WO2011019793A2 - Individualized therapy of single gene disorders with genetically modified adult stem cells - Google Patents

Abstract

Embodiments of the invention provide methods for individualized therapy of diseases and disorders caused by one or more mutations in a single gene that involve administration of adult stem cells to a patient that have been genetically modified to enable the cells to produce small interfering RNA molecules that specifically target the single mutant gene. In particular embodiments of the invention, the monogenic diseases or disorders are accompanied by tissue damage associated with inflammation, and, following administration of the genetically modified adult stem cells to a patient, the cells localize to one or more areas of inflammation. Further embodiments of the invention relate to genetically modified adult stem cells and short interfering RNA molecules used in such methods.

Description

INDIVIDUALIZED THERAPY OF SINGLE GENE DISORDERS WITH GENETICALLY MODIFIED ADULT STEM CELLS

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. provisional patent application number 61/233,537, filed August 13, 2009, which is incorporated herein by reference in its entirety.

TECHNICAL FIELD

[0002] Particular aspects of the present invention relate to methods for individualized therapy of single gene disorders that utilize genetically modified adult stem cells. Further embodiments of the invention relate to genetically modified adult stem cells and short interfering RNAs used in such methods.

BACKGROUND

[0003] Patients diagnosed with disorders caused by a mutation in a single gene, such as the vascular type of Ehlers-Danlos syndrome (VEDS), osteogenesis imperfecta, Marfan syndrome, supravalvular aortic stenosis, and Loeys-Dietz syndrome, currently have very limited treatment options, which include nonspecific symptomatic treatment, genetic counseling, and emergency intervention. Such treatments are less than optimal, and do not alleviate much of the suffering associated with monogenic diseases.

[0004] Ehlers-Danlos syndrome (EDS) is a heterogeneous group of heritable disorders characterized most severely by a rupture of hollow organs. The disease has been divided into at least nine subtypes based upon clinical, genetic, and other grounds. The vascular type of EDS (VEDS) is the most severe form of the syndrome and can lead to sudden death. VEDS is an autosomal dominant disorder in which the adverse joint and dermal conditions seen in other forms of Ehlers-Danlos syndrome are exacerbated by susceptibility to spontaneous and often catastrophic rupture of large arteries and hollow organs such as the bowel and uterus. VEDS patients often have a first major complication by the age of 20 years, and more than 80% have at least one complication by the age of 40. Life expectancy of VEDS patients is reduced; in one study the median survival age was 48 years. In addition, women with VEDS that become pregnant have complications that can lead to death. No proven treatments and no established preventive measures exist for VEDS.

[0005] A defect in the gene for the pro-collagen type III (COL3A1) is usually the genetic basis for VEDS. In normal patients, COL3A1 is a homotripolymer of three identical monomer peptides. Patients heterozygous for a mutation in one copy of the COL3A1 gene exhibit severe symptoms because when one of the two copies of the gene that encodes the monomers is mutated, only 1/2 x 1/2 x 1/2, or 1/8, of the tripolymers are not defective, as described in Pyeritz, R. E., NEJM, 2000, 342, 730-732, incorporated herein by reference in its entirety. Patients that are haploinsufficient for COL3A1 have a reduced amount of non-mutated COL3A1, and exhibit less severe symptoms and subsequent complications than patients that are heterozygous for COL3A1 mutations.

[0006] In contrast to mutations in genes that encode the dominant protein of a tissue (e.g., COLlAl and COL2A1), in which "null" mutations result in phenotypes milder than those caused by mutations that alter protein sequence, the phenotypes produced by four described patients with mutations in COL3A1 overlap with those of the vascular form of EDS, as described in Schwarze U, et al. Am J Hum Genet., 2001, 69, 989-1001, incorporated herein by reference in its entirety. This suggests that the major effect of many of these dominant mutations in the "minor" collagen genes may be expressed through protein deficiency rather than through incorporation of structurally altered molecules into fibrils. However, a less severe phenotype has been observed in patients with the haploinsufficiency type of VEDS, according to a presentation at the annual meeting of The

American Society of Human Genetics, October 27, 2007, San Diego, CA by Rink BD, et al. and in patients described by Plancke, A., et al., Eur J Hum Genet., 2009, (doi: 10.1038/ejhg.2009.76).

[0007] Marfan syndrome (MFS) is an autosomal dominant systemic disorder of connective tissue that affects approximately 1 in 5,000 individuals. Symptoms of Marfan syndrome include aortic aneurysm and dissection, ocular lens dislocation, and long bone overgrowth. One of the main characteristics of Marfan syndrome is a life-threatening, progressive enlargement of the root of the aorta, which can lead to its rupture. Early diagnosis and therapeutic interventions, such as using β- blockers to decrease hemodynamic stress, and prophylactic surgical repair of the aortic root, can increase the life expectancy in Marfan syndrome patients. Other treatments are currently being tested in animal models, such as the angiotensin II receptor blocker losartan, which prevented the development of aneurysms in a MFS mouse model. A clinical trial with losartan is also currently underway in children with MFS. Despite these treatment options, significant morbidity and early mortality remain associated with Marfan syndrome. At best, β-blocker therapy slows the rate of aortic root growth, but it does not preclude the need for reconstructive surgery, which can require sequential revisions and often mandates life-long use of anticoagulants.

[0008] Defects in the fibrillin- 1 (FBNl) gene are considered to be the genetic basis for Marfan syndrome. Fibrillin- 1 has a modular structure, having 47 repeats of six-cysteine epidermal- growth-factor (EGF)-like motifs, 43 of which are of the calcium-binding (cb) type (cb-EGF).

Fibrillin- 1 monomers associate to form complex extracellular macroaggregates, termed

"microfibrils," which are important for the integrity and homeostasis of both elastic and non-elastic tissues. Fibrillin- 1 also contains seven eight-cysteine motifs, which are homologous to motifs found in the latent transforming-growth- factor beta-binding proteins (TGF-β BPs), and a proline-rich region.

[0009] The correlation between various FBNl genotypes and the nature and severity of the clinical manifestations in Marfan syndrome indicate different causative mechanisms for the disorder. The exact mechanisms by which mutations in FBNl result in disease are still unclear, however. A dominant negative model has been proposed, in which a mutant monomer either disrupts the assembly of normal fibrillin- 1 into microfibrils or causes incorrect assembly of microfibrils. The biochemical pathway by which fibrillin- 1 is assembled into microfibrils is not fully understood, however. Different effects on protein trafficking have also been demonstrated, with some mutations acting in a dominant negative fashion and others causing haploinsufficiency. In addition, in Marfan syndrome mouse models, deficiency of fibrillin- 1 alters matrix sequestration of the large latent complex of TGF-β 1, rendering the cytokine more prone for activation and affecting the

bioavailability of endogenous TGF-β 1.

[0010] In addition, cellular responses to misfolding of mutated fibrillin- 1 are also associated with certain mutations in fibrillin- 1. Fibrillin- 1 mutations that affect calcium binding to cb-EGF, also cause retention of misfolded proteins in the endoplasmic reticulum and may induce an unfolded protein response. A mouse heterozygous for an Fbnl allele encoding a cysteine substitution (CyslO39 -> GIy (C1039G)), a mutation in a cb-EGF domain of fibrillin- 1, developed aortic aneurysm with dissection of the vessel wall. This mouse model was used to provide evidence for a critical contribution of haploinsufficiency in the pathogenesis of Marfan syndrome based on rescue experiments with a wild-type FBNl gene.

[0011] Symptoms have also been identified in osteogenesis imperfecta that are also associated with specific mutations in the type I collagen gene, as described in Millington-Ward S, et al., Eur J Hum Genet., 2004, 12, 864-866, incorporated herein by reference in its entirety. In addition, symptoms have been identified in supravalvular aortic stenosis that are associated with specific mutations in the elastin gene, as described in Aboulhosn J., et al, Circulation, 2006, 114, 2412-2422; Milewicz D.M., et al, Matrix Biol, 2000, 19, 471-480, and Li D.Y., et al, Hum MoI Genet., 1997 ', 6, 1021-1028, incorporated herein by reference in their entireties. Moreover, symptoms have been identified in Loeys-Dietz syndrome that are associated with specification mutations in the TGF-β receptor gene, as described in Loeys BX. , et al, N EnglJ Med., 2006, 355, 788-798, incorporated herein by reference in its entirety. Effective treatments for these monogenic disorders have yet to be developed.

[0012] Short-interfering RNAs suppress gene expression through a highly regulated enzyme-mediated process called RNA interference (RNAi). RNAi involves multiple RNA-protein interactions characterized by four major steps: assembly of siRNA with the RNA-induced silencing complex (RISC), activation of the RISC, target recognition and target cleavage.

[0013] Allele-specific silencing of several mutant targets with siRNAs has been studied for diseases including osteogenesis imperfecta, sickle cell anaemia, primary retinal degeneration, spinocerebellar ataxia, and sialuria, as described in Millington-Ward S, et al, Eur J Hum Genet., 2004, 12, 864-866; Dykxhoorn DM, et al., Proc Natl Acad Sci USA,. 2006, 103, 5953-5958; Palfi A, et al, Hum Mutat,. 2006, 27, 260-268; Xia H, et al, Nat Med,. 2004, 10, 816-820; Klootwijk RD, et al, Faseb J., 2008, 22, 3846-3852; and Schwarz, D. S., et al, PLoS Genet, 2006, 2, el40, each of which is incorporated herein by reference in its entirety.

[0014] Using adult stem cells as therapeutic agents to treat a disease has become increasingly popular. During the last decade, isolated and expanded stem and progenitor cells have demonstrated the capacity to differentiate into multiple cell types. The first clinical trial with adult stem cells for the repair of nonhematopoietic tissues was carried out with plastic adherent cells out of bone marrow. These cells can be isolated easily from a small sample of marrow and rapidly expanded to generate large numbers of cells for autologous therapies. The initial clinical trial with allogeneic bone marrow transplantation was implemented for the treatment of patients with severe osteogenesis imperfecta, described in Horwitz, E. M., et ah, Nat Med, 1999, 5, 309-13, incorporated herein by reference in its entirety. However, the study has a number of limitations. First, whereas the number of MSC homed to bone in these patients was small, the patients received other concurrent therapies. In addition, there was no control group in the study. Thus, the real

contribution of the transplanted MSC to the observed positive clinical response is difficult to determine. Furthermore, stem cells have the ability to suppress immune reactions; nevertheless, the allogeneic cell transplantation had to be accompanied by immunosuppression in

the trials, which were initiated for graft-versus host disease. The therapy was also dependent on a matching donor.

[0015] Due to the many limitations of present treatments described above, patients suffering from diseases and disorders caused by mutations in single genes currently have very few viable therapeutic options. A pressing need thus exists in the art for the development of effective treatments for such diseases and disorders.

SUMMARY

[0016] Certain embodiments of the present invention relate to methods for treating diseases and disorders that result from mutations in single genes that lead to tissue damage that is

accompanied by inflammation. Particular aspects of the methods comprise isolating cells from patients suffering from such diseases and disorders and genetically modifying the cells. In embodiments of the methods, the cells are genetically modified by introducing into the cells exogenous DNA that comprises a nucleotide sequence encoding an RNA transcript that is processed in the cells into small interfering RNA molecules. In particular embodiments in the methods, the small interfering RNA molecules comprise a guide strand that is complementary to the messenger RNA encoded by the single gene that has the mutation. Further embodiments of the invention involve introducing the genetically modified cells into the patient, which results in the production of small interfering RNA molecules that specifically reduce expression of the single gene having the mutation in the patient.

[0017] Further embodiments of the present invention relate to cells isolated from patients suffering from diseases or disorders that result from mutations in single genes that lead to tissue damage accompanied by inflammation. Following isolation, the cells are genetically modified in certain embodiments of the invention. In particular aspects of the invention, the cells are genetically modified by introducing into the cells exogenous DNA that comprises a nucleotide sequence encoding an RNA transcript that is processed in the cells into small interfering RNA molecules. In certain aspects of the invention, the small interfering RNA molecules comprise a guide strand that is complementary to messenger RNA encoded by the single genes comprising the mutations.

[0018] Additional embodiments of the present invention relate to small interfering RNA molecules comprising a guide strand that is complementary to messenger RNA encoded by a human gene comprising a mutation that results in a disease or disorder that leads to tissue damage accompanied by inflammation.

BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure IA depicts the nucleotide sequence of a region of mRNA encoded by the COL3A1 gene that is targeted by siRNA molecules. The nucleotide sequences of the targeted region of the wild type COL3A1 mRNA (SEQ ID NO:33) and the targeted region of a mutant COL3A1 mRNA (SEQ ID NO:32) are shown. The nucleotide sequences of the guide strand of 19 synthetic siRNAs designed and tested for reduction of mRNA encoded by wild type and mutant COL3A1 alleles are also shown (SEQ ID NOS: 13-31). The position of the mutation is highlighted in each sequence.

[0020] Figure IB is a graphical representation of the results of a luciferase reporter assay performed in HEK293 cells transfected with a non-silencing control siRNA and one of 19 test siRNAs having the guide strand sequences shown in Figure IA, and a luciferase reporter vector constructed for expression of luciferase and a portion of either the wild-type COL3A1 gene, which is the non-silencing control, or a portion of a COL3A1 gene containing a G85V mutation. The silencing factor shown reflects the amount by which the test siRNAs were able to silence the mutant form of the COL3A1 sequence beyond the silencing exhibited by the wild-type sequence. Each experiment was performed in triplicate and the data were normalized to renilla activity and luciferase activity of control siRNA. Average ± SEM is shown.

[0021] Figure 2 depicts the sequences of wild-type (755-G) (SEQ ID NO:34) and mutant (755-T) (SEQ ID NO:36) COL3A1 cDNA derived from skin fibroblasts. Since the VEDS-patient from which the mutant COL3A1 mRNA was obtained is heterozygous for the COL3A1 755 G/T mutation, sequencing of the region harboring the mutation resulted in detection of both guanine and thymidine at position 755. The G/T mutation resulted in substitution of a valine residue (SEQ ID NO: 37) for the glycine residue (SEQ ID NO:35) in the protein.

[0022] Figure 3 is a graphical representation of the results of a luciferase reporter assay performed in HCTl 16 cells transfected with a non-silencing control siRNA and one of 19 test siRNAs having the guide strand sequences shown in Figure IA, and a luciferase reporter vector constructed for expression of luciferase and a portion of either the wild-type COL3A1 gene, which is the non-silencing control, or a portion of a COL3A1 gene containing a G85V mutation. The silencing factor shown reflects the amount by which the test siRNAs were able to silence the mutant form of the COL3A1 sequence beyond the silencing exhibited by the wild-type sequence. Each experiment was performed in triplicate and the data were normalized to renilla activity and luciferase activity of control siRNA. Average ± SEM is shown.

[0023] Figure 4 shows the results of quantitative RT PCT experiments performed using total RNA isolated from fibroblasts from a normal donor and from a VEDS patient to determine the silencing effect of different siRNAs.

[0024] In Figure 4 A, the amount of wild type COL3A1 mRNA is shown in white columns and the amount of mutated (COL3A1G85Y/+) COL3A1 mRNA is shown in gray columns. The average ± SEM of two replicates is shown. The results were analyzed by the 2-ΔΔCT method and were normalized to GAPDH. The result of a non-silencing control was set at 100%.

[0025] Figure 4B shows the silencing factor determined from the RT PCT experiments, which is the proportion of wild type to the mutated form of COL3A1 mRNA.

[0026] Figure 5 A is a graphical representation of the results of experiments in which levels of wild type COL3A1 mRNA were measured by quantitative RT-PCR following isolation of RNA from primary fibroblasts from normal donors that had been transfected with one of three synthetic siRNAs, si6, silO, or sil7. The nucleotide sequences of the guide strands of these siRNAs are depicted in Figure IA. The average ± SEM of 3 biological and 4 technical replicates is shown. The results were analyzed by the 2^~ΔΔCT method normalized to GAPDH, and the result of a non-silencing control was set to 100%.

[0027] Figure 5B is a graphical representation of the results of experiments in which levels of COL3A1 mRNA encoding a G85V mutation were measured by quantitative RT-PCR following isolation of RNA from primary fibroblasts from a VEDS patient heterozygous for the COL3A1^G85V/+ mutation that had been transfected with one of three synthetic siRNAs, si6, silO, or sil7. The average ± SEM of 3 biological and 4 technical replicates is shown. The results were analyzed by the 2^"ΔΔCT method normalized to GAPDH, and the result of a non-silencing control was set to 100%. The results in Figure 2 A and 2B indicate that the si 10 sequence was most effective at specifically reducing expression of mutant COL3A1.

[0028] Figure 5 C is a graphical representation of the silencing factor for each of the siRNAs shown, indicating the proportional levels of expression of COL3 Al mRNA from primary fibroblasts from normal donors and from donors with the mutation, based on the results depicted in Figure 2A and Figure 2B. *P < 0.05 vs. control.

[0029] Figure 6 shows the results of Western blot analysis of COL3A1 in extracts of human fibroblast tissue culture. Extracts (15 μg) from fibroblasts from a normal donor (ND) and a VEDS patient (COL3A1 G85Y/+) were treated with 100 nM siK (control) or silO siRNA for 14 days and were compared with unttreated fibroblasts.

[0030] Figure 7 is a graphical representation of the results of experiments in which DDIT3 mRNA was analyzed to determine the effect of siRNA treatment on the endoplasmatic reticulum unfolded protein response in human fibroblasts grown in tissue culture. Levels of DDIT3 mRNA were measured by quantitative RT-PCR following isolation of RNA from normal donor fibroblasts or fibroblasts from a VEDS patient heterozygous for the COL3A1^G85V/+ mutation that had been transfected with si 10 synthetic siRNA or the siK control and incubated for 2 days. The results demonstrate that transfection of si 10 significantly reduced the elevated levels OΪDDIT3 mRNA observed in fibroblasts having the COL3AI mutation. The average ± SEM of 3 biological and 4 technical replicates is shown. The results were analyzed by the 2^"ΔΔCT method normalized to GAPDH. The result of a non-silencing control was set 100%. *P < 0.05 vs. ND control, |P < 0.05 vs. COL3A1^Q%5YI+ control.

[0031] Figure 8 depicts the results of ultrastructural analysis of extracellular matrices derived from fibroblast cell cultures by electron microscopy. Figures 8A and 8B show the extracellular matrix derived from normal fibroblasts, which is thin and has weakly banded collagen fibrils. Figures 8C, 8D, and 8E show the extracellular matrix of COL3A1G85V/+ fibroblasts, which formed disorganized bundles of collagen fibrils with irregular contours. Figures 8F and 8G show the extracellular matrix of COL3A1G85V/+ fibroblasts, which formed thin collagen fibrils with regular contours after a treatment with siRNA 10. Large particles (18 nm) correspond to collagen type I labeling and small particles (12 nm) correspond to collagen type III labeling. Bars A, C, D, E, and F: 200 nm; B and G: 100 nm.

[0032] Figure 9 shows the results of electron microscopy experiments demonstrating that si 10 siRNA reduced the level of the mutant form of COL3 'Al in primary fibroblasts, resulting in restoration of collagen fibrils in the cells. Figure 9 A depicts transmission and immunogold electron microscopy of extracted extracellular matrix from fibroblasts of a VEDS patient revealed no structurally normal fibrils. Figure 9B demonstrates that after siRNA treatment, collagen fibers like those present in fibroblasts of normal donors were detectable. Collagen I (large particles, marked by *) and collagen III (small particles, marked by arrow) were present in these fibrils.

[0033] Figure 1OA is a schematic depiction of the experimental steps for production of an shRNA containing pENTR™/U6 entry clone vector using the BLOCK-iT™ U6 entry vector kit

[0034] Figure 1OB is a schematic depiction of the experimental steps for generating an shRNA containing lentiviral expression vector and subsequently expressing the shRNA in mammalian cells, using the BLOCK-iT™ lentiviral RNAi expression system.

[0035] Figure 1 IA is a schematic depiction of the experimental steps for production of an miRNA containing pcDNA™6.2-GW/EmGFP-miR expression vector using the BioModule

BLOCK-iT™ Unit with Pol II miR RNAi expression vector.

[0036] Figure 1 IB is a schematic depiction of the experimental steps for generating an miRNA containing lentiviral expression vector and subsequently expressing the miRNA in mammalian cells, using the BioModule BLOCK-iT™ unit with the lentiviral Pol II miR RNAi expression system.

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0037] Certain embodiments of the invention are directed to individualized therapies for single gene disorders that involve using a patient's own adult stem cells, which have been genetically modified, to reduce expression of a mutant allele or alleles of a single gene that cause a disease or disorder. In some embodiments of the invention, adult stem cells are isolated from a patient having a disease or disorder that results from a mutation in a single gene, the cells are genetically modified to enable them to produce small interfering RNA molecules directed against transcripts produced by the mutant gene, and the genetically modified stem cells are introduced back into the patient, thereby reducing the expression of the mutant gene in the patient via the activity of the small interfering RNA molecules.

[0038] Numerous diseases and disorders caused by mutations in single genes are characterized by tissue damage that induces an inflammatory response. In particular aspects of the invention, following introduction in the patient, the genetically modified stem cells localize to areas of inflammation, and thus localize to areas of tissue damage. The invention thus relates, in particular aspects, to the delivery of genetically modified adult stem cells to areas of tissue damage in a patient, where the genetic modifications, in some embodiments of the invention, involve introduction into the stem cells of exogenous DNA that encodes RNA transcripts that are processed in the cells into small interfering RNA molecules that specifically target messenger RNA produced by the mutant gene.

[0039] The terms "treat" or "treating," as used herein, refer to partially or completely alleviating, inhibiting, preventing, ameliorating and/or relieving a condition from which a patient suffers.

[0040] As used herein, the phrase "a disease or disorder resulting from a mutation in a single gene," and all variations thereof, refers to diseases and disorders that are associated with adverse effects that are caused by one mutation that occurs in only one gene present in the organism having such a disease or disorder. The mutation may occur in one or both copies of the single gene in a diploid organism. In addition, the mutation may occur at different positions in the single gene in different organisms. Furthermore, various single mutations that do not differ in their position from organism to organism may occur at different positions in a single gene, and such different single mutations may result in the same disease or disorder. The phrase "a mutation in a single gene," and all variations thereof, thus refers to a mutation that may occur in one or both copies of a single gene in a diploid organism. In addition, the mutation may occur at different positions in the single gene in different organisms. Furthermore, various single mutations that do not differ in their position from organism to organism may occur at different positions in a single gene.

[0041] As used herein, the phrase "tissue damage accompanied by inflammation," and all variations thereof, refers to any damage in type or degree to any type of tissue that is accompanied by any degree of inflammation.

[0042] As used herein, the term "patient" refers to a mammal, preferably a human.

[0043] As used herein, the phrase "a patient suffering from a disease or disorder," and all variations thereof, refers to a patient who has been diagnosed with one or more conditions, or is suspected to have one or more conditions.

[0044] As used herein, the phrase "isolating cells from a patient" refers to any method that can be used to remove cells from an organism while maintaining the viability of the cells and allowing the cells to be genetically manipulated following removal of the cells from the patient. Those of ordinary skill in the art are familiar with such methods.

[0045] As used herein, the phrase "genetically modifying," and all variations thereof, refers to any type and degree of alteration in the genetic material from an organism, including all forms of DNA and RNA endogenous to an organism, to result in genetic material that is not endogenous to an organism.

[0046] As used herein, the phrase "introducing into the cells exogenous DNA," and all variations thereof, refers to any method that can be used to introduce DNA into a cell while maintaining the integrity of the DNA. Those of ordinary skill in the art are familiar with such methods.

[0047] As used herein, the phrase "introducing the genetically modified cells into a patient," and all variations thereof, refers to any means by which genetically modified cells can be introduced into a patient while maintaining the viability of the cells. Those of ordinary skill in the art are familiar with such methods, which include, for example, intravenous administration of the cells to the patient.

[0048] As used herein, the phrase "localize to areas of inflammation," and all variations thereof, refers to any measurable movement of the genetically modified cells following introduction into a patient to one or more areas of the patient that have any measurable degree of inflammation.

[0049] As used herein, the phrase "RNA transcript processed in the cells into small interfering RNA molecules," and all variations thereof, refers to any means by which any type of RNA molecule is processed into small interfering RNA molecules. Those of ordinary skill in the art are familiar with such means, which are described, for example, in Martin S. E., et al, Annu Rev Genomics Hum Genet., 2007, 8, 81-108 and Martinau H.M., et al, Toxicol Pathol, 2007, 35,327- 336, incorporated herein by reference in their entireties.

[0050] As used herein, the term "guide strand," and all variations thereof, refers to the strand of an siRNA molecule that is incorporated into the RNA-induced silencing complex (RISC) that is formed in the course of the RNA interference (RNAi) pathway.

[0051] As used herein, the phrase "specifically reducing expression of the gene having the mutation with the small interfering RNA molecules," and all variations thereof, refers to any degree or amount of reduction in the expression of the gene having the mutation that results directly or indirectly from the activity of the small interfering RNA molecules.

[0052] As used herein, the phrase "a polypeptide that does not exhibit the same type of biological activity as is exhibited by a polypeptide expressed by a wild type version of the single gene," and all variations thereof, refers to a polypeptide produced by expression of a single gene having a mutation that exhibits a biological activity differing to any measureable extent in degree or type from the biological activity exhibited by a polypeptide produced by expression of a wild type version of the single gene.

[0053] As used herein, the term "haploinsufficiency," and all variations thereof, refers to the condition that occurs when a diploid organism has only a single functional copy of a gene because one copy of the gene is inactivated by any type of mutation or genetic alteration. The single functional copy of a gene in a haploinsuffϊcient organism does not produce the same amount or type of the gene product that is produced in the wild type state, leading to an abnormal or disease state.

[0054] Embodiments of the present invention relate to methods for treating diseases and disorders resulting from a mutation in a single gene that leads to tissue damage accompanied by inflammation. In certain embodiments of the invention, such methods comprise isolating cells from a patient suffering from the disease or disorder. Further embodiments involve genetically modifying the cells by introducing into the cells exogenous DNA comprising a nucleotide sequence encoding an RNA transcript processed in the cells into small interfering RNA molecules that comprise a guide strand complementary to messenger RNA encoded by the gene having the mutation. Additional embodiments of the invention are directed to introducing the genetically modified cells into the patient. In certain embodiments of the invention, the small interfering RNA molecules specifically reduce expression of the gene having the mutation.

[0055] Numerous diseases and disorders result from mutations in single genes, and are thus known as monogenic diseases and disorders. Such diseases and disorders include, for example, vascular-type of the Ehlers-Danlos syndrome, osteogenesis imperfecta, Marfan syndrome, supravalvular aortic stenosis, and Loeys-Dietz syndrome. Those skilled in the art are familiar with additional monogenic disorders.

[0056] Numerous single genes whose mutation leads to particular disorders have been identified. For example, one or more mutations in the collagen type-Ill alpha 1 gene are associated with VEDS, one or more mutations in the collagen type-I alpha 1 gene are associated with osteogenesis imperfecta, one or more mutations in the collagen type-I alpha 2 gene are also associated with osteogenesis imperfecta, one or more mutations in the fibrillin 1 gene are associated with Marfan syndrome, one or more mutations in the elastin gene are associated with supravalvular aortic stenosis, and one or more mutations in the transforming growth factor-β receptor type II gene are associated with Loeys-Dietz syndrome.

[0057] As understood by those skilled in the art, numerous monogenic disorders are characterized by the presence of tissue damage in patients having the disorders, and such tissue damage is often followed inflammation, as described, for example, in Callewaert B., et al., Best Pract Res Clin Rheumatol., 2008, 22, 165-189 and Milewicz D.M., et al., Annu Rev Genomics Hum Genet., 2008, 9, 283-302, incorporated herein by reference in their entireties. Vascular-type of the Ehlers-Danlos syndrome, osteogenesis imperfecta, Marfan syndrome, supravalvular aortic stenosis, and Loeys-Dietz syndrome are examples of such monogenic diseases that are associated with tissue damage accompanied or followed by inflammation.

[0058] Genetic modifications can be introduced into numerous types of cells according to the methods of the invention, and, as understood by those skilled in the art, such cells include all types of stem cells. In particular embodiments of the invention, adult stem cells, such as, for example, mesenchymal stem cells or endothelial progenitor cells are used in the methods. Such cells and their use are described, for example, in Kumar, S., et al., Gene Ther., 2008, 15, 711-715 and Yamahara, K., and Itoh, Ther Adv Cardiovasc Dis., 2009, 3, 17-27 incorporated herein by reference in their entireties. Other cells that can be used in the methods are known in the art, and are described, for example, in Sieveking, D.P. and Ng, M.K., Vase Med, 2009, 14, 153-166 and Ting, A.E., et al., Crit Rev Oncol Hematol., 2008, 65, 81-93 incorporated herein by reference in their entireties. In particular embodiments of the invention, the cells utilized in the methods of the invention are isolated from a patient suffering from a monogenic disorder. Methods for isolation of the cells, including stem cells, are familiar to those skilled in the art.

[0059] Specific embodiments of the invention involve genetic modification of the isolated cells. In certain aspects, the genetic modification involves introduction of exogenous DNA into the cells. Embodiments of the invention are directed to methods in which exogenous DNA comprising a nucleotide sequence that encodes an RNA transcript is introduced into the cells. In preferred embodiments, the RNA transcript is processed into small interfering RNA molecules following introduction of the exogenous DNA into the cells. In alternate embodiments, the RNA transcript is processed into micro RNA molecules following introduction of the exogenous DNA into the cells. Those skilled in the art are familiar with small interfering RNA molecules and micro RNA molecules, their activities, and methods for designing, producing, and using such molecules, as described, for example, in Zou, G.M., and Yoder, M.C,, Biol Cell, 2005, 97, 211-219, incorporated herein by reference in its entirety. Any method known in the art can be used to introduce the exogenous DNA into the cells. In particular embodiments of the invention, a lentivirus vector is used. In other embodiments, an adeno-associated virus vector is used. Those skilled in the art are familiar with such vectors and methods for their construction and use, as described, for example, in Chang, A.H. and Sadelain, M., MoI Ther., 2007, 15, 445-456 and Schultz, B.R. and Chamberlain, J. S., MoI Ther., 2008, 16, 1189-1199 incorporated herein by reference in their entireties. Particular embodiments of the invention thus involve design and production of a vector that can be used to introduce exogenous DNA into cells, preferably adult stem cells, and the exogenous DNA comprises a nucleotide sequence that encodes an RNA transcript that is processed into small interfering RNA molecules or micro RNA molecules, preferably small interfering RNA molecules, following introduction of the exogenous DNA into the cells.

[0060] In certain embodiments of the invention, the RNA transcript encoded by the exogenous DNA is a short hairpin RNA molecule. Further embodiments of the methods of the invention involve processing of the short hairpin RNA molecule into small interfering RNA molecules following introduction of the exogenous DNA into cells.

[0061] In particular aspects of the invention, the RNA transcript produced by the exogenous DNA introduced into the patient's cells is processed into small interfering RNA molecules that comprise a guide strand that is complementary to messenger RNA encoded by the gene having the mutation responsible for the monogenic disease or disorder from which the patient suffers. In preferred embodiments of the invention, the guide strand of the small interfering RNA molecules is complementary to a region of the messenger RNA that comprises a mutation. The nucleotides of the guide strand complementary to a mutation can be present at any position of the guide strand, but are preferably located in the central regions of the guide strand.

[0062] Particular aspects of the invention are directed to methods in which the genetically modified cells are introduced into a patient. In preferred embodiments of the invention, the genetically modified cells are introduced into the patient from which the cells were initially isolated before their genetic modification. Utilization of genetically modified stem cells in a patient that were isolated, before modification, from the same patient has numerous advantages, including eliminating any risk of graft versus host disease and risk of infections associated with blood transfusions, such as infection by Hepatitis B and C, HIV, and cytomegalic viruses.

[0063] The genetically modified cells can be administered to patients using numerous methods familiar to those skilled in the art, as described, for example, in Sieveking, D. P. and Ng, M. K., Vase Med., 2009, 14, 153-166, incorporated herein by reference in its entirety. In preferred embodiments of the invention, the cells are administered intravenously.

[0064] As understood by those skilled in the art, fragmentation and disarray of elastic fibers is a focal event that results in vessel wall inflammation. This type of tissue damage is followed immediately by mobilizing, expanding, and homing of stem cells to the site of the injury. Adult stem cells thus localize to areas of inflammation within an organism, as described, for example, in Chavakis, E., et al., J MoI Cell Cardiol., 2008, 45, 514-522, incorporated herein by reference in its entirety. In this regard, as described in Kalka, et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 3422-3427, incorporated herein by reference in its entirety, stem cells have been shown to localize to lesions in the walls of blood vessels. The methods of the invention utilize this feature of stem cells to direct the genetically modified stem cells to areas of tissue damage, where they can exert their effect. Accordingly, in certain embodiments of the invention, the genetically modified cells localize to areas of inflammation following introduction of the genetically modified cells into a patient, which allows the cells to exert their effect on areas of tissue damage.

[0065] Embodiments of the invention are directed to methods in which, following introduction into a patient, the genetically modified stem cells specifically reduce expression of the gene having the mutation via the activity of small interfering RNA molecules or microRNA molecules produced in the cells. In preferred embodiments, expression of the gene having the mutation is reduced via the activity of small interfering RNA molecules produced in the cells.

[0066] Those skilled in the art understand that in diploid organisms, a mutation may be present in only one copy of a gene, and the organism can thus be heterozygous for a mutation in a single gene. Alternatively, a mutation may be present in both copies of a gene, resulting in the organism being homozygous for a mutation in a single gene. Embodiments of the invention are directed to treatment of patients that are both heterozygous and homozygous for mutations in a single gene.

[0067] As further understood by those skilled in the art, a mutation in a single gene can result in expression of a polypeptide that does not exhibit the same type of biological activity as is exhibited by a polypeptide expressed by a wild type version of the single gene. In instances where a patient is heterozygous for a mutation in a single gene, expression of the wild type copy of the gene could lead to production of a wild type polypeptide, and expression of the mutant copy of the gene could lead to production of a defective polypeptide. In such instances, both wild type and defective polypeptides would be present in the patient. Embodiments of the methods of the invention are directed to treating such patients.

[0068] As also understood by those skilled in the art, blocking expression of the mutant copy of a gene in a diploid patient can result in expression of wild type polypeptide from the wild type copy of the gene. If the amount of polypeptide expressed from the wild type copy of the gene is less than that produced from a patient having no mutation in the gene of interest, a state known as haploinsufficiency results. The methods of the invention, in particular embodiments, are directed to specifically reducing expression of the mutant copy of a single gene in a patient heterozygous for the mutation, which, in some embodiments of the invention, results in haploinsufficiency of the gene. In other embodiments of the invention, the expression of both copies of a single gene is reduced in a patient suffering from a disorder caused by a mutation in the single gene, whether or not the patient is heterozygous or homozygous for a mutation in the gene.

[0069] Other embodiments of the invention relate to cells isolated from a patient suffering from a disease or disorder resulting from a mutation in a single gene that leads to tissue damage accompanied by inflammation. In particular embodiments of the invention, the cells comprise exogenous DNA that comprises a nucleotide sequence encoding an RNA transcript. In

embodiments of the invention, the RNA transcript is processed in the cells into small interfering RNA molecules that comprise a guide strand complementary to messenger RNA encoded by the single gene comprising the mutation. Alternatively, the RNA transcript is processed in the cells into microRNA molecules that target messenger RNA encoded by the single gene comprising the mutation.

[0070] Further aspects of the invention relate to a small interfering RNA molecule that comprises a guide strand complementary to messenger RNA encoded by a human gene that comprises a mutation resulting in a disease or disorder that leads to tissue damage accompanied by inflammation. In preferred embodiments, the guide strand of the small interfering RNA molecules is complementary to a region of the messenger RNA that comprises the mutation. [0071] The following examples are illustrative of certain embodiments of the invention and should not be considered to limit the scope of the invention.

Example 1: Design of Synthetic siRNAs Targeting a COL3A1 Mutation.

[0072] Nineteen synthetic siRNAs were designed to target a mutation in the COL3A1 gene. The sequence of the wild type COL3A1 gene has GenBank accession number BC028178, and the mutant allele targeted by the siRNAs has a GIy -> VaI substitution at position 85 that results from a G-^ T mutation at position 755 when numbering begins at the ATG start codon (A = +1), which corresponds to position 857 when numbering begins with the first nucleotide of the COL3A1 mRNA.

[0073] The third nucleotide from the 3' end of the sense strand of the siRNAs was mismatched with the complementary position of the guide strand, creating an unpaired 5' end of the guide strand to facilitate its entry into RISC, as recommended by Schwarz, D. S., et al., 2006, PLoS Genet., 2(9), el40, incorporated herein by reference in its entirety. In addition, a non-silencing control, siK, was used, and the sequence of the guide strand of siK was: 5'

GCUGGAGAUAGACUGCAUAdTdT 3'(SEQ ID NO:1). The sequences of the 19 test siRNAs are shown in Figure IA (SEQ ID NOS: 13-31). The synthetic siRNAs were designed to vary the position of the nucleotide complementary to the point mutation present in the mRNA transcribed from the mutant COL3A1 gene, such that the position of the nucleotide in the siRNAs

complementary to the point mutation in the target mRNA ranged from the 5' end of the siRNA guide strand to the +19 position of the guide strand, which is two nucleotides from the 3' end of this strand, as shown in Figure IA.

[0074] To create a 20 μM solution of the siRNAs, 50 nmoles of desalted siRNAs were purchased (Invitrogen, Carlsbad, CA) and diluted in 1 mL OfH₂O.

Example 2: Sequencing of COL3A1 mRNA

[0075] For sequencing of mutant and wild-type COL3A1 mRNA obtained from patients' fibroblasts, RNA was extracted using an RNeasy Mini Kit™, obtained from Qiagen; cDNA was synthesized using Superscript III Reverse Transcriptase™, obtained from Invitrogen; and COL3A1 fragments were amplified using the primers COL3Al-for: 5' GGAGGACTCGC AGGCT ATC 3'(SEQ ID NO: 38) and C0L3Al-rev: 5' GCCTGGTTGACCATCACTG 3' (SEQ ID NO: 39). Sequencing was performed with the primer Seq-C0L3Al-rev: 5 ' GAAGGAGCTGACTGGGTTG 3' (SEQ ID NO: 40), and the results are shown in Figure 2.

Example 3: Testing of COL3A1 Targeted siRNAs in Luciferase Reporter Assays

[0076] The siRNAs described in Example 1 were tested in a luciferase reporter assay in HEK293 and were separately tested in HCT 116 cells. Luciferase reporter vectors containing the wild-type COL3A1 gene and the mutant COL3A1 sequence described in Example 1 were prepared, the vectors and siRNAs were transfected into the HEK293 ir GCT 116 cells, and luciferase expression was measured, as described below.

[0077] To test whether the siRNAs were able to silence the mutant COL3A1 mRNA without affecting the wild-type COL3A1 allele, luciferase reporter vectors with inserts of either the wild-type or the mutant COL3A1 cDNA were prepared. The COL3A1 wild type cDNA sequence was ligated into the 3' untranslated region of the luciferase reporter vector. The COL3A1 cDNA sequence was obtained by PCR (forward primer with Xbal site:

AAAAATCTAGACCTGCTGGAAAAGATGGAG (SEQ ID NO:2), reverse primer with Fsel site: AAAAAGGCCGGCCGTCCATCGAAGCCTCTGTG (SEQ ID NO:3); restriction sites underlined) and cloned into the pGEMT® vector (Promega, Madison, WI). The point mutation described in Example 1 was introduced by QuickChange® PCR with 2 U PfuTurbo® polymerase (Stratagene, La Jolla, CA) and the provided buffer, 0.2 mM dNTPs, 125 ng primers (forward, mutation underlined: CCTCCAGGTATCAAAGTTCCAGCTGGGATACCTGG (SEQ ID NO:4), reverse:

CCAGGTATCCCAGCTGGAACTTTGATACCTGGAGG) (SEQ ID NO:5) in a 50 μl reaction. The template plasmid was digested after PCR by addition of 10 U Dpnl (NEB). Plasmids were sequenced and cut by Fsel (NEB) and Xbal (NEB). The inserts were ligated in the luciferase vector pGL4.10[luc2] (Promega).

[0078] Transfections were performed on HEK293 or HCT 116 cells grown in 10% DMEM (Invitrogen) with 1% Penicillin/Streptomycin (Invitrogen) in a 24 well plate. To this end, 40,000 cells were transfected with 25 ng of reporter plasmids, 2 μM siRNA, 25 ng of Renilla control vector (pRL-null, 25 ng), and Dharmafect® Duo transfection reagent (Dharmacon, 1 μl/well). Cells were seeded 24 hours before transfection in antibiotic free medium.

[0079] After 48 hours, cells were lysed with 100 μl Passive Lysis Buffer Ix (Promega), frozen and re -thawed, and luciferase expression was measured with the Dual Luciferase® Reporter Assay System (Promega) and a luminometer. 50 μl of luciferase substrate were added to 40 μl of lysate and the signal was measured for 10 seconds. The renilla activity was measured for 10 seconds after addition of 50 μl of the substrate for renilla.

[0080] Each experiment was performed in triplicate and the data were normalized to renilla activity and luciferase activity of control siRNA. All data are presented as mean ± SEM. A multiple-sample comparison (ANOVA and the multiple range test as post hoc test using the criterion of the least significant differences) was applied to test the differences between the group different modes and time intervals of treatment for significance. A value of p<0.05 was considered to be significant.

[0081] The three best working siRNAs with the highest silencing factor were si6, silO and sil7, as shown in Figure IB (HEK 293 cells) and Figure 3 (HCT 116 cells).

Example 4: Quantitative RT-PCR to Determine the Silencing Effect of siRNAs

[0082] To further analyze the silencing effect of the 19 siRNAs described in Example 1, real time RT PCR experiments were performed. Total RNA was isolated from fibroblasts from a normal donor and from a VEDS patient that had been treated with the 19 siRNAs and RT PCT was performed on the samples to quantitate the amount of wild type and mutated COL3A1 mRNA present in the fibroblasts.

[0083] Total RNA was extracted with the RNeasy kit (Qiagen) and the cDNA was synthesized with a random primer with the MultiScribe™ reverse transcriptase kit (Applied

Biosystems). The SYBR green QuantiTect® mix (Qiagen) was used for real time PCR detection of wild-type COUAl (forward primer: TGGACCTCCAGGTATCAAAGG) (SEQ ID NO:6) or mutated COL3A1 (forward primer; mutation underlined: CTGGACCTCCAGGTATCAAAGT) (SEQ ID NO:7); (the same reverse primer was used for both: GTCATTACCCCGAGCACCT) (SEQ ID NO: 8). The reaction was run in three biological and four technical replicates in an ABI PRISM® 7900HT Sequence Detection System with an annealing temperature of 60 ⁰C. The result was analyzed by the 2^ΔΔCT method normalized to GAPDH (forward primer:

TGCACCACCAACTGCTTAG (SEQ ID NO:9); reverse primer: GGATGCAGGGATGATGTTC (SEQ ID NO: 10)).

[0084] For the evaluation of the effect of the reduced amount of the mutated COL3A1 in the fibroblasts the expression of DDIT3 (forward primer: AGCAGAGGTC ACAAGC ACCT (SEQ ID NO:11); reverse primer: CTGGGGAATGACCACTCTGT) (SEQ ID NO: 12) was analyzed.

[0085] The results of the experiments are shown in Figure 4. All data are presented as mean ± SEM. A multiple-sample comparison (ANOVA and the multiple range test as post hoc test using the criterion of the least significant differences) was applied to test the differences between the group different modes and time intervals of treatment for significance. A value of p<0.05 was considered to be significant. The amount of wild type COL3A1 mRNA is shown in the white columns in Figure 4 A and the amount of mutated COL3A1 mRNA is shown in the gray columns of Figure 4 A. The average ± SEM of two replicates is shown. The results were analyzed by the 2- ΔΔCT method normalized to GAPDH. The result of a non-silencing control was set 100%. The silencing factor shown in Figure 4B was the result of the proportion of wild type/mutated form of COLSAl mRNA.

Example 5: si6, silO, and sil7 Reduced Expression of COL3A1 as Measured by Quantitative RT-PCR in Primary Fibroblasts from a Heterozygous VEDS Patient

[0086] The three siRNAs exhibiting robust silencing of the COL3A1 mutant allele in the experiments described in Examples 3 and 4 (si6, si 10, and si 17, the guide strand sequences of which are shown in Figure IA) were further tested in primary fibroblasts from a VEDS patient

heterozygous for a COL3A1 mutation encoding a glycine substitution, COL3A1^G85V/+, and in control fibroblasts from normal donor. The mutant and normal donor fibroblasts were not morphologically different. Subsequently, RNA was isolated and used for quantitative real time PCR detection as described in Example 4.

[0087] The COL3A1 mutant cell line (CTL-0195) and the wild-type COL3A1 control cell line from normal donor (2003-07/032) were grown in 10% DMEM with 1% Penicillin/Streptomycin. Cells were seeded at their 4th or 5th passage 24 hours before transfection in antibiotic free medium. Transfections were carried out in T25 flasks. 250,000 cells were transfected with 100 nM siRNA and 15 μl/plate of Dharmafect®l transfection reagent (Dharmacon). Cells were collected for RNA extraction 48 hours after the transfections.

[0088] The si6, si 10, and si 17 siRNAs reduced the concentration of the mutant COL3A1 mRNA by at least 94%, with a maximum reduction (97%) achieved by si 10, as shown in Figure 5B. The si6 and si 17 siRNAs, however, reduced the concentration of wild-type COL3A1 mRNA in the fibroblasts as well, and only si 10 specifically reduced mutant COL3A1 mRNA, as shown in Figure 5 A. As compared to the si6 and si 17 siRNAs, the si 10 siRNA exhibited the lowest silencing factor in the artificial reporter gene assay described in Example 3, as shown in Figures IB and 3. As compared to si6 and si 17, si 10 exhibited the highest reduction of the mutated form of COL3 'Al in the primary fibroblasts, however, and exhibited a silencing factor of 36, as shown in Figure 5C. Moreover, si 10 did not affect the wild-type form of COL3A1, demonstrating its ability to

discriminate the wild type and mutant forms of COL3A1.

Example 6: Western Blot Analysis of COL3A1 Levels

[0089] Western blot experiments were also performed to determine the amount of

COL3A1 protein present in human fibroblasts treated with silO siRNA. Extracts (15 μg) from fibroblasts from a normal donor (ND) and from a VEDS patient (COL3A1G85Y/+) were treated with 100 nM siK (control) or with si 10 siRNA for 14 days. Western blots were then performed using the extracts as well as extracts obtained from untreated fibroblasts. 15μg of extracellular matrix extracts were separated on a 5% SDS gel under reducing conditions and transferred to a PVDF membrane according to standard procedures. Western blotting using a 1 : 1000 dilution of a polyclonal anti-COL3Al antibody (AP06517PU-N; Acris Antibodies GmbH, Herford, Germany) and a monoclonal anti-beta-actin antibody (AC- 15, Sigma- Aldrich, Taufkirchen, Germany) was performed and analyzed with the Super Signal West Dura Kit (Pierce, Rockford, USA).

[0090] The results of the experiments are shown in Figure 6, and demonstrate that si 10 siRNA treatment resulted in reduction of the level of COL3A1 protein present in the extracts from the VEDS patients, but did not affect the level of COL3A1 protein present in extracts from the normal donor.

Example 7: silO siRNA Reduced the Elevated Levels of DDIT3 Observed in the Mutant Fibroblasts From VEDS Patients.

[0091] The endoplasmatic reticulum (ER) is responsible for protein folding within each cell and is highly sensitive to alterations in its homeostasis. Disruption of this homeostasis leads to accumulation of unfolded proteins. The imbalance between unfolded proteins and the capacity of the ER to handle this load is referred to as ER stress, described, for example, in Schroder M, et al., Annu Rev Biochem., 2005, 74, 739-789, and Xu C, et al., J Clin Invest,. 2005,115, 2656-2664, incorporated herein by reference in their entireties.

[0092] To cope with it, the ER has evolved a signaling network, termed the unfolded protein response (UPR). The intent of the UPR is to adapt to the changing environment and to reestablish normal ER function. This involves the reduction in protein synthesis and translocation into the ER, followed by the transcriptional activation of UPR target genes, including ER

chaperones. If these adaptive responses cannot compensate for the ER stress, then apoptosis is triggered. This presumably protects the organism from cells that display misfolded proteins. An UPR-induced cell death mediator such as DDIT3 also known as CHOP is involved in this third step is described, for example, in Marciniak SJ, et al., Genes Dev., 2004, 18, 3066-3077, and Szegezdi E, et al., EMBO Rep., 2006, 7, 880-885, incorporated herein by reference in their entireties.

[0093] Expression of the mutated form of COL3A1 may cause retention in the plasmatic reticulum of misfolded proteins, as was observed for fibrillin- 1 mutations by Whiteman P, et al., Hum MoI Genet., 2007,16, 907-918, incorporated herein by reference in its entirety. Expression of the mutated form OΪCOL3A1 may also induce an unfolded protein response, as retention of proteins has been shown to result in such endoplasmatic reticulum stress, as demonstrated by Sorensen S, et al., J Biol Chem., 2006, 281, 468-476, incorporated herein by reference in its entirety.

[0094] Since the DDIT3 (DNA damage inducible transcript 3) gene is expressed ubiquitously at low levels and its expression is elevated by cellular stress and during the

endoplasmatic reticulum unfolded protein response, its expression in fibroblasts having the COL3A1^G85V/+ mutation was examined. Such cells were cultured and transfected as described in Example 3, and RNA was isolated from the cells and used for quantitative real time PCR detection as described in Example 4. The expression of DDIT 3 was indeed elevated in fibroblasts expressing mutated C0L3A1 protein, as shown in Figure 7.

[0095] Expression of mutant COL3A1 was directly associated with elevated expression of DDIT3, but reducing or eliminating expression of the mutant COL3A1 gene by treatment with silO siRNA significantly reduced DDIT3 expression, as shown in Figure 7. After treatment of fibroblasts having the COL3A1 mutation with si 10 siRNA, DDIT3 expression was similar to the level observed in the wild-type fibroblasts. The si 10 siRNA thus reduced the detrimental effects of the mutant COL3A1 protein by reducing the unfolded protein response of the endoplasmic reticulum.

Example 8: VEDS Skin Fibroblasts Form Collagen Fibers After siRNA Treatment

[0096] Patients with VEDS are not able to form a proper extracellular matrix. Electron microscopy experiments were performed as described below to investigate whether cells from a VEDS patient were able to form proper collagen structures in culture and whether the morphology of these fibrils changes after treatment with siRNA 10. Primary skin fibroblasts from a VEDS patient and a normal control were transfected with si 10 and a non-silencing control, respectively, as described below. Cells were grown confluent and were incubated for 10 days in the presence of ImM ascorbate to stimulate the formation of the extracellular matrix. Afterwards, cells were collected and the formed extracellular matrix was extracted as also described below for electron microscopic analysis and for analysis of the presence of COL3A1 mRNA.

[0097] Mutant cell line (CTL-0195) and the wild-type control cell line (2003-07/032) were grown in 10% DMEM with 1% Penicillin/Streptomycin. Cells were seeded at their 4^th or 5 ^th passage 24 hours before transfection in antibiotic free medium. Transfections were carried out in 10 cm plates. 1,000,000 cells were transfected with 100 nM siRNA and Dharmafectl (15 μl/plate). Medium was changed after 2 days to DMEM containing ImM ascorbate. Cells were incubated 10 days before they were collected.

[0098] The extracellular matrix of the cultured primary skin fibroblasts was then extracted according to the following procedures. Cells growing in 10 cm plates were washed twice with PBS, collected using a cell scratcher, and re-suspended in 1 ml extraction buffer (15OmM NaCl, 2mM NaH2PO4, 2OmM EDTA, complete Protease Inhibitor Cocktail Tablets (Roche, Basel, Switzerland), pH 7.4). 200 μl of the cell suspension were removed for RNA extraction. The extracellular matrix of the remaining cells was extracted using an Ultra Turrax (IKA, Staufen, Germany) for 3 x 10s. The obtained lysate was centrifuged for 10 min at 4°C at maximum speed and the supernatant containing suprastructural fragments was used for electron microscopy analysis according to the following procedures.

[0099] Aliquots of supramolecular fragments were spotted onto sheets of Parafϊlm and nickel grids covered with Formvar/carbon were floated on the drops for 10 min to allow adsorption of matrix. Afterwards, grids were subsequently washed with PBS, and treated for 30 min with 2% (w/v) dried skim milk in PBS. Next, the adsorbed material was allowed to react for 2 h with antibodies against collagen type I (BP 8028, Acris) and collagen type III (MAB 3392, Chemicon) diluted 1 : 100 in PBS containing 0.2% dry milk. After washing several times with PBS, the grids were put on drops of 0.2% (w/v) milk solution containing colloidal gold particles coated with antibodies to rabbit and mouse immunoglobulins (12nm and 18nm gold particles, respectively) (Jackson Immuno Research) diluted 1 :30. Finally, the grids were washed with distilled water and negatively stained with 2% uranyl acetate for 7 min. Control experiments were undertaken with the first antibody omitted. Electron micrographs were taken at 80 kV with a Philips EM 410 electron microscope.

[0100] Typically thin and weakly banded collagen fibrils were formed by normal fibroblasts. A labeling with antibodies against collagen type I and type III revealed the presence of these collagens in the formed fibrils, as shown in Figure 8A and Figure 8B. In contrast, amorphous material and disorganized bundles of collagen fibrils were formed by fibroblasts from a VEDS patient. The contours of the formed collagen fibrils were irregular in shape and were often embedded in amorphous material, which is absent in the normal fibroblast cell cultures, as shown in Figures 8C, 8D, and 8E. Immunogold electron microscopy demonstrated the presence of collagen type I and type III in the amorphous network-like structures, as shown in Figures 8C. After treatment of the VEDS cells with siRNA 10, the morphology of the extracellular matrix changed and was similar to the morphology of the extracellular matrix observed in healthy control fibroblasts: the formed collagen fibrils became regular in shape and formed typical networks of collagen fibrils without amorphous material bound to the surface of the collagen fibrils, which is shown in Figure 8E and Figure 9B. In addition, collagen type I and type III were detected by immunogold electron microscopy in the formed fibrils, shown in Figure 8G and Figure 9B. It is therefore possible to reconstitute the extracellular matrix produced by primary skin fibroblasts derived from a VEDS patient after selective knockdown of mutated COL3A1 mRNA.

Example 9: Heterozygous Col3Al (HT CoBAl) Deficient Mice Serve As a Model for Human COL3A1 Haploinsufficiency

[0101] Homozygous CoBaI mice, the only currently available model of vascular type of Ehlers-Danlos syndrome (VEDS), cannot be used for experiments due to extremely high mortality.

[0102] However, COL3A1 haploinsufficiency is connected with a milder form of VEDS in humans. Therefore, heterozygous (HT) CoBaI mice, which express only one copy of the CoBaI gene and were originally described as phenotypically normal, were analyzed. The results, described below, demonstrate that these mice can serve as an experimental model of haploinsufficiency.

[0103] First, there was no difference in survival between wild-type and HT mice. In addition, in a longitudinal study with wild-type and HT mice the vessels were analyzed by sonography, their hearts were evaluated by echocardiography. The blood pressure was measured by tail cuff measurement. The pulse wave velocity was used as a parameter of the stiffness of the vessel, and analyzed via Doppler and ECG measurements. There were no differences between wild- type and HT mice in these measurements.

[0104] Furthermore, 9, 14, and 21 month-old animals were also analyzed in a in a cross sectional experiment. The hemodynamic measurement of these animals confirmed the results from the longitudinal study showing no difference between wild-type (n = 34) and HT (n = 40) animals.

[0105] However, the ex vivo measurements of abdominal aorta of 21 month-old HT mice revealed a significantly lower maximal pressure (pre-rupture pressure) as compared to wild-type mice. Histological evaluation of aortas of heterozygous mice demonstrated abnormalities among 100% of male and 50% of female mice, revealing elastin fragmentation, spindle cell proliferation, inflammation, and reactive fibrosis. [0106] Additional ex vivo analysis of the aorta with a wire-myograph from 10 months old mice confirmed that the compliance of the aorta from younger males are not changed. However, higher compliance was detected in small arteries from CoBAl ^+/~ mice compared to wild type (data not shown). Specifically, a higher compliance of the arteria gracilis of HT mice, measured as larger diameter changes in response to incremental increases of pressure, was observed in the pressure range between 20 and 60 mmHg, but not at higher pressures.

[0107] The pathological phenotype was further confirmed via assessment of hollow organs. The biomechanical property of the colon was assessed by ex vivo measurements of the pressure induced by injections of increment volumes into an isolated segment (compliance). The colon from HT animals was more distensible with a lower pressure generated by a unit of volume (higher compliance) and had a lower maximal (pre-rupture) pressure (higher fragility) in 9-21 month-old animals (data not shown). This was associated with a lower collagen III content detected by quantitative RT-PCR and associated with a lower collagen III protein level, as determined by peptide separation by HPLC and detection with LC-MS (data not shown).

Example 10: Design and Testing of shRNA and pre-miRNAs For Expressing siRNAs and miRNAs to Selectively Reduce Expression of a Mutated FBNl Gene in Cells From Marfan Mice

[0108] Twenty-one miRNAs and 21 siRNAs, containing a mutant nucleotide at each position of the molecules, are designed and tested for their ability to specifically reduce expression of a mutant form of Fbnl . A short hairpin RNA (shRNA) is designed based on the sequence of the siRNAs exhibiting silencing activity specific for mutant Fbnl, and subcloned into a pSUPER plasmid. Likewise, a pre-miRNA cassette for expression of miRNAs exhibiting silencing activity specific for mutant Fbnl is cloned in the RNAi expression vector pcDNA™ 6.2-GW/EmGFP-miR (Invitrogen).

[0109] A luciferase reporter vector with short inserts of either the wild-type or mutant Fbnl cDNA is prepared and the siRNAs and miRNAs best able to silence the mutant Fbnl mRNA without affecting the wild-type mRNA are identified. These inserts, despite the fact that they contain mRNA corresponding to the designed Fbnl sequence, do not alter the luciferase protein sequence because it is ligated into the 3' untranslated region of the luciferase.

[0110] The wild-type and mutant Fbnl cDNA are obtained via PCR on cells from

Fbnl^cl039G/+mice and are cloned into the pGEMT plasmid (Promega). Alternatively, the mutation is introduced using a QuickChange® kit (Stratagene), via site-directed mutagenesis using PCR.

Restriction sites for Fsel and Xbal are also inserted using PCR. Plasmids are sequenced, cut by Fsel and Xbal, and the inserts are ligated into the pGL4.10[luc2] luciferase vector (Promega).

[0111] Testing is performed in human embryonic kidney (HEK293) cells, as these cells are known trans feet easily and effectively with Fugene®6 trans fection reagent (Roche). After such transfection, cells are collected after 48 hours, lysed using Passive Lysis Buffer (Promega), frozen, re-thawed and measured with the Dual Luciferase Kit (Promega) and a luminometer.

[0112] A mouse is obtained that is heterozygous for the Fbnl allele encoding a cysteine substitution, CyslO39 -> GIy (C1039G), in an epidermal growth factor-like domain of fibrillin- 1 (FδniC1039G/+), which constitutes the most common class of mutations causing MFS. The aortic root in FδniC1039G/+ mice undergoes progressive dilatation, evident as early as 2 weeks of age, and this size difference becomes more pronounced with age.

[0113] The three most efficient and selective miRNAs and siRNAs are further tested in primary skin fibroblasts from wild-type and Fbnl^cl039G/+mice. Primary skin fibroblasts are transfected using the Human Dermal Fibroblast (NHDF) Nucleofector® Kit (Amaxa). RNA is extracted using an RNeasy® purification kit (Qiagen) and the amount of mutant and wild-type mRNA will be quantified. As there is only a difference in one nucleotide for the quantification of the silencing efficiency, quantitative RT-PCR assays utilizing selective PCR primers are used. The Fbnl mutation being targeted is substitution of the thymine at nucleotide 3115 by guanine.

[0114] In addition, the Fbnl protein is detected in cell lysates and conditioned media by Western blot analysis, so that wild-type and mutated Fbnl is distinguished in cells from Fbnl^cl039G/+ mice. Fbnl mutations that affect calcium binding to cb-EGF cause endoplasmatic reticulum retention of misfolded proteins, as described in Whiteman P, et al., Hum MoI Genet., 2007,16, 907- 918, hereby incorporated by reference in its entirety. Thus, the fragments of cbEGFl 1-22 within the Fbnl protein that contained such mutations were not detectable in the conditioned medium derived from a human fibroblast cell line, as measured by Western blot analysis with an antibody against the proline-rich region of Fbnl. Instead, the fragments were detectable in the cell lysate, as described in Whiteman P, et al., Hum MoI Genet., 2007,16, 907-918, incorporated by reference herein in its entirety. Therefore, detection of Fbnl in cell lysates is performed.

[0115] Another assay for detecting an Fbnl alteration is based on the induction of an unfolded protein response by misfolded Fbnl . The unfolded protein response is connected with an induction of chaperones Grp78, Grp94 and ERp72, as described in Sorensen S, et al., J Biol Chem., 2006, 281, 468-476, hereby incorporated by reference in its entirety. Therefore expression of one or more of these chaperones is measured by quantitative RT-PCR.

Example 11: Construction of shRNA and miRNA Lentiviral Vectors Designed to Target a Mutated FBNl Gene and Testing Using Cells from Marfan Mice

[0116] The miRNA and siRNA constructs with the highest silencing potential for mutated Fbnl and negligible effect on wild-type Fbnl are transferred to a lentiviral expression system for in vivo testing. A type of lentiviral expression system (Invitrogen) and an experimental outline for use of the system are shown in Figure 1OA, Figure 1OB, Figure 1 IA, and Figure 1 IB. Briefly, the pcDNA™6.2-GW/EmGFP-miR expression vector contains "att" sites to facilitate the transfer of the pre-miRNA expression cassette into appropriate Gateway® destination vectors thus allowing the expression of miRNA in viral systems. The pre-miRNA cassette is transferred to a pLenti6/V5- DEST using the Gateway® strategy of Invitrogen. This expression system contains an niRNA- stabilizing sequence, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), a nuclear import sequence, the central polypurine tract (cPPT), as well as the gene for the Emerald green fluorescent protein (GFP). The former generates up to a 5-fold higher virus titer, while the latter allows for traceability of the transfected cells.

[0117] The experimental steps necessary to generate a replication incompetent lentivirus that is able to derive the selected miRNA sequence are known in the art; for example, protocols are available from Invitrogen.

[0118] The replication-incompetent lentivirus is produced in 293FT cells, a transformed HEK293 cell line. The lentiviral construct is tested in primary skin fibroblasts originating from Fbnl^cl039G/+mice and then introduced in adult stem cells from mice, such as mesenchymal stem cells (MSCs), endothelial progenitor cells, or other adult stem cells known in the art. These cells are optionally immortalized to allow for unlimited production, such as using expression of the telomerase reverse transcriptase protein (TERT). For example, an expression plasmid containing human TERT cDNA is available from ATCC and is used to immortalize adult stem cells using methods known in the art. The results of introducing the pre-miRNA into the lenti viral construct in order to specifically silence the mutated Fbnl in mouse MSCs are detected by GFP. Cell clones are analyzed for obvious change in morphology, growth characteristics, and expression pattern measured by FACS and immunohistochemical staining as a sign of incorporation of the pre-miRNA construct in a growth sensitive region of the host DNA.

[0119] The stem cells with the introduced lentiviral construct are administered (for example, intravenously) to the Fbnl^cl039G/+mice, wherein the stem cells are attracted to the site of injury following tissue damage. The homed, modified stem cells then promote healing, reduction of the aneurysm, and strengthen the vessel wall.

[0120] To detect healing, reduction of the aneurysm, and/or strengthening of the vessel wall, sonography and/or a small animal CT are used. Aneurysms are detected in Fbnl^cl039G/+ mice by sonography. In addition, the aortic dimension is optionally measured using a small animal CT. Measurements are taken shortly after administration, and thereafter to measure the reduction of the aortic root dilation over time.

Example 12: Improvement of Vascular Stem Cell Repair in Marfan Mice by Knocking Down Expression of Several Gene Products

[0121] As miRNAs are expressed in clusters in long primary transcripts driven by RNA polymerase II, several gene products can be specifically knocked down simultaneously. Therefore, the knock down of several genes via co-cistronic expression of multiple miRNAs in an appropriate vector, such as the pcDNA™6.2-GW/EmGFP-FbnlmiR vector from Invitrogen, or other appropriate commercially available vectors, is performed. TGF-βl is a second target for a specific knock down by miRNA in the improved stem cells, since it presents the target for the alternative treatment of the MFS by losartan, as described in Matt, P., et ah, 2008, J Thorac Cardiovasc Surg., 135(2), 389-94, herein incoporated by reference in its entirety. Additional vascular healing improving genes are identified via methods known in the art, such as by a microarray analysis of mRNA derived from human stem cells and the Fbnl^cl039G/+ mouse.

[0122] Specialized search algorithms known in the art are used to identify the most potent silencing miRNA for these additional targets. Several of these identified miRNAs are tested further; pre-miRNA constructs are transfected into primary fibroblasts and expression of the corresponding gene is measured to test the miRNAs for their ability to knock down such expression. Based on the results, the appropriate miRNA is subcloned into the pcDNA™6.2-GW/EmGFP-FbnlmiR expression vector. The co-cistronic construct is transferred to pLenti6/V5-DEST to produce the corresponding lenti virus. Then, this construct is introduced into MSCs, and/or optionally other progenitor cell types. As described above in Example 9, the genetically modified stem cells are administered to the mice and the subsequent healing caused by the administration of these stem cells is measured.

[0123] The entire disclosure of each patent, patent application, and publication cited or described in this document is hereby incorporated herein by reference.

Claims

We Claim:

1. A method for treating a disease or disorder resulting from a mutation in a single gene that leads to tissue damage accompanied by inflammation, comprising

isolating cells from a patient suffering from the disease or disorder;

genetically modifying the cells by introducing into the cells exogenous DNA comprising a nucleotide sequence encoding an RNA transcript processed in the cells into small interfering RNA molecules that comprise a guide strand complementary to messenger RNA encoded by the gene having the mutation;

introducing the genetically modified cells into the patient; and

specifically reducing expression of the gene having the mutation with the small interfering RNA molecules.

2. The method of claim 1 wherein a lentivirus vector or an adeno-associated virus vector is used to introduce the exogenous DNA into the cells.

3. The method of claim 1 wherein the guide strand of the small interfering RNA molecules is complementary to a region of the messenger RNA that comprises the mutation.

4. The method of claim 1 wherein the RNA transcript encoded by the exogenous DNA is a short hairpin RNA molecule.

5. The method of claim 1 wherein the mutation in the single gene results in expression of a polypeptide that does not exhibit the same type of biological activity as is exhibited by a polypeptide expressed by a wild type version of the single gene.

6. The method of claim 5 wherein specifically reducing the expression of the single gene having the mutation results in haploinsufficiency of the gene.

7. The method of claim 1 wherein the cells are mesenchymal stem cells or endothelial progenitor cells.

8. The method of claim 1 wherein the genetically modified cells localize to areas of inflammation following introduction of the genetically modified cells into the patient.

9. The method of claim 1 wherein the gene having the mutation is collagen type-Ill alpha 1 , collagen type-I alpha 1, collagen type-I alpha 2, fibrillin 1, elastin, or transforming growth factor-β receptor type II.

10. The method of claim 1 wherein the disease or disorder is vascular-type of the Ehlers-Danlos syndrome, osteogenesis imperfecta, Marfan syndrome, supravalvular aortic stenosis, or Loeys-Dietz syndrome.

11. The method of claim 1 wherein the genetically modified cells are administered to the patient intravenously.

12. Cells isolated from a patient suffering from a disease or disorder resulting from a mutation in a single gene that leads to tissue damage accompanied by inflammation comprising exogenous DNA comprising a nucleotide sequence encoding an RNA transcript processed in the cells into small interfering RNA molecules that comprise a guide strand complementary to messenger RNA encoded by the single gene comprising the mutation.

13. The cells of claim 12 wherein the exogenous DNA is introduced into the cells with a lentivirus vector or an adeno-associated virus vector.

14. The cells of claim 12 wherein the guide strand of the small interfering RNA molecules is complementary to a region of the messenger RNA that comprises the mutation.

15. The cells of claim 12 wherein the RNA transcript encoded by the exogenous DNA is a short hairpin RNA molecule.

16. The cells of claim 12 wherein the mutation in the single gene results in expression of a polypeptide that does not exhibit the same type of biological activity as is exhibited by a polypeptide expressed by a wild type version of the single gene.

17. The cells of claim 12 wherein the small interfering RNA molecules specifically reduce the expression of the gene comprising the mutation after introduction of the cells into the patient.

18. The cells of claim 17 wherein specifically reducing the expression of the gene with the small interfering RNA molecules results in haploinsufficiency for the gene.

19. The cells of claim 12 wherein the stem cells are mesenchymal stem cells or endothelial progenitor cells.

20. The cells of claim 12 wherein the cells localize to areas of inflammation following introduction of the cells into the patient.

21. The stem cells of claim 12 wherein the gene having the mutation is collagen type-Ill alpha 1, collagen type-I alpha 1, collagen type-I alpha 2, fibrillin 1, elastin, or transforming growth factor-β receptor type II.

22. The stem cells of claim 12 wherein the disease or disorder is vascular-type of the Ehlers- Danlos syndrome, osteogenesis imperfecta, Marfan syndrome, supravalvular aortic stenosis, or Loeys-Dietz syndrome.

23. A small interfering RNA molecule comprising a guide strand complementary to messenger RNA encoded by a human gene comprising a mutation resulting in a disease or disorder that leads to tissue damage accompanied by inflammation.

24. The small interfering RNA molecule of claim 23 wherein the guide strand of the small interfering RNA molecules is complementary to a region of the messenger RNA that comprises the mutation.

25. The small interfering RNA molecule of claim 23 wherein the mutation in the human gene results in expression of a polypeptide that does not exhibit the same type of biological activity as is exhibited by a polypeptide expressed by a wild type version of the single gene.

26. The small interfering RNA molecule of claim 23 wherein the human gene comprising the mutation is collagen type-Ill alpha 1, collagen type-I alpha 1, collagen type-I alpha 2, fibrillin 1, elastin, or transforming growth factor-β receptor type II.

27. The small interfering RNA molecule of claim 23 wherein the disease or disorder is vascular- type of the Ehlers-Danlos syndrome, osteogenesis imperfecta, Marfan syndrome, supravalvular aortic stenosis, or Loeys-Dietz syndrome.