WO2011013040A1

WO2011013040A1 - Aptamers which inhibit the activity of the human rad51 protein, and biological uses thereof

Info

Publication number: WO2011013040A1
Application number: PCT/IB2010/053343
Authority: WO
Inventors: Pierre Weigel; Susan Martinez; Fabrice Fleury; Damien Eveillard; Axelle Renodon-Corniere; Masayuki Takahashi
Original assignee: Centre National De La Recherche Scientifique (Cnrs); Universite De Nantes
Priority date: 2009-07-31
Filing date: 2010-07-22
Publication date: 2011-02-03
Also published as: FR2948663B1; FR2948663A1

Abstract

The invention relates to aptamers that can be obtained by the SELEX technique, wherein the selected aptamers have an inhibitory effect on Rad51 recombinase activity of at least 70%, more particularly at least 80%. Uses as Rad51 inhibitors, in particular in therapy.

Description

Aptamers inhibiting the activity of human Rad51 protein and their biological applications

The subject of the invention is aptamers that inhibit human Rad51 protein activity and their biological applications.

The human Rad51 protein (HsRad51, designated Rad51) plays a central role in the repair of double-strand breaks in DNA, via homologous recombination. Rad51 initiates the recombination reaction by the formation of a nucleoprotein filament, through the cooperative association of the monomers of Rad51 on single-stranded DNA. The formed complex binds a second double-stranded DNA to exchange the homologous strands, which step is accompanied by the hydrolysis of ATP. This activity is necessary for survival and cell proliferation. However, its activity has a negative effect on anticancer treatments. It is indeed related to the resistance of cancer cells to chemo- and radiotherapy.

The value of having products capable of decreasing the resistance of tumor cells to anticancer treatments is measured.

The work of the inventors in this field led them to retain Rad51 as a target for the development of new therapeutic agents. Rad51 in humans is a protein of 339 amino acids with a molecular weight of 36966 Da. Its primary sequence is given in the Sequence Listing document and identified under SEQ ID No. 1. It is a complex protein with multiple domains, including an ATPase domain with L1 and L2 DNA binding loops. It is on the one hand able to form a homopolymer and on the other hand able to interact with the DNA.

In their search for ligands of high affinity and specificity with respect to

Rad51, the inventors have used the SELEX method (Systematic Evolution of Ligands by EXponential enrichment) developed by Tuerk and GoId, (1) and Ellington and Szostak (2). This method makes it possible to isolate RNA or single-stranded DNA oligonucleotide sequences from a random library of oligonucleotides. These sequences have been referred to as aptamers by Ellington and Szostak to describe their property to specifically interact with other biological molecules. This term will be used hereinafter indifferently with that of inhibitor to designate the oligonucleotides according to the invention. By operating under selected conditions of selection, the inventors have thus isolated aptamers which have been found to correspond to inhibitors of high potential on the activity of the protein.

The object of the invention is therefore to provide, as new products, oligonucleotides or aptamers capable in particular of modulating the activity of Rad51 and even of inhibiting it, which makes it possible, in particular, to increase the sensitivity of the cancer cells to the treatments. cancer.

It also relates to means for selecting these aptamers according to the SELEX method.

According to yet another aspect, the invention is directed to diagnostic and therapeutic applications of these aptamers.

The invention relates to aptamers obtainable by the SELEX technique, in which a synthetic single-stranded DNA (ssDNA) library containing a random central region surrounded by constant regions at the 5 'and 3' ends, used as sites for the amplifications, is incubated with a target molecule, the DNAs having interacted with the target being alone retained and amplified for a new round of selection, to enrich the library in sequences interacting specifically with the target protein, the selected DNAs being cloned and if necessary sequences.

According to the invention, such aptamers are as obtained by a process characterized in that

the target molecule is the Rad51 protein, this protein being incubated with an ssDNA library, in the presence of a selection buffer containing MgCl 2 and ATP,

the formed DNA-Rad51 complex is separated by electrophoresis and the delayed DNA extracted from the gel,

at each round of selection, the selected DNA is re-amplified using the primers P1 and P2, then only with the primer P1, and the relative affinity with respect to Rad51 is evaluated,

- the astringency being increased during the selection,

the ssDNAs from the last round of selection are isolated and cloned into plasmids, the plasmids then being extracted, purified and sequenced,

the selected sequences are grouped on the basis of their similarities and the presence of consensus patterns, the aptamers thus selected having an inhibitory effect on the Rad51 recombinase activity of at least 70%, more especially at least 80%.

In the above selection method, the ssDNAs incubated with the target are labeled, for example with an IRD fluorophore. In another variant, the ssDNAs are not labeled. The incubation is carried out for 30 minutes at room temperature.

Suitable plasmids for the cloning step include plasmid pCR®-Blunt IITOPO®. As illustrated by the examples, this plasmid has in particular been used to transform E. coli TOPO10 cells, which have been cultured.

The aptamers of the invention are more particularly characterized in that they have an apparent Kd of the order of 40 to 90 nM and comprise about 60% G-C bases.

Preferred aptamers correspond to the sequences SEQ ID No. 2-10.

Advantageously, the SELEX procedure is initiated with Rad51 at 2 μM in the presence of the 4 μM ssDNA library in a selection buffer of pH 7.9 containing 2 mM of MgCl 2 and 1 mM of ATP. Throughout the selection, the concentration of the library is maintained at 3-4 μM.

Preferably, the astringency is increased during the selection, for example from 2 to 75.

Under these conditions, 7 rounds of selection make it possible to obtain about 80 aptamers of interest whose in silico analysis leads to the establishment of clusters with similarities of sequences.

As demonstrated by the results given in the examples, the aptamers of the invention bind to Rad51 with a high affinity of the order of 1 nM and very efficiently inhibit the exchange reaction of strands of Rad51 DNA. , thus acting on the activity of the protein and not on its expression.

The use of these aptamers thus advantageously makes it possible to modulate the activity of Rad51.

These aptamers are small molecules and can therefore easily enter the tissues. They can be obtained and modified easily, synthetically and generally are not or weakly immunogenic.

The invention thus aims at the use of the aptamers defined above as therapeutic agents. It relates in particular to pharmaceutical compositions, characterized in that they contain a therapeutically effective amount of at least one aptamer as defined above, in combination with a pharmaceutically inert vehicle.

These compositions are advantageously used in the context of anticancer treatments.

These pharmaceutical compositions are characterized in that they are in a form intended for oral, injectable or parenteral administration.

The doses of administration will be easily chosen by the practitioner depending on the age and condition of the patient.

Other characteristics and advantages of the invention are given in the following examples in which reference is made to FIGS. 1 to 8.

These figures present respectively:

FIG. 1: the effect of the aptamers of the invention on the recombinase activity of

Rad51

FIG. 2: secondary aptamer structures of the invention

Figure 3: aptamer affinity of the invention for Rad51

FIG. 4: the specificity of selected aptamers according to the invention

FIGS. 5 and 6: the secondary structures obtained by MFoId for aptamers of the invention and fragments thereof

FIG. 7: the structural study by CD and UV of aptamers of the invention,

- Figure 8: the main component analysis of the data obtained by SELEX.

Materials and methods

1 - Molecular size markers

DNA markers

-SmartLadder (Eurogentec): The standard volume used is 5 μL. The solution contains 14 fragments of 200 to 10,000 base pairs (bp) (200, 400, 600, 800, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 8000 and 10000 bp).

-Low Molecular Weight DNA Ladder (BioLabs): The volume used is 1 μL. The solution contains 11 fragments of 25 to 766 base pairs (bp) (25, 50, 75, 100, 150, 200, 250, 300, 350, 500, 766 bp).

Protein markers Precision Plus ProteinTM Standards marker prestained Broad Range

(Bio-Rad) contains 8 molecular weight proteins between 6.5 and 210 kDa.

Aprotinin 6.5; Lysozyme 14.4; Trypsin inhibitor 21.5; Carbonic Anhydrase 31;

Ovalbumin 45; Albumin serum (BSA) 66.2; Galactosidase 116.3 and Myosin 200 kDa. The volume used is 4 μl_.

2 - Peptides and oligonucleotides

The peptide corresponding to the L1 loop of N-terminal biotinylated Rad51

(biot-U), biot-RTDYSGRGELSAR, has been synthesized.

Oligonucleotides were synthesized. They present the sequences SEQ ID

No. 11-16 below:

SEQ ID NO: 11: (P1): δ'-TAGGGAATTCGTCGACGGATCC-S '

SEQ ID NO: 12: (P2): 5'-CGG CGC ATG CGT CGA CCT GGA G-3 '

SEQ ID NO: 13 (Rec58): 5'-TCC TTT TGA TAA GAG GTC ATT TTT GCG GAT GGC TTA GAG CTT AAT TGC TGA ATC TGG T- 3 '

SEQ ID NO: 14 (Rec32 (: 5'-CCA TCC GCA AAA ATG ACC TCT TAT CAA AAG GA-

3 '

SEQ ID No. 15 (IRD-Rec32): 5'-TCC TTT TGA TAA GAG GTC ATT TTT GCG GAT

GG-3 '(labeled with 5' IRDye fluorophore)

SEQ ID NO: 16 (ssDNA library): 5'-TAGGGAATTCGTCGACGGATCC- (N) ₅₀ -

CTCCAGGTCGACGCA TGCGCCG- 3 '(3)

3 - Production and purification of Rad51

Production

Cell transformation by thermal shock

The competent bacteria E.coli JM109 (DE3) are thawed at 4 ° C. 100 μl of the solution are added to 1 -50 ng of the vector pET15b-HsRad51 and incubated in ice for 30 min. The heat shock is performed at 42 ° C for 45 seconds, followed by a 10-minute incubation in ice. Then, 900 μl of prewarmed LB medium are added and the medium is incubated for 60 min at 37 ° C. with stirring. The solution is then centrifuged at 13000 rpm for 5 min. The pellet is taken up in 50 μl of LB medium and spread on a box of LB agar which contains ampicillin (100 μg / ml) and chloramphenicol (30 μg / ml), and incubated for 16 hours at 37 ° C. Bacterial culture

The culture is carried out in 1 L of LB medium containing 1 mL of ampicillin 100 mg / mL and 30 mg / mL of chloramphenicol with all of the bacterial carpet from the LB agar plate.

The culture is carried out with stirring at 30 ⁰ C until an OD at 600 nm of 0.6.

Induction with 1 mM NPTG is carried out for 18 h. The culture is centrifuged at 4 ° C. for 30 min at 4100 rpm and the cell pellet is stored at -20 ^° C.

Purification of Rad51

Purification on Ni-NTA column

The Rad51 protein contains in its C-terminal part a polyhistidine label (6-His), which allows it to be purified by affinity chromatography on an immobilized nickel column.

This system is based on the high selectivity and affinity that has the histidine label for the Ni2 + -NTA (nitriloacetic acid) matrix (Qiagen).

The bacterial pellet from 2 L of culture is suspended in buffer A

(50 mM TrisHCI pH 8.0, 500 mM NaCl, 5 mM imidazole, 10% glycerol and 5 mM β-mercaptoethanol).

This suspension is sonicated at 4 ° C (3 x 45-70%). The solution obtained is centrifuged at 15,000 rpm and 4 ° C for 25 min. The supernatant obtained is mixed with 1 ml of Ni-NTA resin, which has been washed beforehand with buffer A, and then incubated for 60 min with stirring at 4 ° C. The protein is then eluted with an imidazole gradient (60 mM to 250 mM). The different fractions containing Rad51 are pooled and the protein concentrations are estimated by the Bradford method (8), using bovine serum albumin (BSA) as standard.

In order to eliminate the histidine tag, the fractions containing the protein are treated with thrombin protease (Amersham Biosciences), 1.5 U / 1 mg of

Rad51. Dialysis is also performed against 1 L buffer (20 mM Tris HCl pH 8.0, 200 mM KCl, 0.25 EDTA, 2 mM mercaptoethanol) for 16-20 h at 4 ° C with shaking.

Purification on anion exchange column

Following dialysis the sample is centrifuged for 10 min at 4100 rpm and the supernatant added to the MonoQ column (Healthcare Biosciences), and the recovered samples are subjected to a final dialysis buffer (20 mM TrisHCI pH 8; 200 mM KCI; 0.25 mM EDTA; 5 mM DTT; 20% glycerol) for 3 h at 4 ° C. The protein concentration of the different fractions is determined by the Bradford method.

Protein assay by the Bradford method

The protein assay was performed by the Bradford method. At 800 μL of the solution containing the protein, 200 μL of Bio-Rad reagent are added. After 15 min of incubation at room temperature, the absorbance is read at 595 nm. The protein concentration is determined by reference to a standard range of bovine serum albumin (2 to 20 μg / ml).

Protein analysis on SDS-PAGE

In order to visualize the different purification steps, a sample is taken at each step, added with loading buffer under denaturing conditions, and denatured for 5 min at 100 ^° C.

The samples are analyzed by electrophoresis under denaturing conditions, in a gel consisting of a concentrating upper part and a lower separating part. The migration is at 120 volts. The gel is then stained with Coomasie blue to demonstrate protein. The presence and purity of the protein are determined by comparison with a marker kit (6.5-200 kDa, Bio-Rad).

4- Immunodetection of transferred proteins (western blot)

The proteins present in the samples are previously resolved by SDS-PAGE and then transferred to a nitrocellulose membrane (Hybond TM ECL ™, Amersham Biosciences) in transfer buffer (25 mM Tris base, 192 mM glycine, 20% ethanol) for 16 hours. at 4 ° C and 90 mA. The membrane is blocked with a solution of TTBS (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% Tween 20) with 5% BSA for 1 hour at RT. To detect the Rad51 protein, the membrane is first incubated with an anti-Rad51 mouse monoclonal antibody (Rad51 Ab-1 (NeoMarkers) clone 51 Rad01) diluted 1: 10,000 in TTBS buffer supplemented with 1% BSA, for 1 h at room temperature.

After the incubation, 3 washes of 5 min are carried out with TTBS. The membrane is then incubated for 45 minutes with a second antibody, anti-mouse labeled with Alexa-Fluor 700 (Molecular Probes) diluted 1/10000 in TTBS. From this stage the membrane is protected from light. Successive washes are performed in TTBS buffer for 45 min in total. Detection of the protein is performed by scanning the membrane using an Odyssey (Infrared Imaging System, LI-COR Biosciences) scanner, which detects the fluorescence of the IRDye 700 fluorophore. The molar mass marker is also detected.

5 - SELEX

In order to amplify the library used for the different rounds of selection, two different types of PCR were used: a so-called conventional PCR with primers P1 and P2, which will produce double-stranded DNAs. As well as an asymmetric PCR with only P1, which makes it possible to obtain single-stranded DNAs.

Classical PCR

The amplification of single-stranded DNA was carried out with primers P1 and P2 1 at 1 μM, in Tris-HCl buffer pH 8.8, 75 mM, 10 mM KCl, 20 mM BSA, 0, 01% Tween 20, 0.05% nonidet P40 in the presence of 200 ng single stranded DNA, 0.4 mM dNTPs, 3 mM MgCl 2, and 2.5 U of the Taq DNA polymerase enzyme ( Invitrogen) for a final volume of 50 μL. A denaturation of 5 min at 94 ° C. is carried out for the initial separation of the strands of the DNA, followed by 30 cycles successively comprising a denaturation step of 1 min at 94 ° C., a primer attachment step of 20 sec. at 56 ° C and an extension step of 30 sec at 72 ° C, followed by a final extension of 5 min.

Asymmetric PCR

To obtain the single-stranded DNAs, an amplification was carried out in the same medium as that described above, but using as matrix an aliquot of double-stranded DNA (5 ng) obtained by the conventional PCR, and which previously purified using the MinElute Kit (Qiagen). For the selection procedure the asymmetric PCR was carried out with the primer P1. For the labeling of the DNAs, the same primer is used but labeled with the IRDyeδOO fluorophore. The PCR program is the same as for conventional PCR, only the number of cycles was decreased to 25 at the end of selection.

Purification from PCR products

The purification of the DNA obtained by PCR (classical or asymmetric) is carried out with the "MinElute® PCR Purification Kit" (Qiagen) and using the protocol recommended in this kit.

Extraction and purification of DNA from the gel In order to recover the DNA from RAD51-DNA complexes in an agarose or polyacrylamide gel, the complex is excised from the gel and then purified with the QIAEX II kit (Qiagen) according to the supplier's instructions.

Quantification of DNA

Quantification of the purified DNAs is by measuring the absorbance at 260 nm with a biophotometer (Eppendorf). An absorbance equal to 1 corresponds to a concentration of single-stranded DNA of 40 μg / cm3 or double-stranded DNA of 50 μg / cm3.

- SELEX against L1 peptide

To select for aptamers against the L1 peptide, an avidin-biotin system was used, which makes it possible to isolate the "biotinylated Ls-peptide-L1" complexes.

Before each round of selection, the ssDNA library is denatured at 90 ^° C. for 5 min, then rapidly cooled in ice, followed by 15 min at room temperature. In order to avoid selecting ssDNAs that could have interacted with avidin, a cross-selection was performed systematically before each round. This consists in incubating the ssDNA library (1 μM) with the avidin resin (80 μl) in the selection buffer A (10 mM Tris-HCl pH 7.9, 30 mM KCl, 100 mM NaCl) for 15 minutes. min at 37 ° C in a total volume of 250 μL. The solution containing the resin is deposited in a column. Unretained DNAs are used to perform a round of selection with the biotinylated L1 peptide. The solution containing the DNA library (1 μM) is incubated with the biot-L1 peptide (10 μM in the first round, and 0.2 μM in the fifth round, Table III.1 Chapter III) for 15 min at 37 ° C. . The incubation is continued in the presence of 600 .mu.l of avidin resin for 15 min, then the solution is deposited in a column. Following the washes, the "biot-L1 / ssDNA" complexes are eluted in 8 fractions of 300 μl with a PBS buffer containing 2 mM biotin. The absorbance of the fractions is measured at 280 nm to identify the most concentrated fractions. The DNA is extracted from the fractions enriched in Rad51 -DNAsb complexes by phenol-chloroform extraction.

The aqueous phase is recovered by centrifugation (5 min at 4000 rpm), treated with ethanol and the precipitated DNA. The ssDNA obtained is amplified as previously described. These can be used for a new selection round. Phenol-chloroform extraction

At a determined volume of solution containing the DNA, the same volume of phenol-chloroform solution is added, and mixed vigorously. The phases aqueous and organic are separated after centrifugation at 6000 rpm for 7 min. The aqueous phase is recovered.

Precipitation with ethanol

The aqueous solution containing the DNA is adjusted to a concentration of cations by adjusting to 0.3 M sodium acetate, and the final volume determined. Two volumes of 100% ethanol at 20 ^° C. are added to the solution and precipitated at -20 ^° C. for at least 2 hours. The solution is then centrifuged for 10 min at 10,000 rpm and 4 ° C.

The pellet is dried and taken up in sterile water.

- SELEX against the human protein Rad51

The SELEX procedure is initiated with single-stranded DNA from the initial library.

From the second round of selection, the ssDNAs are obtained by asymmetric PCR, as described above. The treatment of the ssDNAs was carried out under the same conditions as those described for the L1 peptide.

The ssDNAs (around 4 μM) are incubated with the Rad51 protein (2 μM

1st round and 0.05 μM in the 7th round, Table III.2, Chapter III) in the selection buffer B (20 mM Tris-HCl pH 7.9, 2 mM MgCl ₂ , 1 mM ATP, and KCI 30 at 70 mM) for 30 min at 30 ^° C. In this study the separation of the bound and free ssDNAs is carried out by delay gel (1% agarose gel or polyacrylamide in native conditions for the last 2 laps), the complex ADNRad51 is excised and recovered from the gel. The ssDNAs are amplified by PCR as previously described.

After seven rounds of selection, the single-stranded DNAs obtained are amplified by PCR with primers P1 and P2, cloned, and then sequenced.

Cloning of selected sequences

The double-stranded DNA fragments required for cloning were obtained by

Classical PCR using as template 200 ng of single-stranded DNA (from the last round of selection), 0.4 mM dNTPs, 3 mM MgCl ₂ , 1 μM primers P1 and P2 and 2.5 U of the high-fidelity Pfu DNA polymerase enzyme (Promega) in a final volume of 50 μL.

DNA purified using the MinElute kit kit (Qiagen) was quantified by absorbance at 260 nm. Subsequently, 160 ng of DNA were placed in the presence of 10 ng of the pCR®-Blunt IITOPO® plasmid (Zero Blunt®TOPO®PCR Cloning Kit, Qiagen). (Figure 11.1), in a buffer comprising 50 mM Tris HCl pH 7.4; 1 mM EDTA, 2 mM DTT, 0.1% Triton X-100, 100 μg / ml BSA and 50% glycerol.

For the transformation, 6 .mu.l of the cloning medium are mixed with the chemically competent E.coli TOPO10 strain, according to the protocol provided by the manufacturer. The vector pCR®-Blunt II-TOPO® allows direct selection of recombinants via the interruption of the lethal gene ccdB ύ'E.coli. In the vector, the ccdB gene was fused at the 5 'end of the LacZα gene sequence, coding for the C-terminal end of the LacZα protein fragment. The ligation of a free PCR product, obtained using of the enzyme Pfu DNA Polymerase (Promega), interrupts the expression of the LacZα-ccdB fusion gene and ensures, after transformation, the growth of the positive recombinants. The transformants are plated on LB agar plates in the presence of kanamycin 50 μg / mL and incubated in an oven at 37 ° C. Cells that do not contain the vector do not grow. The isolated colonies are cultured in a liquid LB kanamycin 50 μg / mL medium for 12 h at 37 ° C. The plasmids were purified with the QIAprep®Spin kit (Qiagen) using the extraction protocols recommended by the supplier. Sequencing was performed with the "M13 reverse" primer.

- Techniques for studying the protein-nucleic acid interaction

Ge / delay and assessment of aptamer affinity

The gel retardation technique makes it possible to study the protein / nucleic acid interactions in vitro. The principle is based on the difference in electrophoretic migration between the protein-DNA complex and the DNA alone (Figure II.2). The greater the interaction, the more "slowed down" DNA is important. This delay can be visualized on an agarose gel or on a polyacrylamide gel under native conditions.

DNA labeled with IRDyeδOO were obtained by PCR using the P1 primer labeled with this fluorophore. "Labeled protein-DNA" complexes are formed in a final reaction medium of 10 μl. A fixed amount of DNA (aptamer) is incubated with increasing concentrations of Rad51 protein, in selection buffer B (20 mM Tris-HCl pH 7.9, 2 mM MgCl 2, 30 mM KCl, 1 mM ATP) supplemented with 5 mM DTT and 0.5% Tween, for 30 min at 37 ° C.

The complexes are resolved in a 1% agarose gel, or on a 6% native polyacrylamide gel. The gel is then scanned into an Odyssey scanner Infrared Imaging System (LICOR Biosciences). The resulting bands are quantified using the Odyssey software.

To calculate the apparent Kd of each aptamer, a constant concentration of aptamer (2.5 nM) labeled with NRD800 is incubated for 30 min at 37 ° C with increasing concentrations of Rad51 (0 to 1 μM). The products are then solved by a delay gel. The bands corresponding to the Rad51 -aptamer complex, as well as the band corresponding to the aptamer alone, are quantified. To obtain the Kd values, we expressed the fluorescence intensity of the complex relative to the total intensity of the well (complexed DNA + free DNA). Kd is the concentration of Rad51 needed to bind 50% of the DNA. The graph, as well as the trend curves were made with SigmaPlot software.

Dot-blot method and evaluation of the affinity of a DNA library

Upon selection of aptamers against the L1 peptide, the affinity of the selected DNAs was assessed by the dot-blot system. The NRD800 labeled DNAs (10 nM) are incubated with increasing concentrations of Rad51 (0 to 1 μM) in the selection buffer A, for 30 min at 37 ° C, in a total volume of 10 μl. The samples are diluted to 50 μL final, then deposited on a membrane (HAWP 0.45 μm, Millipore) immobilized in the bio-dot system (Bio-Rad). This membrane was previously treated with alkali with 0.5 M KOH for 20 min (Pileur et al., 2003) to avoid nonspecific cling of the DNAs on the membrane. Once the complexes are deposited, the membrane is washed and scanned. The spots are then quantified with the Odyssey software. The fluorescence intensity is directly proportional to the amount of ssDNA bound to the protein Rad51 retained on the membrane. Spot normalization is done by subtracting the background noise.

Chemical bridging of Rad51

The Rad51 protein (2 μM) previously dialyzed in a PBS buffer with a dialysis unit (Slide A Layer®Mini Dialysis Units, Pierce), was incubated alone, or with different concentrations of DNA selected for 10 min at room temperature, in a buffer containing 20 mM phosphate, 50 mM NaCl, 1 mM MgCl 2 and 1 mM ATP. The chemical bridging reaction (Figure II.3) was initiated with the addition of BS3 (bis [sulfosuccinimidyl] suberate, Pierce) at 50 μM and left for 30 min at room temperature. The reactions are then stopped by incubation for 15 min with 50 mM Tris-HCl pH 7.5. The products are separated on a 10% SDS-PAGE gel, followed by a western blotting. The membrane has been scanned and the quantization of the bands corresponding to Rad51 was performed using the Odyssey software.

The ester functions of crosslinker BS3 (or a DSS analog) react with the amino groups of proteins (-NH2) and form an amide function, very stable, resistant to denaturing conditions.

Strand exchange reaction

This study is based on the ability of the Rad51 protein to exchange homologous DNA strands. The reaction was carried out according to Takizawa and collaborators

(4). The single-stranded oligonucleotide used is named Rec58 (58 nt). Double-stranded DNA (32 bp) is formed by hybridization of the oligonucleotides Rec32 and IRD-Rec32.

The Rad51 protein (0.5 μM) was incubated with the 58 nt single-stranded DNA (100 nM) and in the presence or absence of the different aptamers, in a buffer containing 20 mM Tris-HCl pH 8.0; 1 mM ATP, 1 mM DTT, 100 μg / mL BSA, 20 mM MgCb, 2 mM creatine phosphate, 75 μg / mL creatine kinase and 2% glycerol, at 37 ° C for 15 min. The reaction was initiated by the addition of the NRD-labeled double-stranded DNA (32 bp), which has a sequence homology portion with the sequence of 58 nucleotides. The reaction is stopped after 1 h of incubation at 37 ° C by the addition of 0.7% SDS and 0.7 mg / ml proteinase K (Roche Molecular Biochemicals), then incubated for 10 min at 37 ° C. The samples are then separated in a 15% native polyacrylamide gel in TBE buffer at 120 volts for about 90 minutes. The detection of labeled DNA and the quantification of products are done using the Odyssey scanner.

- Spectroscopy

Fluorescence spectroscopy was used to study the interaction of the Rad51 protein with DNA, as well as circular dichroism techniques that provide information on the secondary structures of DNAs and proteins. Both of these techniques use a phenomenon of absorption of light.

Experimental conditions of CD measurements and absorbance

CD spectra of aptamers (100 μM nucleotides) or Rad51 (0.5 and 1 μM) were determined using a four-sided 0.2 x 1 cm quartz dish (Hellma) in a J-810 spectrometer (Jasco) with parameters: slot width: 2 nm; response time: 0.125 sec; measurement interval: 0.1 s; and 2 measurement accumulations. Spectra were measured in final 150 μL in buffer containing 20 mM Tris-HCl pH 7.5; 2 mM MgCl ₂ , 30 mM KCl. The buffer has was filtered on nitrocellulose and degassed. The spectra were taken at 20 ^° C., unless otherwise indicated. Absorbance spectra were obtained in a J-810 (Jasco) spectrometer at 260 nm. The initial temperature was 20 ^° C. and then increased to 80 ° C., at a rate of 1 ° C. per minute. The value of the melting temperature (Tm) was obtained after the analyzes of the curves.

Statistical treatment of results

When the experiments are carried out in triplicate or more, the values presented correspond to the means ± deviation of "n" independent experiments. Differences between averages for the presented results were statistically evaluated with the Man & Whitney test. The results were judged statistically significant if p <0.01.

Pattern and structure analysis with MEME and MFoId

The search for consensus motifs was carried out with each cluster separately, and analyzed with the MEME software (Multiple EM for Motif Elicitation, EM being itself the acronym for "Expectation Maximization") (5) (6) (http: // meme.nbcr.net/meme/cgi-bin/meme.cgi). The parameters used were: a maximum of 8 searched patterns per cluster, with a minimum pattern length of 6 and maximum of 50, and with the maximum number of occurrences of the pattern.

The prediction of secondary structures of the aptamers was carried out with the software MFoId (http://mfold.bioinfo.rpi.edu) (7) with the conditions: 1 M NaCl and 37 ° C. Results

Sequences of selected aptamers

All the sequences obtained by the SELEX procedure are presented in Table 1 below.

Table 1

Sequences retained after SELEX against HsRad51 (clusters 2, 3, 4, 5)

Example nomenclature used: A1 = Aptamer 1 = Clone 1

Cluster 2

> clone7

TAGGGAATTCGTCGACGGATCCCCGTCAGGGTTCGCACTCCAGGTCGACGCATGCGCC

> clonel8

TAGGGAATTCGTCGACGGATCCCCGTCAGGGTTCGCACTCCAGGTCGACGCATGCGCC

> clone47

TAGGGAATTCGTCGACGGATCCAGTCAACAACTCCAGGTCGACGCATGCGCC

> clone58

TAGGGAATTCGTCGACGGATCCTCAAGTTATGTGGGCTCCAGGTCGACGCATGCGCCG

> clone67

TAGGGAATTCGTCGACGGATCCGAGGCGGAAACTCCAGGTCGACGCATGCGCCG

> clone75

TAGGGAATTCGTCGACGGATCCCCCTGACACGATCGCTCCAGGTCGACGCATGCGCC

> clone79

TAGGGAATTCGTCGACGGATCCCGATACGCACTACAAACTCCAGGTCGACGCATGCGCCG

> clone89

TAGGGAATTCGTCGACGGATCCTGATCGGACTTTACCTCCAGGTCGACGCATGCGCCG

Cluster 3

> clonelO

TAGGGAATTCGTCGACGGATCCAGTCCGTGGTTAGGGAATTCGTCGACGGATCCCTCCAGGTCGAC GCATGCGCCG

> clone48

TAGGGAATTCGTCGACGGATCCGAGGAAACACGGGGTGTGGCTAGCCTCCAGGTCGACGCAT GCGCC

> clone64

TAGGGAATTCGTCGACGGATCCTGCGTGGTTAGGGATTCGTCGACGGATCCCTCCAGGTCGA CGCATGCGCC

> clone68

TAGGGAATTCGTCGACGGATCCAGTCCGTGGTTAGGGAATTCGTCGACGGATCCTCCAGGTC GACGCATGCGCC

> clone90

TAGGGAATTCGTCGACGGATCCAGTCCGTGGATAGGGAATTCGTCGACGGATCCGCAGGCTC CAGGTCGACGCATGCGCCG

Cluster 4

> clone3 TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG

> clone6

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG

> clone9

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACTATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG

> clonel7

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCACCGATCGTTC (TGCCTCCAGGTCGACGCATGCGCCG

> clone22

> clone27

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCGTGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG

> clone30

> clone41

> clone42

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGGACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG

> clone52

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAGCTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCC

> clone55

> clone72

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCTGGCATCTCCTGGGACATGAACTCGTTCG CTTATATGCCTCCAGGTCGACGCATGCGCCG

> clone80

> clone82

TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACCCGTTC GCTTATATGCCTTCAGGTCGACGCATGCGCCG

> clone84

Cluster 5

> clonel

TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC > clone2

TAGGGAATTCGTCGACGGATCCAGTGTGCCCGGGGAGCGGGCTTGGCGCGAGGTTGGATCCA CTACTGGGATCTCCAGGTCGACGCATGCGCCG

> clone5

TAGGGAATTCGTCGACGGATCCGGGACGCGCCAAAAGCTGGTCGAGTGCGAGTGTTGTGAAC GGATGGTGGTCTCCAGGTCGACGCATGCGCCG

> clonell

TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCCG

> clonel2

TAGGGAATTCGTCGACGGATCCCGCTTTTTAGGACACGGTTCGACTGACTTTGGCGCCTAGA TTGGATTAAGCTCCAGGTCGACGCATGCGCCG

> clonel3

TAGGGAATTCGTCGACGGATCCATCCTCAAAGGTTGGACACACATCAATAATAATTGTTCTT GTGGGCTCGCGCTCCAGGTCGACGCATGCGCCG

> clonel4

TAGGGAATTCGTCGACGGATCCGACTCGGACGGAGAATAGAGTTGCGTAACTCAATTATGCA CCGAGGGGGACTCCAGGTCGACGCATGCGCCG

> clonel5

TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTGCTCCAGGTCGACGCATGCGCCG

> clonel 6

TAGGGAATTCGTCGACGGATCCAGTCCGTGGCTAGGGAATTCGTCGACGGATCCAGTCCGTG GTTAGGGAATTCGTCGACGGATCCCCTCCAGGTCGACGCATGCGCCG

> clone24

TAGGGAATTCGTCGACGGATCCAGTCTACAAACAGTGTCGCCTGAAGTTATTTCGCTGCTTG GTTCTACGGACTCCAGGTCGACGCATGCGCCG

> clone29

TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTGATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC

> clone31

TAGGGAATTCGTCGACGGATCCGGTAGACCAGGGCTGATCGGCGGGGTCGGCGCAGAGATGT GTAAGGATAGCTCCAGGTCGACGCATGCGCCG

> clone36

TAGGGAATTCGTCGACGGATCCATGGCCGAGGCGTGCGTGGGATGGGACACTGCCTGAGGGG TGCACCCAACCTCCAGGTCGACGCATGCGCCG

> clone37

TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC

> clone38

> clone45

TAGGGAATTCGTCGACGGATCCTGCGTGGTTAGGGAATTCGTCGACGGATCCTGCGTGGTTA GGGAATTCGTCGACGGATCCCTCCAGGTCGACGCATGCGCCG

> clone49

TAGGGAATTCGTCGACGGATCCACGGGCCGGGCTTCCTAGACAGGGTGTGTTATCGTGGTGT CGGCACGGTGCTCCAGGTCGACGCATGCGCCG

> clone53

TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC > cl one 60

TAGGGAATTCGTCGACGGATCCGTTTAACCGTGTGATCTGTGTTCTGCGCAATCTTGGTGCA GCGGGCCAACCTCCAGGTCGACGCATGCGCCG

> clone62

TAGGGAATTCGTCGACGGATCCTGGTGGCAGGTGGGACGTGAGCGCGGAGCACGGAGGCGCC AGACTCGTGACTCCAGGTCGACGCATGCGCCG

> clone63

TAGGGAATTCGTCGACGGATCCGAAGGATCCGGCAGTGGAGCTTGGTGTGGAACGTTTAGCA TCCAAAGGTGCTCCAGGTCGACGCATGCGCC

> clone69

> clone71

TAGGGAATTCGTCGACGGATCCGAAAGTTGCCGACTGGGATGTTTTCACTTGGGGTAAGGAA CGGGGGGGGTCTCCAGGTCGACGCATGCGCCG

> clone76

TAGGGAATTCGTCGACGGATCCAGTGGCGGAGGGGTGCATGGCCGCGGGGGTGCCGTGGGCT ATACTTCGATCTCCAGGTCGACGCATGCGCCG

> clone77

> clone78

TAGGGAATTCGTCGACGGATCCTGGTCATCGCGGTGTGGTGGTACGGAGATCTTGGTCTACA GCTCCTTGGCTCCAGGTCGACGCATGCGCCG

> clone83

TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG ACGGATCCCCTCCAGGTCGACGCATGCGCCG

> clone87

TAGGGAATTCGTCGACGGATCCGCCTAGAACGCTCCCGCACAGGGTACGGTGGGATGTGGGT TGGGGCTACCCTCCAGGTCGACGCATGCGCCG

In silico analysis of selected aptamer sequences

This in silico analysis consists in comparing all the sequences 2 to 2, which made it possible to construct a "matrix of distance" representative of their respective homology. In this matrix where each row / column represents a sequence, the closer two nucleotide sequences are, the smaller the distance between them. Conversely, the more distant two sequences are, the greater the distance that separates them. This distance matrix can be represented as a hierarchical tree. The inventors' approach was then to isolate the similar sequences for a given threshold. The threshold set for this analysis allowed us to identify 6 clusters of DNA sequences. For a better visualization of the results, the sequence distribution is represented using an analysis of the principal component data (PCA) Jackson, (9). To do this, we search for the representation axes (i.e. the components) that explain the maximum variance associated with the distance between each sequence. This takes into account the two most significant components. The first component takes into account 84.36% of the data discrepancies, and the second component takes into account 7.8%, ie a total of 92.16% of the initial variation of SELEX represented by these two axes. This filtration and the associated representation gives an overview of the distribution of the data according to the similarity of the sequences (Figure 8).

Each point cloud will then be considered representative of a cluster.

A detailed cluster analysis shows that the clusters farthest from the center of the representation (i.e. barycenter of the data) contain the most divergent sequences (i.e.vahance the highest compared to the average of the other sequences).

Each sequence obtained is associated with a given cluster. The aptamers retained for the following are indicated in each cluster (A7, A13, A30, A45, A47, A48, A77, A79 and A90).

Effect of aptamers on Rad51 strand exchange activity

Strand exchange activity assays of Rad51 were performed to evaluate the effect of the inhibitors of the invention. The protocol of Takizawa et al. (4) was used. Briefly, the Rad51 protein is incubated with a single-stranded substrate DNA of 58 nucleotides (nt). The reaction is initiated by the addition of a 32 bp double-stranded DNA labeled with a fluorophore (IRDyeδOO), which has a strand homologous to the sequence of 58 nt. When there is a strand exchange activity, the appearance of a single-stranded DNA band of 32 nt is observed.

The sequences of the invention, not all having identical sizes, the concentrations are expressed in "nucleotide" equivalent (nucleotide concentration = molar concentration x number of nucleotides of the entire sequence) in order to homogenize the results. The molar concentrations are shown in Table 2 below. The size of each aptamer is indicated. The molar concentrations (nM) and nucleotide equivalent (5 μM) used for the study of strand exchange activity are presented.

Table 2

To test the effect of aptamers on strand exchange activity, the Rad51 protein is incubated with substrate single-stranded DNA in the presence or absence of aptamers. Then, the appearance of the ssDNA band of the reaction is detected and quantified.

The results are given in FIGS. 1A and 1B: (A) The inhibition of the Rad51 recombinase activity (0.5 μM) by the selected aptamers (5 μM nucleotides) was detected by separating the products on a polyacrylamide gel under native conditions. Double-stranded DNA control (dsDNA) and control activity in the absence of an aptamer are also shown. (B) The gels were scanned and the interest bands quantified with the Odyssey software (LI-COR). Quantification of 3 Independent experiments is presented after normalization versus control.

The labeled dsDNA alone migrates in a native polyacrylamide gel as a single band. In the absence of aptamer, the strand exchange activity leads to the appearance of a single-stranded DNA (ssDNA) band (well 2, control activity). This strand exchange activity will be considered as a reference activity (equal to 1 in FIG. 1B). The activity is then evaluated in the presence of the different aptamers (wells 3 to 11).

The results obtained show that all the inhibitors tested show an inhibitory effect on the Rad51 recombinase activity. A79, A13 and A30 aptamers inhibit activity by about 70-80% (ie 83 nM for A79 and 53 nM for A13 and A30).

The results obtained show that the aptamers selected by increasing the astringency during selection rounds, the salt concentration and the Rad51: DNA ratio have an inhibitory effect on the Rad51 strand exchange activity.

In the presence of aptamers A79, A30 and A13, the strand exchange activity (or recombinase activity) is decreased by a factor close to 4.

A statistical analysis of the results (Mann & Whitney test) indicates that the inhibitory effect of A79 is significant (p <0.01) compared with other aptamers of similar size (A7, A47 and A48). Inhibition observed in the presence of A30 and A13 aptamers is also statistically significant (p <0.01) compared to the effect of aptamers A45, A77 and A90, of similar size.

It should be noted the difference in the inhibition of the recombinase activity by A79 and A47 aptamers, belonging to cluster 2. Their nucleotide composition and their respective secondary structures determined with MFoId 37 ° C are very similar. In particular, these secondary structures exhibit a difference in the size of the closed loop (FIG. 2).

Characterization of the inhibitors of the invention

Affinity of aptamers for Rad51

Aptamers A30, A13 and A79 were labeled with a fluorophore

(IRDyeδOO) and their relative affinity for the protein evaluated by the delay gel technique. The results are given in FIG. 3 (A). The different aptamers labeled with IRDyeδOO (2.5 nM) are incubated in the presence of increasing concentrations of Rad51 (0-1 μM). After separation of the reaction medium by 1.5% agarose gel electrophoresis, the bands corresponding to the free aptamer and bound to Rad51 are quantified. In each experiment, the intensity of the band corresponding to the free aptamer is taken as reference (100%). (B) The bands corresponding to the free and bound aptamers are quantified and the results expressed in% of aptamers bound to the protein. The dissociation constant (apparent Kd) of each aptamer is calculated from the equation of the trend curve. Kd is the concentration of Rad51 at which 50% of the DNA is free.

NRD-labeled aptamers are incubated with increasing concentrations of Rad51 and resolved on an agarose gel. The gel is scanned and the bands quantified.

The results show that the apparent Kd is 40 ± 6 nM for A79, 72 ± 25 nM for A30, and 76 ± 12 nM for A13. The affinity of the initial library used for selection was also evaluated and shows an apparent major Kd of 200 nM, which confirms that the aptamers selected have an increased affinity for Rad51.

The aptamers A13 and A30 have apparent similar Kd values. These two aptamers also have similar effects on the inhibition of recombinase activity, as well as on DNA binding and on the oligomerization of Rad51. As previously described, A79 appears to modulate Rad51 in a manner other than A13 and A30.

Specificity of aptamers for Rad51

In order to confirm the specificity of the aptamers of the invention, their interaction with the bacterial homologue RecA was tested. The experiments were also performed by gel delay. The A30 and A79 aptamers labeled with NRDyeδOO (2.5 nM) are incubated in the presence of increasing concentrations of RecA (0-1000 nM).

After separation from the reaction medium by 1.5% agarose gel electrophoresis, no band corresponding to the RecAaptamer complex is observed. The results are given in Figures 4A and 4B.

The results obtained clearly show that A30 and A79 do not interact with the RecA protein added at concentrations up to

1 μM, which demonstrates the very high selectivity with respect to the human Rad51 protein of the inhibitor aptamers of the invention. Structural studies of aptamers A30 and A79

The aptamers A79 and A30 were fragmented to take into account the different parts of the sequence, and to maintain secondary structures. The structures obtained are shown in FIGS. 5A and 5B: (A) aptamer A30 was fragmented into 3 segments A30-1, A30-2, and A30-3 respectively corresponding to segments 1 -31, 32-62, 63-94 of the entire sequence. (B) The predicted secondary structures of the entire aptamer A30 and the A30-1, A30-2, and A30-3 fragments obtained by MFoId at 37 ° C are presented.

The sequences of the different segments of the aptamers were analyzed with the online software MFoId (7) (http://mfold.bioinfo.rpi.edu/).

The A30 aptamer 94 nucleotides (nt) was cut into 3 fragments of about 32 nt. The predicted secondary structures of the different fragments were also determined (Figure 5).

The aptamer A79 60 nt was cut into 4 fragments of sizes between 23 and 38 nt. The predicted secondary structures of the different fragments were also determined. The results are given in Figure 6: (A) A79 aptamer was fragmented into 4 segments A79-1, A79-2, A79-3 and A79-4 respectively corresponding to segments 1 -35, 23-58, 12 -49 and 27-49 of the entire sequence. (B) The predicted secondary structures of the whole aptamer and the A79-1, A79-2, A79-3 and A79-4 fragments obtained by MFoId at 37 ° C are presented.

The results show that both aptamers (A30 and A79) form stem-loop structures known to promote the stability of single-stranded nucleic acids (DNA and RNA). This stability is also linked to the composition of bases, the pairing between guanine (G) and cytosine (C) favoring stability with respect to the pairing between adenine (A) and thymine (T), due to the number of hydrogen bonds (3 links for GC, against 2 links for A-T). In addition, aptamer A30 has 61% nucleotide GC and 59% A79, which contributes to the stabilization of their structure. The structure of A30 is more complex, forming 4 closed loops, as well as 3 stems with several GC bonds (G = -13.20 kcal / mol at 37 ° C, determined by MFoId). A79 aptamer forms a visibly less complex structure, with a lower number of GC bonds than A30 (g = -6.07 kcal / mol at 37 ° C, determined by MFoId). Study of the aptamer structure

The structure of aptamers was studied using circular dichroism (CD, for Circular Dichroism). The temperature induces changes in the structure of the nucleic acids. The spectrum of aptamers A79 and A30 has been studied at different temperatures, for wavelengths between 220 and 340 nm. The results are given in FIG. 7: (A) CD spectra were obtained at 20 ^° C. and at 80 ^° C. in a TrisHCI buffer. The 2 aptamers have a positive curve at 275 nm and a negative curve at 245 nm. (B) CD curves of aptamers were measured at a constant wavelength of 275 nm. Curves as a function of temperature were obtained by raising the temperature from 20 ° C. to 80 ^° C. and lowering the temperature. (C) Absorbance curves were measured at 260 nm with temperature variations as described in (B).

The signal amplitude at these two wavelengths is maximum at 20 ° C, and decreases by about 50% when the temperature reaches 80 ° C, reflecting a loss of structure. This major effect can be explained by a lower chirality of aptamers induced by weaker pairing and stacking of bases at 80 ^° C.

CD and UV curves were obtained by increasing the temperature (from 20 ° C. to 80 ° C.) and subsequently by lowering the temperature (from 80 ^° C. to 20 ° C.). The CD spectra show a point of inflection, which corresponds to a change in the aptamer structure, and which corresponds to the Tm (melting temperature). This can be visualized also in the UV absorbance curves. The Tm for aptamer A79 is 55 ° C and the Tm for A30 is 40 ^° C.

The base composition of aptamers A30 and A79 shows that they have 61% and 59% GC bases. This high content of GC bonds could explain the presence of secondary structures. A30 aptamer contains 30% G, 31% C, 18% A and 21% T. The aptamer A79 contains 27% G, 32% C, 25% A and 16% T. Bibliographical References

1 - Tuerk and GoId 1990 ,, Science 249: 505-510

2 - Ellington and Szostak, 1990, 346: 812-822

3 - Fukusaki et al., 2000, Bioorg med Chem lett 10: 423-5

4 - Takisawa et al., 2004, genes to CeIIs, 9, 781-790

5 - Bailey & Elkan, 1994, Proc Int. Intell. Syst Mol Mol, 2, 28-36,

6 - Bailey et al., 2006, Nucl.Acids Res. 34: W369-373

7 - Zucker, 2003, Nucl.Acids Res.31: 3406-3415,

8 - Bradford, 1976, Anal Biochem, 72, 248-254,

9 - Jackson, 1991, A User's Guide to Principal Components, Wiley N. Y.

Claims

claims

1-Aptamers obtainable by the SELEX technique in which a synthetic single-stranded DNA (ssDNA) library containing a random central region surrounded by constant regions at the 5 'and 3' ends, used as fixation sites for amplifications , is incubated with a target molecule, the DNAs having interacted with the target being alone retained and amplified for a new round of selection, to enrich the bank in sequences interacting specifically with the target protein, the selected DNAs being cloned,

characterized in that

- the astringency being increased during the selection,

the ssDNAs from the last round of selection are isolated, cloned in plasmids, the plasmids then being extracted, purified and sequenced,

the selected sequences are grouped on the basis of their similarities and the presence of consensus patterns,

the aptamers thus selected having an inhibitory effect on the Rad51 recombinase activity of at least 70%, more especially at least 80%.

2 - Aptamers according to claim 1, characterized in that they have an apparent Kd of the order of 40 to 90 nM and comprise about 60% G-C bases.

3 - Aptamers according to claim 1 or 2, characterized in that they correspond to the sequences SEQ ID No. 2-10.

4 - Aptamers according to any one of claims 1 to 3 for use as inhibitors of Rad51.

5 - Pharmaceutical compositions, characterized in that they contain a therapeutically effective amount of at least one apatamer according to one of any of claims 1 to 3 in association with a pharmaceutically inert carrier.

6 - Pharmaceutical compositions according to claim 5, characterized in that they are in a form intended for oral administration, injectable, parenteral.