WO2011021166A1 - Meganuclease variants cleaving a dna target sequence from the human lysosomal acid alpha-glucosidase gene and uses thereof - Google Patents

Abstract

An l-Crel variant, wherein one of the two l-Crel monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG core domain situated respectively from positions 26 to 40 and 44 to 77 of l-Crel, said variant being able to cleave a DNA target sequence from the human lysosomal acid α-glucosidase gene. Use of said variant and derived products for the prevention and the treatment of pathological conditions caused by a mutation in the human lysosomal acid α-glucosidase gene (Pompe's disease).

Description

MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE HUMAN LYSOSOMAL ACID a-GLUCOSIDASE GENE AND

USES THEREOF

The invention relates to meganuclease variants which cleave a DNA target sequence from the human lysosomal acid a-glucosidase gene, to vectors encoding such variants, to a cell, an animal or a plant modified by such vectors and to the use of these meganuclease variants and products derived therefrom for genome therapy, ex vivo (gene cell therapy) and genome engineering.

Lysosomal acid a-glucosidase gene (GAA) or lysosomal acid maltase gene encodes an enzyme that hydrolyzes linear a 1 -4 and a 1-6 glucosidic linkages ranging from large polymers (glycogen) to maltose and the artificial substrate 4-MU- a -D-glucoside (Palmer, T.N., Biochem. J., 1971, 124, 701-71 1). Its activity leads to the production of monosaccharides such as glucose, preventing the accumulation of glycogen in the organism.

The GAA gene (SEQ ID NO: 3) is located on Chromosome 17 at the position 17q25.2-25.3, spans approximately 20kb and contains 20 exons (Accession number GenBank NC_000017.9 or NT_024871.1 1). The first exon is non-coding. The size of the mRNA is about 3.6 kb. The promoter has features characteristic of a "housekeeping" gene. The coding sequence is 2859 base pairs long and gives rise to a protein 953 amino acids long with a molecular weight of 105 kD. The name of the gene product is acid α-glucosidase or acid maltase.

Autosomal recessive total or partial deficiency of GAA (glycogen storage disease type II, GAADII; or acid maltase deficiency, AMD) results in a spectrum of phenotypes including an infantile disorder (Pompe's disease), the most severe form of the disease, (Hers et al , The Metabolic basis of inherited disease, 6^th edition, 1989, 425-452), a juvenile and a late onset adult myopathy (Mehler and DiMauro, Neurology, 1977, 27, 178-184).

Pompe's disease is characterized by symptoms including hypotonia with a massive accumulation of glycogen in skeletal and heart muscle with death due to cardiorespiratory failure. Patients with the slowly progressive later onset forms die due to respiratory failure. In all cases, affected subjects accumulate progressively higher amounts of non degraded glycogen in their lysosomes and autophagosomes, leading to distension of the organelles and subsequent cellular and tissue dysfunction.

The enzyme deficiency in Pompe's disease is caused by mutations in the acid a-glucosidase gene (GAA). The nature of the mutations in the acid o glucosidase gene and the combination of mutant alleles determine the level of residual lysosomal acid a-glucosidase activity and primarily the clinical phenotype of Pompe's disease. Although exceptional cases have been described, in general a combination of two alleles with fully deleterious mutations leads to the virtual absence of acid a- glucosidase activity and to the severe classic infantile phenotype. A severe mutation in one allele and a milder mutation in the other result in a slower progressive phenotype with residual activity up to 23% of average control activity. Patients with the common c.-32-13T>G mutation, combined with a fully deleterious mutation on the other allele, all show significant residual enzyme activity and a protracted course of disease, but onset of symptoms varied from the 1 ^st year of life to late adulthood (Kroos M. A. et al, Neurology, 2007, 68, 1 10-1 15). At present more than 200 different mutations in the acid α-glucosidase gene are known. A list of all known mutations and their functional effects is given on OMIM (Online Mendelian Inheritance in Man) entry 23200.

Pompe's disease is an untreatable disorder, for which only supportive care is available, namely dietary and physiotherapy to reduce the incidence and severity of the disease although in general such supportive care will only temporarily improve the symptoms and not alter the final outcome for the disease which in general is mortality in infant onset type Pompe's disease. In March 2006 Myozyme, the first treatment for patients with Pompe disease, received marketing authorization in the European Union, followed in April 2006 by FDA approval in the United States. Myozyme is manufactured by Genzyme and is an 'enzyme replacement therapy' (ERT). The rationale for this therapy is to treat the disease by intravenous administration of the deficient enzyme. This treatment is very expensive and therefore not available to all patients who need it, in addition the treatment must continue throughout the patients life in order to continue to alleviate the endemic enzymatic deficiency. Therefore although this intravenous enzyme replacement therapy has improved the lives of many Pompe's disease patients immeasurably this therapy does not represent the end of Pompe's disease or the need for further therapies. Another potential therapeutic approach to Pompe's disease is gene therapy whose goal is to introduce the gene coding for the deficient enzyme into the somatic cells, thus creating a permanent enzyme source. Current gene therapy strategies are based on a complementation approach, wherein randomly inserted but functional extra copy of the gene provide for the function of the mutated endogenous copy. Currently no efforts have been made to develop gene therapy methods for Pompe's disease.

Homologous gene targeting strategies have been used to knock out endogenous genes (Capecchi M.R., Science, 1989, 244, 1288-1292; Smithies O., Nat Med, 2001, 7, 1083-1086) or knock-in exogenous sequences into the genome. It can as well be used for gene correction, and in principle, for the correction of mutations linked with monogenic diseases. However, gene correction is difficult to achieve clinically, due to the low efficiency of the process ( 10^"6 to 10^"9 events per transfected cell). In the last decade, several methods have been developed to enhance this yield. For example, chimeraplasty (de Semir D. et al, J Gene Med, 2003, 5, 625-639) and Small Fragment Homologous Replacement (Goncz K.K. et al. Gene Therapy, 2001, 8, 961-965; Sangiuolo F. et al, BMC Med Genet, 2002, 3, 8; Bruscia E. et al, Gene Ther, 2002, 9, 683-685; De Semir D. and Aran J.M., Oligonucleotides, 2003, 13, 261-269) have both been used to try to correct CFTR mutations with various levels of success.

Another strategy to enhance the efficiency of recombination is to deliver a DNA double-strand break in the targeted locus (Figure 1A), using an enzymatically induced double strand break at or around the locus where recombination is required.

The most accurate way to correct a genetic defect is to use a repair matrix with a non mutated copy of the gene, resulting in a reversion of the mutation. However, the efficiency of gene correction decreases as the distance between the mutation and the DSB grows, with a five-fold decrease by 200 bp of distance. Therefore, a given DNA cleaving enzyme can be used to correct only mutations in the vicinity of its DNA target.

An alternative, termed "exon knock-in^*' is featured in Figure IB. In this case, a meganuclease cleaving in the 5' part of the gene can be used to knock-in functional exonic sequences upstream of the deleterious mutation. Although this method places the transgene in its regular location, it also results in exons duplication, whose long term impact remains to be seen. In addition, should naturally cis-acting elements be placed in an intron downstream of the cleavage, this alteration to the gene environment could also lead to further unwanted effects such as over or under expression of the altered gene. However, this method has a tremendous advantage in that a single DNA cleaving enzyme could be used to correct any mutation affecting a patient.

For this purpose Meganucleases have been identified as a suitable enzyme to induce the required double strand break. Meganucleases are by definition sequence-specific endonucleases recognizing large sequences (Thierry, A. and B. Dujon, Nucleic Acids Res., 1992, 20, 5625-5631). They can cleave unique sites in living cells, thereby enhancing gene targeting by 1000-fold or more in the vicinity of the cleavage site (Puchta et al, Nucleic Acids Res., 1993, 21, 5034-5040 ; Rouet et al, Mol. Cell. Biol., 1994, 14, 8096-8106 ; Choulika et al , Mol. Cell. Biol., 1995, 15, 1968-1973; Puchta et al. , Proc. Natl. Acad. Sci. U.S.A., 1996, 93, 5055-5060 ; Sargent et al , Mol. Cell. Biol, 1997, 17, 267 '-277; Cohen-Tannoudji et al , Mol. Cell. Biol., 1998. 18, 1444-1448 ; Donoho, et al, Mol. Cell. Biol., 1998. 18, 4070-4078; Elliott et al , Mol. Cell. Biol., 1998, 18, 93-101 ).

Although several hundred natural meganucleases, also referred to as "homing endonucleases" have been identified (Chevalier, B.S. and B.L. Stoddard, Nucleic Acids Res., 2001 , 29, 3757-3774), the repertoire of cleavable target sequences is too limited to allow the specific cleavage of a target site in a gene of interest as there is usually no cleavable site in a chosen gene of interest. For example, there is no cleavage site for a known naturally occurring meganuclease in human lysosomal acid a-glucosidase gene. Theoretically, the making of artificial sequence specific endonucleases with chosen specificities could alleviate this limit. To overcome this limitation, an approach adopted by a number of workers in this field is the fusion of Zinc-Finger Proteins (ZFPs) with the catalytic domain of Fokl, a class IIS restriction endonuclease, so as to make functional sequence-specific endonucleases (Smith et al, Nucleic Acids Res., 1999, 27, 674-681 ; Bibikova et al, Mol. Cell. Biol., 2001, 21 , 289-297; Bibikova et al , Genetics, 2002, 161 , 1 169-1175; Bibikova et al, Science, 2003, 300, 764; Porteus, M.H. and D. Baltimore, Science, 2003, 300, 763-; Alwin et al., Mol. Ther., 2005, 12, 610-617; Urnov et al, Nature, 2005, 435, 646-651 ; Porteus, M.H., Mol. Ther., 2006, 13, 438-446). Such ZFP nucleases have recently been used for the engineering of the IL2RG gene in human lymphoid cells (Urnov et al, Nature, 2005, 435, 646-651).

The binding specificity of Cys2-His2 type Zinc-Finger Proteins, is easy to manipulate because specificity is driven by essentially four residues per zinc finger (Pabo et al , Annu. Rev. Biochem., 2001 , 70, 313-340; Jamieson et al , Nat. Rev. Drug Discov., 2003, 2, 361 -368). Studies from the Pabo laboratories have resulted in a large repertoire of novel artificial ZFPs, able to bind most G/ANNG/ANNG/ANN sequences (Rebar, E.J. and CO. Pabo, Science, 1994, 263, 671-673; Kim, J.S. and CO. Pabo, Proc. Natl. Acad. Sci. U S A, 1998, 95, 2812- 2817), Klug (Choo, Y. and A. Klug, Proc, Natl. Acad. Sci. USA, 1994, 91, 1 1163- 1 1 167; Isalan M. and A. Klug, Nat. Biotechnol., 2001 , 19, 656-660) and Barbas (Choo, Y. and A. Klug, Proc. Natl. Acad. Sci. USA, 1994, 91, 1 1 163-11 167; Isalan M. and A. Klug, Nat. Biotechnol., 2001, 19, 656-660).

Nevertheless, ZFPs have serious limitations, especially for applications requiring a very high level of specificity, such as therapeutic applications. It was recently shown that Fokl nuclease activity in ZFP fusion proteins can act with either one recognition site or with two sites separated by variable distances via a DNA loop (Catto et al , Nucleic Acids Res., 2006, 34, 171 1-1720). Thus, the specificities of these ZFP nucleases are degenerate, as illustrated by high levels of toxicity in mammalian cells and Drosophila (Bibikova et al , Genetics, 2002, 161 , 1 169-1175; Bibikova et al, Science, 2003, 300, 764-.).

The inventors seeing these problems have adopted a different approach using engineered meganucleases.

In the wild, meganucleases are essentially represented by homing endonucleases. Homing Endonucleases (HEs) are a widespread family of natural meganucleases including hundreds of proteins families (Chevalier, B.S. and B.L. Stoddard, Nucleic Acids Res., 2001 , 29, 3757-3774). These proteins are encoded by mobile genetic elements which propagate by a process called "homing": the endonuclease cleaves a cognate allele from which the mobile element is absent, thereby stimulating a homologous recombination event that duplicates the mobile DNA into the recipient locus. Given their exceptional cleavage properties in terms of efficacy and specificity, they could represent ideal scaffold to derive novel, highly specific endonucleases.

HEs belong to four major families. The LAGLIDADG family, named after a conserved peptidic motif involved in the catalytic center, is the most widespread and the best characterized group. Seven structures are now available. Whereas most proteins from this family are monomeric and display two LAGLIDADG motifs, a few ones have only one motif, but dimerize to cleave palindromic or pseudo-palindromic target sequences.

Although the LAGLIDADG peptide is the only conserved region among members of the family, these proteins share a very similar architecture (Figure 2A). The catalytic core is flanked by two DNA-bindmg domains with a perfect twofold symmetry for homodimers such as l-Crel (Chevalier, et al , Nat. Struct. Biol., 2001 , 8, 312-3 16) and l-Msol (Chevalier et al, J. Mol. Biol, 2003, 329, 253-269) and with a pseudo symmetry for monomers such as l-Scel (Moure et al , J. Mol. Biol., 2003, 334, 685-69, l-Dmol (Silva et al , J. Mol. Biol., 1999, 286, 1 123-1 136) or l-Anil (Bolduc et al , Genes Dev., 2003, 17, 2875-2888). Both monomers or both domains of monomeric proteins contribute to the catalytic core, organized around divalent cations. Just above the catalytic core, the two LAGLIDADG peptides play also an essential role in the dimerization interface. DNA binding depends on two typical saddle-shaped αββαββα folds, sitting on the DNA major groove. Other domains can be found, for example in inteins such as Pl-Pful (Ichiyanagi et al , J. Mol. Biol., 2000, 300, 889- 901) and ΡΙ-SceI (Moure et al , Nat. Struct. Biol, 2002, 9, 764-770), which protein splicing domain is also involved in DNA binding.

The making of functional chimeric meganucleases, by fusing the N- terminal l-Dmol domain with an l-Crel monomer (Chevalier et al , Mol. Cell., 2002, 1 0, 895-905; Epinat et al , Nucleic Acids Res, 2003, 31 , 2952-62; International PCT Applications WO 03/078619 and WO 2004/03 1346) have demonstrasted the plasticity of meganucleases.

Different groups have used a semi-rational approach to locally alter the specificity of l-Crel (Seligman et al , Genetics, 1997, 147, 1653-1664; Sussman et al , J. Mol. Biol., 2004, 342, 31 -41 ; International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et al , J. Mol. Biol., 2006, 355, 443-458; Rosen et al , Nucleic Acids Res., 2006, 34, 4791 -4800 ; Smith et al , Nucleic Acids Res., 2006, 34, el49), I-Scel (Doyon et al, J. Am. Chem. Soc, 2006, 128, 2477-2484), Pl-Scel (Gimble et al , J. Mol. Biol., 2003 , 334, 993- 1008 ) and l-Msol (Ashworth et al , Nature, 2006. 441 , 656-659).

In addition, hundreds of l-Crel derivatives with locally altered specificity were engineered by combining the semi-rational approach and High Throughput Screening:

- Residues Q44, R68 and R70 or Q44, R68, D75 and 177 of l-Crel were mutagenized and a collection of variants with altered specificity at positions ± 3 to 5 of the DNA target (5NNN DNA target) were identified by screening (International PCT Applications WO 2006/097784 and WO 2006/097853 ; Arnould et al, J. Mol. Biol., 2006, 355, 443-458; Smith et al , Nucleic Acids Res., 2006, 34, el 49).

- Residues K28, N30 and Q38 or N30, Y33, and Q38 or K28, Y33, Q38 and S40 of l-Crel were mutagenized and a collection of variants with altered specificity at positions ± 8 to 10 of the DNA target ( 10NNN DNA target) were identified by screening (Smith et al . Nucleic Acids Res., 2006, 34, el 49; International PCT Applications WO 2007/060495 and WO 2007/049156).

Two different variants were combined and assembled in a functional heterodimeric endonuclease able to cleave a chimeric target resulting from the fusion of a different half of each variant DNA target sequence (Arnould et al , precited; International PCT Applications WO 2006/097854 and WO 2007/034262), as illustrated on figure 2B. Interestingly, the novel proteins had kept proper folding and stability, high activity, and a narrow specificity.

Furthermore, residues 28 to 40 and 44 to 77 of l-Crel were shown to form two separable functional subdomains, able to bind distinct parts of a homing endonuclease half-site (Smith et al. Nucleic Acids Res., 2006, 34, el 49; International PCT Applications WO 2007/049095 and WO 2007/057781 ).

The combination of mutations from the two subdomains of l-Crel within the same monomer allowed the design of novel chimeric molecules (homodimers) able to cleave a palindromic combined DNA target sequence comprising the nucleotides at positions ± 3 to 5 and + 8 to 10 which are bound by each subdomain (Smith et al , Nucleic Acids Res., 2006, 34, el49; International PCT Applications WO 2007/060495 and WO 2007/0491 6), as illustrated on figure 2C.

The combination of the two former steps allows a larger combinato- rial approach, involving four different subdomains. The different subdomains can be modified separately and combined to obtain an entirely redesigned meganuclease variant (heterodimer or single-chain molecule) with chosen specificity, as illustrated on figure 2D. In a first step, couples of novel meganucleases are combined in new molecules ("half-meganucleases") cleaving palindromic targets derived from the target one wants to cleave. Then, the combination of such "half-meganuclease" can result in a heterodimeric species cleaving the target of interest. The assembly of four sets of mutations into heterodimeric endonucleases cleaving a model target sequence or a sequence from different genes has been described in the following patent applications: XPC gene (WO2007093918), RAG gene (WO2008010093), HPRT gene (WO2008059382), beta-2 microglobulin gene (WO2008102274), Rosa26 gene (WO2008152523) and Human hemoglobin beta gene (WO200913622).

These variants can be used to cleave genuine chromosomal sequences and have paved the way for novel perspectives in several fields, including gene therapy.

However, even though the base-pairs ±1 and ±2 do not display any contact with the protein, it has been shown that these positions are not devoid of content information (Chevalier et al , J. Mol. Biol., 2003, 329, 253-269), especially for the base-pair ±1 and could be a source of additional substrate specificity (Argast et al, J. Mol. Biol., 1998, 280, 345-353 ; Jurica et al, Mol. Cell., 1998, 2, 469-476; Chevalier, B.S. and B.L. Stoddard, Nucleic Acids Res., 2001 , 29, 3757-3774). In vitro selection of cleavable l-Crel target (Argast et al., precited) randomly mutagenized, revealed the importance of these four base-pairs on protein binding and cleavage activity. It has been suggested that the network of ordered water molecules found in the active site was important for positioning the DNA target (Chevalier et al , Biochemistry, 2004, 43, 14015-14026). In addition, the extensive confomiational changes that appear in this region upon l-Crel binding suggest that the four central nucleotides could contribute to the substrate specificity, possibly by sequence dependent conformational preferences (Chevalier et al , 2003, precited).

Unexpectedly the inventors have now found active new endonucleases that cleave targets containing changes in these four central nucleotides, which are

in the wildtype l-Crel target. These variants could be used to induce a double strand break in the Human Lysomal Acid oc-Glucosidase Gene (GAA) gene and hence allow the replacement and/or alteration of an endogenous GAA allele(s) so as to treat Pompe's disease and also to allow further experimental study of this important disease in cellular or other types of model systems.

Therefore according to a first aspect of the present invention there is provided an l-Crel variant, characterized in that at least one of the two l-Crel monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG core domain situated from positions 26 to 40 and 44 to 77 of I- Crel, said variant being able to cleave a DNA target sequence from GAA and being obtainable by a method comprising at least the steps of:

(a) constructing a first series of l-Crel variants having at least one substitution in a first functional subdomain of the LAGLIDADG core domain situated from positions 26 to 40 of l-Crel,

(b) constructing a second series of I-Oel variants having at least one substitution in a second functional subdomain of the LAGLIDADG core domain situated from positions 44 to 77 of l-Crel,

(c) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant l-Crel site wherein at least one of (i) the nucleotide triplet in positions -10 to -8 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA,

(d) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein at least one of (i) the nucleotide triplet in positions -5 to -3 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions +3 to +5 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in position -5 to -3 of said DNA target sequence from GAA,

(e) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant I-Oel site wherein at least one of (i) the nucleotide triplet in positions +8 to +10 of the I-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -10 to -8 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA,

(f) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein at least one of (i) the nucleotide triplet in positions +3 to +5 of the \-Crel site has been replaced with the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -5 to -3 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA,

(g) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (c) and step (d), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions -10 to -8 is identical to the nucleotide triplet which is present in positions - 10 to -8 of said DNA target sequence from GAA, (ii) the nucleotide triplet in positions +8 to +10 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA, (iii) the nucleotide triplet in positions -5 to -3 is identical to the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA and (iv) the nucleotide triplet in positions +3 to +5 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA, and/or

(h) combining in a single variant, the mutation(s) in positions 26 to

40 and 44 to 77 of two variants from step (e) and step (f), to obtain a novel homodimeric I-Oel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -10 to -8 is identical to the reverse complementary sequence of the nucleotide triplet in positions +8 to +10 of said DNA target sequence from GAA, (iii) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA, (iv) the nucleotide triplet in positions -5 to -3 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA,

(i) combining the variants obtained in steps (g) and (h) to form heterodimers, and

(j) selecting and/or screening from the heterodimers of step (i) those heterodimers which are able to cleave a sequence wherein (i) the nucleotide triplet in positions +8 to +10 of the I-Oel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and

(ii) the nucleotide triplet in positions -10 to -8 is identical to the sequence of the nucleotide triplet in positions +8 to +10 of said DNA target sequence from GAA and

(iii) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and

(iv) the nucleotide triplet in positions -5 to -3 is identical to the sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and (v) wherein the nucleotides at positions -2 to +2 are identical to the nucleotides which are present at positions -2 to +2 of said DNA target sequence from GAA,

(k) selecting and/or screening from those selected heterodimers from step (j), those heterodimers which are able to cleave said DNA target sequence from GAA.

In the present Patent Application the terms meganuclease(s) and variant (s) and variant meganuclease(s) will be used interchangeably herein.

One of the step(s) (c), (d), (e), (f), (i) or (k) may be omitted. For example, if step (c) is omitted, step (d) is performed with a mutant l-Crel target wherein both nucleotide triplets at positions -10 to -8 and -5 to -3 have been replaced with the nucleotide triplets which are present at positions -10 to -8 and -5 to -3, respectively of said genomic target, and the nucleotide triplets at positions +3 to +5 and +8 to +10 have been replaced with the reverse complementary sequence of the nucleotide triplets which are present at positions -5 to -3 and -10 to -8, respectively of said genomic target.

The (intramolecular) combination of mutations in steps (g) and (h) may be performed by amplifying overlapping fragments comprising each of the two subdomains, according to well-known overlapping PCR techniques.

The (intermolecular) combination of the variants in step (i) is performed by co-expressing one variant from step (g) with one variant from step (h), so as to allow the formation of heterodimers. For example, host cells may be modified by one or two recombinant expression vector(s) encoding said variant(s). The cells are then cultured under conditions allowing the expression of the variant(s), so that heterodimers are formed in the host cells, as described previously in the International PCT Application WO 2006/097854 and Arnould et al, J. Mol. Biol, 2006, 355, 443- 458.

The selection and/or screening in steps (c), (d), (e), (f), (j) and/or (k) may be performed by measuring the cleavage activity of the variant according to the invention by any well-known, in vitro or in vivo cleavage assay, such as those described in the International PCT Application WO 2004/067736; Epinat et al, Nucleic Acids Res., 2003, 31 , 2952-2962; Chames et al, Nucleic Acids Res., 2005, 33, el78; Arnould et al, J. Mol. Biol, 2006, 355, 443-458, and Arnould et al, J. Mol. Biol., 2007, 371, 49-65. For example, the cleavage activity of the variant of the invention may be measured by a direct repeat recombination assay, in yeast or mammalian cells, using a reporter vector. The reporter vector comprises two truncated, non-functional copies of a reporter gene (direct repeats) and the genomic (non-palindromic) DNA target sequence within the intervening sequence, cloned in yeast or in a mammalian expression vector. Usually, the genomic DNA target sequence comprises one different half of each (palindromic or pseudo-palindromic) parent homodimeric l-Crel meganuclease target sequence. Expression of the heterodimeric variant results in a functional endonuclease which is able to cleave the genomic DNA target sequence. This cleavage induces homologous recombination between the direct repeats, resulting in a functional reporter gene, whose expression can be monitored by an appropriate assay. The cleavage activity of the variant against the genomic DNA target may be compared to wild type l-Crel or l-Scel activity against their natural target.

According to another advantageous embodiment of said method, steps (c), (d), (e), (f), (j) and/or (k) are performed in vivo, under conditions where the double-strand break in the mutated DNA target sequence which is generated by said variant leads to the activation of a positive selection marker or a reporter gene, or the inactivation of a negative selection marker or a reporter gene, by recombination- mediated repair of said DNA double-strand break.

Furthermore, the homodimeric combined variants obtained in step (g) or (h) are advantageously submitted to a selection/screening step to identify those which are able to cleave a pseudo-palindromic sequence wherein at least the nucleotides at positions -11 to -3 (combined variant of step (g)) or +3 to +11 (combined variant of step (h)) are identical to the nucleotides which are present at positions -1 1 to -3 (combined variant of step (g)) or +3 to +11 (combined variant of step (h)) of said genomic target, and the nucleotides at positions +3 to +11 (combined variant of step (g)) or -11 to -3 (combined variant of step (h)) are identical to the reverse complementary sequence of the nucleotides which are present at positions -11 to -3 (combined variant of step (g)) or +3 to +1 1 (combined variant of step (h)) of said genomic target.

Preferably, the set of combined variants of step (g) or step (h) (or both sets) undergoes an additional selection/screening step to identify the variants which are able to cleave a pseudo-palindromic sequence wherein :

(1 ) the nucleotides at positions -1 1 to -3 (combined variant of step g)) or +3 to +1 1 (combined variant of step (h)) are identical to the nucleotides which are present at positions -1 1 to -3 (combined variant of step (g)) or +3 to +11 (combined variant of step h)) of said genomic target, and

(2) the nucleotides at positions +3 to +1 1 (combined variant of step (g)) or -1 1 to -3 (combined variant of step (h)) are identical to the reverse complementary sequence of the nucleotides which are present at positions - 1 1 to -3 (combined variant of step (g)) or +3 to +1 1 (combined variant of step (h)) of said genomic target.

This additional screening step increases the probability of isolating heterodimers which are able to cleave the genomic target of interest (step (k)).

Steps (a), (b), (g), (h) and (i) may further comprise the introduction of additional mutations at other positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target, at positions which improve the binding and/or cleavage properties of the variants, or at positions which either prevent or impair the formation of functional homodimers or favor the formation of the heterodimer, as defined above.

The additional mutations may be introduced by site-directed mutagenesis and/or random mutagenesis on a variant or on a pool of variants, according to standard mutagenesis methods which are well-known in the art, for example by using PCR.

In particular, random mutations may be introduced into the whole variant or in a part of the variant, in particular the C-terminal half of the variant (positions 80 to 163) to improve the binding and/or cleavage properties of the variants towards the DNA target from the gene of interest.

Site-directed mutagenesis at positions which improve the binding and/or cleavage properties of the variants, for example at positions 19, 54, 80, 87, 105 and /or 132, may also be combined with random-mutagenesis. The mutagenesis may be performed by generating random/site-directed mutagenesis libraries on a pool of variants, according to standard mutagenesis methods which are well-known in the art. Site-directed mutagenesis may be advantageously performed by amplifying overlapping fragments comprising the mutated position(s), as defined above, according to well-known overlapping PCR techniques. In addition, multiple site- directed mutagenesis, may advantageously be performed on a variant or on a pool of variants.

Preferably, the mutagenesis is performed on one monomer of the heterodimer formed in step (i), step (j) or step (k), advantageously on a pool of monomers, preferably on both monomers of the heterodimer of step (i), (j) or (k). Preferably, at least two rounds of selection/screening are performed according to the process illustrated Arnould et al, J. Mol. Biol., 2007, 371, 49-65. In the first round, one of the monomers of the heterodimer is mutagenised, co-expressed with the other monomer to form heterodimers, and the improved monomers Y⁺ are selected against the target from the gene of interest. In the second round, the other monomer (monomer X) is mutagenised, co-expressed with the improved monomers Y⁺ to form heterodimers, and selected against the target from the gene of interest to obtain meganucleases (X⁺ Y⁺) with improved activity. The mutagenesis may be random-mutagenesis or site-directed mutagenesis on a monomer or on a pool of monomers, as indicated above. Both types of mutagenesis are advantageously combined. Additional rounds of selection/screening on one or both monomers may be performed to improve the cleavage activity of the variant.

Preferably the variant may be obtained by a method comprising the additional steps of:

(1) selecting heterodimers from step (k) and constructing a third series of variants having at least one substitution in at least one of the monomers in said selected heterodimers,

(m) combining said third series variants of step (1) and screening the resulting heterodimers for altered cleavage activity against said DNA target from GAA.

Preferably in step (1) at least one substitution is introduced by site directed mutagenesis in a DNA molecule encoding said third series of variants, and/or by random mutagenesis in a DNA molecule encoding said third series of variants.

Preferably steps (1) and (m) are repeated at least two times and wherein the heterodimers selected in step (1) of each further iteration are selected from heterodimers screened in step (m) of the previous iteration which showed altered cleavage activity against said DNA target from GAA.

Target sequences can be chosen in any region of the GAA, but in particular are best positioned as close as possible to the locations of known disease causing mutations wherein the variant is for use in a gene repair therapy using a DNA repair matrix. Or alternatively the target sequence may be chosen at the beginning of GAA if the variant is for use in an "exon knock-in" method. The Inventors have identified a series of DNA targets in the human lysosomal acid cc-glucosidase gene that are cleavable by l-Crel variants (Table 1).

5 Table 1 : list of DNA target within the GAA gene cleavable by I-Crel variants.

I-Crel variants to these targets were created using a combinatorial approach, to entirely redesign the DNA binding domain of the I-Crel protein and thereby engineer novel meganucleases with fully engineered specificity for the desired 10 GAA target.

The combinatorial approach, as illustrated in Figure 2D was used to entirely redesign the DNA binding domain of the \-Cre\ protein and thereby engineer novel meganucleases with fully engineered specificity, to cleave one DNA target named GAA2.

In particular the heterodimer of step (i) may comprise monomers obtained in steps (g) and (h), with the same DNA target recognition and cleavage activity properties.

Alternatively the heterodimer of step (i) may comprise monomers obtained in steps (g) and (h), with different DNA target recognition and cleavage activity properties.

In particular the first series of I-Crel variants of step (a) are derived from a first parent meganuclease.

In particular the second series of variants of step (b) are derived from a second parent meganuclease.

In particular the first and second parent meganucleases are identical.

Alternatively the first and second parent meganucleases are different.

In particular the variant may be obtained by a method comprising the additional steps of:

(k) selecting heterodimers from step (j) and constructing a third series of variants having at least one substitution in at least one of the monomers of said selected heterodimers,

(1) combining said third series variants of step (k) and screening the resulting heterodimers for enhanced cleavage activity against said DNA target from the GAA.

In a preferred embodiment of said variant, said substitution(s) in the subdomain situated from positions 44 to 77 of I-Crel are at positions 44, 68, 70, 75 and/or 77.

In another preferred embodiment of said variant, said substitution(s) in the subdomain situated from positions 28 to 40 of l-Crel are at positions 28, 30, 32, 33, 38 and/or 40.

In another preferred embodiment of said variant, it comprises one or more mutations at positions of other amino acid residues that contact the DNA target sequence or interact with the DNA backbone or with the nucleotide bases, directly or via a water molecule; these residues are well-known in the art (Jurica et al. , Molecular Cell., 1998, 2, 469-476; Chevalier et al, J. Mol. Biol, 2003, 329, 253-269). In particular, additional substitutions may be introduced at positions contacting the phosphate backbone, for example in the final C-terminal loop (positions 137 to 143 ; Prieto et al , Nucleic Acids Res., Epub 22 April 2007).

Preferably said residues are involved in binding and cleavage of said DNA cleavage site.

More preferably, said residues are at positions 138, 139, 142 or 143 of l-Crel. Two residues may be mutated in one variant provided that each mutation is in a different pair of residues chosen from the pair of residues at positions 138 and 139 and the pair of residues at positions 142 and 143. The mutations which are introduced modify the interaction(s) of said amino acid(s) of the final C-terminal loop with the phosphate backbone of the l-Crel site. Preferably, the residue at position 138 or 139 is substituted by a hydrophobic amino acid to avoid the formation of hydrogen bonds with the phosphate backbone of the DNA cleavage site. For example, the residue at position 138 is substituted by an alanine or the residue at position 139 is substituted by a methionine. The residue at position 142 or 143 is advantageously substituted by a small amino acid, for example a glycine, to decrease the size of the side chains of these amino acid residues.

More preferably, said substitution in the final C-terminal loop modify the specificity of the variant towards the nucleotide at positions ± 1 to 2, ± 6 to 7 and/or ± 1 1 to 12 of the l-Crel site.

In another preferred embodiment of said variant, it comprises one or more additional mutations that improve the binding and/or the cleavage properties of the variant towards the DNA target sequence from the GAA gene.

The additional residues which are mutated may be on the entire I- Crel sequence, and in particular in the C-terminal half of I-Oel (positions 80 to 163). Both l-Crel monomers are advantageously mutated; the mutation(s) in each monomer may be identical or different. For example, the variant comprises one or more additional substitutions at positions: 2, 19, 43, 80 and 81. Said substitutions are advantageously selected from the group consisting of: N2S, G19S, F43L, E80K and 18 IT. More preferably, the variant comprises at least one substitution selected from the group consisting of: N2S, G19S, F43L, E80K and I81T. The variant may also comprise additional residues at the C-terminus. For example a glycine (G) and/or a proline (P) residue may be inserted at positions 164 and 165 of l-Crel, respectively.

According to a preferred embodiment, said additional mutation in said variant further impairs the formation of a functional homodimer. More preferably, said mutation is the G19S mutation. The G19S mutation is advantageously introduced in one of the two monomers of a heterodimeric l-Crel variant, so as to obtain a meganuclease having enhanced cleavage activity and enhanced cleavage specificity. In addition, to enhance the cleavage specificity further, the other monomer may carry a distinct mutation that impairs the formation of a functional homodimer or favors the formation of the heterodimer.

In another preferred embodiment of said variant, said substitutions are replacement of the initial amino acids with amino acids selected from the group consisting of: A, D, E, G, H, K, N, P, Q, R, S, T, Y, C, V, L, M, F, I and W.

In particular the variant is selected from the group consisting of SEQ

ID NO: 19 to 46, 66 to 103, 106 and 1 15 to 193.

Most particularly is selected from the group consisting of SEQ ID NO: 19 to 46, 66 to 103, 106, and 1 15 to 193 and 195 to 203.

In order to verify that the methods according to the present invention were able to generate variants cleaving both GAA targets which vary in the 2NN portion of the target (+2 to -2) and targets which do not, the inventors identified targets in the GAA gene in which the relevant 2NN portions were either identical to the 2NN portion of the wild type l-Crel target or not. The inventors have shown that it is possible to generate variants recognizing and cleaving these two classes of GAA targets, therefore increasing further the utility of the variants according to the present invention.

The variant of the invention may be derived from the wild-type I- Crel (SEQ ID NO: 1 ) or an l-Crel scaffold protein having at least 85 % identity, preferably at least 90 % identity, more preferably at least 95 % identity with SEQ ID NO: 1 , such as the scaffold called l-Crel N75 (167 amino acids; SEQ ID NO: 107) having the insertion of an alanine at position 2, and the insertion of AAD at the C- terminus (positions 164 to 166) of the l-Crel sequence. In addition, the variants of the invention may include one or more residues inserted at the NH₂ terminus and/or COOH terminus of the sequence. For example, a tag (epitope or polyhistidine sequence) is introduced at the NH₂ terminus and/or COOH terminus; said tag is useful for the detection and/or the purification of said variant. The variant may also comprise a nuclear localization signal (NLS); said NLS is useful for the importation of said variant into the cell nucleus. The NLS may be inserted just after the first methionine of the variant or just after an N-terminal tag.

The variant according to the present invention may be a homodimer which is able to cleave a palindromic or pseudo-palindromic DNA target sequence.

Alternatively, said variant is a heterodimer, resulting from the association of a first and a second monomer having different substitutions at positions 28 to 40 and 44 to 77 of l-Crel, said heterodimer being able to cleave a non- palindromic DNA target sequence from the GAA gene.

The DNA target sequences are situated in the GAA ORF and these sequences cover all the GAA ORF (Table 1).

The sequence of each l-Crel variant is defined by the mutated residues at the indicated positions. The positions are indicated by reference to I-CVel sequence (SEQ ID NO: 1) ; I-Crel has N, S, Y, Q, S, Q, R, R, D, I and E at positions 30, 32, 33, 38, 40, 44, 68, 70, 75, 77 and 80 respectively.

Each monomer (first monomer and second monomer) of the heterodimeric variant according to the present invention may also be named with a letter code, after the eleven residues at positions 28, 30, 32, 33, 38, 40, 44, 68 and 70, 75 and 77 and the additional residues which are mutated, as indicated above. For example, 2S/28K30G32S33Y38A40S/44 68A70S75N77I/81 T (SEQ ID NO: 41).

The heterodimeric variant as defined above may have only the amino acid substitutions as indicated above. In this case, the positions which are not indicated are not mutated and thus correspond to the wild-type l-Crel (SEQ ID NO: 1)-

Preferred heterodimeric variants cleaving the GAA2 target are presented in Table 2.

First I-Crel variant Second l-Crel variant

Sequence Sequence SEQ

Table 2: List of mutants cleaving the GAA2 target

The invention encompasses l-Crel variants having at least 85 % identity, preferably at least 90 % identity, more preferably at least 95 % (96 %, 97 %, 98 %, 99 %) identity with the sequences as defined above, said variant being able to cleave a DNA target from the GAA gene.

The heterodimeric variant is advantageously an obligate heterodimer variant having at least one interesting pair of mutations corresponding to residues of the first and the second monomers which make an intermolecular interaction between the two l-Crel monomers, wherein the first mutation of said pair(s) is in the first monomer and the second mutation of said pair(s) is in the second monomer and said pair(s) of mutations prevent the formation of functional homodimers from each monomer and allow the formation of a functional heterodimer, able to cleave the genomic DNA target from the GAA gene.

To form an obligate heterodimer, the monomers have advantageously at least one of the following pairs of mutations, respectively for the first monomer and the second monomer:

a) the substitution of the glutamic acid at position 8 with a basic amino acid, preferably an arginine (first monomer) and the substitution of the lysine at position 7 with an acidic amino acid, preferably a glutamic acid (second monomer); the first monomer may further comprise the substitution of at least one of the lysine residues at positions 7 and 96, by an arginine,

b) the substitution of the glutamic acid at position 61 with a basic amino acid, preferably an arginine (first monomer) and the substitution of the lysine at position 96 with an acidic amino acid, preferably a glutamic acid (second monomer); the first monomer may further comprise the substitution of at least one of the lysine residues at positions 7 and 96, by an arginine,

c) the substitution of the leucine at position 97 with an aromatic amino acid, preferably a phenylalanine (first monomer) and the substitution of the phenylalanine at position 54 with a small amino acid, preferably a glycine (second monomer); the first monomer may further comprise the substitution of the phenylalanine at position 54 by a tryptophane and the second monomer may further comprise the substitution of the leucine at position 58 or lysine at position 57, by a methionine, and

d) the substitution of the aspartic acid at position 137 with a basic amino acid, preferably an arginine (first monomer) and the substitution of the arginine at position 51 with an acidic amino acid, preferably a glutamic acid (second monomer).

For example, the first monomer may have the mutation D 137R and the second monomer, the mutation R51 D. The obligate heterodimer meganuclease comprises advantageously, at least two pairs of mutations as defined in a), b), c) or d), above; one of the pairs of mutation is advantageously as defined in c) or d). Preferably, one monomer comprises the substitution of the lysine residues at positions 7 and 96 by an acidic amino acid (aspartic acid (D) or glutamic acid (E)), preferably a glutamic acid ( 7E and K96E) and the other monomer comprises the substitution of the glutamic acid residues at positions 8 and 61 by a basic amino acid (arginine (R) or lysine ( ); for example, E8K and E61R). More preferably, the obligate heterodimer meganuclease, comprises three pairs of mutations as defined in a), b) and c), above.

The obligate heterodimer meganuclease consists advantageously of a first monomer (A) having at least the mutations (i) E8R, E8K or E8H, E61R, E61 K or E61 H and L97F, L97 W or L97Y; (ii) K7R, E8R, E61 R, K96R and L97F, or (iii) K7R, E8R, F54W, E61R, K96R and L97F and a second monomer (B) having at least the mutations (iv) K7E or K7D, F54G or F54A and 96D or K96E; (v) K7E, F54G, L58M and K96E, or (vi) K7E, F54G, K57M and K96E. For example, the first monomer may have the mutations K7R, E8R or E8K, E61R, K96R and L97F or K7R, E8R or E8K, F54W, E61R, K96R and L97F and the second monomer, the mutations K7E, F54G, L58M and K96E or K7E, F54G, K57M and K96E. The obligate heterodimer may comprise at least one NLS and/or one tag as defined above; said NLS and/or tag may be in the first and/or the second monomer

The subject-matter of the present invention is also a single-chain chimeric meganuclease (fusion protein) derived from an I-Oel variant as defined above. The single-chain meganuclease may comprise two I-Oel monomers, two I- Crel core domains (positions 6 to 94 of l-CreY) or a combination of both. Preferably, the two monomers /core domains or the combination of both, are connected by a peptidic linker.

The subject-matter of the present invention is also a polynucleotide fragment encoding a variant or a single-chain chimeric meganuclease as defined above; said polynucleotide may encode one monomer of a homodimeric or heterodimeric variant, or two domains/monomers of a single-chain chimeric meganuclease.

The subject-matter of the present invention is also a recombinant vector for the expression of a variant or a single-chain meganuclease according to the invention. The recombinant vector comprises at least one polynucleotide fragment encoding a variant or a single-chain meganuclease, as defined above. In a preferred embodiment, said vector comprises two different polynucleotide fragments, each encoding one of the monomers of a heterodimeric variant.

A vector which can be used in the present invention includes, but is not limited to, a viral vector, a plasmid, a RNA vector or a linear or circular DNA or RNA molecule which may consists of a chromosomal, non chromosomal, semisynthetic or synthetic nucleic acids. Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those skilled in the art and commercially available.

Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno- associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis virus), paramyxovirus (e. g. measles and Sendai), positive strand RNA viruses such as picor- navirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e. g., vaccinia, fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses include: avian leukosis- sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffm, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).

Preferred vectors include lentiviral vectors, and particularly self inactivacting lentiviral vectors.

Vectors can comprise selectable markers, for example: neomycin phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase, hygromycin phosphotransferase, herpes simplex virus thymidine kinase, adenosine deaminase, Glutamine Synthetase, and hypoxanthine-guanine phosphoribosyl transferase for eukaryotic cell culture; TRP1, URA3 and LEU2 for S. cerevisiae; tetracycline, rifampicin or ampicillin resistance in E. coli.

Preferably said vectors are expression vectors, wherein the sequence(s) encoding the variant/single-chain meganuclease of the invention is placed under control of appropriate transcriptional and translational control elements to permit production or synthesis of said variant. Therefore, said polynucleotide is comprised in an expression cassette. More particularly, the vector comprises a repli- cation origin, a promoter operatively linked to said polynucleotide, a ribosome- binding site, an RNA-splicing site (when genomic DNA is used), a polyadenylation site and a transcription termination site. It also can comprise an enhancer. Selection of the promoter will depend upon the cell in which the polypeptide is expressed. Preferably, when said variant is a heterodimer, the two polynucleotides encoding each of the monomers are included in one vector which is able to drive the expression of both polynucleotides, simultaneously. Suitable promoters include tissue specific and/or inducible promoters. Examples of inducible promoters are: eukaryotic metallothionine promoter which is induced by increased levels of heavy metals, prokaryotic lacZ promoter which is induced in response to isopropyl- -D-thiogalacto- pyranoside (IPTG) and eukaryotic heat shock promoter which is induced by increased temperature. Examples of tissue specific promoters are skeletal muscle creatine kinase, prostate-specific antigen (PSA), a-antitrypsin protease, human surfactant (SP) A and B proteins, β-casein and acidic whey protein genes.

According to another advantageous embodiment of said vector, it includes a targeting construct comprising sequences sharing homologies with the region surrounding the genomic DNA cleavage site as defined above.

For instance, said sequence sharing homologies with the regions surrounding the genomic DNA cleavage site of the variant is a fragment of the human GAA gene comprising position 1 to position 4000 of SEQ ID NO: 3. Alternatively, the vector coding for an l-Crel variant/single-chain meganuclease and the vector comprising the targeting construct are different vectors.

More preferably, the targeting DNA construct comprises: a) sequences sharing homologies with the region surrounding the genomic DNA cleavage site as defined above, and

b) a sequence to be introduced flanked by sequences as in a) or included in sequences as in a).

Preferably, homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used. Therefore, the targeting DNA construct is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb. Indeed, shared DNA homologies are located in regions flanking upstream and downstream the site of the break and the DNA sequence to be introduced should be located between the two arms. The sequence to be introduced may be any sequence used to alter the chromosomal DNA in some specific way including a sequence used to repair a mutation in the GAA gene, restore a functional GAA gene in place of a mutated one, modify a specific sequence in the GAA gene, to attenuate or activate the GAA gene, to inactivate or delete the GAA gene or part thereof, to introduce a mutation into a site of interest or to introduce an exogenous gene or part thereof. Such chromosomal DNA alterations are used for genome engineering (animal models/recombinant cell lines) or genome therapy (gene correction or recovery of a functional gene). The targeting construct comprises advantageously a positive selection marker between the two homology arms and eventually a negative selection marker upstream of the first homology arm or downstream of the second homology arm. The marker(s) allow(s) the selection of cells having inserted the sequence of interest by homologous recombination at the target site.

The sequence to be introduced is a sequence which repairs a mutation in the GAA gene (gene correction or recovery of a functional gene), for the purpose of genome therapy (figure 1A and IB). For correcting the GAA gene, cleavage of the gene occurs in the vicinity of the mutation, preferably, within 500 bp of the mutation (Figure IB). The targeting construct comprises a GAA gene fragment which has at least 200 bp of homologous sequence flanking the target site (minimal repair matrix) for repairing the cleavage, and includes a sequence encoding a portion of wild-type GAA gene corresponding to the region of the mutation for repairing the mutation (Figure IB). Consequently, the targeting construct for gene correction comprises or consists of the minimal repair matrix; it is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb. Preferably, when the cleavage site of the variant overlaps with the mutation the repair matrix includes a modified cleavage site that is not cleaved by the variant which is used to induce said cleavage in the GAA gene and a sequence encoding wild-type GAA that does not change the open reading frame of the GAA gene.

Alternatively, for making knock-in cells/animals, the targeting DNA construct comprises a GAA gene fragment which has at least 200 bp of homologous sequence flanking the target site of the l-Crel variant for repairing the cleavage, the sequence of an exogenous gene of interest included in an expression cassette and eventually a selection marker such as the neomycin resistance gene.

For the insertion of a sequence, DNA homologies are generally located in regions directly upstream and downstream to the site of the break (sequences immediately adjacent to the break; minimal repair matrix). However, when the insertion is associated with a deletion of ORF sequences flanking the cleavage site, shared DNA homologies are located in regions upstream and downstream the region of the deletion.

Alternatively, for restoring a functional gene (Figures 1A et IB), cleavage of the gene occurs upstream of a mutation. Preferably said mutation is the first known mutation in the sequence of the gene, so that all the downstream mutations of the gene can be corrected simultaneously. The targeting construct comprises the exons downstream of the cleavage site fused in frame (as in the cDNA) and with a polyadenylation site to stop transcription in 3'. The sequence to be introduced (exon knock-in construct) is flanked by introns or exons sequences surrounding the cleavage site, so as to allow the transcription of the engineered gene (exon knock-in gene) into a m NA able to code for a functional protein (Figure IB). For example, the exon knock-in construct is flanked by sequences upstream and downstream of the cleavage site, from a minimal repair matrix as defined above.

The subject matter of the present invention is also a targeting DNA construct as defined above.

The subject-matter of the present invention is also a composition characterized in that it comprises at least one meganuclease as defined above (variant or single-chain chimeric meganuclease) and/or at least one expression vector encoding said meganuclease, as defined above.

In a preferred embodiment of said composition, it comprises a targeting DNA construct, as defined above.

Preferably, said targeting DNA construct is either included in a recombinant vector or it is included in an expression vector comprising the polynucleotide(s) encoding the meganuclease according to the invention.

The subject-matter of the present invention is further the use of a meganuclease as defined above, one or two polynucleotide(s), preferably included in expression vector(s), for reparing mutations of the GAA gene.

According to an advantageous embodiment of said use, it is for inducing a double-strand break in a site of interest of the GAA gene comprising a genomic DNA target sequence, thereby inducing a DNA recombination event, a DNA loss or cell death.

According to the invention, said double-strand break is for: repairing a specific sequence in the GAA gene, modifying a specific sequence in the GAA gene, restoring a functional GAA gene in place of a mutated one, attenuating or activating the GAA gene, introducing a mutation into a site of interest of the GAA gene, introducing an exogenous gene or a part thereof, inactivating or deleting the GAA gene or a part thereof, translocating a chromosomal arm, or leaving the DNA unrepaired and degraded.

The subject-matter of the present invention is also a method for making a GAA knock-out or knock-in recombinant cell, comprising at least the step of:

(a) introducing into a cell, a meganuclease as defined above (I-Oel variant or single-chain derivative), so as to induce a double stranded cleavage at a site of interest of the GAA gene comprising a DNA recognition and cleavage site for said meganuclease, simultaneously or consecutively,

(b) introducing into the cell of step (a), a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a recombinant cell having repaired the site of interest by homologous recombination,

(c) isolating the recombinant cell of step (b), by any appropriate means.

The subject-matter of the present invention is also a method for making a GAA knock-out or knock-in animal, comprising at least the step of:

(a) introducing into a pluripotent precursor cell or an embryo of an animal, a meganuclease as defined above, so as to induce a double stranded cleavage at a site of interest of the GAA gene comprising a DNA recognition and cleavage site for said meganuclease, simultaneously or consecutively,

(b) introducing into the animal precursor cell or embryo of step (a) a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA, so as to generate a genomically modified animal precursor cell or embryo having repaired the site of interest by homologous recombination,

(c) developing the genomically modified animal precursor cell or embryo of step (b) into a chimeric animal, and

(d) deriving a transgenic animal from the chimeric animal of step

(c).

Preferably, step (c) comprises the introduction of the genomically modified precursor cell generated in step (b) into blastocysts so as to generate chimeric animals.

The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest.

For making knock-out cells/animals, the DNA which repairs the site of interest comprises sequences that inactivate the GAA gene.

For making knock-in cells/animals, the DNA which repairs the site of interest comprises the sequence of an exogenous gene of interest, and eventually a selection marker, such as the neomycin resistance gene.

In a preferred embodiment, said targeting DNA construct is inserted in a vector. The subject-matter of the present invention is also a method for making a GAA-deficient cell, comprising at least the step of:

(a) introducing into a cell, a meganuclease as defined above, so as to induce a double stranded cleavage at a site of interest of the GAA gene comprising a DNA recognition and cleavage site of said meganuclease, and thereby generate genomically modified GAA deficient cell having repaired the double-strands break, by non-homologous end joining, and

(b) isolating the genomically modified GAA deficient cell of step (a), by any appropriate mean.

The subject-matter of the present invention is also a method for making a GAA knock-out animal, comprising at least the step of:

(a) introducing into a pluripotent precursor cell or an embryo of an animal, a meganuclease, as defined above, so as to induce a double stranded cleavage at a site of interest of the GAA gene comprising a DNA recognition and cleavage site of said meganuclease, and thereby generate genomically modified precursor cell or embryo having repaired the double-strands break by non-homologous end joining,

(b) developing the genomically modified animal precursor cell or embryo of step (a) into a chimeric animal, and

(c) deriving a transgenic animal from a chimeric animal of step (b). Preferably, step (b) comprises the introduction of the genomically modified precursor cell obtained in step (a), into blastocysts, so as to generate chimeric animals.

The cells which are modified may be any cells of interest. For making knock-in/transgenic mice, the cells are pluripotent precursor cells such as embryo-derived stem (ES) cells, which are well-known in the art. For making recombinant human cell lines, the cells may advantageously be PerC6 (Fallaux et al., Hum. Gene Ther. 9, 1909-1917, 1998) or HEK293 (ATCC # CRL-1573) cells.

The animal is preferably a mammal, more preferably a laboratory rodent (mice, rat, guinea-pig), or a cow, pig, horse or goat.

Said meganuclease can be provided directly to the cell or through an expression vector comprising the polynucleotide sequence encoding said meganuclease and suitable for its expression in the used cell. For making recombinant cell lines expressing an heterologous protein of interest, the targeting DNA comprises a sequence encoding the product of interest (protein or RNA), and eventually a marker gene, flanked by sequences upstream and downstream the cleavage site, as defined above, so as to generate genomically modified cells having integrated the exogenous sequence of interest in the GAA gene, by homologous recombination.

The sequence of interest may be any gene coding for a certain protein/peptide of interest, included but not limited to: reporter genes, receptors, signaling molecules, transcription factors, pharmaceutically active proteins and peptides, disease causing gene products and toxins. The sequence may also encode an RNA molecule of interest including for example a siRNA.

The expression of the exogenous sequence may be driven, either by the endogenous GAA gene promoter or by a heterologous promoter, preferably a ubiquitous or tissue specific promoter, either constitutive or inducible, as defined above. In addition, the expression of the sequence of interest may be conditional; the expression may be induced by a site-specific recombinase such as Cre or FLP (Akagi K, Sandig V, Vooijs M, Van der Valk M, Giovannini M, Strauss M, Berns A (May 1997). " Nucleic Acids Res. 25 (9): 1766-73.; Zhu XD, Sadowski PD (1995). J Biol Chem 270).

Thus, the sequence of interest is inserted in an appropriate cassette that may comprise an heterologous promoter operatively linked to said gene of interest and one or more functional sequences including but not limited to (selectable) marker genes, recombinase recognition sites, polyadenylation signals, splice acceptor sequences, introns, tag for protein detection and enhancers.

The subject matter of the present invention is also a kit for making GAA knock-out or knock-in cells/animals comprising at least a meganuclease and/or one expression vector, as defined above. Preferably, the kit further comprises a targeting DNA comprising a sequence that inactivates the GAA gene flanked by sequences sharing homologies with the region of the GAA gene surrounding the DNA cleavage site of said meganuclease. In addition, for making knock-in cells/animals, the kit includes also a vector comprising a sequence of interest to be introduced in the genome of said cells/animals and eventually a selectable marker gene, as defined above.

The subject-matter of the present invention is also the use of at least one meganuclease and/or one expression vector, as defined above, for the preparation of a medicament for preventing, improving or curing a pathological condition caused by a mutation in the GAA gene as defined above, in an individual in need thereof.

Preferably said pathological condition is Pompe's disease.

The use of the meganuclease may comprise at least the step of (a) inducing in somatic tissue(s) of the donor/ individual a double stranded cleavage at a site of interest of the GAA gene comprising at least one recognition and cleavage site of said meganuclease by contacting said cleavage site with said meganuclease, and (b) introducing into said somatic tissue(s) a targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies to the region surrounding the cleavage site and (2) DNA which repairs the GAA gene upon recombination between the targeting DNA and the chromosomal DNA, as defined above. The targeting DNA is introduced into the somatic tissues(s) under conditions appropriate for introduction of the targeting DNA into the site of interest.

According to the present invention, said double-stranded cleavage may be induced, ex vivo by introduction of said meganuclease into somatic cells from the diseased individual and then transplantation of the modified cells back into the diseased individual.

The subject-matter of the present invention is also a method for preventing, improving or curing a pathological condition caused by a mutation in the GAA gene, in an individual in need thereof, said method comprising at least the step of administering to said individual a composition as defined above, by any means. The meganuclease can be used either as a polypeptide or as a polynucleotide construct encoding said polypeptide. It is introduced into mouse cells, by any convenient means well-known to those in the art, which are appropriate for the particular cell type, alone or in association with either at least an appropriate vehicle or carrier and/or with the targeting DNA.

According to an advantageous embodiment of the uses according to the invention, the meganuclease (polypeptide) is associated with: - liposomes, polyethyleneimine (PEI); in such a case said association is administered and therefore introduced into somatic target cells.

- membrane translocating peptides (Bonetta, The Scientist, 2002, 16, 38; Ford et al, Gene Ther., 2001 , 8, 1-4 ; Wadia and Dowdy, Curr. Opin. Biotechnol., 2002, 13, 52-56); in such a case, the sequence of the variant/single-chain meganuclease is fused with the sequence of a membrane translocating peptide (fusion protein).

According to another advantageous embodiment of the uses according to the invention, the meganuclease (polynucleotide encoding said meganuclease) and/or the targeting DNA is inserted in a vector. Vectors comprising targeting DNA and/or nucleic acid encoding a meganuclease can be introduced into a cell by a variety of methods (e.g., injection, direct uptake, projectile bombardment, liposomes, electroporation). Meganucleases can be stably or transiently expressed into cells using expression vectors. Techniques of expression in eukaryotic cells are well known to those in the art. (See Current Protocols in Human Genetics: Chapter 12 "Vectors For Gene Therapy" & Chapter 13 "Delivery Systems for Gene Therapy"). Optionally, it may be preferable to incorporate a nuclear localization signal into the recombinant protein to be sure that it is expressed within the nucleus.

Once in a cell, the meganuclease and if present, the vector comprising targeting DNA and/or nucleic acid encoding a meganuclease are imported or translocated by the cell from the cytoplasm to the site of action in the nucleus.

For purposes of therapy, the meganucleases and a pharmaceutically acceptable excipient are administered in a therapeutically effective amount. Such a combination is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. An agent is physiologically significant if its presence results in a detectable change in the physiology of the recipient. In the present context, an agent is physiologically significant if its presence results in a decrease in the severity of one or more symptoms of the targeted disease and in a genome correction of the lesion or abnormality.

In one embodiment of the uses according to the present invention, the meganuclease is substantially non-immunogenic, i.e., engender little or no adverse immunological response. A variety of methods for ameliorating or eliminating delete- rious immunological reactions of this sort can be used in accordance with the invention. In a preferred embodiment, the meganuclease is substantially free of N-formyl methionine. Another way to avoid unwanted immunological reactions is to conjugate meganucleases to polyethylene glycol ("PEG") or polypropylene glycol ("PPG") (preferably of 500 to 20,000 daltons average molecular weight (MW)). Conjugation with PEG or PPG, as described by Davis et al. (US 4,179,337) for example, can provide non-immunogenic, physiologically active, water soluble endonuclease conjugates with anti-viral activity. Similar methods also using a polyethylene— polypropylene glycol copolymer are described in Saifer et al. (US 5,006,333).

The invention also concerns a prokaryotic or eukaryotic host cell which is modified by a polynucleotide or a vector as defined above, preferably an expression vector.

The invention also concerns a non-human transgenic animal or a transgenic plant, characterized in that all or a part of their cells are modified by a polynucleotide or a vector as defined above.

As used herein, a cell refers to a prokaryotic cell, such as a bacterial cell, or an eukaryotic cell, such as an animal, plant or yeast cell.

The subject-matter of the present invention is also the use of at least one meganuclease variant, as defined above, as a scaffold for making other meganucleases. For example, further rounds of mutagenesis and selection/screening can be performed on said variants, for the purpose of making novel meganucleases.

The different uses of the meganuclease and the methods of using said meganuclease according to the present invention include the use of the l-Crel variant, the single-chain chimeric meganuclease derived from said variant, the poly- nucleotide(s), vector, cell, transgenic plant or non-human transgenic mammal encoding said variant or single-chain chimeric meganuclease, as defined above.

The subject matter of the present invention is also an l-Crel variant having mutations at positions 28 to 40 and/or 44 to 77 of l-Crel that is useful for engineering the variants able to cleave a DNA target from the GAA gene, according to the present invention. In particular, the invention encompasses the l-Crel variants as defined in step (c) to (f) of the method for engineering l-Crel variants, as defined above, including the variants at positions 28, 30, 32, 33, 38 and 40, or 44, 68, 70, 75 and 77 presented in Tables 3 and 4. The invention encompasses also the l-Crel variants as defined in step (g) and (h) of the method for engineering l-Crel variants, as defined above including the combined variants of Tables 5 and 6.

Single-chain chimeric meganucleases able to cleave a DNA target from the gene of interest are derived from the variants according to the invention by methods well-known in the art (Epinat et al , Nucleic Acids Res., 2003, 31, 2952-62; Chevalier et al, Mol. Cell., 2002, 10, 895-905; Steuer et al, Chembiochem., 2004, 5, 206-13 ; International PCT Applications WO 03/078619 and WO 2004/031346). Any of such methods, may be applied for constructing single-chain chimeric meganucleases derived from the variants as defined in the present invention.

The polynucleotide sequence(s) encoding the variant as defined in the present invention may be prepared by any method known by the man skilled in the art. For example, they are amplified from a cDNA template, by polymerase chain reaction with specific primers. Preferably the codons of said cDNA are chosen to favour the expression of said protein in the desired expression system.

The recombinant vector comprising said polynucleotides may be obtained and introduced in a host cell by the well-known recombinant DNA and genetic engineering techniques.

The l-Crel variant or single-chain derivative as defined in the present invention are produced by expressing the polypeptide(s) as defined above; preferably said polypeptide(s) are expressed or co-expressed (in the case of the variant only) in a host cell or a transgenic animal/plant modified by one expression vector or two expression vectors (in the case of the variant only), under conditions suitable for the expression or co-expression of the polypeptide(s), and the variant or single-chain derivative is recovered from the host cell culture or from the transgenic animal/plant.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001 , Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Harries & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds. -in-chief, Academic Press, Inc., New York), specifically, Vols.154 and 155 (Wu et al. eds.) and Vol. 185, "Gene Expression Technology" (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-1V (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

Definitions

- Amino acid residues in a polypeptide sequence are designated herein according to the one-letter code, in which, for example, Q means Gin or Glutamine residue, R means Arg or Arginine residue and D means Asp or Aspartic acid residue.

- Amino acid substitution means the replacement of one amino acid residue with another, for instance the replacement of an Arginine residue with a Glutamine residue in a peptide sequence is an amino acid substitution.

- Altered/enhanced/increased cleavage activity, refers to an increase in the detected level of meganuclease cleavage activity, see below, against a target DNA sequence by a second meganuclease in comparison to the activity of a first meganuclease against the target DNA sequence. Normally the second meganuclease is a variant of the first and comprise one or more substituted amino acid residues in comparison to the first meganuclease.

- Nucleotides are designated as follows: one-letter code is used for designating the base of a nucleoside: a is adenine, t is thymine, c is cytosine, and g is guanine. For the degenerated nucleotides, r represents g or a (purine nucleotides), k represents g or t, s represents g or c, w represents a or t, m represents a or c, y repre- sents t or c (pyrimidine nucleotides), d represents g, a or t, v represents g, a or c, b represents g, t or c, h represents a, t or c, and n represents g, a, t or c.

- by "meganuclease", is intended an endonuclease having a double- stranded DNA target sequence of 12 to 45 bp. Said meganuclease is either a dimeric enzyme, wherein each domain is on a monomer or a monomeric enzyme comprising the two domains on a single polypeptide.

- by "meganuclease domain" is intended the region which interacts with one half of the DNA target of a meganuclease and is able to associate with the other domain of the same meganuclease which interacts with the other half of the DNA target to form a functional meganuclease able to cleave said DNA target.

- by "meganuclease variant" or "variant" is intended a meganuclease obtained by replacement of at least one residue in the amino acid sequence of the wild-type meganuclease (natural meganuclease) with a different amino acid.

- by "meganuclease variant" or "variant" it is intended a meganuclease obtained by replacement of at least one residue in the amino acid sequence of the parent meganuclease (natural or variant meganuclease) with a different amino acid.

- by "peptide linker" it is intended to mean a peptide sequence of at least 10 and preferably at least 17 amino acids which links the C-terminal amino acid residue of the first monomer to the N-terminal residue of the second monomer and which allows the two variant monomers to adopt the correct conformation for activity and which does not alter the specificity of either of the monomers for their targets.

- by "subdomain" it is intended the region of a LAGLIDADG homing endonuclease core domain which interacts with a distinct part of a homing endonuclease DNA target half-site.

- by "targeting DNA construct/minimal repair matrix/repair matrix" it is intended to mean a DNA construct comprising a first and second portions which are homologous to regions 5' and 3' of the DNA target in situ. The DNA construct also comprises a third portion positioned between the first and second portion which comprise some homology with the corresponding DNA sequence in situ or alternatively comprise no homology with the regions 5' and 3 ' of the DNA target in situ. Following cleavage of the DNA target, a homologous recombination event is stimulated between the genome containing the GAA gene and the repair matrix, wherein the genomic sequence containing the DNA target is replaced by the third portion of the repair matrix and a variable part of the first and second portions of the repair matrix.

- by "functional variant" is intended a variant which is able to cleave a DNA target sequence, preferably said target is a new target which is not cleaved by the parent meganuclease. For example, such variants have amino acid variation at positions contacting the DNA target sequence or interacting directly or indirectly with said DNA target.

- by "selection or selecting" it is intended to mean the isolation of one or more meganuclease variants based upon an observed specified phenotype, for instance altered cleavage activity. This selection can be of the variant in a peptide form upon which the observation is made or alternatively the selection can be of a nucleotide coding for selected meganuclease variant.

- by "screening" it is intended to mean the sequential or simultaneous selection of one or more meganuclease variant (s) which exhibits a specified phenotype such as altered cleavage activity.

- by "derived from" it is intended to mean a meganuclease variant which is created from a parent meganuclease and hence the peptide sequence of the meganuclease variant is related to (primary sequence level) but derived from (mutations) the sequence peptide sequence of the parent meganuclease.

- by "I-Crel" is intended the wild-type I-Crel having the sequence of pdb accession code l g9y, corresponding to the sequence SEQ ID NO: 1 in the sequence listing.

- by "I-Crel variant with novel specificity" is intended a variant having a pattern of cleaved targets different from that of the parent meganuclease. The terms "novel specificity", "modified specificity", "novel cleavage specificity", "novel substrate specificity" which are equivalent and used indifferently, refer to the specificity of the variant towards the nucleotides of the DNA target sequence. In the present Patent Application all the I-Crel variants described comprise an additional Alanine after the first Methionine of the wild type I-Crel sequence (SEQ ID NO: 1). These variants also comprise two additional Alanine residues and an Aspartic Acid residue after the final Proline of the wild type I-Crel sequence. These additional residues do not affect the properties of the enzyme and to avoid confusion these additional residues do not affect the numeration of the residues in I-Crel or a variant referred in the present Patent Application, as these references exclusively refer to residues of the wild type I-Crel enzyme (SEQ ID NO: 1) as present in the variant, so for instance residue 2 of I-Crel is in fact residue 3 of a variant which comprises an additional Alanine after the first Methionine.

- by "I-Oel site" is intended a 22 to 24 bp double-stranded DNA sequence which is cleaved by l-Crel. I-Crel sites include the wild-type (natural) non- palindromic l-Crel homing site and the derived palindromic sequences such as the sequence 5'- t.i2C-i ia-ioa-ga-8a-7C-6g.5 4C-3g-2t-ia₊i c₊-2g+3a₊- c₊5g+6t+7t+gt₊9t₊iog+i ia i2 (SEQ ID NO: 2), also called C 1221 (Figure 4).

- by "domain" or "core domain" is intended the "LAGLIDADG homing endonuclease core domain" which is the characteristic αι βι β₂θΐ₂β₃β₄α₃ fold of the homing endonucleases of the LAGLIDADG family, corresponding to a sequence of about one hundred amino acid residues. Said domain comprises four beta-strands (β ι β2β3 4) folded in an anti-parallel beta-sheet which interacts with one half of the DNA target. This domain is able to associate with another LAGLIDADG homing endonuclease core domain which interacts with the other half of the DNA target to form a functional endonuclease able to cleave said DNA target. For example, in the case of the dimeric homing endonuclease l-Crel (163 amino acids), the LAGLIDADG homing endonuclease core domain corresponds to the residues 6 to 94.

- by "subdomain" is intended the region of a LAGLIDADG homing endonuclease core domain which interacts with a distinct part of a homing endo- nuclease DNA target half-site.

- by "chimeric DNA target" or "hybrid DNA target" it is intended the fusion of a different half of two parent meganuclease target sequences. In addition at least one half of said target may comprise the combination of nucleotides which are bound by at least two separate subdomains (combined DNA target).

- by "beta-hairpin" is intended two consecutive beta-strands of the antiparallel beta-sheet of a LAGLIDADG homing endonuclease core domain (βιβ2 0Γ,β₃β₄) which are connected by a loop or a turn, - by "single-chain meganuclease", "single-chain chimeric meganu- clease", "single-chain meganuclease derivative", "single-chain chimeric meganuclease derivative" or "single-chain derivative" is intended a meganuclease comprising two LAGLIDADG homing endonuclease domains or core domains linked by a peptidic spacer. The single-chain meganuclease is able to cleave a chimeric DNA target sequence comprising one different half of each parent meganuclease target sequence.

- by "DNA target", "DNA target sequence", "target sequence" , "target-site", "target" , "site", "site of interest", "recognition site", "recognition sequence", "homing recognition site", "homing site", "cleavage site" is intended a 20 to 24 bp double-stranded palindromic, partially palindromic (pseudo-palindromic) or non-palindromic polynucleotide sequence that is recognized and cleaved by a LAGTIDADG homing endonuclease such as l-Crel, or a variant, or a single-chain chimeric meganuclease derived from l-Crel. These terms refer to a distinct DNA location, preferably a genomic location, at which a double stranded break (cleavage) is to be induced by the meganuclease. The DNA target is defined by the 5' to 3 ' sequence of one strand of the double-stranded polynucleotide, as indicate above for C1221. Cleavage of the DNA target occurs at the nucleotides at positions +2 and -2, respectively for the sense and the antisense strand. Unless otherwise indicated, the position at which cleavage of the DNA target by an l-Cre I meganuclease variant occurs, corresponds to the cleavage site on the sense strand of the DNA target.

- by "DNA target half-site", "half cleavage site" or "half-site" is intended the portion of the DNA target which is bound by each LAGLIDADG homing endonuclease core domain.

- by "chimeric DNA target" or "hybrid DNA target" is intended the fusion of different halves of two parent meganuclease target sequences. In addition at least one half of said target may comprise the combination of nucleotides which are bound by at least two separate subdomains (combined DNA target).

- by "GAA gene" is intended a Lysosomal acid -glucosidase gene, preferably the GAA gene of a vertebrate, more preferably the GAA gene of a mammal such as human. GAA gene sequences are available in sequence databases, such as the NCBI/GenBank database. The human GAA gene sequence (20kb) is available under accession number NC_000017.9 (positions 75689950 to 75708274). Figure 3 illustrates the 20 exons of the human GAA gene (Exon 1 (position 1 to 408) Exon 2 (positions 3073 to 3650 ), Exon 3 (positions 4267 to 4412), Exon 4 (positions 6075 to 6240), Exon 5 (positions 6318 to 6414), Exon 6 (positions 6808 to 6927), Exon 7 (positions 7007 to 7125), Exon 8 (positions 7215 to 7346), Exon 9 (positions 8463 to 8573), Exon 10 (positions 9245 to 9358), Exon 11 (positions 9459 to 9543), Exon 12 (positions 10501 to 10618), Exon 13 (positions 11096 to 11229), Exon 14 (positions 11394 to 1 1545). Exon 15 (positions 1 1736 to 1 1884), Exon 16 (positions 15486 to 15627), Exon 17 (positions 161 18 to 16267), Exon 18 (positions 1671 1 to 16875). Exon 19 (positions 17171 to 17323), and Exon 20 (positions 17790 to 18397). The ORF which is from position 3105 of Exon 2 to position 17849 of Exon 20. The human GAA gene is transcribed into a 3782 bp mRNA (GenBank NM 000152.3) containing the GAA ORF from positions 368 to 3228 .

- by "DNA target sequence from the GAA gene", "genomic DNA target sequence", " genomic DNA cleavage site", "genomic DNA target" or "genomic target" is intended a 20 to 24 bp sequence of a GAA gene as defined above, which is recognized and cleaved by a meganuclease variant or a single-chain chimeric meganuclease derivative.

- by "parent meganuclease" it is intended to mean a wild type meganuclease or a variant of such a wild type meganuclease with identical properties or alternatively a meganuclease with some altered characteristic in comparison to a wild type version of the same meganuclease. In the present invention the parent meganuclease can refer to the initial meganuclease from which the first series of variants are derived in step a. or the meganuclease from which the second series of variants are derived in step b., or the meganuclease from which the third series of variants are derived in step k.

- by "vector" is intended a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.

- by "homologous" is intended a sequence with enough identity to another one to lead to homologous recombination between sequences, more particularly having at least 95 % identity, preferably 97 % identity and more preferably 99 %. - "identity" refers to sequence identity between two nucleic acid molecules or polypeptides. Identity can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. A degree of similarity or identity between nucleic acid or amino acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid sequences. Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default setting.

- by mutation is intended the substitution, deletion, insertion of one or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a polypeptide sequence. Said mutation can affect the coding sequence of a gene or its regulatory sequence. It may also affect the structure of the genomic sequence or the structure/stability of the encoded mRNA.

In addition to the preceding features, the invention further comprises other features which will emerge from the description which follows, which refers to examples illustrating the l-Crel meganuclease variants and their uses according to the invention, as well as to the appended drawing in which:

- Figure 1 : Two different strategies for restoring a functional gene with meganuclease -induced recombination. A. Gene correction. A mutation occurs within the GAA gene. Upon cleavage by a meganuclease and recombination with a repair matrix the deleterious mutation is corrected. B. Exonic sequences knock-in. A mutation occurs within the GAA gene. The mutated mRNA transcript is featured below the gene. In the repair matrix, exons located upstream of the cleavage site are fused in frame (as in a cDNA), with a polyadenylation site to stop transcription in 3'. Introns and exons sequences can be used as homologous regions. Exonic sequences knock-in results into an engineered gene, transcribed into a mRNA able to code for a functional GAA protein.

- Figure 2: Modular structure of homing endo nucleases and the combinatorial approach for custom meganucleases design A. Tridimensional structure of the I-Crel homing endonuclease bound to its DNA target. The catalytic core is surrounded by two ββαββ folds forming a saddle-shaped interaction interface above the DNA major groove. B. Different binding sequences derived from the l-Crel target sequence (top right and bottom left) to obtain heterodimers or single chain fusion molecules cleaving non palindromic chimeric targets (bottom right). C. The identification of smaller independent subunit, i. e., subunit within a single monomer or ββ ββ fold (top right and bottom left) would allow for the design of novel chimeric molecules (bottom right), by combination of mutations within a same monomer. Such molecules would cleave palindromic chimeric targets (bottom right). D. The combination of the two former steps would allow a larger combinatorial approach, involving four different subdomains. In a first step, couples of novel meganucleases could be combined in new molecules ("half-meganucleases") cleaving palindromic targets derived from the target one wants to cleave. Then, the combination of such "half-meganuclease" can result in an heterodimeric species cleaving the target of interest. Thus, the identification of a small number of new cleavers for each subdomain would allow for the design of a very large number of novel endonucleases.

- Figure 3 : Genomic locus of GAA gene. Human GAA gene ( sequence ref: NC 000017.9). Exons sequences are indicated as black boxes with their junctions. The GAA2 target (SEQ ID NO: 8) is indicated with its sequence and position.

- Figure 4: The GAA2 target sequence (SEQ ID NO: 8) and its derivatives. 10TTC_P (SEQ ID NO: 4), l OGAC P (SEQ ID NO: 5), 5CCT_P (SEQ ID NO: 6) and 5CAGJ⁵ ((SEQ ID NO: 7), P stands for Palindromic) are close derivatives found to be cleaved by previously obtained l-Crel mutants. They differ from C 1221 (SEQ ID NO: 2) by the boxed motives. C 1221 , 10TTC_P, 10GTC_P, 5CCT_P and 5CTG_P were first described as 24 bp sequences, but structural data suggest that only the 22 bp are relevant for protein/DNA interaction. Consequently, positions ±12 are indicated in parenthesis. GAA2 (SEQ ID NO: 8) is the DNA sequence located in the human GAA gene at position 1889- 1910 (Figure 3). GAA2.2 (SEQ ID NO: 9) differs from GAA2 at positions -2;- l ;+l ;+2 where l-Crel cleavage site (GTAC) was inserted. GAA2.3 (SEQ ID NO: 10) is the palindromic sequence derived from the left part of GAA2, and GAA2.4 (SEQ ID NO: 1 1 ) is the palindromic sequence derived from the right part of GAA2. As shown, the boxed motives from 10TTC_P, lOGTC P, 5CCT P and 5CTG_P are found in the GAA2 series of targets.

- Figure 5: Cleavage of GAA2.3 (SEQ ID NO: 10) by combinatorial mutants. The figure displays an example of primary screening of l-Crel combinatorial mutants with the GAA2.3 (SEQ ID NO: 10) target. In this filter, the sequences of positive mutants at position Al , B12, C2, Dl l and E5 are 28K30G32S33Y38G40S/44R68Y70S75N77Q (SEQ ID NO: 22), 2S/28R30N32S33N38R40Q/44K68Y70S75D77R (SEQ ID NO: 21), 28R30N32S33N38R40Q/44D68A70S75K77R (SEQ ID NO: 20), 28K30G32S33Y38G40S/44D68A70S75K77R (SEQ ID NO: 24) and 28K30G32S33Y38A40S/44K68S70S75Y77N (SEQ ID NO: 23), respectively (same nomenclature as for Table 1). H10, Hl l , H12 are positive controls of different strength.

- Figure 6: Cleavage of GAA2.4 (SEQ ID NO: 1 1 ) by combinatorial mutants. The figure displays an example of primary screening of l-Crel combinatorial mutants with the GAA2.4 target. In this filter, the sequences of positive mutants at positions A3, B2, F12, G10 and H9 are 28K30K32S33P38Q40S/44N68Y70S75Y77N (SEQ ID NO: 30), 28K30K32S33R38Q40S/44T68Y70S75Y77V (SEQ ID NO: 31 ), 28K30K32S33A38Q40S/44N68Y70S75Y77N (SEQ ID NO: 29), 28K30R32Q33Y38Q40S/44A68Y70S75Y77V (SEQ ID NO: 33) and 28K30R32Q33Y38Q40S/44T68Y70S75Y77V (SEQ ID NO: 32) respectively (same nomenclature as for Table 2). H10, Hl l , H12 are positive controls of different strength.

- Figure 7: Cleavage of GAA2.2 (SEQ ID NO: 9) and GAA2 targets by heterodimeric combinatorial mutants. A. Secondary screening of 120 combinations of l-Crel mutants with the GAA2.2 target. B. Secondary screening of the same combinations of I-Crel mutants with the GAA2 target (SEQ ID NO: 8). Mutants displaying best cleavage of GAA2 are circled. Sequences of these combinations (GAA2.3 x GAA2.4) at position al, a5, c5, el and g5 are (28K30N32S33R38Q40Q/44D68A70S75K77R (SEQ ID NO: 19) x 28K30K32S33A38Q40S/44N68Y70S75Y77N (SEQ ID NO: 29)), (28K30G32S33Y38A40S/44K68S70S75Y77N (SEQ ID NO: 23) x 28K30K32S33A38Q40S/44N68Y70S75Y77N (SEQ ID NO: 29)), (28K30G32S33Y38A40S/44K68S70S75Y77N (SEQ ID NO: 23) x 28K30K32S33P38Q40S/44N68Y70S75Y77N (SEQ ID NO: 30)), ((28K30N32S33R38Q40Q/44D68A70S75K77R (SEQ ID NO: 19) x 28K30K32S33R38Q40S/44T68Y70S75Y77V (SEQ ID NO: 31)) and (28 30G32S33Y38A40S/44K68S70S75Y77N (SEQ ID NO: 23) x 28K30R32Q33Y38Q40S/44T68Y70S75Y77V (SEQ ID NO: 32)), respectively. The two right spots of each four spot clusters are positive controls of different strength.

- Figure 8: Improved cleavage of the GAA2 target (SEQ ID NO: 8). Secondary screening of optimized GAA2.3 mutants

2S/28K30G32S33Y38A40S/44K68A70S75N77I/81T (SEQ ID NO: 41) (panel A) or 28K30G32S33Y38A40S/44K68A70S75N771/80K (SEQ ID NO: 42) (mutant 3A5) (panel B) combined with a library of optimized GAA2.4 mutants on the GAA2 target (SEQ ID NO: 8). Circled spots in position al, a4, alO and j3 correspond to functional GAA2 mutants obtained from combination with GAA2.4 mutant sequences 19S/28K30K32S33R38Q40S/44T68Y70S75Y77V (SEQ ID NO: 45) (mutant 4A6), 19S/28K30K32S33R38Q40S/44N68Y70S75Y77N, (SEQ ID NO: 43), 19S/28K30K32S33A38Q40S/44N68Y70S78Y77N (SEQ ID NO: 44) and 28K30K32T33A38Q40S/43L/44N68Y70S75Y77N (SEQ ID NO: 46), respectively. The two right spots of each four spot clusters are positive controls of different strength.

- Figure 9: pCLS0542

- Figure 10: pCLS 1055

- Figure 1 1 : pCLS 1 107

- Figure 12: A shows a schematic representation of a gene repair assay in which a single-copy LacZ gene driven by the CMV promoter is interrupted by the GAA2 target sequence and is thus non-functional. The transfection of the cell line with plasmids coding for GAA2 meganucleases and a LacZ repair plasmid allows the restoration of a functional LacZ gene by homologous recombination; and B shows the results of this assay for GAA2 mutants 3A5/4A6 (respectively, SEQ ID NO: 42 and SEQ ID NO: 45) which induces high level of gene targeting in CHO cells.

- Figure 13: pCLS 1069 - Figure 14: Genomic locus of GAA gene; (sequence ref: NC

000017.10).

- Figure 15: GAA21 and GAA21 derived targets. The GAA21.1 target sequence (SEQ ID NO: 108) and its derivatives 10TTC_P (SEQ ID NO: 4), 10CCC_P (SEQ ID NO: 1 1 1), 5CAT_P (SEQ ID NO: 109) and 5GAG_P (SEQ ID NO: 1 10), P stands for Palindromic) are derivatives of C1221 (SEQ ID NO: 2), found to be cleaved by previously obtained I-Crel mutants. CI 221 , 10TTC P, 10CCC P, 5CAT_P and 5GAG__P were first described as 24 bp sequences, but structural data suggest that only the 22 bp are relevant for protein/DNA interaction. Consequently, positions ±12 are indicated in parenthesis. GAA21.1 (SEQ ID NO: 108) is the DNA sequence located in the human GAA gene at position 2159-2182 on NC0000017.10. GAA21.3 (SEQ ID NO: 1 12) is the palindromic sequence derived from the left part of GAA21.1 , and GAA21.4 (SEQ ID NO: 113) is the palindromic sequence derived from the right part of GAA21.1.

- Figure 16: Identification of meganucleases cleaving GAA21.1 target. Variants cleaving GAA21.4 (lanes) and GAA21.3 (columns) where co- expressed in Yeast to form heterodimers.

- Figure 17: Identification of improved meganucleases cleaving GAA21.1 target. Variants cleaving GAA21.4 (lanes) and GAA21.3 (columns) where co-expressed in Yeast to form heterodimers.

- Figure 18: Activity cleavage in CHO cells of single chain heterodimer pCLS4056 SCOH-GA6-bl2-C (SEQ ID NO: 202), pCLS4626 SCOH- GA6-G2 3-C (SEQ ID NO: 203), pCLS4624 SCOH-GA6-G2M 1 -C (SEQ ID NO: 201) and pCLS4330 SCOH-G2b562-C (SEQ ID NO: 200), compared to IScel (pCLS 1090) and SCOH-RAG-CLS (pCLS2222) meganucleases as positive controls. The empty vector control (pCLS 1069) has also been tested on each target. Plasmid pCLS1728 contains control RAGl .10.1 target sequence.

Example 1: Strategy for engineering novel meganucleases cleaving a target from the human lysosomal acid -glucosidase gene

GAA2 is a 22 bp (non-palindromic) target (SEQ ID NO: 8) located in the coding sequence of human lysosomal acid a-glucosidase gene. The target sequence corresponds to positions 1889-1910 of the human lysosomal acid ot- glucosidase gene (accession number NC_000017.9; Figure 3).

The GAA2 sequence is partly a patchwork of the 1 OTTC P (SEQ ID NO: 4), 10GAC_P (SEQ ID NO: 5), 5CCT_P (SEQ ID NO: 6) and 5CAGJ⁵ (SEQ ID NO: 7) (Figure 4) which are cleaved by previously identified meganucleases, obtained as described in International PCT Applications WO 2006/097784 and WO 2006/097853 ; Arnould et al, J. Mol. Biol., 2006, 355, 443-458; Smith et al , Nucleic Acids Res., 2006. Thus, GAA2 could be cleaved by combinatorial variants resulting from these previously identified meganucleases.

The 10TTCJP (SEQ ID NO: 4), 10GAC_P (SEQ ID NO: 5), 5CCTJP (SEQ ID NO: 6) and 5CAG P (SEQ ID NO: 7) target sequences are 24 bp derivatives of C I 221 (SEQ ID NO: 2), a palindromic sequence cleaved by l-Crel (Arnould et al, precited). However, the structure of l-Crel bound to its DNA target suggests that the two external base pairs of these targets (positions - 12 and 12) have no impact on binding and cleavage (Chevalier et al , Nat. Struct. Biol., 2001 , 8, 312- 3 16; Chevalier and Stoddard, Nucleic Acids Res., 2001 , 29, 3757-3774; Chevalier et al , J. Mol. Biol., 2003, 329, 253-269), and in this study, only positions -1 1 to 1 1 were considered. Consequently, the GAA2 series of targets were defined as 22 bp sequences instead of 24 bp. GAA2 (SEQ ID NO: 8) differs from C1221 (SEQ ID NO: 2) in the 4 bp central region. According to the structure of the l-Crel protein bound to its target, there is no contact between the 4 central base pairs (positions -2 to 2) and the I-Oel protein (Chevalier et al , Nat. Struct. Biol., 2001 , 8, 312-316; Chevalier and Stoddard, Nucleic Acids Res., 2001 , 29, 3757-3774; Chevalier et al, J. Mol. Biol., 2003, 329, 253-269). Thus, the bases at these positions should not impact the binding efficiency. However, they could affect cleavage, which results from two nicks at the edge of this region. Thus, the gtga sequence in -2 to 2 was first substituted with the gtac sequence from C I 221 , resulting in target GAA2.2 (Figure 4). Then, two palindromic targets, GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 1 1 ), were derived from GAA2.2 (SEQ ID NO: 9, Figure 4). Since GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 1 1 ) are palindromic, they should be cleaved by homodimeric proteins. Thus, proteins able to cleave the GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 1 1 ) sequences as homodimers were first designed (examples 2 and 3) and then co-expressed to obtain heterodimers cleaving GAA2 (SEQ ID NO: 8, example 4). Heterodimers cleaving the GAA2.2 (SEQ ID NO: 9) and GAA2 (SEQ ID NO: 8) targets could be identified. In order to improve cleavage activity for the GAA2 target (SEQ ID NO: 8), a series of variants cleaving GAA2.3 (SEQ ID NO: 10) and GAA2.4 (SEQ ID NO: 11) was chosen, and then refined. The chosen variants were subjected to random mutagenesis, and used to form novel heterodimers that were screened against the GAA2 target (SEQ ID NO: 8, example 5). Heterodimers could be identified with an improved cleavage activity for the GAA2 target (SEQ ID NO: 8).

Example 2: Making of meganucleases cleaving GAA2.3

In this example, we show that l-Crel mutants can cut the GAA2.3 DNA target (SEQ ID NO: 10) sequence derived from the left part of the GAA2 target (SEQ ID NO: 8) in a palindromic form (Figure 4). GAA2.3 (SEQ ID NO: 10) is similar to 5CCT_P (SEQ ID NO: 6) in positions ±1 , ±2, ±3, ±4, ±5 and to 10TTC_P (SEQ ID NO: 4) in positions ±1 , ±2, ±8, ±9 and ±10. We hypothesized that positions ±6, ±7 and ±1 1 would have little effect on the binding and cleavage activity. Mutants able to cleave 5CCT_P (SEQ ID NO: 6) were previously obtained by mutagenesis on l-Crel N75 at positions 44, 68, 70 (Arnould, Chames et al. 2006), 75 and 77. Mutants able to cleave the 10TTC_P (SEQ ID NO: 4) target were obtained by mutagenesis on I-Crel N75 and D75 at positions 28, 30, 32, 33, 38, 40 and 70 (Smith, et al 2006). We reasoned that combining such pairs of mutants would allow for the cleavage of the GAA2.3 target (SEQ ID NO: 10).

Both sets of proteins are mutated at position 70. However, we hypothesized the existence of two separable functional subdomains. That implies that this position has little impact on the specificity in base 10 to 8 of the target. Therefore, we have combined mutations at positions 44, 68, 70, 75 and 77 from proteins cleaving 5CCT_P (SEQ ID NO: 6) with the 28, 30, 32, 33, 38 and 40 mutations from proteins cleaving 10TTC_P (SEQ ID NO: 4) to check whether combined mutants could cleave the GAA2.3 target (SEQ ID NO: 10).

Material and Methods

Construction of target vector The target was cloned as follow: oligonucleotide corresponding to the target sequence flanked by gateway cloning sequence was ordered from Proligo: 5' TGGCATACAAGTTTTGGTCTCCTGTACAGGAGACCAACAATCGTCTGTCA

3' (SEQ ID NO: 12). Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned using the Gateway protocol (Invitrogen) into yeast reporter vector (pCLS1055, Figure 10). Yeast reporter vector was transformed into S. cerevisiae strain FYBL2-7B (MAT a, ura3A851, trplA63, leu2Al, lys2A202).

Construction of combinatorial mutants

l-Crel mutants cleaving 10TTC_P or 5CCT_P were identified in a former study. In order to generate l-Crel derived coding sequence containing mutations from both series, separate overlapping PCR reactions were carried out that amplify the 5' end (aa positions 1-43) or the 3' end (positions 39-167) of the l-Crel coding sequence. For both the 5' and 3' end, PCR amplification is carried out using primers specific to the vector (pCLS0542, Figure 9) (Gall OF 5'-GCAACTTTAGTGCTGACACATACAGG- 3 ' (SEQ ID NO: 13) or GallOR 5 ' -ACAACCTTGATTGGAGACTTGACC-3 ' (SEQ ID NO: 14)) and primers specific to the l-Crel coding sequence for amino acids 39-43 (assF 5'-CTAXXXTTGACCTTT-3' (SEQ ID NO: 15) or assR 5'- A AAGGTC AAXXXT AG- 3 ' (SEQ ID NO: 16)) where XXX code for residue 40. The PCR fragments resulting from the amplification reaction realized with the same primers and with the same coding sequence for residue 40 were pooled. Then, each pool of PCR fragments resulting from the reaction with primers Gall OF (SEQ ID NO:

13) and assR (SEQ ID NO: 16) or assF (SEQ ID NO: 15) and GallOR (SEQ ID NO:

14) was mixed in an equimolar ratio. Finally, approximately 25ng of each final pool of the two overlapping PCR fragments and 75ng of vector DNA (pCLS0542, Figure 9) linearized by digestion with Ncol and Eagl were used to transform the yeast Saccharomyces cerevisiae strain strain FYC2-6A (MAToc, trplA63, leu2Al, his3A200) using a high efficiency LiAc transformation protocol (Gietz and Woods, 2002). An intact coding sequence containing both groups of mutations is generated by in vivo homologous recombination in yeast.

Mating of meganuclease expressing clones and screening in yeast Screening was performed as described previously (Arnould, Chames et al. 2006). Mating was performed using a colony gridder (QpixII, Genetix). Mutants were gridded on nylon filters covering YPD plates, using a low gridding density (about 4 spots/cm²). A second gridding process was performed on the same filters to spot a second layer consisting of different reporter-harboring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30°C for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, with galactose (1 %) as a carbon source, and incubated for five days at 37°C, to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02% X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1 % SDS, 6% dimethyl formamide (DMF), 7mM β- mercaptoethanol, 1 % agarose, and incubated at 37°C, to monitor β-galactosidase activity. Results were analyzed by scanning and quantification was performed using proprietary software.

Sequencing of mutants

To recover the mutant expressing plasmids, yeast DNA was extracted using standard protocols and used to transform E. coli. Sequence of mutant ORF were then performed on the plasmids by Millegen SA. Alternatively, ORFs were amplified from yeast DNA by PCR (Akada, Murakane et al. 2000), and sequence was performed directly on PCR product by Millegen SA.

Results

I-Crel combinatorial mutants were constructed by associating mutations at positions 44, 68, 70, 75 and 77 with the 28, 30, 32, 33, 38 and 40 mutations on the l-Crel N75 or D75 scaffold, resulting in a library of complexity 1480. Example of combinations is displayed on Table 3. This library was transformed into yeast and 2232 clones ( 1 .5 times the diversity) were screened for cleavage against GAA2.3 DNA target (SEQ ID NO: 10). 55 positives clones were found, which after sequencing and validation by secondary screening turned out to correspond to 32 different novel endonucleases (see Table 3). Examples of positives mutants cutting the GAA2.3 target (SEQ ID NO: 10) are shown in Figure 5. 51

Table 3: Panel of mutants theoretically present in the combinatorial library used in example 1

(Onlv 96 out of the 1480 combinations are displayed).

+ indicates that the combinatorial mutant was found among the identified positives.

Example 3: Making of meganucleases cleaving GAA2.4

5 In this example, we show that we can cleave the GAA2.4 DNA target (SEQ ID NO:

1 1) sequence derived from the right part of the GAA2 target (SEQ ID NO: 8) in a palindromic form (Figure 6). All target sequences described in this example are 22 bp palindromic sequences. GAA2.4 (SEQ ID NO: 1 1) is similar to 5CAG_P (SEQ ID NO: 7) in positions ±1, ±2, ±3, ±4, ±5, ±6, ±7, ±9, ±10 and ±1 1 and to 10GAC_P 10 (SEQ ID NO: 5) in positions ±1 , ±2, ±6, ±7, ±8, ±9, ±10 and ±11. We hypothesized that positions ±6 and ±1 1 would have little effect on the binding and cleavage activity. Mutants able to cleave 5CAG_P (SEQ ID NO: 7) were previously obtained by mutagenesis on l-Cre\ N75 at positions 44, 68, 70 (Arnould, Chames et al. 2006), 75 and 77. Mutants able to cleave the 10GAC_P target (SEQ ID NO: 5) were obtained by mutagenesis on l-Crel N75 and D75 at positions 28, 30, 32, 33, 38, 40, 70 (Smith, et al 2006). We reasoned that combining such pairs of mutants would allow for the cleavage of the GAA2.4 target (SEQ ID NO: 1 1 ).

Both sets of proteins are mutated at position 70. However, we hypothesized the existence of two separable functional subdomains. That implies that this position has little impact on the specificity in base 10 to 8 of the target. Therefore, we have combined mutations at positions 44, 68, 70, 75 and 77 from proteins cleaving 5CAG_P (SEQ ID NO: 7) with the 28, 30, 32, 33, 38, 40 mutations from proteins cleaving 10GAC_P (SEQ ID NO: 5) to check whether combined mutants could cleave the GAA2.4 target (SEQ ID NO: 1 1 ).

Material and Methods

Construction of target vector, construction of combinatorial mutants, mating of meganuclease expressiong clones and screening in yeast, and sequencing of mutants were performed as in example 2.

Results

l-Crel combinatorial mutants were constructed by associating mutations at positions 44, 68, 70, 75 and 77 with the 28, 30, 32, 33, 38 and 40 mutations on the l-Crel N75 or D75 scaffold, resulting in a library of complexity 1600. Examples of combinatorial mutants are displayed on table 4. This library was transformed into yeast and 2232 clones ( 1.4 times the diversity) were screened for cleavage against GAA2.4 DNA target (SEQ ID NO: 1 1 ). 184 positives clones were found, which after sequencing and validation by secondary screening turned out to be correspond to 145 different novel endonucleases (see Table 4). Examples of positives mutants cutting the GAA2.4 target

(SEQ ID NO: 1 1) are shown in Figure 6.

Table 4: Panel of mutants theoretically present in the combinatorial library used in example 2.

(Only 77 out of the 1600 combinations are displayed).

Amino acids at positions 44, 68, 70, 75, and 77 (ex: DASKR stands for

D44, A68, S70, K75 and R77)

DASKR KRSNV KSSYN KTSDR KYSDK KYSDR KYSDT KYSYi RASNN RYSNQ RYSNN RYSYN 53

+ indicates that the combinatorial mutant was found among the identified positives.

Example 4: Making of nieganucleases cleaving GAA2

We have previously identified -Crel mutants able to cleave each of the palindromic GAA2 derived targets (GAA2.3, (SEQ ID NO: 10) and GAA2.4, (SEQ ID NO: 1 1)) 5 (see examples 2 and 3). We decided to co-express pairs of such mutants in yeast (one cutting GAA2.3 and one cutting GAA2.4). Upon co-expression, there should be three active molecular species, two homodimers, and one heterodimer. We tested whether the heterodimers that should be formed cut the GAA2.2 (SEQ ID NO: 9) and GAA2 targets (SEQ ID NO: 8).

10 Material and Methods

Cloning of mutants in kanamycin resistant vector

To coexpress two I-Oel mutants in yeast, we subcloned mutants cutting the GAA2.4 sequence (SEQ ID NO: 1 1) in a kanamycin resistant yeast expression vector (pCLSl 107, Figure 1 1).

15 Mutants were amplified by PCR reaction using primers common for leucine vector (pCLS0542, Figure 9) and kanamycin vector (pCLS1 107, Figure 1 1) (Gall OF 5'- GCAACTTTAGTGCTGACACATACAGG-3 ' (SEQ ID NO: 13) and GallOR 5'- ACAACCTTGATTGGAGACTTGACC-3' (SEQ ID NO: 14)). Approximately 25ng of PCR fragment and 75ng of vector DNA (pCLS1107, Figure 1 1) linearized by digestion with DralH and NgoMIV are used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MAToc, trpl A63, leu2Al, his3A200) using a high efficiency LiAc transformation protocol. An intact coding sequence for the I-Oel mutant is generated by in vivo homologous recombination in yeast.

Mutants co-expression

Yeast strain expressing a mutant cutting the GAA2.3 target (SEQ ID NO: 10) was transformed with DNA coding for a mutant cutting the GAA2.4 target (SEQ ID NO: 11) in pCLS 1 107 (Figure 1 1) expression vector. Transformants were selected on -L Glu + G418 medium.

Mating of me ganucl eases co-expressing clones and screening in yeast:

Mating was performed using a colony gridder (QpixII, Genetix). Mutants were gridded on nylon filters covering YPD plates, using a low gridding density (about 4 spots/cm²). A second gridding process was performed on the same filters to spot a second layer consisting of different reporter-harbouring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30°C for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, adding G418, with galactose (1 %) as a carbon source, and incubated for five days at 37°C, to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02% X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1% SDS, 6% dimethyl formamide (DMF), 7mM β-mercaptoethanol, 1% agarose, and incubated at 37°C, to monitor β- galactosidase activity. Results were analyzed by scanning and quantification was performed using proprietary software.

Results

Co-expression of mutants cleaving the GAA2.3 (10 mutants) and GAA2.4 (12 mutants) sequences, respectively SEQ ID NO: 10 and SEQ ID NO: 1 1, resulted in efficient cleavage of the GAA2.2 target (SEQ ID NO: 9) in almost all cases (Figure 7 panel A). Furthermore, some of these combinations were able to cut the GAA2 (SEQ ID NO: 8) natural target (Figure 7 panel B) that differs from the GAA2.2 sequence (SEQ ID NO: 9) just by 2 bp in positions -2 and +1 (Figure 4). Functional combinations cleaving GAA2 target (SEQ ID NO: 8) are summarized in Table 5. 55

Table 5: Mutants used in example 3.

+ indicates that the heterodimeric mutant was cleaving the GAA2 target.

Example 5: Optimization of meganucleases cleaving GAA2 by random 5 mutagenesis

We have previously identified l-Oel mutants able to cleave the non palindromic GAA2.2 (SEQ ID NO: 9) target by assembly of mutants cleaving the palindromic GAA2.3 (SEQ ID NO: 10) and GAA2.4 target (SEQ ID NO: 11). Some of these combinations were able to cleave GAA2 (SEQ ID NO: 8, Table 5). We decided to optimize the protein combinations cleaving GAA2 (SEQ ID NO: 8), and look for variants cleaving GAA2 with a better efficacy. According to the structure of the I-Oel protein bound to its target, there is no contact between the 4 central base pairs (positions -2 to 2) and the l-Crel protein (Chevalier, Monnat et al. 2001 ; Chevalier and Stoddard 2001 ; Chevalier, Turmel et al 2003). Thus, it is difficult to rationally choose a set of positions to mutagenize, and mutagenesis was done on the whole protein. Random mutagenesis results in high complexity libraries. However, we decided to mutagenize the two components of the heterodimers cleaving GAA2. The refinement process, described in details in Arnould et al (J. Mol. Biol., 2007, 371 , 49-65) is divided in two steps. First, a collection of initial GAA2.3 positive mutants is submitted to random mutagenesis by error-prone PCR. The library is transformed into a yeast strain containing the GAA2 target and one of the best GAA2.4 initial mutants. A symmetrical experiment is also performed with a library of randomly mutagenized GAA2.4 mutants, which are screened against GAA2 target (SEQ ID NO: 8) and one of the best GAA2.3 initial mutants.

Finally, we produced yeast strains containing several best refined GAA2.3 mutants towards the GAA2.3 target (SEQ ID NO: 10). These different strains were screened with the best refined GAA2.4 mutants and checked for an improved cleavage activity on the GAA2 target (SEQ ID NO: 8).

Material and Methods

Construction of libraries by random mutagenesis

On a pool of chosen mutants we have performed random mutagenesis by PCR using Mn²⁺ or by a two-step PCR process using dNTP derivatives 8-oxo-dGTP and dPTP as described in the protocol from Jena Bioscience GmbH for the JBS dNTP-Mutageneis kit. Primers used are preATGCreFor (5'- gcataaattactatacttctatagacacgcaaacacaaatacacagcggccttgccacc-3' (SEQ ID NO: 17)) and ICrelpostRev (5'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgc-3' (SEQ ID NO: 18)). Approximately 25ng of the PCR product and 75ng of vector DNA (pCLSl 107, Figure 11) linearized by digestion with Dralll and NgoMlV were used to transform the yeast Saccharomyces cerevisiae strain FYC2-6A (MAT , trplA63, leu2Al , his3A200) using a high efficiency LiAc transformation protocol (Gietz and Woods 2002). Expression plasmids containing an intact coding sequence for the I- i_idtmze mu_e

Crel m GAA₂₄u. tant is generated by in vivo homologous recombination in yeast.

Mutant-target yeast strains, screening and sequencing

The yeast strain FYBL2-7B (MAT a, ura3 A851 , trp l A63 , leu2Al , lys2A202) containing the GAA2 target (SEQ ID NO: 8) in the yeast reporter vector (pCLS1055, Figure 10) is transformed with mutants, in the leucine vector (pCLS0542, Figure 9), cutting the GAA2.3 target (SEQ ID NO: 10), using a high efficiency LiAc transformation protocol. Mutant-target yeasts are used as target strains for mating assays as described in example 1. Positives resulting clones were verified by sequencing (Millegen) as described in example 1.

Results

During the first steps of the refinement process, 1 12 refined GAA2.4 mutants, combined with the initial GAA2.3 mutant, gave a significantly improved signal. On the other hand, 74 refined GAA2.3 mutants, combined with the initial GAA2.4 mutant, gave an improved signal.

On figure 8, we showed 2 examples of optimized GAA2.3 mutants that we combined with optimized GAA2.4 mutants. On each panel, several combinations of mutants gave an improved cleavage activity

Examples of positive clone according to the nomenclature of Table 3 are listed in Table 6.

Table 6: Functional mutant combinations displaying improved cleavage activity for GAA2, as described in example 5.

Optimized mutant GAA2.3

2S/ GSYAS/ ASNI/81 T KGSYAS/KASNI/80K

SEQ ID NO: 41 SEQID O: 42

19S/KKSRQS/NYSYN

+ +

c SEQ!D NO: 43

19S/KKSAQS/NYSYN

+ +

SEQID NO: 44

19S/KKS RQS/TYS YV

+ +

SEQID NO: 45

K TAQS/NYSYN/43L

o + +

SEQ!D NO: 46 Example 6: GAA2 mutants induce high levels of gene targeting in CHO- 1 cells

To further assess the cleavage activity of the GAA2 mutants, a chromosomal reporter system in CHO cells was used (Figure 12 A). In this system a single-copy LacZ gene driven by the CMV promoter is interrupted by the GAA2 target sequence (SEQ ID NO: 8) and is thus non-functional. The transfection of the cell line with plasmids coding for GAA2 meganucleases and a LacZ repair plasmid allows the restoration of a functional LacZ gene by homologous recombination. It has previously been shown that double-strand breaks can induce homologous recombination; therefore the frequency with which the LacZ gene is repaired is indicative of the cleavage efficiency of the genomic GAA2 target site (SEQ ID NO: 8).

1) Material and Methods

a) Re-cloning of meganucleases

The ORF of I-Crel mutants 3A5 (SEQ ID NO: 42) and 4A6 (SEQ ID NO: 45) cleaving the GAA2 target (SEQ ID NO: 8) identified in example 5 were re-cloned in pCLS1069 (Figure 13). ORFs were amplified by PCR on yeast DNA using the here below described attBl-ICrelFor and attB2-ICreIRev primers. Primers used are attBl- ICrelFor (5'- ggggacaagtttgtacaaaaaagcaggcttcgaaggagatagaaccatggccaataccaaatataacaaagagttcc-3'; SEQ ID NO: 104) and attB2-ICreIRev (5'- ggggaccactttgtacaagaaagctgggtttagtcggccgccggggaggatttcttcttctcgc-3 '; SEQ ID NO: 105). PCR products were cloned in CHO expression vector pCDNA6.2 from INVITROGEN (pCLS 1069, Figure 13) using the Gateway protocol (IN VITRO GEN) . Resulting clones were verified by sequencing (MILLEGEN).

b) Chromosomal assay in CHO-K1 cells

CHO-K1 cell lines harbouring the reporter system were seeded at a density of 2x10^s cells per 10 cm dish in complete medium (Kaighn's modified F-12 medium (F12-K), supplemented with 2 mM L-glutamine, penicillin (100 Ul/ml), streptomycin (100 μ^πιΐ), amphotericin B (Fongizone) (0.25 μ^πιΐ) (INVITROGEN-LIFE SCIENCE) and 10% FBS (SIGMA- ALDRICH CHIMIE). The next day, cells were transfected with Polyfect transfection reagent (QIAGEN). Briefly, 2 μ of lacz repair matrix vector was co-transfected with various amounts of meganucleases expression vectors. After 72 hours of incubation at 37 °C, cells were fixed in 0.5 % glutaraldehyde at 4 °C for 10 min, washed twice in 100 mM phosphate buffer with 0.02 % NP40 and stained with the following staining buffer (10 mM Phosphate buffer, 1 mM MgCl2, 33 mM K hexacyano ferrate (III), 33 mM K hexacyanoferrate (II), 0.1 % (v/v) X-Gal). After, an overnight incubation at 37 °C, plates were examined under a light microscope and the number of LacZ positive cell clones counted. The frequency of LacZ repair is expressed as the number of LacZ+ foci divided by the number of transfected cells (5xl0⁵) and corrected by the transfection efficiency.

2) Results

Figure 12 B shows that the GAA2 mutants 3A5/4A6 (respectively, SEQ ID NO: 42 and SEQ ID NO: 45) can induce high level of gene targeting in CHO cells. Furthermore, previous works have demonstrated that certain mutations arose more frequently than others in our refinement process for engineered meganucleases. These mutations allow a better cleavage activity in yeast and in mammal cells. Several sets of mutations were therefore introduced in the meganuclease targeting GAA2 target (SEQ ID NO: 8). For instance, the introduction of the 1132V mutation in the 3A5 mutant (3A5I132V; SEQ ID NO: 106) increase the gene correction frequency by a 2.5 fold factor in comparison with the initial 3A5/4A6 heterodimer.

Example 7: Engineering meganucleases targeting GAA21

GAA21 , also referred to as GAA21.1 , is a 24 bp non-palindromic target (TCTTCCCCATGTACCTCGGGGGCC SEQ ID NO: 108) located in the human lysosomal acid a-glucosidase gene. The target sequence corresponds to positions 2159-2182 of the human lysosomal acid a-glucosidase gene on reference sequence NC000017.10 (Figure 14). It can thus be used for several strategies including the introduction of a functional coding DNA sequence (cds) to follow a exon KI strategy. GAA21.1 localization in early part of GAA21 gene makes it especially well suited to apply this strategy. The GAA21.1 target is located in an intronic part of GAA gene. Since it is located in the part of the gene corresponding to the N-terminal part of the encoded protein, the meganuclease able to cleave this target might among other uses (mutagenesis, genome engineering) be used to perform exon Knock In of a functional version of GAA gene to correct functionally a deficient GAA gene.

GAA21 sequence is partly a patchwork of the 10TTC P (SEQ ID NO: 4), 10CCC _.P (SEQ ID NO: 1 11), 5CAT_P (SEQ ID NO: 109) and 5GAGJ⁵ (SEQ ID NO: 110) target sequences that are 24 bp derivatives of C1221 (SEQ ID NO: 2), a palindromic sequence cleaved by l-Crel (Arnould et al., J. Mol. Biol., 2006, 355, 443-458). However, the structure of I-Oel bound to its DNA target suggests that the two external base pairs of these targets (positions -12 and 12) have no impact on binding and cleavage (Chevalier et al, Nat. Struct. Biol., 2001, 8, 312-316; Chevalier and Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774; Chevalier et al , J. Mol. Biol., 2003, 329, 253-269), and therefore in this study, only positions -11 to 1 1 were considered.

Consequently, the GAA21 series of targets were defined as 22 bp sequences instead of 24 bp. GAA21.1 possesses the same sequence as C1221 for - 2/+2 region. Two palindromic targets, GAA21.3

(TCTTCCCCATGTACATGGGGAAGA SEQ ID NO: 112) and GAA21.4 (GGCCCCCGAGGTACCTCGGGGGCC SEQ ID NO: 1 13), were derived from GAA21.1 (SEQ ID NO: 108, Figure 14). Since GAA21.3 (SEQ ID NO: 1 12) and GAA21.4 (SEQ ID NO: 1 13) are palindromic, they should be cleaved by homodimeric proteins. Thus, proteins able to cleave the GAA21.3 (SEQ ID NO: 112) and GAA21.4 (SEQ ID NO: 1 13) sequences as homodimers were first obtained with the same methods as those described in previous examples for GAA2 target.

l-Crel heterodimers able to cleave target sequence GAA21.1 (SEQ ID NO: 108) were identified using methods derived from those described in Chames et al. (Nucleic Acids Res., 2005, 33, el78), Arnould et al. (J. Mol. Biol., 2006, 355, 443-458), Smith et al. (Nucleic Acids Res., 2006, 34, el49), Arnould et al. (Arnould et al. J Mol Biol. 2007 371 :49-65) could. Heterodimers with activity upon the GAA21.1 target (SEQ ID NO: 108) were identified in Yeast.

These heterodimers were then used to design single-chain meganucleases directed against the GAA21.1 target sequence (SEQ ID NO: 108). These single-chain meganucleases were cloned into mammalian expression vectors and tested for GAA21.1 cleavage in CHO cells. Strong cleavage activity of the GAA21.1 target could be observed for these single chain molecules in mammalian cells.

Example 7.1 Identification of meganucleases cleaving GAA21.1

I-Crel variants potentially cleaving the GAA21.1 target sequence in heterodimeric form were constructed by genetic engineering. Pairs of such variants were then co-expressed in yeast. Upon co-expression, three molecular species are obtained, namely two homodimers and the desired heterodimer. It was then determined whether the heterodimers were capable of cutting GAA21 .1 target sequence SEQ ID NO: 108.

1) Materials and Methods

a) Construction of variants of the l-Crel meganuclease cleaving palindromic sequences derived from the GAA21 .1 target sequence

The GAA21.1 (SEQ ID NO: 108) sequence is partially a combination of the l OTTCJP (SEQ ID NO: 4), 5CATJP (SEQ ID NO: 109), 10CCC_P (SEQ ID NO: 1 1 1 ) and 5GAG_P (SEQ ID NO: 1 10) target sequences which are shown on Figure 14. These sequences are cleaved by meganucleases obtained as described in International PCT applications WO 2006/097784 and WO 2006/097853, Arnould et al. (J. Mol. Biol., 2006, 355, 443-458) and Smith et al. (Nucleic Acids Res,, 2006).

A series of targets were derived from GAA21 (Figure 14). The palindromic targets, GAA21.3 (TCTTCCCCATGTACATGGGGAAGA SEQ ID NO: 1 12) and GAA21.4 (GGCCCCCGAGGTACCTCGGGGGCC SEQ ID NO: 1 13), should be cleaved by homodimeric proteins. Therefore, homodimeric l-Crel variants cleaving either the GAA21.3 palindromic target sequence of SEQ ID NO: 1 12 or the GAA21 .4 palindromic target sequence of SEQ ID NO: 1 13 were constructed using methods derived from those described in Chames et al. (Nucleic Acids Res., 2005, 33 , el 78), Arnould et al. (J. Mol. Biol., 2006, 355, 443-458), Smith et al. (Nucleic Acids Res., 2006, 34, el49) and Arnould et al. (Arnould et al. J Mol Biol. 2007 371 :49-65). b) Construction of target vector

An oligonucleotide consisting of SEQ ID NO: 1 14, corresponding to the GAA21.1 target sequence flanked by gateway cloning sequences, was ordered from PROLIGO. This oligo has the following sequence:

TGGCATACAAGTTTTCTTCCCCATGTACCTCGGGGGCCCA ATCGTCTGTCA SEQ ID NO: 1 14).

Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned into the pCLS 1055 yeast reporter vector using the Gateway protocol (INVITROGEN).

Yeast reporter vector was transformed into the FYBL2-7B Saccharomyces cerevisiae strain having the following genotype: MAT a, ura3 A851 , trp l A63, leu2A l , lys2A202. The resulting strain corresponds to a reporter strain (MILLEGEN). c) Co-expression of variants

The open reading frames coding for the variants cleaving the GAA21.3 or the GAA21 .4 sequences were cloned into the pCLS 1 107 and pCLS0542 expression vectors, respectively. Yeast DNA from these variants was extracted using standard protocols and was used to transform E. coli. The resulting plasmids were then used to co-transform yeast. Transformants were selected on synthetic medium lacking leucine and containing G418. d) Mating of meganucleases coexpressing clones and screening in yeast

Mating was performed using a colony gridder (QpixII, Genetix). Variants were gridded on nylon filters covering YPD plates, using a low gridding density (4-6 spots/cm²). A second griddmg process was performed on the same filters to spot a second layer consisting of different reporter-harboring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30°C for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, adding G418, with galactose (2 %) as a carbon source, and incubated for five days at 37 °C, to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02 % X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1 % SDS, 6% dimethyl formamide (DMF), 7mM β-mercaptoethanol, 1 % agarose, and incubated at 37°C, to monitor β-galactosidase activity. Results were analyzed by scanning and quantification was performed using an appropriate software. Results examples are shown in figure 16 and figure 17.

2) Results

Co-expression of different variants resulted in cleavage of the GAA21.1 target in the combinations indicated in Table 7 herebelow. All combinations in this table correspond to active heterodimer.

First l-Crel variant (GAA21.4) Second l-Crel variant (GAA21.3)

Sequences Sequences SEQ ID NO:

33C38S44A68Y70S75Y 123

30R38E44A70S75Q77E 33T44A68Y70S75Y85R 124

SEQ ID NO: 115 33C38S44N68Y70S75Y77R80K 125

33T44A68Y70S75Y83L 126

33T44A49S50R68Y70S75Y 127

33T44A68Y70S75Y117G 128

33C38S44N68Y70S75Y77N99L 129

33C44A68Y70S75Y 130

26R33C38S44N68Y70S75Y77R 131

33C38S44A68Y70S75Y 132

30R38E44N68H70S75Y77N80K 33T44A68Y70S75Y85R 133

SEQ ID NO: 116 33C38S44N68Y70S75Y77R80 134

33T44A68Y70S75Y83L 135

33T44A49S50R68Y70S75Y 136

33T44A68Y70S75Y117G 137

33C38S44N68Y70S75Y77N99L 138

33C44A68Y70S75Y 39 26R33C38S44N68Y70S75Y77R 140

26R33C38S44A68Y70S7SY77N99L 141

30R38E44A70S75Q77E 2SR33C38S44A68Y70S75Y85R 142

SEQ ID NO: 117 26R33C38S44N68Y70S75Y85R 143

33C38S44A68Y70S75Y1 17G 144

33C38S44A68Y70S75Y85R 145

26R33C38S44N68Y70S75Y77R129A 146

26R33C38S44N68Y70S75Y77N99L 147

33T43L44A68Y70S75Y83L1 17G 148

33T44A68Y70S75Y83L 149

30R38E44N68H70S75Y77N80K105A 26R33C38S44A68Y70S75Y77N99L 150

SEQ ID NO: 118 26R33C38S44A68Y70S75Y85R 151

26R33C38S44N68Y70S75Y85R 152

33C38S44A68Y70S75Y1 1 7G 153

33C38S44A68Y70S75Y85R 154

26R33C38S44N68Y70S75Y77R129A 155

26R33C38S44N68Y70S75Y77N99L 156

33T43L44A68Y70S75Y83L1 7G 157

33T44A68Y70S75Y83L 158R38E44N68H70S75Y77N80K96R105A 26R33C38S44A68Y70S75Y77N99L 159

SEQ ID NO: 119 26R33C38S44A68Y70S75Y85R 160

26R33C38S44N68Y70S75Y85R 161

33C38S44A68Y70S75Y1 17G 162

33C38S44A68Y70S75Y85R 163

26R33C38S44IM68Y70S75Y77R129A 64

26R33C38S44N68Y70S75Y77N99L 165

33T43L44A68Y70S75 Y83L117G 166

33T44A68Y70S75Y83L 167

30R38E44N68H70S75Y77N80R 26R33C38S44A68Y70S75Y77N99L 168

SEQ ID NO: 120 26R33C38S44A68Y70S75Y85R 169 26R33C38S44N68Y70S75Y85R 170

33C38S44A68Y70S75Y117G 171

33C38S44A68Y70S75Y85R 172

26R33C38S44N68Y70S75Y77R 29A 173

26R33C38S44N68Y70S75Y77N99L 174

33T43L44A68Y70S75Y83L117G 175

33T44A68Y70S75Y83L 176

30R38E44N68H70S75Y77N80K153A 26R33C38S44A68Y70S75Y77N99L 1 7

SEQ ID NO: 121 26R33C38S44A68Y70S75Y85R 178

26R33C38S44N68Y70S75Y85R 179

33C38S44A68Y70S75Y 17G 80

33C38S44AS8Y70S75Y85R 81

26R33C38S44N68Y70S75Y77R129A 182

26R33C38S44N68Y70S75Y77N99L 183

33T43L44A68Y70S75Y83L117G 184

33T44A68Y70S75Y83L 185

30 38E44N46S68H70S75Y77N80K 26R33C38S44A68Y70S75Y77N99L 186

SEQ ID NO: 122 26R33C38S44A68Y70S75Y85R 187

26R33C38S44N68Y70S75Y85R 188

33C38S44A68Y70S75Y 1 7G 189

33C38S44A68Y70S75Y85R 190

2SR33C38S44N68Y70S75Y77R 29A 191

26R33C38S44N68Y70S75Y77N99L 192

33T43L44A68Y70S75Y83L1 7G 193

Table 7: heterodimers cleaving GAA21.1 in Yeast

In conclusion, several heterodimeric l-Crel variants able to cleave GAA21 target sequence in yeast were identified (Examples of positive results are shown in Figures 16 and 17). Example 7.2. Validation of GAA21 target cleavage in an extrachromosomal model in CHO cells by covalent assembly of heterodimers as single chain l-Crel variants able to efficiently cleave the GAA21 target in yeast when forming heterodimers are described hereabove in example 7.1. In order to further assess the cleavage activity for the GAA21 target in CHO cells, synthetic single chain molecules based on several pairs of mutants identified in Yeast have been assayed using an extrachromosomal assay in CHO cells.

The screen in CHO cells is a single-strand annealing (SSA) based assay where cleavage of the target by the meganucleases induces homologous recombination and expression of a LagoZ reporter gene (a derivative of the bacterial lacZ gene). Several scaffolds have been generated and tested.The Ml x MA GAA21 heterodimer gives high cleavage activity in yeast. GAA21.3-MA is a GAA21.3 cutter that bears the following mutations in comparison with the l-Crel wild type sequence: 26R 33C 38S 44A 68Y 70S 75Y 85R. GAA21.4-M1 is a GAA21.4 cutter that bears the following mutations in comparison with the l-Crel wild type sequence: 30R 38E 44N 46S 68H 70S 75Y 77N 80K.

Single chain constructs were engineered using the linker RM2 [AAGGSDKYNQALSKYNQALSKYNQALSGGGGS (SEQ ID NO: 194)], thus resulting in the production of the single chain molecule: MA-linkerRM2-Ml .

During this design step, the G19S mutation was introduced into the C-terminal Ml variant. In addition, mutations K7E and K96E were introduced into the MA variant and mutations E8K and E61R into the Ml variant to create the single chain molecule: MA (K7E K96E) - linkerRM2 - Ml (E8K E61R G19S) that is further called SCOH-GA6-G2M 3 scaffold

(7E26R33C38S44A68Y70S75Y85R96E132V_8K19S30R38E44N46S61R68H70S75 Y77N80K132V; SEQ ID NO: 203).

Some additional amino-acid substitutions have been found in previous studies to enhance the activity of l-Crel derivatives: I132V (replacement of Isoleucine 132 with Valine), E80K and V105A are some of these mutations of potential interest. The I132V mutation was introduced into either one, both or none of the coding sequence of N-terminal and C-terminal protein fragments.

Similar strategies were applied to several scaffolds and the resulting proteins are shown in Table 8 below. All the single chain molecules were assayed in CHO for cleavage of the GAA21.1 target.

1) Materials and Methods

a) Cloning of GAA21.1 target in a vector for CHO screen

An oligonucleotide corresponding to the GAA21 target sequence flanked by gateway cloning sequences, was ordered from PROLIGO (TGGCATACAAGTTTTCTTCCCCATGTACCTCGGGGGCCCAATCGTCTGTCA , SEQ ID NO: 114). Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned using the Gateway protocol (INVITROGEN) into the pCLS 1058 CHO reporter vector. Cloned target was verified by sequencing (MILLEGEN). b) Cloning of the single chain molecule

A series of synthetic gene assembly was ordered to MWG- EUROFINS or GeneCust providers. Synthetic genes coding for the different single chain variants targeting GAA21 ("SCOH-GA6") were cloned into pCLS1853 using Ascl and Xhol restriction sites. c) Extrachromosomal assay in mammalian cells

CHO Kl cells were transfected with Polyfect® transfection reagent according to the supplier's protocol (Qiagen). 72 hours after transfection, culture medium was removed and 150μ1 of lysis/revelation buffer for β -galactosidase liquid assay was added. After incubation at 37°C, OD was measured at 420 nm. The entire process was performed on an automated Velocityl l BioCel platform. Per assay, 150 ng of target vector was cotransfected with an increasing quantity of variant DNA from 0.78 to 25 ng. Finally, the transfected DNA variant DNA quantity was 0.78, 1.56, 3.12, 6.25, 12.5 and 25ng. The total amount of transfected DNA was completed to 175ng (target DNA, variant DNA, carrier DNA) using an empty vector (pCLS0002). d) Results

The activity of the single chain molecules against the GAA21 target was monitored using the previously described CHO assay along with our internal control SCOH-RAG and I-Sce I meganucleases. All comparisons were done at 0.78, 1.56, 3.12, 6.25, 12.5 and 25ng transfected variant DNA (Figure 18). Examples of single chain molecules displaying GAA21 target cleavage activity in CHO assay are listed in Table 8 below.

Variants shared specific behavior upon assayed dose depending on the mutation profile they bear (Figure 18). For example, pCLS4626 SCOH-GA6- G2M3-C (SEQ ID NO: 202) displays higher activity at all tested doses than pCLS4056 SCOH-GA6-bl2-C (SEQ ID NO: 201) variant. In particular pCLS4626 SCOH-GA6-G2 3-C (SEQ ID NO: 202) displays an activity comparable or superior to the activity of SC Rag and superior at low dose to the activity of I-Scel, a reference molecule in genome engineering. All of the "SCOH-GA6" variants active in CHO assay can be considered for genome engineering at GAA21 locus including insertion of transgenes (exon KI), gene modification, gene correction and mutagenesis.

Table 8: Single chain series designed for strong cleavage of GAA21 target in CHO cells

Claims

1. An l-Crel variant, characterized in that at least one of the two I- Crel monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG core domain situated from positions 26 to 40 and 44 to 77 of I-Oel, said variant being able to cleave a DNA target sequence from the Human Lysosomal Acid a-Glucosidase Gene (GAA), and being obtainable by a method comprising at least the steps of:

(a) constructing a first series of l-Crel variants having at least one substitution in a first functional subdomain of the LAGLIDADG core domain situated from positions 26 to 40 of l-Crel,

(b) constructing a second series of l-Crel variants having at least one substitution in a second functional subdomain of the LAGLIDADG core domain situated from positions 44 to 77 of l-Crel,

(c) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant l-Crel site wherein at least one of (i) the nucleotide triplet in positions -10 to -8 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions +8 to +10 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in position -10 to -8 of said DNA target sequence from GAA,

(d) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein at least one of (i) the nucleotide triplet in positions -5 to -3 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions +3 to +5 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in position -5 to -3 of said DNA target sequence from GAA,

(e) selecting and/or screening the variants from the first series of step (a) which are able to cleave a mutant I-Crel site wherein at least one of (i) the nucleotide triplet in positions +8 to +10 of the I-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -10 to -8 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in position +8 to +10 of said DNA target sequence from GAA,

(f) selecting and/or screening the variants from the second series of step (b) which are able to cleave a mutant l-Crel site wherein at least one of (i) the nucleotide triplet in positions +3 to +5 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -5 to -3 has been replaced with the reverse complementary sequence of the nucleotide triplet which is present in position +3 to +5 of said DNA target sequence from GAA,

(g) combining in a single variant, the mutation(s) in positions 26 to

40 and 44 to 77 of two variants from step (c) and step (d), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions -10 to -8 is identical to the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA, (ii) the nucleotide triplet in positions +8 to +10 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -10 to -8 of said DNA target sequence from GAA, (iii) the nucleotide triplet in positions -5 to -3 is identical to the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA and (iv) the nucleotide triplet in positions +3 to +5 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions -5 to -3 of said DNA target sequence from GAA, and/or

(h) combining in a single variant, the mutation(s) in positions 26 to 40 and 44 to 77 of two variants from step (e) and step (f), to obtain a novel homodimeric l-Crel variant which cleaves a sequence wherein (i) the nucleotide triplet in positions +8 to +10 of the I-Oel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and (ii) the nucleotide triplet in positions -10 to -8 is identical to the reverse complementary sequence of the nucleotide triplet in positions +8 to +10 of said DNA target sequence from GAA, (iii) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA, (iv) the nucleotide triplet in positions -5 to -3 is identical to the reverse complementary sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA,

(i) combining the variants obtained in steps (g) and (h) to form heterodimers, and

(j) selecting and/or screening from the heterodimers of step (i) those heterodimers which are able to cleave a sequence wherein (i) the nucleotide triplet in positions +8 to +10 of the l-Crel site has been replaced with the nucleotide triplet which is present in positions +8 to +10 of said DNA target sequence from GAA and

(ii) the nucleotide triplet in positions -10 to -8 is identical to the sequence of the nucleotide triplet in positions +8 to +10 of said DNA target sequence from GAA and

(iii) the nucleotide triplet in positions +3 to +5 is identical to the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and

(iv) the nucleotide triplet in positions -5 to -3 is identical to the sequence of the nucleotide triplet which is present in positions +3 to +5 of said DNA target sequence from GAA and (v) wherein the nucleotides at positions -2 to +2 are identical to the nucleotides which are present at positions -2 to +2 of said DNA target sequence from GAA,

(k) selecting and/or screening from those selected heterodimers from step (j), those heterodimers which are able to cleave said DNA target sequence from GAA.

2. The variant of claim 1 , wherein said variant may be obtained by a method comprising the additional steps of:

(1) selecting heterodimers from step (k) and constructing a third series of variants having at least one substitution in at least one of the monomers in said selected heterodimers,

(m) combining said third series variants of step (1) and screening the resulting heterodimers for altered cleavage activity against said DNA target from GAA.

3. The variant of claim 2, wherein in said step (1) said at least one substitution is introduced by site directed mutagenesis in a DNA molecule encoding said third series of variants, and/or by random mutagenesis in a DNA molecule encoding said third series of variants.

4. The variants of claim 2 or 3, wherein steps (1) and (m) are repeated at least two times and wherein the heterodimers selected in step (1) of each further iteration are selected from heterodimers screened in step (m) of the previous iteration which showed altered cleavage activity against said DNA target from GAA.

5. The variant of any one of claims 1 to 4, wherein said substitu- tion(s) in the subdomain situated from positions 44 to 77 of l-Crel are in positions 44, 68, 70, 75 and/or 77.

6. The variant of any one of claims 1 to 5, wherein said substitution^) in the subdomain situated from positions 26 to 40 of l-Crel are in positions 26, 28, 30, 32, 33, 38 and/or 40.

7. The variant of any one of claims 1 to 6, which comprises one or more substitutions in positions 137 to 143 of l-Crel that modify the specificity of the variant towards the nucleotide in positions ± 1 to 2, ± 6 to 7 and/or + 11 to 12 of the target site in GAA.

8. The variant of any one of claims 1 to 7, which comprises one or more substitutions on the entire l-Crel sequence that improve the binding and/or the cleavage properties of the variant towards said DNA target sequence from GAA.

9. The variant of any one of claims 1 to 8, wherein said substitutions are replacement of the initial amino acids with amino acids selected in the group consisting of A, D, E, F, G, H, I, K, M, N, P, Q, R, S, T , Y, C, W, L and V.

10. The variant of any one of claims 1 to 9, which is a heterodimer, resulting from the association of a first and a second monomer having different mutations in positions 26 to 40 and 44 to 77 of l-Crel, said heterodimer being able to cleave a non-palindromic DNA target sequence from GAA.

1 1. The variant of claim 10, which is an obligate heterodimer, wherein the first and the second monomer, respectively, further comprises the D137R mutation and the R51D mutation.

12. The variant of claim 10, which is an obligate heterodimer, wherein the first monomer further comprises the K7R, E8R, E61R, K96R and L97F or K7R, E8R, F54W, E61R, K96R and L97F mutations and the second monomer further comprises the K7E, F54G, L58M and K96E or K7E, F54G, K57M and K96E mutations.

13. The variant according to any one of claim 1 to 12, wherein said variant consists of a single polypeptide chain comprising two monomers or core domains of one or two variant(s) of anyone of claims 1 to 13 or a combination of both.

14. The variant of claim 13 which comprises the first and the second monomer as defined in anyone of claims 1 to 13, connected by a peptide linker.

15. The variant of claim any one of claims 1 to 14, wherein said DNA target is selected from the group consisting of the SEQ ID NO: 8, 47 to 65 and 108.

16. The variant according to any one of claims 1 to 15, wherein at least one of said I-Crel monomers are selected from the group consisting of SEQ ID

NO: 19 to 46, 66 to 103, 106, and 115 to 193.

17. The variant according to any one of claims 1 to 15, wherein said variant is selected from the group consisting of SEQ ID NO: 19 to 46, 66 to 103, 106, and 1 15 to 193 and 195 to 203.

18. A polynucleotide fragment encoding the variant of anyone of claims 1 to 17.

19. An expression vector comprising at least one polynucleotide fragment of claim 18.

20. The vector of claim 19, which includes a targeting construct comprising a sequence to be introduced flanked by sequences sharing homologies with the regions surrounding said DN A target sequence from GAA.

21. The vector of claim 20, wherein said sequence to be introduced is a sequence which inactivates GAA.

22. The vector of claim 21 , wherein the sequence which inactivates GAA comprises in the 5 ' to 3' orientation: a first transcription termination sequence and a marker cassette including a promoter, the marker open reading frame and a second transcription termination sequence, and said sequence interrupts the transcription of the coding sequence.

23. The vector of any one of claims 19 to 22, wherein said sequence sharing homologies with the regions surrounding DNA target sequence from GAA is a fragment of GAA comprising sequences upstream and downstream of the cleavage site, so as to allow the deletion of coding sequences flanking the cleavage site.

24. A host cell which is modified by a polynucleotide of claim 18 or a vector of anyone of claims 19 to 23.

25. A non-human transgenic animal which is modified by a polynucleotide of claim 17 or a vector of anyone of claims 19 to 23.

26. A transgenic plant which is modified by a polynucleotide of claim 17 or a vector of anyone of claims 19 to 23.

27. Use of at least one variant of anyone of claims 1 to 17, or at least one vector according to anyone of claims 19 to 23, for genome engineering, for non- therapeutic purposes.

28. Use of a variant according to any one of claims 1 to 17, a nucleic acid molecule according to claim 18 or a vector according to any one of claims 19 to 23 to prepare a medicament to treat a genetic disease caused by a mutation in GAA.