inoculated onto the surface of the following media:
- Fusarium strains utilized were F. avenaceum, F. oxysporum, F. proliferatum, and F. sporotrichioides. Ascospore-inoculated plates were then incubated at room temperature (23 0 C) for 3 days. Spore germination was examined daily.
- aqueous spore suspensions were suspended in the filtrates of four separate pathogenic Fusarium and three beneficial fungal strains for 1 day and 3 day in the ratio of 1 :2 (1 part of aqueous spore suspension: 2 parts of fungal filtrate), and the filtrate-suspended spores were then transferred and inoculated onto PDA for additional 1 day. Control treatments were suspended with sterilized distilled water or PDB.
- Germinated ascospores were counted and recorded as a percentage of the total ascospore number. The results are summarized in Table 2. Numbers in each column represented mean of ascospore germination (in %) ⁇ standard deviation. Each incubation day for Sphaerodes was analyzed separately. Means within each column of Sphaerodes for each filtrate-suspension treatment followed by the same letter are not significantly different at P ⁇ 0.05 after Mann- Whitney U test.
- Fusa ⁇ um strains F. graminearum 3-ADON strain SMCD2243, biotrophic mycoparasite Sphaerodes mycoparasitica SMCD2220-01, and Trichoderma harzianum T-22 (RootShield-'cornmercial product) as a control strain with mycoparasitic properties were maintained on PDA amended with antibiotics. Taxon specific primers
- Mycelial suspension was filtered through 2 layers of cheesecloth to remove the glassbeads and bigger mycelial clumps. The flow-through was then used as mycelial suspension stock (10°) for serial dilution. S-tock of mycelial suspension was further diluted into a series spanning from 10- 2 , 10- 3 , and 10- 4 . This dilution series were plated on PDA using the pour plate method. The number of CFU (colony forming units) was counted and recorded. Mycelial suspensions were adjusted with sterile water to about 10 '5 - 10 "6 CFU/mL for S. mycoparasitica and T. harzianum, and to about 10 "4 - 10 "5 CFU/mL for F. graminearum.
- This layer 20 was then overlayed with a second layer 30 (Ig) of either Pro- Mix" mix amended and homogenized with ⁇ 5 to 6 x 10 4 CFU of F. graminearum mycelial suspension or alternatively with Pro-Mix ® mixwith water only.
- the second layer 30 was followed by a third layer 40 (Ig) of either Sunshine ® peat moss (Sunshine is a registered trademark of Sun Gro Horticulture Canada Ltd., Seba Beach, AB, CA) supplemented and homogenized with ⁇ 5 to 6 x 10 5 CFU of S. mycoparasite or alternatively with T. harzianum mycelial suspension or alternatively with water only.
- Root biomass, total biomass, root length, total length, and seed germination of F. graminearum infected spring wheat were significantly increased with the treatments of S. mycoparasitica compared to inoculation with F. graminearum alone (Table 3).
- Table 3 Effects of SMCD2220-01 (SM) and F. graminearum 3-ADON (Fgra) inoculation treatments on root biomass (g), total biomass (g), root length (cm), total length (cm) and seed germination (%) of spring wheat plants
- the mycoparasite S. mycoparasitica demonstrates both biomass stimulation and bioprotection or biocontrol.
- the SmyITSF/R primer set was tested with S. mycoparasitica, seven Fusarium species, night different ascomycetous fungal isolates two zygomycete fungi, and three basidiomycetous fungal strains. This primer set only amplified S. mycoparasitica.
- SM S. mycoparasitica
- Fa F. avenaceum
- Fo F. oxysporum
- Fs F. sporotrichio
- Figure 13 shows RT-PCR sigmoidal coloured curves for Sphaerodes mycoparasitica (SMCD 2220-01), with 0.025 fluorescence line, showing the range of 3.8 x 102 to 3.8 x 10-2 ng in a ten-hold decreasing manner.
- Potato dextrose agar (PDA), potato dextrose broth (PDB), yeast extract, malt extract agar (MEA), agar, and peptone were purchased from Difco (Becton Dickinson Diagnostics, Sparks, Maryland). Streptomycin sulphate, Neomycin sulphate, and other reagents of analytic grade were from Sigma-Aldrich (Oakville, ON, CA) .
- Fungal strains and growth conditions Four phytopathogenic Fusarium strains (F. avenaceum SMCD 2241, F. oxysporum SMCD 2242, F. proliferatum (Matsush.) Nirenberg SMCD 2244, and F. sporotrichioides Sherb SMCD 2243), three beneficial fungal inoculants: T. harzianum (RootShield ® ), P. bilaii ([JumpStart ® ), and Chaetomium globosum Kunze; and one mycoparasitic fungal strain, S.
- mycoparasitica were maintained on PDA amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate) and used throughout this study.
- An isolate of the mycoparasitic fungus, S. mycoparasitica was separated from its F. oxysporum host on myclobutanil agar (MBA) selective medium as previously described and a monosporic culture was achieved by picking up mature perithecia which were then suspended and shaken in 2-mL sterile distilled water blanks to encourage release of ascospores. The ascospore-suspension was then spread on PDA plates.
- Aqueous spore suspensions (10 ⁇ L) of S. mycoparasitica were transferred and inoculated onto the surface of the following media: 1.5% water agar (WA), PDA, MLA, MEA, Carnation leaf agar (CLA) (Tschanz et al. 1976), 1.5% water agar plus 100 mL/L of Fusarium filtrate, and PDA with 100 mL/L of the Fusarium filtrate. Fusarium filtrates were created using F. avenaceum, F. oxysporum, F. proliferatum, and F. sporotrichioides.
- S. mycoparasitica ascospore-inoculated plates were then incubated at room temperature (23 C) for 3 d, and spore germination was examined daily. All treatments were in three replicates and experiment was repeated twice.
- PDA Potato dextrose agar
- Id Sus Id Sus + Id PDA
- 3d Sus 3d Sus + Id PDA
- 3d Sus + Id PDA 1 day Fusarium-f ⁇ trate suspension
- 1 day filtrate suspension 1 day filtrate suspension with an additional day incubation on PDA medium
- 3 day suspension 3 day filtrate suspension with an additional day incubation on PDA, respectively.
- No spore germination was observed in the treatments with P. bilaii and C. globosum fungal filtrates.
- Sph ⁇ erodes ascospores showed the highest number of germinated ascospores in the F. ⁇ ven ⁇ ceum-f ⁇ trate suspension.
- ascospore germination of S. mycoparasitica in F. avenaceum-f ⁇ trate was significantly higher (89.2%) than in other treatments.
- the amount of spore germination was increased compared to control. There was no germination recorded for the 1 d suspension in the F. oxysporum-f ⁇ WratQ treatment.
- Table 5 Percentage spore germination of Sphaerodes mycoparasitica ascospores suspended in different Fusarium and biocontrol fungi filtrates assesed throughout four chronosequences. Control treatments were suspended with sterilized distilled water
- Spore germination assessments Microscopic assessments of ascospore germination were conducted after incubation for 1 d and 3 d (spore germination was counted on suspensions). Percentage of germinated spores was obtained by scoring the spores on a Petri dish while observing them through the 20Ox and 40Ox objectives of the Carl Zeiss Axioskop2 microscope and systematically choosing 50 spores, starting at the top right corner and continuing to count until 50. Each drop of the ascospore suspension on a growth medium plate was considered as a subunit, and there were three subunits or replicates per plate. The experiments were repeated twice.
- Fusarium strains All phytopathogenic Fusarium strains: Fusarium graminearum 3- ADON (Fgra3) SMCD 2243, and 15-ADON (Fgral5) SMCD 2244 chemotypes, F. avenaceum (Fave) SMCD 2241, F. oxysporum (Foxy) SMCD 2242, F. proliferatum (Fpro) SMCD 2244, F.
- sporotrichioides Fspo
- Fspo sporotrichioides
- mycoparasitic Sphaerodes mycoparasitica SMCD 2220 strain were retrieved from Saskatchewan Collection and Database (SMCD), maintained on PDA amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate) and used throughout this study.
- Dual-culture assays Dual-culture assays for examining the degree of hyphal reduction/inhibition or damage to F. graminearum chemotypes were assessed as disclosed in Goh and Vujanovic (2009, Mycologia DOI: 10.3852/69-171). S. mycoparasitica is slow-growing fungus as compared to F. graminearumus 3 and 15 strains. Therefore, S. mycoparasitica was pre- inoculated onto the PDA plates for I d, at 21 0 C in darkness, prior to inoculating Fusarium mycelial plugs. Linear mycelial growth of Fusarium strains for both treatments indicated above was measured and recorded daily for 5 days.
- F. graminearum-specific (Fgl6NF/R) and trichothecene Tri5 gene-specific (Tox5-l/2) primer sets were used in this study.
- Standard curves for F. graminearum- and Tri5 gene-primer sets were generated, based on threshold cycles (Ct), by using a series of 10-fold diluted genomic DNAs from F. graminearum (spanning from 2.7 x 10 2 to 2.7 x 10 "2 ng/ ⁇ l for F.
- Real-time PCR quantification Real-time PCR amplifications on total genomic DNA extracted from the sampling zones (as described above) were performed using MiniOpticon (Bio-Rad Laboratories Inc., Mississauga, ON, CA). All the real-time PCR reactions were performed by utilizing the real-time PCR MJ white tubes (Bio-Rad Laboratories Inc., Mississauga, ON, CA) in a total volume of 25 ⁇ l.
- the reaction mixture for all real-time PCR assays were: 12.5 ⁇ l of IQ Supermix (Bio-Rad Laboratories Inc., Mississauga, ON, CA), 1 ⁇ l of each 10 ⁇ M forward/reverse primers (Invitrogen), 9.5 ⁇ l of sterilized UltraPure Millipore water, and 1 ⁇ l of DNA template.
- Real-time PCR conditions for Fgl6NF/R primer set used were outlined in Nicholson et al. (1998, Physiol. MoI. Plant Pathol. 53: 17-37) with melting curve analysis at 60 to 95 0 C. Parameters for Tox5-l/2 primer set as described in Schnerr et al. (2001, Int. J. Food microbiol.
- SMCD 2243 Two Fusarium graminearum 3- ADON (SMCD 2243) and 15- ADON (SMCD 2244) chemotypes, Trichoderma harzianum necrotrophic (SMCD 2166) and Sphaerodes mycoparasitica biotrophic (SMCD 2220) mycoparasites were obtained from the Saskatchewan Microbial Collection and Database (SMCD). All strains were maintained on Potato dextrose agar (PDA, BD Biosciences, Mississauga, ON, CA) amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate; Sigma- Aldrich Canada Ltd., Oakville, ON, CA) prior to study initiation.
- PDA Potato dextrose agar
- Chemical fungicide control A concentration of 100 ⁇ mol/L tebuconazole was prepared from Folicur ® 432F (43.2% tebuconazole, Bayer CropScience Inc., Saskatoon, SK, CA; Folicur is a registered trademark of Bayer Aktiengesellschaft, Leverkusen, Fed. Rep. Germany). This fungicide preparation was used throughout the study.
- Dual-culture assay was carried out between F. graminearum and Folicur ® (100 ⁇ mol/L tebuconazole) or biological (T harzianum or S. mycoparasitica) agents on Minimal medium as disclosed by Xue et al. (2009, Can. J. Plant Pathol. 31 : 169-179).
- Inoculated dual-culture plates were incubated at room temperature (23C) in dark conditions for a week.
- Mycelia of F. graminearum were harvested after a week of inoculation with either chemical or biological agents.
- RNA from the samples were extracted using Aurum Total RNA mini kit and extracted RNA was treated with DNAse (Bio-Rad Laboratories Inc., Mississauga, ON, CA) according the manufacturer's recommendations. Samples were then stored at -70C till gene expression analysis.
- TriIO gene was induced ( Figure 27D). Generally, all four Tri genes were repressed significantly when challenged with biotrophic mycoparasitic Sphaerodes mycoparasitica ( Figure 27A - 27D).
- Real-time Reverse-transcription PCR was performed by using an IScript One-Step RT-PCR kit with SYBR Green on a MiniOpticon Cycler System (Bio-Rad Laboratories Inc., Mississauga, ON, CA), according to the manufacturer's instruction. Primer sets used for amplification and gene expression were summarized in Table 6.
- Tri4-F TAAACGCCCGCGAAGTTCACA Jiao et al. 2008, FEMS Lett.
- Tri4-R TGGTGATGGTTCGCTTCGAG 285: 212-219
- Tr5F AGCGACTACAGGCTTCCCTC
- Tr5R AA ACC ATCC AGTTCTCC ATCTG
- TrilO-R CTGCGGCGAGTGAGTTTGACA
- RT-PCR sample 25 ⁇ L contained 3 ⁇ L of RNA template, 8.85 ⁇ L of nucleae-free water, 12.5 ⁇ L of RT-PCR reaction mixture (2x), 0.5 ⁇ L of IScript RT enzyme mix (50x) (Bio-Rad Laboratories Inc., Mississauga, ON, CA), 0.1 ⁇ L of 50 ⁇ M solutions of both forward and reverse targeted gene-specific primers (Invitrogen Corp., Carslbad, CA, USA).
- Real-time PCR conditions were performed as outlined by manufacturer's recommendations: 50C for lOmin, 95C for 5min, followed by 40 cycles of denaturing at 95C for 10s and annealing at 55C for 30s, 95C for lmin and 55C for 1 min.
- PCR reactions were checked for absence of any primer-dimer formation or non-specific PCR amplification by performing melting curve analysis. Contamination of RNA template with residual genomic DNA was eliminated because there was no amplification detected using reverse transcriptase free real-time RT-PCR reaction as template.
- Tri genes were observed to be more sensitive in F. graminearum chemotype 3 when co- inoculated with Trichoderma necrotrophic mycoparasite, however, in F. graminearum chemotype 15, Tri genes appeared to be more responsive towards treatment with chemical fungicide ( Figures 27A-27D).
- PKS4 gene for both F. graminearum chemotypes was monitored to be more sensitive towards treatments with Trichoderma necrotrophic mycoparasitic fungus compared to chemical and biotrophic mycoparasitic agents ( Figure 28A). However, PKS13 gene in F. graminearum chemotype 15 was found to demonstrate higher sensitivity towards chemical stimulus ( Figure 28B).
- Mycotoxins extraction and analyses DON, ZEA, 3-ADON and 15-ADON mycotoxins were extracted from agar mycelial plugs (0.5cm 2 ) cut from the sampling zone located approximately 0.5 cm behind the contact zone between F. graminearum and S. mycoparasitica. The extraction was performed by three 10-ml volumes of ethyl acetate. The samples were sonicated on ice and shaken vigorously in ethyl acetate, and then they were allowed to stand for 5 min for separation of phases. The organic phase was siphoned off and passed through sodium sulfate to remove water. The solvent was allowed to evaporate at room temperature (23 °C) for 3 days.
- TLC thin liquid chromatography
- HPLC high performance liquid chromatography
- the amount of DON produced was between 70 to 90 ug/L. Consequently, it was too low to be detected in TLC analysis.
- ZEA was high enough to be analyzed with TLC and both F. graminearum chemotypes were observed to produce higher amounts of ZEA toxin under the treatment with Folicur ® compared to other treatments ( Figure 29).
- HPLC ZEA was found to be reduced when challenged with Folicur ® compared to F. graminearum colony only (Figure 30).
- DON and 3-ADON was detected to increase for both F. graminearum when inoculated together with Folicur ® ( Figure 30).
- Folicur ® was monitored to trigger highest amount of 15- ADON under in vitro assay (Figure 30).
- S. mycoparasitica biotrophic mycoparasite
- T. harzianum neurotrophic mycoparasite
- Fungi, media, and culture conditions Fungal strains were obtained from culture collections at University of Saskatchewan (Food and Bioproduct Sciences fungal collection). Strains of the following fungal species were used, plant pathogenic Fusarium graminearum , F. graminearum (3 ADON), F. graminearum (15 ADON), F. avenaceum, F. culmorum, , F. proliferation, F. oxysporum, F. arthrosporoides and mycoparasitic Spaeherodes mycoparasitica and Trichoderma harzianum. Fungi were maintained on potato dextrose agar for 2 wks at 21 0 C in darkness. Folicur was also used in this study.
- F. avenaceum isolates color identification numbers (CIN) were generated with Hex Color Code Chart (http://wu ⁇ v.2crcatcawcbsite.com/build/hex-colors.html#cotorgenerator).
- CINs are: Ds #71232B: Red and highly virulent, tolerant at 80 0 C for 4 hours; Es #4E040B: Moderately red and moderately virulent, tolerant 40 0 C for 4 hours; Bs #A86608: White and non virulent, susceptible 40 0 C for 4 hours.
- Three 0.1 g mycelium samples from three replicates of each isolate was mixed and used for DNA extraction and RT-PCR analyses.
- Auro RT SEQ ID NO: 32
- Auro RTR SEQ ID NO: 33
- SEQ ID NO: 33 ATGACRACTTCCCGTGGRCC
- the specificity of this set of primers was tested by conventional PCR assay using genomic DNA from Fusarium and mycoparasites using the amplification reactions volumes indicated above.
- the amplification protocol was 1 cycle of 120 s at 94 0 C, 35 cycles of 30 s at 94 0 C (denaturalization), 30 s at 56 0 C (annealing), 45 s at 72 0 C (extension), and 1 cycle of 10 min at
- the pair of primers used to amplify the ⁇ -tubulin (tub) gene were FGtubf (SEQ ID NO: 34) and Fgtubr (SEQ ID NO: 35).
- PCR efficiencies of the real time RT-PCR for both genes were checked by performing a 10-fold serial dilution of positive control template to generate a standard curve, and by plotting the Ct as a function of log [10] of template.
- Presence of aurofusarin was tested and quantified by RT-PCR in pathogenic Fusarium graminearum , F. graminearum (3 ADON), F. graminearum (15ADON), F. avenaceum, F. culmorum, Mycoparasite, F. proliferatum, F. oxysporum, F. arthrosporoides and mycoparasitic, Sphaerodes mycoparasitica and Trichoderma harzianum. Relative gene expression was studied when Fusarium isolates were co-cultured with Folicur ® , Sphaerodes and Trichoderma.
- the designed RT-PCR primer set was checked for its specificity by conventional PCR on tested fungal species.
- a single band 157 bp long was amplified in F. graminearum (3 ADON), F. graminearum (15 ADON), F. avenaceum, F. culmorum but not in other strains.
- One week old grown cultures tested for their aurofusarin relative gene expression and ⁇ -tublin gene was used as an internal control.
- F. graminearum which produces 15ADON showed highest level gene expression followed by F ' .graminearum (3AD0N) and similar kind of expression results were observed with F. avenacum and F. culmorum.
- Aurofusarin relative gene expression was quantified when each Fusarium species was co-cultured for a week with Sphaerodes, Trichoderma and Folicur R ( Figure 31).
- S. mycoparasitica was most effective in reducing the aurofusarin relative gene expression followed by Trichoderma and Folicur ( Figure 31).
- S. mycoparasitica was most affective on F. graminearum producing 15 ADON, but also efficiently reduced the expression level in F. culmorum and F. avenaceum and F. graminearum producing 3 ADON ( Figure 31).
- Trichoderma was able to somewhat affect F. graminearum producing 15 ADON and F. culmorum, but showed no impact on F.
- RNA isolation, reverse transcription and real time RT-PCR All the cultures were grown for a week under dark and used for expression studies. Fungal total RNA was isolated using the "Total Quick RNA Cells and Tissues" Kit (Bio-Rad Laboratories Inc., Mississauga, ON, CA), according to the manufacturer's instructions, and stored at -80 °C. DNAse I treatment to remove the chromosomal DNA contamination from the samples was performed using the "Deoxyribonuclease I, Amplification Grade" (Invitrogen Corp., Carlsbad, CA, USA).
- First strand cDNA was synthesized using the "Iscript RNA PCR Reagent Kit” (Bio-Rad Laboratories Inc., Mississauga, ON, CA). Relative Quantification of aur gene expression was performed in a MiniOpticon Sequence Detection System using the SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Mississauga, ON, CA) and the primer pairs indicated above.
- the PCR thermal cycling conditions for both genes were as follows: an initial step at 95 0 C for 10 min and 40 cycles at 95 °C for 15 s and at 60 °C for 1 min.
- SYBR green PCR master mix 12.5 ⁇ l (Bio-Rad Laboratories Inc., Mississauga, ON, CA) was used as the reaction mixture, with the addition of 6.5 ⁇ l of sterile milli-Q water, 1.0 ⁇ l of each primer (5 ⁇ M), and 5 ⁇ l of template cDNA, in a final volume of 25 ⁇ l.
- appropriate negative controls containing no template were subjected to the same procedure to exclude or detect any possible contamination or carryover.
- Each sample (triplicate) was amplified twice in every experiment. The results were normalized using the all fungi cDNA amplifications run on the same plate.
- the tub2 gene is an endogenous control that was used to normalize quantitation of mRNA target for differences in the amount of total cDNA added to each reaction.
- Real Time RT-PCR analysis is based on the threshold cycle (CT), which is defined as the first amplification cycle at which the fluorescence signal is greater than the minimal detection level, indicating that PCR products become detectable.
- CT threshold cycle
- Relative quantitation was the analytical method used in this study. A comparison within a sample is made with the gene of interest (aur) to that of the endogenous control gene ⁇ tub!). Quantitation is relative to the control gene by subtracting the CT of the control gene (tub2) from the CT of the gene of interest (aur) ( ⁇ CT).
- Each ⁇ CT value (corresponding to each sample) was subtracted by the calibrator value (FpMM ⁇ -lC) to obtain the corresponding ⁇ CT values.
- ⁇ CT values were transformed to Iog2 (due to the doubling function of PCR) to generate the relative expression levels.
- S. mycoparasitica SMCD 2220 and F. graminearum 3 -ADON chemotype SMCD 2243 were obtained from the Saskatchewan Microbial Collection and Database (SMCD). These fungal cultures were grown on potato dextrose agar (PDA, BD Biosciences, Mississauga, ON, CA) supplemented with antibiotics prior to the study. Mycelial suspensions of these fungal strains (10 4 for F. graminearum and 10 6 for both biotrophic mycoparasite and antagonistic fungus) were produced for greenhouse experiment, as follows.
- F. graminearum 3 -ADON chemotype strain was inoculated in potato dextrose broth (PDA, BD Biosciences, Mississauga, ON, CA), incubated at room temperature (-21 0 C) in darkness using shaker (lOOrpm), for a week prior to harvesting the mycelia for greenhouse application.
- Mycelia of F. graminearnm were transferred into sterilized commercial blender for cutting the mycelial inoculants into small debris and these mycelia were adjusted to concentration of 10 4 CFU/mL.
- S. mycoparasitica was inoculated in the best preferment yeast peptone dextrose (YPD) (yeast, 5g; peptone, 1Og; dextrose, 1Og per 1 L of sterile-double distilled water) broth, incubated at room temp in darkness, using shaker at 100 rpm for a week prior to harvesting the mycelia.
- YPD yeast peptone dextrose
- Mycelia of S. mycoparasitica were transferred into sterilized commercial blender for cutting the mycelial inoculants into small debris and the mycelia were adjusted to concentration of 10 4 CFU/mL for greenhouse application.
- wheat and barley spikes were sprayed with mycelial suspension of S. mycoparasitica at a concentration of 10 6 CFU/mL, antagonistic fungal isolate at a concentration of 10 6 CFU/mL, 65 ⁇ mol/L tebuconazole, or sterile distilled water.
- the treatments were applied as outlined in Xue et al. (2009, Can. J. Plant Pathol. 31 : 169-179) with slight modifications.
- plants were kept at room temperature and covered with sterile Whirl-Pak ® bags (Whirl-Pak is a registered trademark of Aristotle Corp., Stamford, CT, USA) for overnight to allow fungal growth prior to F. graminearum inoculation. Plants were then inoculated with mycelial suspension of F. graminearum at a concentration of 10 4 CFU/mL. Fusarium graminearum inoculum was sprayed on the spikes and covered with sterile Whirl-Pak ® bags for overnight. The inoculated plants were maintained for an additional 21 days prior to sampling.
- Percentage of infected spikelets (IS) per spike, FHB index, FDK, and weight of 100 seeds were rated as outlined in Xue et al. (2009).
- the FHB visual severity scale was determined according to the methods disclosed by Stack and McMullen (http://www.ag.ndsu.edu/pubs/plantsci/smgrains/pplO95w.htm).
- FIG. 33 The biocontrol effects of different concentrations of S. mycoparasitica of Fusarium head blight symptoms in barley are shown in Figure 33.
- the data in Figures 33A, 33B, and 33C show that inoculation of a susceptible barley cultivar with F. graminearum significantly reduced that height of the plants, average numbers of spikes form per plant, and the average weight of 5 spikes.
- inoculation of the barley cultivar with S. mycoparasitica did not affect growth and development.
- Treatment of F. graminearum-infQctQd barley with S. mycoparasitica at an inoculation level of 10 6 CFU/mL prevented the onset of any Fusarium head blight symptoms.
- FIG. 34 The biocontrol effects of different concentrations of S. mycoparasitica of Fusarium head blight symptoms in wheat are shown in Figure 34.
- the data in Figures 34A, 34B, and 34C show that inoculation of a susceptible wheat cultivar with F. graminearum significantly reduced that height of the plants, average numbers of spikes form per plant, and the average weight of 5 spikes.
- inoculation of the wheat cultivar with S. mycoparasitica did not affect growth and development.
- Treatment of F. graminearum-infected wheat with S. mycoparasitica at an inoculation level of 10 6 CFU/mL prevented the onset of any Fusarium head blight symptoms.
- Real-time PCR quantification Total DNA was extracted from the wheat and barly spices with DNeasy ® Plant Mini Kit (Qiagen Inc., Mississauga, ON, CA). Extracted total DNAs from spikes of different treatments were employed in real-time PCR quantification. Two different primer sets and PCR conditions used in this study were described in Nicholson et al. (1998) for Fgl6NF/R primer set and Schnerr et al. (2001) for Tox5-l/2 primer set. Total DNA extracted from spring wheat and barley spikes harvested from greenhouse trials were carried out in a MiniOpticon (Bio-Rad Laboratories Inc., Mississauga, ON, CA).
- FIG. 37 shows effects of S. mycoparasitica (B) and Folicur fungicide (FoI) treatments on F. graminearum chemotype 3 -ADON genomic DNA detected in barley spikes employing RT-PCR.
- Treatments were: Fus - F. graminearum; B-Fus - 5 * . mycoparasitica with F. graminearum; Fol-Fus - Folicur fungicide with F. graminearum. All values obtained were the means of six replicates. Error bars indicate standard deviation of the mean.
- Means of F. graminearum DNA with Tox 5 primer were log 10 transformed prior to LSD test. Both primer sets were analyzed separately. Values followed by the same letters within each primer set are not significantly different using LSD test at P ⁇ 0.05.
- PDA potato dextrose agar
Abstract
Description
Claims
Priority Applications (10)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
UAA201203725A UA104050C2 (en) | 2009-08-28 | 2010-08-30 | Isolated culture of sphaerodes mycoparasitica for control of fusarium spp |
BRBR112012004160-6A BR112012004160A2 (en) | 2009-08-28 | 2010-08-30 | Fusarium biocontrol and fusarium mycotoxins |
EA201270327A EA201270327A1 (en) | 2009-08-28 | 2010-08-30 | BIOLOGICAL REGULATION OF FUSARIUM AND MYCOTOXIN FUSARIUM |
AU2010286276A AU2010286276B2 (en) | 2009-08-28 | 2010-08-30 | Fusarium and Fusarium mycotoxin biocontrol |
EP10811051.1A EP2470659A4 (en) | 2009-08-28 | 2010-08-30 | Fusarium and fusarium mycotoxin biocontrol |
JP2012525827A JP2013502902A (en) | 2009-08-28 | 2010-08-30 | Biological regulators for fusarium and fusarium mycotoxins |
CA2772106A CA2772106C (en) | 2009-08-28 | 2010-08-30 | Fusarium and fusarium mycotoxin biocontrol |
US13/405,771 US20120156173A1 (en) | 2009-08-28 | 2012-02-27 | Fusarium and other pathogenic fungi and mycotoxin biocontrol |
IN2475DEN2012 IN2012DN02475A (en) | 2009-08-28 | 2012-03-21 | |
US14/556,624 US20150150921A1 (en) | 2009-08-28 | 2014-12-01 | Fusarium and other pathogenic fungi and mycotoxin biocontrol |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US23790609P | 2009-08-28 | 2009-08-28 | |
US61/237,906 | 2009-08-28 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US13/405,771 Continuation-In-Part US20120156173A1 (en) | 2009-08-28 | 2012-02-27 | Fusarium and other pathogenic fungi and mycotoxin biocontrol |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2011022809A1 true WO2011022809A1 (en) | 2011-03-03 |
Family
ID=43627106
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CA2010/001253 WO2011022809A1 (en) | 2009-08-28 | 2010-08-30 | Fusarium and fusarium mycotoxin biocontrol |
Country Status (9)
Country | Link |
---|---|
EP (1) | EP2470659A4 (en) |
JP (1) | JP2013502902A (en) |
AU (1) | AU2010286276B2 (en) |
BR (1) | BR112012004160A2 (en) |
CA (1) | CA2772106C (en) |
EA (1) | EA201270327A1 (en) |
IN (1) | IN2012DN02475A (en) |
UA (1) | UA104050C2 (en) |
WO (1) | WO2011022809A1 (en) |
Cited By (58)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014053395A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Use of n-thio-anthranilamide compounds on cultivated plants |
WO2014053407A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | N-thio-anthranilamide compounds and their use as pesticides |
WO2014053403A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Method of controlling insecticide resistant insects |
WO2014053406A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Method of controlling ryanodine-modulator insecticide resistant insects |
WO2014053404A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Pesticidally active mixtures comprising anthranilamide compounds |
WO2014053405A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Pesticidally active mixtures comprising anthranilamide compounds |
WO2014053401A2 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Method of improving plant health |
WO2014056780A1 (en) | 2012-10-12 | 2014-04-17 | Basf Se | A method for combating phytopathogenic harmful microbes on cultivated plants or plant propagation material |
WO2014079820A1 (en) | 2012-11-22 | 2014-05-30 | Basf Se | Use of anthranilamide compounds for reducing insect-vectored viral infections |
WO2014082879A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted [1,2,4]triazole compounds |
WO2014082880A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted [1,2,4] triazole compounds |
WO2014082881A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides |
WO2014082871A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides |
WO2014086856A1 (en) | 2012-12-04 | 2014-06-12 | Basf Agro B.V., Arnhem (Nl) | Compositions comprising a quillay extract and a biopesticide |
WO2014086850A1 (en) | 2012-12-04 | 2014-06-12 | Basf Agro B.V., Arnhem (Nl) | Compositions comprising a quillay extract and a fungicidal inhibitor of respiratory complex ii |
WO2014086854A1 (en) | 2012-12-04 | 2014-06-12 | Basf Agro B.V., Arnhem (Nl) | Compositions comprising a quillay extract and a plant growth regulator |
EP2746257A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746260A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746255A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746262A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds for combating phytopathogenic fungi |
EP2746264A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746263A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Alpha-substituted triazoles and imidazoles |
EP2746279A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
EP2746258A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746278A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746267A2 (en) | 2012-12-19 | 2014-06-25 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
EP2746259A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746256A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
EP2746277A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
WO2014095672A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | Substituted [1,2,4]triazole compounds and their use as fungicides |
WO2014095548A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | Substituted [1,2,4]triazole compounds and their use as fungicides |
WO2014095547A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
WO2014095534A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
WO2014095381A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
WO2014095555A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
WO2014124850A1 (en) | 2013-02-14 | 2014-08-21 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
WO2014147528A1 (en) | 2013-03-20 | 2014-09-25 | Basf Corporation | Synergistic compositions comprising a bacillus subtilis strain and a biopesticide |
EP2815650A1 (en) | 2013-06-18 | 2014-12-24 | Basf Se | Fungicidal mixtures II comprising strobilurin-type fungicides |
WO2015011615A1 (en) | 2013-07-22 | 2015-01-29 | Basf Corporation | Mixtures comprising a trichoderma strain and a pesticide |
WO2015036058A1 (en) | 2013-09-16 | 2015-03-19 | Basf Se | Fungicidal pyrimidine compounds |
WO2015036059A1 (en) | 2013-09-16 | 2015-03-19 | Basf Se | Fungicidal pyrimidine compounds |
WO2015055757A1 (en) | 2013-10-18 | 2015-04-23 | Basf Se | Use of pesticidal active carboxamide derivative in soil and seed application and treatment methods |
WO2015086462A1 (en) | 2013-12-12 | 2015-06-18 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
WO2015091645A1 (en) | 2013-12-18 | 2015-06-25 | Basf Se | Azole compounds carrying an imine-derived substituent |
WO2015104422A1 (en) | 2014-01-13 | 2015-07-16 | Basf Se | Dihydrothiophene compounds for controlling invertebrate pests |
EP2924027A1 (en) | 2014-03-28 | 2015-09-30 | Basf Se | Substituted [1,2,4]triazole and imidazole fungicidal compounds |
EP2949649A1 (en) | 2014-05-30 | 2015-12-02 | Basf Se | Fungicide substituted [1,2,4]triazole and imidazole compounds |
EP2949216A1 (en) | 2014-05-30 | 2015-12-02 | Basf Se | Fungicidal substituted alkynyl [1,2,4]triazole and imidazole compounds |
EP2952507A1 (en) | 2014-06-06 | 2015-12-09 | Basf Se | Substituted [1,2,4]triazole compounds |
EP2952512A1 (en) | 2014-06-06 | 2015-12-09 | Basf Se | Substituted [1,2,4]triazole compounds |
EP2952506A1 (en) | 2014-06-06 | 2015-12-09 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2962568A1 (en) | 2014-07-01 | 2016-01-06 | Basf Se | Mixtures comprising a bacillus amyliquefaciens ssp. plantarum strain and a pesticide |
EP3111763A1 (en) | 2015-07-02 | 2017-01-04 | BASF Agro B.V. | Pesticidal compositions comprising a triazole compound |
CN107916266A (en) * | 2017-12-05 | 2018-04-17 | 华中农业大学 | Fusarium toxin detoxification path related gene ADH, AKR6D1, AKR13B2 and its application |
CN110724643A (en) * | 2019-11-18 | 2020-01-24 | 河南省农业科学院植物保护研究所 | Penicillium citrinum with disease prevention and growth promotion functions, microbial inoculum and application thereof |
EP3628158A1 (en) | 2018-09-28 | 2020-04-01 | Basf Se | Pesticidal mixture comprising a mesoionic compound and a biopesticide |
US10899932B2 (en) | 2014-10-24 | 2021-01-26 | Basf Se | Non-amphoteric, quaternisable and water-soluble polymers for modifying the surface charge of solid particles |
CN113832038A (en) * | 2021-09-27 | 2021-12-24 | 中国农业科学院植物保护研究所 | Fusarium equiseti (Fusarium equiseti) K2017-696 and application thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110286190B (en) * | 2019-06-26 | 2024-03-22 | 山东农业大学 | Method for simultaneously measuring DON and multiple DON bioconversion products |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120156173A1 (en) * | 2009-08-28 | 2012-06-21 | Vladimir Vujanovic | Fusarium and other pathogenic fungi and mycotoxin biocontrol |
-
2010
- 2010-08-30 EA EA201270327A patent/EA201270327A1/en unknown
- 2010-08-30 JP JP2012525827A patent/JP2013502902A/en active Pending
- 2010-08-30 CA CA2772106A patent/CA2772106C/en active Active
- 2010-08-30 BR BRBR112012004160-6A patent/BR112012004160A2/en not_active IP Right Cessation
- 2010-08-30 WO PCT/CA2010/001253 patent/WO2011022809A1/en active Application Filing
- 2010-08-30 EP EP10811051.1A patent/EP2470659A4/en not_active Withdrawn
- 2010-08-30 UA UAA201203725A patent/UA104050C2/en unknown
- 2010-08-30 AU AU2010286276A patent/AU2010286276B2/en active Active
-
2012
- 2012-03-21 IN IN2475DEN2012 patent/IN2012DN02475A/en unknown
Non-Patent Citations (4)
Title |
---|
GOH, Y.K. ET AL.: "Biotrophic mycoparasitic interactions between Sphaerodes mycoparasitica and phytopathogenic Fusarium species.", BIOCONTROL SCIENCE AND TECHNOLOGY., vol. 20, no. 9, 30 April 2010 (2010-04-30), pages 891 - 902, XP008151207 * |
HAVERSON, R.M. ET AL.: "Novel use of a Pyrenomycetous Mycoparasite for Management of Fusarium Wilt of Watermelon.", PLANT DISEASE., vol. 86, no. 9, September 2002 (2002-09-01), pages 1025 - 1030, XP008151214 * |
See also references of EP2470659A4 * |
VUJANOVIC, V. ET AL.: "Sphaerodes mycoparasitica sp. nov., a new biotrophic mycoparasite on Fusarium avenaceum, F. graminearum and F. oxysporum.", MYCOLOGICAL RESEARCH., vol. 113, 1 September 2009 (2009-09-01), pages 1172 - 1180, XP026709811 * |
Cited By (65)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014053395A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Use of n-thio-anthranilamide compounds on cultivated plants |
WO2014053407A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | N-thio-anthranilamide compounds and their use as pesticides |
WO2014053403A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Method of controlling insecticide resistant insects |
WO2014053406A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Method of controlling ryanodine-modulator insecticide resistant insects |
WO2014053404A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Pesticidally active mixtures comprising anthranilamide compounds |
WO2014053405A1 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Pesticidally active mixtures comprising anthranilamide compounds |
WO2014053401A2 (en) | 2012-10-01 | 2014-04-10 | Basf Se | Method of improving plant health |
WO2014056780A1 (en) | 2012-10-12 | 2014-04-17 | Basf Se | A method for combating phytopathogenic harmful microbes on cultivated plants or plant propagation material |
WO2014079820A1 (en) | 2012-11-22 | 2014-05-30 | Basf Se | Use of anthranilamide compounds for reducing insect-vectored viral infections |
WO2014082879A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted [1,2,4]triazole compounds |
WO2014082880A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted [1,2,4] triazole compounds |
WO2014082881A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides |
WO2014082871A1 (en) | 2012-11-27 | 2014-06-05 | Basf Se | Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides |
WO2014086856A1 (en) | 2012-12-04 | 2014-06-12 | Basf Agro B.V., Arnhem (Nl) | Compositions comprising a quillay extract and a biopesticide |
WO2014086850A1 (en) | 2012-12-04 | 2014-06-12 | Basf Agro B.V., Arnhem (Nl) | Compositions comprising a quillay extract and a fungicidal inhibitor of respiratory complex ii |
WO2014086854A1 (en) | 2012-12-04 | 2014-06-12 | Basf Agro B.V., Arnhem (Nl) | Compositions comprising a quillay extract and a plant growth regulator |
EP2746263A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Alpha-substituted triazoles and imidazoles |
EP2746267A2 (en) | 2012-12-19 | 2014-06-25 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
EP2746255A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746262A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds for combating phytopathogenic fungi |
EP2746264A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
WO2014095381A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
EP2746279A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
EP3173406A1 (en) | 2012-12-19 | 2017-05-31 | Basf Se | Substituted [1,2,4]triazole compounds and their use as fungicides |
EP2746278A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP3181558A1 (en) | 2012-12-19 | 2017-06-21 | Basf Se | Substituted [1,2,4]triazole compounds and their use as fungicides |
WO2014095555A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
EP2746256A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
EP2746277A1 (en) | 2012-12-19 | 2014-06-25 | Basf Se | Fungicidal imidazolyl and triazolyl compounds |
WO2014095672A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | Substituted [1,2,4]triazole compounds and their use as fungicides |
WO2014095548A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | Substituted [1,2,4]triazole compounds and their use as fungicides |
WO2014095547A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
WO2014095534A1 (en) | 2012-12-19 | 2014-06-26 | Basf Se | New substituted triazoles and imidazoles and their use as fungicides |
EP2746257A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746258A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746260A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2746259A1 (en) | 2012-12-21 | 2014-06-25 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
WO2014124850A1 (en) | 2013-02-14 | 2014-08-21 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
WO2014147528A1 (en) | 2013-03-20 | 2014-09-25 | Basf Corporation | Synergistic compositions comprising a bacillus subtilis strain and a biopesticide |
EP2815650A1 (en) | 2013-06-18 | 2014-12-24 | Basf Se | Fungicidal mixtures II comprising strobilurin-type fungicides |
EP2815649A1 (en) | 2013-06-18 | 2014-12-24 | Basf Se | Fungicidal mixtures II comprising strobilurin-type fungicides |
WO2015011615A1 (en) | 2013-07-22 | 2015-01-29 | Basf Corporation | Mixtures comprising a trichoderma strain and a pesticide |
WO2015036059A1 (en) | 2013-09-16 | 2015-03-19 | Basf Se | Fungicidal pyrimidine compounds |
WO2015036058A1 (en) | 2013-09-16 | 2015-03-19 | Basf Se | Fungicidal pyrimidine compounds |
EP3456201A1 (en) | 2013-10-18 | 2019-03-20 | BASF Agrochemical Products B.V. | Use of pesticidal active carboxamide derivative in soil and seed application and treatment meth-ods |
WO2015055757A1 (en) | 2013-10-18 | 2015-04-23 | Basf Se | Use of pesticidal active carboxamide derivative in soil and seed application and treatment methods |
WO2015086462A1 (en) | 2013-12-12 | 2015-06-18 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
WO2015091645A1 (en) | 2013-12-18 | 2015-06-25 | Basf Se | Azole compounds carrying an imine-derived substituent |
WO2015104422A1 (en) | 2014-01-13 | 2015-07-16 | Basf Se | Dihydrothiophene compounds for controlling invertebrate pests |
EP2924027A1 (en) | 2014-03-28 | 2015-09-30 | Basf Se | Substituted [1,2,4]triazole and imidazole fungicidal compounds |
EP2949649A1 (en) | 2014-05-30 | 2015-12-02 | Basf Se | Fungicide substituted [1,2,4]triazole and imidazole compounds |
EP2949216A1 (en) | 2014-05-30 | 2015-12-02 | Basf Se | Fungicidal substituted alkynyl [1,2,4]triazole and imidazole compounds |
EP2952507A1 (en) | 2014-06-06 | 2015-12-09 | Basf Se | Substituted [1,2,4]triazole compounds |
EP2952506A1 (en) | 2014-06-06 | 2015-12-09 | Basf Se | Substituted [1,2,4]triazole and imidazole compounds |
EP2952512A1 (en) | 2014-06-06 | 2015-12-09 | Basf Se | Substituted [1,2,4]triazole compounds |
EP2962568A1 (en) | 2014-07-01 | 2016-01-06 | Basf Se | Mixtures comprising a bacillus amyliquefaciens ssp. plantarum strain and a pesticide |
US10899932B2 (en) | 2014-10-24 | 2021-01-26 | Basf Se | Non-amphoteric, quaternisable and water-soluble polymers for modifying the surface charge of solid particles |
EP3111763A1 (en) | 2015-07-02 | 2017-01-04 | BASF Agro B.V. | Pesticidal compositions comprising a triazole compound |
CN107916266B (en) * | 2017-12-05 | 2020-08-11 | 华中农业大学 | Fusarium toxin detoxification pathway related genes ADH, AKR6D1 and AKR13B2 and application thereof |
CN107916266A (en) * | 2017-12-05 | 2018-04-17 | 华中农业大学 | Fusarium toxin detoxification path related gene ADH, AKR6D1, AKR13B2 and its application |
EP3628158A1 (en) | 2018-09-28 | 2020-04-01 | Basf Se | Pesticidal mixture comprising a mesoionic compound and a biopesticide |
WO2020064480A1 (en) | 2018-09-28 | 2020-04-02 | Basf Se | Pesticidal mixture comprising a mesoionic compound and a biopesticide |
CN110724643A (en) * | 2019-11-18 | 2020-01-24 | 河南省农业科学院植物保护研究所 | Penicillium citrinum with disease prevention and growth promotion functions, microbial inoculum and application thereof |
CN110724643B (en) * | 2019-11-18 | 2022-07-15 | 河南省农业科学院植物保护研究所 | Penicillium citrinum with disease prevention and growth promotion functions, microbial inoculum and application thereof |
CN113832038A (en) * | 2021-09-27 | 2021-12-24 | 中国农业科学院植物保护研究所 | Fusarium equiseti (Fusarium equiseti) K2017-696 and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CA2772106C (en) | 2017-11-07 |
JP2013502902A (en) | 2013-01-31 |
EP2470659A4 (en) | 2013-07-10 |
BR112012004160A2 (en) | 2015-09-01 |
EP2470659A1 (en) | 2012-07-04 |
CA2772106A1 (en) | 2011-03-03 |
AU2010286276B2 (en) | 2013-12-12 |
AU2010286276A1 (en) | 2012-03-08 |
IN2012DN02475A (en) | 2015-08-21 |
UA104050C2 (en) | 2013-12-25 |
EA201270327A1 (en) | 2013-03-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2010286276B2 (en) | Fusarium and Fusarium mycotoxin biocontrol | |
You et al. | Multiple criteria-based screening of Trichoderma isolates for biological control of Botrytis cinerea on tomato | |
RU2634386C2 (en) | Microbacterium strain, compositions and methods to combat fusariosis | |
Shanmugam et al. | Biocontrol of vascular wilt and corm rot of gladiolus caused by Fusarium oxysporum f. sp. gladioli using plant growth promoting rhizobacterial mixture | |
Sreedevi et al. | Isolation and screening of effective Trichoderma spp. against the root rot pathogen Macrophomina phaseolina | |
Phong et al. | Antifungal Activities of Chaetomium spp. against Fusarium Wilt of Tea. | |
Jaihan et al. | Selection of entomopathogenic fungus for biological control of chili anthracnose disease caused by Colletotrichum spp. | |
US20220017856A1 (en) | Anti-phytopathogenic compositions | |
Cosseboom et al. | Competitive ability of multi-fungicide resistant Botrytis cinerea in a blackberry planting over three years | |
WO2019035067A1 (en) | Organic fungicide derived through microbial fermentation | |
Martínez-Arias et al. | Enhancement of Populus alba tolerance to Venturia tremulae upon inoculation with endophytes showing in vitro biocontrol potential | |
Nira et al. | Alternaria leaf spot of broccoli caused by Alternaria alternata in Bangladesh | |
US20150150921A1 (en) | Fusarium and other pathogenic fungi and mycotoxin biocontrol | |
Kumar et al. | Trichoderma spp.: Identification and characterization for pathogenic control and its potential application | |
Leplat et al. | Colonization dynamic of various crop residues by Fusarium graminearum monitored through real‐time PCR measurements | |
Vilavong et al. | Application of a new bio-formulation of Chaetomium cupreum for biocontrol of Colletotrichum gloeosporioides causing coffee anthracnose on Arabica variety in Laos | |
Mahmoud et al. | Genetic diversity and biological control of Rhizoctonia solani associated with root rot of soybean in assiut governorate, Egypt | |
ES2696982B2 (en) | Endophytic fungi HTF58 Alternaria alternata and HRO8 Fusarium acuminatum from Artemisa thuscula and Artemisa austriaca as antifungals for agricultural use | |
Ibrahim et al. | Fungi as potential biocontrol agents against Convolvulus arvensis and Portulaca oleracea infesting the agroecosystems of Egypt | |
KR101876939B1 (en) | Composition for controlling plant disease comprising Aspergillus persii strain producing penicillic acid as effective component and uses thereof | |
Elshahawy et al. | Antagonistic activity of Trichoderma asperellum against Fusarium species, chemical profile and their efficacy for management of Fusarium‐root rot disease in dry bean | |
KR100459066B1 (en) | Method for the biological control of plant diseases using chaetomium globosum f0142 and chaetoviridins a and b produced by same | |
CN112955538A (en) | Method for biologically controlling fusarium ear blight of grain | |
WO2015111081A2 (en) | An herbicidal composition for controlling parthenium weed and strain thereof | |
WO2021130735A1 (en) | Organic fungicide derived through microbial fermentation and efficient formulation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10811051 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010286276 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2772106 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2012525827 Country of ref document: JP |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2010286276 Country of ref document: AU Date of ref document: 20100830 Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2475/DELNP/2012 Country of ref document: IN |
|
REEP | Request for entry into the european phase |
Ref document number: 2010811051 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010811051 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: A201203725 Country of ref document: UA Ref document number: 201270327 Country of ref document: EA |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012004160 Country of ref document: BR |
|
ENP | Entry into the national phase |
Ref document number: 112012004160 Country of ref document: BR Kind code of ref document: A2 Effective date: 20120224 |