WO2011013040A1 - Aptamers which inhibit the activity of the human rad51 protein, and biological uses thereof - Google Patents
Aptamers which inhibit the activity of the human rad51 protein, and biological uses thereof Download PDFInfo
- Publication number
- WO2011013040A1 WO2011013040A1 PCT/IB2010/053343 IB2010053343W WO2011013040A1 WO 2011013040 A1 WO2011013040 A1 WO 2011013040A1 IB 2010053343 W IB2010053343 W IB 2010053343W WO 2011013040 A1 WO2011013040 A1 WO 2011013040A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aptamers
- rad51
- dna
- protein
- selection
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Definitions
- the subject of the invention is aptamers that inhibit human Rad51 protein activity and their biological applications.
- the human Rad51 protein plays a central role in the repair of double-strand breaks in DNA, via homologous recombination. Rad51 initiates the recombination reaction by the formation of a nucleoprotein filament, through the cooperative association of the monomers of Rad51 on single-stranded DNA. The formed complex binds a second double-stranded DNA to exchange the homologous strands, which step is accompanied by the hydrolysis of ATP. This activity is necessary for survival and cell proliferation. However, its activity has a negative effect on anticancer treatments. It is indeed related to the resistance of cancer cells to chemo- and radiotherapy.
- the value of having products capable of decreasing the resistance of tumor cells to anticancer treatments is measured.
- Rad51 in humans is a protein of 339 amino acids with a molecular weight of 36966 Da. Its primary sequence is given in the Sequence Listing document and identified under SEQ ID No. 1. It is a complex protein with multiple domains, including an ATPase domain with L1 and L2 DNA binding loops. It is on the one hand able to form a homopolymer and on the other hand able to interact with the DNA.
- the inventors have used the SELEX method (Systematic Evolution of Ligands by EXponential enrichment) developed by Tuerk and GoId, (1) and Ellington and Szostak (2). This method makes it possible to isolate RNA or single-stranded DNA oligonucleotide sequences from a random library of oligonucleotides. These sequences have been referred to as aptamers by Ellington and Szostak to describe their property to specifically interact with other biological molecules. This term will be used hereinafter indifferently with that of inhibitor to designate the oligonucleotides according to the invention. By operating under selected conditions of selection, the inventors have thus isolated aptamers which have been found to correspond to inhibitors of high potential on the activity of the protein.
- the object of the invention is therefore to provide, as new products, oligonucleotides or aptamers capable in particular of modulating the activity of Rad51 and even of inhibiting it, which makes it possible, in particular, to increase the sensitivity of the cancer cells to the treatments. cancer.
- the invention is directed to diagnostic and therapeutic applications of these aptamers.
- the invention relates to aptamers obtainable by the SELEX technique, in which a synthetic single-stranded DNA (ssDNA) library containing a random central region surrounded by constant regions at the 5 'and 3' ends, used as sites for the amplifications, is incubated with a target molecule, the DNAs having interacted with the target being alone retained and amplified for a new round of selection, to enrich the library in sequences interacting specifically with the target protein, the selected DNAs being cloned and if necessary sequences.
- ssDNA synthetic single-stranded DNA
- such aptamers are as obtained by a process characterized in that
- the target molecule is the Rad51 protein, this protein being incubated with an ssDNA library, in the presence of a selection buffer containing MgCl 2 and ATP,
- the formed DNA-Rad51 complex is separated by electrophoresis and the delayed DNA extracted from the gel,
- the selected DNA is re-amplified using the primers P1 and P2, then only with the primer P1, and the relative affinity with respect to Rad51 is evaluated,
- the ssDNAs from the last round of selection are isolated and cloned into plasmids, the plasmids then being extracted, purified and sequenced,
- the selected sequences are grouped on the basis of their similarities and the presence of consensus patterns, the aptamers thus selected having an inhibitory effect on the Rad51 recombinase activity of at least 70%, more especially at least 80%.
- the ssDNAs incubated with the target are labeled, for example with an IRD fluorophore.
- the ssDNAs are not labeled. The incubation is carried out for 30 minutes at room temperature.
- Suitable plasmids for the cloning step include plasmid pCR®-Blunt IITOPO®. As illustrated by the examples, this plasmid has in particular been used to transform E. coli TOPO10 cells, which have been cultured.
- the aptamers of the invention are more particularly characterized in that they have an apparent Kd of the order of 40 to 90 nM and comprise about 60% G-C bases.
- Preferred aptamers correspond to the sequences SEQ ID No. 2-10.
- the SELEX procedure is initiated with Rad51 at 2 ⁇ M in the presence of the 4 ⁇ M ssDNA library in a selection buffer of pH 7.9 containing 2 mM of MgCl 2 and 1 mM of ATP. Throughout the selection, the concentration of the library is maintained at 3-4 ⁇ M.
- the astringency is increased during the selection, for example from 2 to 75.
- the aptamers of the invention bind to Rad51 with a high affinity of the order of 1 nM and very efficiently inhibit the exchange reaction of strands of Rad51 DNA. , thus acting on the activity of the protein and not on its expression.
- aptamers are small molecules and can therefore easily enter the tissues. They can be obtained and modified easily, synthetically and generally are not or weakly immunogenic.
- the invention thus aims at the use of the aptamers defined above as therapeutic agents. It relates in particular to pharmaceutical compositions, characterized in that they contain a therapeutically effective amount of at least one aptamer as defined above, in combination with a pharmaceutically inert vehicle.
- compositions are advantageously used in the context of anticancer treatments.
- compositions are characterized in that they are in a form intended for oral, injectable or parenteral administration.
- the doses of administration will be easily chosen by the practitioner depending on the age and condition of the patient.
- FIG. 1 the effect of the aptamers of the invention on the recombinase activity of
- FIG. 2 secondary aptamer structures of the invention
- FIG. 4 the specificity of selected aptamers according to the invention
- FIGS. 5 and 6 the secondary structures obtained by MFoId for aptamers of the invention and fragments thereof
- FIG. 7 the structural study by CD and UV of aptamers of the invention
- the standard volume used is 5 ⁇ L.
- the solution contains 14 fragments of 200 to 10,000 base pairs (bp) (200, 400, 600, 800, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 8000 and 10000 bp).
- the volume used is 1 ⁇ L.
- the solution contains 11 fragments of 25 to 766 base pairs (bp) (25, 50, 75, 100, 150, 200, 250, 300, 350, 500, 766 bp).
- Bio-Rad contains 8 molecular weight proteins between 6.5 and 210 kDa.
- Ovalbumin 45 Albumin serum (BSA) 66.2; Galactosidase 116.3 and Myosin 200 kDa.
- the volume used is 4 ⁇ l_.
- biot-U biot-RTDYSGRGELSAR
- SEQ ID NO: 11 (P1): ⁇ '-TAGGGAATTCGTCGACGGATCC-S '
- SEQ ID NO: 12 (P2): 5'-CGG CGC ATG CGT CGA CCT GGA G-3 '
- SEQ ID NO: 16 (ssDNA library): 5'-TAGGGAATTCGTCGACGGATCC- (N) 50 -
- the competent bacteria E.coli JM109 (DE3) are thawed at 4 ° C. 100 ⁇ l of the solution are added to 1 -50 ng of the vector pET15b-HsRad51 and incubated in ice for 30 min. The heat shock is performed at 42 ° C for 45 seconds, followed by a 10-minute incubation in ice. Then, 900 ⁇ l of prewarmed LB medium are added and the medium is incubated for 60 min at 37 ° C. with stirring. The solution is then centrifuged at 13000 rpm for 5 min.
- the pellet is taken up in 50 ⁇ l of LB medium and spread on a box of LB agar which contains ampicillin (100 ⁇ g / ml) and chloramphenicol (30 ⁇ g / ml), and incubated for 16 hours at 37 ° C.
- Bacterial culture is taken up in 50 ⁇ l of LB medium and spread on a box of LB agar which contains ampicillin (100 ⁇ g / ml) and chloramphenicol (30 ⁇ g / ml), and incubated for 16 hours at 37 ° C.
- the culture is carried out in 1 L of LB medium containing 1 mL of ampicillin 100 mg / mL and 30 mg / mL of chloramphenicol with all of the bacterial carpet from the LB agar plate.
- the culture is carried out with stirring at 30 0 C until an OD at 600 nm of 0.6.
- Induction with 1 mM NPTG is carried out for 18 h.
- the culture is centrifuged at 4 ° C. for 30 min at 4100 rpm and the cell pellet is stored at -20 ° C.
- the Rad51 protein contains in its C-terminal part a polyhistidine label (6-His), which allows it to be purified by affinity chromatography on an immobilized nickel column.
- Ni2 + -NTA nitriloacetic acid matrix
- the bacterial pellet from 2 L of culture is suspended in buffer A
- This suspension is sonicated at 4 ° C (3 x 45-70%).
- the solution obtained is centrifuged at 15,000 rpm and 4 ° C for 25 min.
- the supernatant obtained is mixed with 1 ml of Ni-NTA resin, which has been washed beforehand with buffer A, and then incubated for 60 min with stirring at 4 ° C.
- the protein is then eluted with an imidazole gradient (60 mM to 250 mM).
- the different fractions containing Rad51 are pooled and the protein concentrations are estimated by the Bradford method (8), using bovine serum albumin (BSA) as standard.
- BSA bovine serum albumin
- the fractions containing the protein are treated with thrombin protease (Amersham Biosciences), 1.5 U / 1 mg of thrombin protease (Amersham Biosciences), 1.5 U / 1 mg of thrombin protease (Amersham Biosciences), 1.5 U / 1 mg of thrombin protease (Amersham Biosciences), 1.5 U / 1 mg of thrombin protease (Amersham Biosciences), 1.5 U / 1 mg of
- Dialysis is also performed against 1 L buffer (20 mM Tris HCl pH 8.0, 200 mM KCl, 0.25 EDTA, 2 mM mercaptoethanol) for 16-20 h at 4 ° C with shaking.
- the sample is centrifuged for 10 min at 4100 rpm and the supernatant added to the MonoQ column (Healthcare Biosciences), and the recovered samples are subjected to a final dialysis buffer (20 mM TrisHCI pH 8; 200 mM KCI; 0.25 mM EDTA; 5 mM DTT; 20% glycerol) for 3 h at 4 ° C.
- the protein concentration of the different fractions is determined by the Bradford method.
- the protein assay was performed by the Bradford method. At 800 ⁇ L of the solution containing the protein, 200 ⁇ L of Bio-Rad reagent are added. After 15 min of incubation at room temperature, the absorbance is read at 595 nm. The protein concentration is determined by reference to a standard range of bovine serum albumin (2 to 20 ⁇ g / ml).
- the samples are analyzed by electrophoresis under denaturing conditions, in a gel consisting of a concentrating upper part and a lower separating part.
- the migration is at 120 volts.
- the gel is then stained with Coomasie blue to demonstrate protein.
- the presence and purity of the protein are determined by comparison with a marker kit (6.5-200 kDa, Bio-Rad).
- the proteins present in the samples are previously resolved by SDS-PAGE and then transferred to a nitrocellulose membrane (Hybond TM ECL TM, Amersham Biosciences) in transfer buffer (25 mM Tris base, 192 mM glycine, 20% ethanol) for 16 hours. at 4 ° C and 90 mA.
- transfer buffer 25 mM Tris base, 192 mM glycine, 20% ethanol
- the membrane is blocked with a solution of TTBS (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% Tween 20) with 5% BSA for 1 hour at RT.
- the membrane is first incubated with an anti-Rad51 mouse monoclonal antibody (Rad51 Ab-1 (NeoMarkers) clone 51 Rad01) diluted 1: 10,000 in TTBS buffer supplemented with 1% BSA, for 1 h at room temperature.
- Rad51 Ab-1 NaoMarkers
- TTBS 3 washes of 5 min are carried out with TTBS.
- the membrane is then incubated for 45 minutes with a second antibody, anti-mouse labeled with Alexa-Fluor 700 (Molecular Probes) diluted 1/10000 in TTBS. From this stage the membrane is protected from light. Successive washes are performed in TTBS buffer for 45 min in total. Detection of the protein is performed by scanning the membrane using an Odyssey (Infrared Imaging System, LI-COR Biosciences) scanner, which detects the fluorescence of the IRDye 700 fluorophore. The molar mass marker is also detected.
- LI-COR Biosciences Odyssey
- PCR In order to amplify the library used for the different rounds of selection, two different types of PCR were used: a so-called conventional PCR with primers P1 and P2, which will produce double-stranded DNAs. As well as an asymmetric PCR with only P1, which makes it possible to obtain single-stranded DNAs.
- the amplification of single-stranded DNA was carried out with primers P1 and P2 1 at 1 ⁇ M, in Tris-HCl buffer pH 8.8, 75 mM, 10 mM KCl, 20 mM BSA, 0, 01% Tween 20, 0.05% nonidet P40 in the presence of 200 ng single stranded DNA, 0.4 mM dNTPs, 3 mM MgCl 2, and 2.5 U of the Taq DNA polymerase enzyme ( Invitrogen) for a final volume of 50 ⁇ L. A denaturation of 5 min at 94 ° C.
- an amplification was carried out in the same medium as that described above, but using as matrix an aliquot of double-stranded DNA (5 ng) obtained by the conventional PCR, and which previously purified using the MinElute Kit (Qiagen).
- the asymmetric PCR was carried out with the primer P1.
- the same primer is used but labeled with the IRDye ⁇ OO fluorophore.
- the PCR program is the same as for conventional PCR, only the number of cycles was decreased to 25 at the end of selection.
- the purification of the DNA obtained by PCR (classical or asymmetric) is carried out with the "MinElute® PCR Purification Kit” (Qiagen) and using the protocol recommended in this kit.
- Quantification of the purified DNAs is by measuring the absorbance at 260 nm with a biophotometer (Eppendorf).
- An absorbance equal to 1 corresponds to a concentration of single-stranded DNA of 40 ⁇ g / cm3 or double-stranded DNA of 50 ⁇ g / cm3.
- the ssDNA library is denatured at 90 ° C. for 5 min, then rapidly cooled in ice, followed by 15 min at room temperature.
- a cross-selection was performed systematically before each round. This consists in incubating the ssDNA library (1 ⁇ M) with the avidin resin (80 ⁇ l) in the selection buffer A (10 mM Tris-HCl pH 7.9, 30 mM KCl, 100 mM NaCl) for 15 minutes. min at 37 ° C in a total volume of 250 ⁇ L. The solution containing the resin is deposited in a column.
- Unretained DNAs are used to perform a round of selection with the biotinylated L1 peptide.
- the solution containing the DNA library (1 ⁇ M) is incubated with the biot-L1 peptide (10 ⁇ M in the first round, and 0.2 ⁇ M in the fifth round, Table III.1 Chapter III) for 15 min at 37 ° C. .
- the incubation is continued in the presence of 600 .mu.l of avidin resin for 15 min, then the solution is deposited in a column.
- the "biot-L1 / ssDNA" complexes are eluted in 8 fractions of 300 ⁇ l with a PBS buffer containing 2 mM biotin.
- the absorbance of the fractions is measured at 280 nm to identify the most concentrated fractions.
- the DNA is extracted from the fractions enriched in Rad51 -DNAsb complexes by phenol-chloroform extraction.
- the aqueous phase is recovered by centrifugation (5 min at 4000 rpm), treated with ethanol and the precipitated DNA.
- the ssDNA obtained is amplified as previously described. These can be used for a new selection round. Phenol-chloroform extraction
- the aqueous solution containing the DNA is adjusted to a concentration of cations by adjusting to 0.3 M sodium acetate, and the final volume determined. Two volumes of 100% ethanol at 20 ° C. are added to the solution and precipitated at -20 ° C. for at least 2 hours. The solution is then centrifuged for 10 min at 10,000 rpm and 4 ° C.
- the pellet is dried and taken up in sterile water.
- the SELEX procedure is initiated with single-stranded DNA from the initial library.
- the ssDNAs are obtained by asymmetric PCR, as described above.
- the treatment of the ssDNAs was carried out under the same conditions as those described for the L1 peptide.
- the ssDNAs (around 4 ⁇ M) are incubated with the Rad51 protein (2 ⁇ M
- the single-stranded DNAs obtained are amplified by PCR with primers P1 and P2, cloned, and then sequenced.
- the vector pCR®-Blunt II-TOPO® allows direct selection of recombinants via the interruption of the lethal gene ccdB ⁇ 'E.coli.
- the ccdB gene was fused at the 5 'end of the LacZ ⁇ gene sequence, coding for the C-terminal end of the LacZ ⁇ protein fragment.
- the ligation of a free PCR product obtained using of the enzyme Pfu DNA Polymerase (Promega), interrupts the expression of the LacZ ⁇ -ccdB fusion gene and ensures, after transformation, the growth of the positive recombinants.
- the transformants are plated on LB agar plates in the presence of kanamycin 50 ⁇ g / mL and incubated in an oven at 37 ° C. Cells that do not contain the vector do not grow.
- the isolated colonies are cultured in a liquid LB kanamycin 50 ⁇ g / mL medium for 12 h at 37 ° C.
- the plasmids were purified with the QIAprep®Spin kit (Qiagen) using the extraction protocols recommended by the supplier. Sequencing was performed with the "M13 reverse" primer.
- the gel retardation technique makes it possible to study the protein / nucleic acid interactions in vitro.
- the principle is based on the difference in electrophoretic migration between the protein-DNA complex and the DNA alone ( Figure II.2). The greater the interaction, the more "slowed down" DNA is important. This delay can be visualized on an agarose gel or on a polyacrylamide gel under native conditions.
- DNA labeled with IRDye ⁇ OO were obtained by PCR using the P1 primer labeled with this fluorophore.
- "Labeled protein-DNA" complexes are formed in a final reaction medium of 10 ⁇ l.
- a fixed amount of DNA (aptamer) is incubated with increasing concentrations of Rad51 protein, in selection buffer B (20 mM Tris-HCl pH 7.9, 2 mM MgCl 2, 30 mM KCl, 1 mM ATP) supplemented with 5 mM DTT and 0.5% Tween, for 30 min at 37 ° C.
- the complexes are resolved in a 1% agarose gel, or on a 6% native polyacrylamide gel.
- the gel is then scanned into an Odyssey scanner Infrared Imaging System (LICOR Biosciences).
- the resulting bands are quantified using the Odyssey software.
- a constant concentration of aptamer (2.5 nM) labeled with NRD800 is incubated for 30 min at 37 ° C with increasing concentrations of Rad51 (0 to 1 ⁇ M).
- the products are then solved by a delay gel.
- the bands corresponding to the Rad51 -aptamer complex, as well as the band corresponding to the aptamer alone, are quantified.
- Kd we expressed the fluorescence intensity of the complex relative to the total intensity of the well (complexed DNA + free DNA).
- Kd is the concentration of Rad51 needed to bind 50% of the DNA.
- the graph, as well as the trend curves were made with SigmaPlot software.
- the affinity of the selected DNAs was assessed by the dot-blot system.
- the NRD800 labeled DNAs (10 nM) are incubated with increasing concentrations of Rad51 (0 to 1 ⁇ M) in the selection buffer A, for 30 min at 37 ° C, in a total volume of 10 ⁇ l.
- the samples are diluted to 50 ⁇ L final, then deposited on a membrane (HAWP 0.45 ⁇ m, Millipore) immobilized in the bio-dot system (Bio-Rad). This membrane was previously treated with alkali with 0.5 M KOH for 20 min (Pileur et al., 2003) to avoid nonspecific cling of the DNAs on the membrane.
- the membrane is washed and scanned.
- the spots are then quantified with the Odyssey software.
- the fluorescence intensity is directly proportional to the amount of ssDNA bound to the protein Rad51 retained on the membrane. Spot normalization is done by subtracting the background noise.
- the chemical bridging reaction ( Figure II.3) was initiated with the addition of BS3 (bis [sulfosuccinimidyl] suberate, Pierce) at 50 ⁇ M and left for 30 min at room temperature. The reactions are then stopped by incubation for 15 min with 50 mM Tris-HCl pH 7.5. The products are separated on a 10% SDS-PAGE gel, followed by a western blotting. The membrane has been scanned and the quantization of the bands corresponding to Rad51 was performed using the Odyssey software.
- crosslinker BS3 (or a DSS analog) react with the amino groups of proteins (-NH2) and form an amide function, very stable, resistant to denaturing conditions.
- the single-stranded oligonucleotide used is named Rec58 (58 nt).
- Double-stranded DNA (32 bp) is formed by hybridization of the oligonucleotides Rec32 and IRD-Rec32.
- the Rad51 protein (0.5 ⁇ M) was incubated with the 58 nt single-stranded DNA (100 nM) and in the presence or absence of the different aptamers, in a buffer containing 20 mM Tris-HCl pH 8.0; 1 mM ATP, 1 mM DTT, 100 ⁇ g / mL BSA, 20 mM MgCb, 2 mM creatine phosphate, 75 ⁇ g / mL creatine kinase and 2% glycerol, at 37 ° C for 15 min.
- the reaction was initiated by the addition of the NRD-labeled double-stranded DNA (32 bp), which has a sequence homology portion with the sequence of 58 nucleotides.
- the reaction is stopped after 1 h of incubation at 37 ° C by the addition of 0.7% SDS and 0.7 mg / ml proteinase K (Roche Molecular Biochemicals), then incubated for 10 min at 37 ° C.
- the samples are then separated in a 15% native polyacrylamide gel in TBE buffer at 120 volts for about 90 minutes.
- the detection of labeled DNA and the quantification of products are done using the Odyssey scanner.
- Fluorescence spectroscopy was used to study the interaction of the Rad51 protein with DNA, as well as circular dichroism techniques that provide information on the secondary structures of DNAs and proteins. Both of these techniques use a phenomenon of absorption of light.
- CD spectra of aptamers 100 ⁇ M nucleotides) or Rad51 (0.5 and 1 ⁇ M) were determined using a four-sided 0.2 x 1 cm quartz dish (Hellma) in a J-810 spectrometer (Jasco) with parameters: slot width: 2 nm; response time: 0.125 sec; measurement interval: 0.1 s; and 2 measurement accumulations.
- Spectra were measured in final 150 ⁇ L in buffer containing 20 mM Tris-HCl pH 7.5; 2 mM MgCl 2 , 30 mM KCl. The buffer has was filtered on nitrocellulose and degassed. The spectra were taken at 20 ° C., unless otherwise indicated.
- This in silico analysis consists in comparing all the sequences 2 to 2, which made it possible to construct a "matrix of distance" representative of their respective homology.
- this matrix where each row / column represents a sequence, the closer two nucleotide sequences are, the smaller the distance between them. Conversely, the more distant two sequences are, the greater the distance that separates them.
- This distance matrix can be represented as a hierarchical tree.
- the inventors' approach was then to isolate the similar sequences for a given threshold.
- the threshold set for this analysis allowed us to identify 6 clusters of DNA sequences.
- the sequence distribution is represented using an analysis of the principal component data (PCA) Jackson, (9). To do this, we search for the representation axes (i.e.
- Each point cloud will then be considered representative of a cluster.
- a detailed cluster analysis shows that the clusters farthest from the center of the representation (i.e. barycenter of the data) contain the most divergent sequences (i.e.vahance the highest compared to the average of the other sequences).
- Each sequence obtained is associated with a given cluster.
- the aptamers retained for the following are indicated in each cluster (A7, A13, A30, A45, A47, A48, A77, A79 and A90).
- Strand exchange activity assays of Rad51 were performed to evaluate the effect of the inhibitors of the invention.
- the protocol of Takizawa et al. (4) was used. Briefly, the Rad51 protein is incubated with a single-stranded substrate DNA of 58 nucleotides (nt). The reaction is initiated by the addition of a 32 bp double-stranded DNA labeled with a fluorophore (IRDye ⁇ OO), which has a strand homologous to the sequence of 58 nt. When there is a strand exchange activity, the appearance of a single-stranded DNA band of 32 nt is observed.
- nucleotide concentration molar concentration x number of nucleotides of the entire sequence
- concentrations are shown in Table 2 below. The size of each aptamer is indicated. The molar concentrations (nM) and nucleotide equivalent (5 ⁇ M) used for the study of strand exchange activity are presented.
- the Rad51 protein is incubated with substrate single-stranded DNA in the presence or absence of aptamers. Then, the appearance of the ssDNA band of the reaction is detected and quantified.
- FIGS. 1A and 1B The results are given in FIGS. 1A and 1B:
- A The inhibition of the Rad51 recombinase activity (0.5 ⁇ M) by the selected aptamers (5 ⁇ M nucleotides) was detected by separating the products on a polyacrylamide gel under native conditions. Double-stranded DNA control (dsDNA) and control activity in the absence of an aptamer are also shown.
- B The gels were scanned and the interest bands quantified with the Odyssey software (LI-COR). Quantification of 3 Independent experiments is presented after normalization versus control.
- the strand exchange activity leads to the appearance of a single-stranded DNA (ssDNA) band (well 2, control activity). This strand exchange activity will be considered as a reference activity (equal to 1 in FIG. 1B).
- the activity is then evaluated in the presence of the different aptamers (wells 3 to 11).
- the strand exchange activity (or recombinase activity) is decreased by a factor close to 4.
- NRD-labeled aptamers are incubated with increasing concentrations of Rad51 and resolved on an agarose gel. The gel is scanned and the bands quantified.
- the results show that the apparent Kd is 40 ⁇ 6 nM for A79, 72 ⁇ 25 nM for A30, and 76 ⁇ 12 nM for A13.
- the affinity of the initial library used for selection was also evaluated and shows an apparent major Kd of 200 nM, which confirms that the aptamers selected have an increased affinity for Rad51.
- the aptamers A13 and A30 have apparent similar Kd values. These two aptamers also have similar effects on the inhibition of recombinase activity, as well as on DNA binding and on the oligomerization of Rad51. As previously described, A79 appears to modulate Rad51 in a manner other than A13 and A30.
- the aptamers A79 and A30 were fragmented to take into account the different parts of the sequence, and to maintain secondary structures.
- the structures obtained are shown in FIGS. 5A and 5B:
- the A30 aptamer 94 nucleotides (nt) was cut into 3 fragments of about 32 nt.
- the predicted secondary structures of the different fragments were also determined ( Figure 5).
- the aptamer A79 60 nt was cut into 4 fragments of sizes between 23 and 38 nt.
- the predicted secondary structures of the different fragments were also determined.
- the results are given in Figure 6:
- B The predicted secondary structures of the whole aptamer and the A79-1, A79-2, A79-3 and A79-4 fragments obtained by MFoId at 37 ° C are presented.
- aptamers form stem-loop structures known to promote the stability of single-stranded nucleic acids (DNA and RNA). This stability is also linked to the composition of bases, the pairing between guanine (G) and cytosine (C) favoring stability with respect to the pairing between adenine (A) and thymine (T), due to the number of hydrogen bonds (3 links for GC, against 2 links for A-T).
- aptamer A30 has 61% nucleotide GC and 59% A79, which contributes to the stabilization of their structure.
- aptamers were studied using circular dichroism (CD, for Circular Dichroism). The temperature induces changes in the structure of the nucleic acids.
- the spectrum of aptamers A79 and A30 has been studied at different temperatures, for wavelengths between 220 and 340 nm.
- FIG. 7 The results are given in FIG. 7: (A) CD spectra were obtained at 20 ° C. and at 80 ° C. in a TrisHCI buffer. The 2 aptamers have a positive curve at 275 nm and a negative curve at 245 nm. (B) CD curves of aptamers were measured at a constant wavelength of 275 nm. Curves as a function of temperature were obtained by raising the temperature from 20 ° C. to 80 ° C. and lowering the temperature. (C) Absorbance curves were measured at 260 nm with temperature variations as described in (B).
- the signal amplitude at these two wavelengths is maximum at 20 ° C, and decreases by about 50% when the temperature reaches 80 ° C, reflecting a loss of structure. This major effect can be explained by a lower chirality of aptamers induced by weaker pairing and stacking of bases at 80 ° C.
- CD and UV curves were obtained by increasing the temperature (from 20 ° C. to 80 ° C.) and subsequently by lowering the temperature (from 80 ° C. to 20 ° C.).
- the CD spectra show a point of inflection, which corresponds to a change in the aptamer structure, and which corresponds to the Tm (melting temperature). This can be visualized also in the UV absorbance curves.
- the Tm for aptamer A79 is 55 ° C and the Tm for A30 is 40 ° C.
- aptamers A30 and A79 show that they have 61% and 59% GC bases. This high content of GC bonds could explain the presence of secondary structures.
- A30 aptamer contains 30% G, 31% C, 18% A and 21% T.
- the aptamer A79 contains 27% G, 32% C, 25% A and 16% T.
Abstract
The invention relates to aptamers that can be obtained by the SELEX technique, wherein the selected aptamers have an inhibitory effect on Rad51 recombinase activity of at least 70%, more particularly at least 80%. Uses as Rad51 inhibitors, in particular in therapy.
Description
Aptamères inhibiteurs de l'activité de la protéine Rad51 humaine et leurs applications biologiques Aptamers inhibiting the activity of human Rad51 protein and their biological applications
L'invention a pour objet des aptamères inhibiteurs de l'activité la protéine Rad51 humaine et leurs applications biologiques. The subject of the invention is aptamers that inhibit human Rad51 protein activity and their biological applications.
La protéine Rad51 humaine (HsRad51 , désignée par Rad51 ) joue un rôle central dans la réparation des cassures double brin de l'ADN, via la recombinaison homologue. Rad51 initie la réaction de recombinaison par la formation d'un filament nucléoprotéique, grâce à l'association coopérative des monomères de Rad51 sur de l'ADN simple brin. Le complexe formé fixe un deuxième ADN double brin, afin d'échanger les brins homologues, étape qui s'accompagne de l'hydrolyse d'ATP. Cette activité est nécessaire à la survie et à la prolifération cellulaire. Cependant, son activité a un effet négatif sur les traitements anticancéreux. Elle est en effet liée à la résistance des cellules cancéreuses aux chimio- et radiothérapies. The human Rad51 protein (HsRad51, designated Rad51) plays a central role in the repair of double-strand breaks in DNA, via homologous recombination. Rad51 initiates the recombination reaction by the formation of a nucleoprotein filament, through the cooperative association of the monomers of Rad51 on single-stranded DNA. The formed complex binds a second double-stranded DNA to exchange the homologous strands, which step is accompanied by the hydrolysis of ATP. This activity is necessary for survival and cell proliferation. However, its activity has a negative effect on anticancer treatments. It is indeed related to the resistance of cancer cells to chemo- and radiotherapy.
On mesure l'intérêt de disposer de produits capables de diminuer la résistance des cellules tumorales aux traitements anticancéreux. The value of having products capable of decreasing the resistance of tumor cells to anticancer treatments is measured.
Les travaux des inventeurs dans ce domaine les ont amenés à retenir Rad51 comme cible pour le développement de nouveaux agents thérapeutiques. Rad51 chez l'homme est une protéine de 339 acides aminés de poids moléculaire de 36966 Da. Sa séquence primaire est donnée dans le document Listage des séquences et identifiée sous SEQ ID N°1. Il s'agit d'une protéine complexe comportant plusieurs domaines, dont un domaine ATPase avec les boucles L1 et L2 de liaison à l'ADN. Elle est d'une part capable de former un homopolymère et d'autre part capable d'interagir avec l'ADN. The work of the inventors in this field led them to retain Rad51 as a target for the development of new therapeutic agents. Rad51 in humans is a protein of 339 amino acids with a molecular weight of 36966 Da. Its primary sequence is given in the Sequence Listing document and identified under SEQ ID No. 1. It is a complex protein with multiple domains, including an ATPase domain with L1 and L2 DNA binding loops. It is on the one hand able to form a homopolymer and on the other hand able to interact with the DNA.
Dans leur recherche de ligands de haute affinité et spécificité vis-à-vis de In their search for ligands of high affinity and specificity with respect to
Rad51 , les inventeurs ont utilisé la méthode SELEX (Systematic Evolution of Ligands by EXponential enrichment) développée par Tuerk et GoId, (1 ) et Ellington et Szostak (2). Cette méthode permet d'isoler des séquences d'oligonucléotides de type ARN ou ADN simple brin, à partir d'une banque aléatoire d'oligonucléotides. Ces séquences ont été désignées par le terme aptamères par Ellington et Szostak, pour décrire leur propriété à interagir de façon spécifique avec d'autres molécules biologiques. Ce terme sera utilisé ci-après indifféremment avec celui d'inhibiteur pour désigner les oligonucléotides selon l'invention.
En opérant dans des conditions déterminées de sélection, les inventeurs ont ainsi isolé des aptamères qui se sont avérés correspondre à des inhibiteurs de fort potentiel sur l'activité de la protéine. Rad51, the inventors have used the SELEX method (Systematic Evolution of Ligands by EXponential enrichment) developed by Tuerk and GoId, (1) and Ellington and Szostak (2). This method makes it possible to isolate RNA or single-stranded DNA oligonucleotide sequences from a random library of oligonucleotides. These sequences have been referred to as aptamers by Ellington and Szostak to describe their property to specifically interact with other biological molecules. This term will be used hereinafter indifferently with that of inhibitor to designate the oligonucleotides according to the invention. By operating under selected conditions of selection, the inventors have thus isolated aptamers which have been found to correspond to inhibitors of high potential on the activity of the protein.
L'invention a donc pour but de fournir, en tant que nouveaux produits, des oligonucléotides ou aptamères capables notamment de moduler l'activité de Rad51 et même de l'inhiber ce qui permet notamment, d'augmenter la sensibilité des cellules cancéreuses aux traitements anticancéreux. The object of the invention is therefore to provide, as new products, oligonucleotides or aptamers capable in particular of modulating the activity of Rad51 and even of inhibiting it, which makes it possible, in particular, to increase the sensitivity of the cancer cells to the treatments. cancer.
Elle vise également des moyens pour sélectionner ces aptamères selon la méthode SELEX. It also relates to means for selecting these aptamers according to the SELEX method.
Selon encore un autre aspect, l'invention vise les applications en diagnostic et en thérapeutique de ces aptamères. According to yet another aspect, the invention is directed to diagnostic and therapeutic applications of these aptamers.
L'invention vise des aptamères susceptibles d'être obtenus par la technique SELEX, dans laquelle une banque d'ADN simple brin (ADNsb) synthétique, contenant une région centrale aléatoire entourée de régions constantes aux extrémités 5' et 3', utilisées comme sites de fixation pour les amplifications,est incubée avec une molécule cible, les ADN ayant interagi avec la cible étant seuls retenus et amplifiés pour un nouveau tour de sélection, pour enrichir la banque en séquences interagissant spécifiquement avec la protéine cible, les ADN sélectionnés étant clones et le cas échéant séquences. The invention relates to aptamers obtainable by the SELEX technique, in which a synthetic single-stranded DNA (ssDNA) library containing a random central region surrounded by constant regions at the 5 'and 3' ends, used as sites for the amplifications, is incubated with a target molecule, the DNAs having interacted with the target being alone retained and amplified for a new round of selection, to enrich the library in sequences interacting specifically with the target protein, the selected DNAs being cloned and if necessary sequences.
Conformément à l'invention, de tels aptamères sont tels qu'obtenus par un procédé caractérisé en ce que According to the invention, such aptamers are as obtained by a process characterized in that
- la molécule cible est la protéine Rad51 , cette protéine étant incubée avec une banque d'ADNsb, en présence d'un tampon de sélection renfermant MgC^ et ATP, the target molecule is the Rad51 protein, this protein being incubated with an ssDNA library, in the presence of a selection buffer containing MgCl 2 and ATP,
- le complexe ADN-Rad51 formé est séparé par électrophorèse et l'ADN retardé extrait du gel, the formed DNA-Rad51 complex is separated by electrophoresis and the delayed DNA extracted from the gel,
- à chaque tour de sélection, l'ADN sélectionné est ré-amplifié à l'aide des amorces P1 et P2, puis uniquement avec l'amorce P1 , et l'affinité relative vis- à-vis de Rad51 est évaluée, at each round of selection, the selected DNA is re-amplified using the primers P1 and P2, then only with the primer P1, and the relative affinity with respect to Rad51 is evaluated,
- l'astringence étant augmentée durant la sélection, - the astringency being increased during the selection,
- les ADNsb issus du dernier tour de sélection sont isolés, clones dans des plasmides, les plasmides étant ensuite extraits, purifiés et séquences, the ssDNAs from the last round of selection are isolated and cloned into plasmids, the plasmids then being extracted, purified and sequenced,
- les séquences sélectionnées sont regroupées sur la base de leurs similarités et de la présence de motifs consensus,
les aptamères ainsi sélectionnés présentant un effet inhibiteur de l'activité recombinase de Rad51 d'au moins 70%, plus spécialement d'au moins 80%. the selected sequences are grouped on the basis of their similarities and the presence of consensus patterns, the aptamers thus selected having an inhibitory effect on the Rad51 recombinase activity of at least 70%, more especially at least 80%.
Dans le procédé de sélection ci-dessus, les ADNsb incubés avec la cible sont marqués, par exemple avec un fluorophore IRD. Dans une autre variante, les ADNsb ne sont pas marqués. L'incubation est notamment réalisée 30 min à température ambiante. In the above selection method, the ssDNAs incubated with the target are labeled, for example with an IRD fluorophore. In another variant, the ssDNAs are not labeled. The incubation is carried out for 30 minutes at room temperature.
Des plasmides appropriés pour l'étape de clonage comprennent le plasmide pCR®-Blunt IITOPO®. Comme illustré par les exemples, ce plasmide a notamment été utilisé pour transformer les cellules E.coli TOPO10, qui ont été mises en culture. Suitable plasmids for the cloning step include plasmid pCR®-Blunt IITOPO®. As illustrated by the examples, this plasmid has in particular been used to transform E. coli TOPO10 cells, which have been cultured.
Les aptamères de l'invention sont plus spécialement caractérisés en ce qu'ils présentent un Kd apparent de l'ordre de 40 à 90 nM et comportent environ 60% de bases G-C. The aptamers of the invention are more particularly characterized in that they have an apparent Kd of the order of 40 to 90 nM and comprise about 60% G-C bases.
Des aptamères préférés répondent aux séquences SEQ ID N°2-10. Preferred aptamers correspond to the sequences SEQ ID No. 2-10.
Avantageusement, la procédure SELEX est initiée avec Rad51 à 2μM en présence de la banque d'ADNsb à 4μM dans un tampon de sélection de pH7,9 renfermant 2mM de MgC^ et 1 mM d'ATP. Tout au long de la sélection, la concentration de la banque est maintenue à 3-4 μM. Advantageously, the SELEX procedure is initiated with Rad51 at 2 μM in the presence of the 4 μM ssDNA library in a selection buffer of pH 7.9 containing 2 mM of MgCl 2 and 1 mM of ATP. Throughout the selection, the concentration of the library is maintained at 3-4 μM.
De préférence, l'astringence est augmentée durant la sélection, par exemple d'une valeur de 2 à 75. Preferably, the astringency is increased during the selection, for example from 2 to 75.
Dans ces conditions, 7 tours de sélection permettent d'obtenir environ 80 aptamères d'intérêt dont l'analyse in silico conduit à l'établissement de clusters avec des similarités de séquences. Under these conditions, 7 rounds of selection make it possible to obtain about 80 aptamers of interest whose in silico analysis leads to the establishment of clusters with similarities of sequences.
Comme le démontrent les résultats donnés dans les exemples, les aptamères de l'invention se liant à Rad51 avec une haute affinité, de l'ordre du nM et inhibent avec une grande efficacité la réaction d'échanges de brins de l'ADN de Rad51 , agissant ainsi sur l'activité de la protéine et non sur son expression. As demonstrated by the results given in the examples, the aptamers of the invention bind to Rad51 with a high affinity of the order of 1 nM and very efficiently inhibit the exchange reaction of strands of Rad51 DNA. , thus acting on the activity of the protein and not on its expression.
L'utilisation de ces aptamères permet ainsi de manière avantageuse de moduler l'activité de Rad51. The use of these aptamers thus advantageously makes it possible to modulate the activity of Rad51.
Ces aptamères sont de petites molécules et peuvent donc entrer facilement dans les tissus. Ils peuvent être obtenus et modifiés aisément, par synthèse et de manière générale sont non ou faiblement immunogènes. These aptamers are small molecules and can therefore easily enter the tissues. They can be obtained and modified easily, synthetically and generally are not or weakly immunogenic.
L'invention vise ainsi l'utilisation des aptamères définis ci-dessus en tant qu'agents thérapeutiques.
Elle vise en particulier des compositions pharmaceutiques, caractérisées en ce qu'elles renferment une quantité thérapeutiquement efficace d'au moins un aptamère tel que défini ci-dessus, en association avec un véhicule pharmaceutiquement inerte. The invention thus aims at the use of the aptamers defined above as therapeutic agents. It relates in particular to pharmaceutical compositions, characterized in that they contain a therapeutically effective amount of at least one aptamer as defined above, in combination with a pharmaceutically inert vehicle.
Ces compositions sont avantageusement utilisées dans le cadre de traitements anticancéreux. These compositions are advantageously used in the context of anticancer treatments.
Ces compositions pharmaceutiques sont caractérisées en ce qu'elles se présentent sous une forme destinée à une administration par voie orale, injectable ou parentérale.. These pharmaceutical compositions are characterized in that they are in a form intended for oral, injectable or parenteral administration.
Les doses d'administration seront aisément choisies par le praticien en fonction de l'âge et de l'état du patient. The doses of administration will be easily chosen by the practitioner depending on the age and condition of the patient.
D'autres caractéristiques et avantages de l'invention sont donnés dans les exemples qui suivent dans lesquels il est fait référence aux figures 1 à 8. Other characteristics and advantages of the invention are given in the following examples in which reference is made to FIGS. 1 to 8.
Ces figures présentent respectivement: These figures present respectively:
- Figure 1 : l'effet des aptamères de l'invention sur l'activité recombinase de FIG. 1: the effect of the aptamers of the invention on the recombinase activity of
Rad51 Rad51
- Figure 2 : les structures secondaires d'aptamères de l'invention FIG. 2: secondary aptamer structures of the invention
Figure 3: l'affinité d'aptamères de l'invention pour Rad51 Figure 3: aptamer affinity of the invention for Rad51
- Figure 4: la spécificité d'aptamères sélectionnés selon l'invention FIG. 4: the specificity of selected aptamers according to the invention
- Figures 5 et 6: les structures secondaires obtenues par MFoId pour des aptamères de l'invention et des fragments de ce dernier FIGS. 5 and 6: the secondary structures obtained by MFoId for aptamers of the invention and fragments thereof
- Figure 7: l'étude structurale par CD et UV d'aptamères de l'invention, FIG. 7: the structural study by CD and UV of aptamers of the invention,
- Figure 8 : l'analyse en composante principale des données obtenues par SELEX. - Figure 8: the main component analysis of the data obtained by SELEX.
Matériels et Méthodes Materials and methods
1 - Marqueurs de taille moléculaire 1 - Molecular size markers
Marqueurs d'ADN DNA markers
-SmartLadder (Eurogentec) : Le volume standard utilisé est 5 μL. La solution contient 14 fragments de 200 à 10000 paires de bases (pb) (200, 400, 600, 800, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 8000 et 10000 pb). -SmartLadder (Eurogentec): The standard volume used is 5 μL. The solution contains 14 fragments of 200 to 10,000 base pairs (bp) (200, 400, 600, 800, 1000, 1500, 2000, 2500, 3000, 4000, 5000, 6000, 8000 and 10000 bp).
-Low Molecular Weight DNA Ladder (BioLabs) : Le volume utilisé est 1 μL. La solution contient 11 fragments de 25 à 766 paires de bases (pb) (25, 50, 75, 100, 150, 200, 250, 300, 350, 500, 766 pb). -Low Molecular Weight DNA Ladder (BioLabs): The volume used is 1 μL. The solution contains 11 fragments of 25 to 766 base pairs (bp) (25, 50, 75, 100, 150, 200, 250, 300, 350, 500, 766 bp).
Marqueurs de protéine
Le marqueur « Précision Plus ProteinTM Standards prestained Broad Range »Protein markers Precision Plus ProteinTM Standards marker prestained Broad Range
(Bio-Rad) contient 8 protéines de masse molaires comprises entre 6,5 et 210 kDa.(Bio-Rad) contains 8 molecular weight proteins between 6.5 and 210 kDa.
Aprotinin 6,5 ; Lysozyme 14,4 ; Trypsin inhibitor 21 ,5 ; Carbonic Anhydrase 31 ;Aprotinin 6.5; Lysozyme 14.4; Trypsin inhibitor 21.5; Carbonic Anhydrase 31;
Ovalbumin 45 ; Sérum Albumin (BSA) 66,2 ; Galactosidase 116,3 et Myosin 200 kDa. Le volume utilisé est de 4 μl_. Ovalbumin 45; Albumin serum (BSA) 66.2; Galactosidase 116.3 and Myosin 200 kDa. The volume used is 4 μl_.
2 - Peptides et oligonucléotides 2 - Peptides and oligonucleotides
Le peptide correspondant à la boucle L1 de Rad51 biotinylée en N-terminal The peptide corresponding to the L1 loop of N-terminal biotinylated Rad51
(biot-U ), biot-RTDYSGRGELSAR, a été synthétisé. (biot-U), biot-RTDYSGRGELSAR, has been synthesized.
Les oligonucléotides ont été synthétisés. Ils présentent les séquences SEQ ID Oligonucleotides were synthesized. They present the sequences SEQ ID
N°11 -16 ci-dessous: No. 11-16 below:
SEQ ID N°11 : (P1 ) : δ'-TAGGGAATTCGTCGACGGATCC-S' SEQ ID NO: 11: (P1): δ'-TAGGGAATTCGTCGACGGATCC-S '
SEQ ID N°12 :(P2): 5'- CGG CGC ATG CGT CGA CCT GGA G-3' SEQ ID NO: 12: (P2): 5'-CGG CGC ATG CGT CGA CCT GGA G-3 '
SEQ ID N°13 (Rec58) : 5'- TCC TTT TGA TAA GAG GTC ATT TTT GCG GAT GGC TTA GAG CTT AAT TGC TGA ATC TGG T- 3' SEQ ID NO: 13 (Rec58): 5'-TCC TTT TGA TAA GAG GTC ATT TTT GCG GAT GGC TTA GAG CTT AAT TGC TGA ATC TGG T- 3 '
SEQ ID N°14 (Rec32( : 5'- CCA TCC GCA AAA ATG ACC TCT TAT CAA AAG GA- SEQ ID NO: 14 (Rec32 (: 5'-CCA TCC GCA AAA ATG ACC TCT TAT CAA AAG GA-
3' 3 '
SEQ ID N°15 (IRD-Rec32) : 5'- TCC TTT TGA TAA GAG GTC ATT TTT GCG GAT SEQ ID No. 15 (IRD-Rec32): 5'-TCC TTT TGA TAA GAG GTC ATT TTT GCG GAT
GG- 3' (marqué au fluorophore IRDye en 5') GG-3 '(labeled with 5' IRDye fluorophore)
SEQ ID N°16 (Banque d'ADNsb) : 5'- TAGGGAATTCGTCGACGGATCC-(N)50-SEQ ID NO: 16 (ssDNA library): 5'-TAGGGAATTCGTCGACGGATCC- (N) 50 -
CTCCAGGTCGACGCA TGCGCCG- 3' (3) CTCCAGGTCGACGCA TGCGCCG- 3 '(3)
3 - Production et purification de Rad51 3 - Production and purification of Rad51
Production Production
Transformation de cellules par choc thermique Cell transformation by thermal shock
Les bactéries compétentes E.coli JM109 (DE3) sont décongelées à 4°C. 100 μL de la solution sont additionnés à 1 -50 ng du vecteur pET15b-HsRad51 et incubés dans la glace pendant 30 min. Le choc thermique est réalisé à 42°C pendant 45 secondes, suivi d'une incubation de 10 minutes dans la glace. Puis, 900 μL de milieu LB préchauffé sont additionnés et le milieu est incubé pendant 60 min à 37°C sous agitation. La solution est par la suite centrifugée à 13000 rpm pendant 5 min. Le culot est repris dans 50 μL du milieu LB et étalé sur boite de LB agar qui contient de l'ampicilline (100 μg/mL) et du chloramphénicol (30 μg/mL), et incubé 16 heures à 37°C.
Culture bactérienne The competent bacteria E.coli JM109 (DE3) are thawed at 4 ° C. 100 μl of the solution are added to 1 -50 ng of the vector pET15b-HsRad51 and incubated in ice for 30 min. The heat shock is performed at 42 ° C for 45 seconds, followed by a 10-minute incubation in ice. Then, 900 μl of prewarmed LB medium are added and the medium is incubated for 60 min at 37 ° C. with stirring. The solution is then centrifuged at 13000 rpm for 5 min. The pellet is taken up in 50 μl of LB medium and spread on a box of LB agar which contains ampicillin (100 μg / ml) and chloramphenicol (30 μg / ml), and incubated for 16 hours at 37 ° C. Bacterial culture
La culture se réalise dans 1 L de milieu LB contenant 1 mL d'ampicilline 100 mg/mL et 30 mg/mL de chloramphénicol avec la totalité du tapis bactérien provenant de la boite LB agar. The culture is carried out in 1 L of LB medium containing 1 mL of ampicillin 100 mg / mL and 30 mg / mL of chloramphenicol with all of the bacterial carpet from the LB agar plate.
La culture est réalisée sous agitation à 300C jusqu'à une DO à 600 nm de 0,6.The culture is carried out with stirring at 30 0 C until an OD at 600 nm of 0.6.
Une induction par NPTG 1 mM est réalisée pendant 18 h. La culture est centrifugée à 4°C pendant 30 min à 4100 rpm et le culot cellulaire est conservé à -200C. Induction with 1 mM NPTG is carried out for 18 h. The culture is centrifuged at 4 ° C. for 30 min at 4100 rpm and the cell pellet is stored at -20 ° C.
Purification de Rad51 Purification of Rad51
Purification sur colonne Ni-NTA Purification on Ni-NTA column
La protéine Rad51 contient dans sa partie C-terminal une étiquette polyhistidine (6- His), ce qui permet sa purification par chromatographie d'affinité sur colonne de nickel immobilisé. The Rad51 protein contains in its C-terminal part a polyhistidine label (6-His), which allows it to be purified by affinity chromatography on an immobilized nickel column.
Ce système est basé sur la forte sélectivité et affinité qui possède l'étiquette histidine pour la matrice Ni2+-NTA (acide nitriloacétique) (Qiagen). This system is based on the high selectivity and affinity that has the histidine label for the Ni2 + -NTA (nitriloacetic acid) matrix (Qiagen).
Le culot bactérien provenant de 2 L de culture est suspendu dans le tampon A The bacterial pellet from 2 L of culture is suspended in buffer A
(TrisHCI 50 mM pH 8,0, NaCI 500 mM, imidazole 5 mM, glycérol 10% et .β.- mercaptoéthanol 5 mM). (50 mM TrisHCI pH 8.0, 500 mM NaCl, 5 mM imidazole, 10% glycerol and 5 mM β-mercaptoethanol).
Cette suspension est soumise à une sonication à 4°C (3 x 1 '45 à 70%). La solution obtenue est centrifugée à 15000 rpm et 4°C pendant 25 min. Le surnageant obtenu est mélangé à 1 mL de résine Ni-NTA, qui a été préalablement lavée avec du tampon A, puis incubé pendant 60 min sous agitation à 4°C. La protéine est ensuite éluée par un gradient en imidazole (60 mM à 250 mM). Les différentes fractions contenant Rad51 sont rassemblées puis les concentrations de protéines sont estimées par la méthode de Bradford (8), en utilisant l'albumine sérum bovine (BSA) comme standard. This suspension is sonicated at 4 ° C (3 x 45-70%). The solution obtained is centrifuged at 15,000 rpm and 4 ° C for 25 min. The supernatant obtained is mixed with 1 ml of Ni-NTA resin, which has been washed beforehand with buffer A, and then incubated for 60 min with stirring at 4 ° C. The protein is then eluted with an imidazole gradient (60 mM to 250 mM). The different fractions containing Rad51 are pooled and the protein concentrations are estimated by the Bradford method (8), using bovine serum albumin (BSA) as standard.
Afin d'éliminer l'étiquette histidine, les fractions contenant la protéine sont traitées avec de la protéase thrombine (Amersham Biosciences), 1 ,5 U/ 1 mg de In order to eliminate the histidine tag, the fractions containing the protein are treated with thrombin protease (Amersham Biosciences), 1.5 U / 1 mg of
Rad51. Une dialyse est également réalisée contre 1 L de tampon (20 mM Tris HCI pH 8,0 ; 200 mM KCI ; 0,25 EDTA ; 2 mM ..-mercaptoéthanol) pendant 16-20 h, à 4°C sous agitation. Rad51. Dialysis is also performed against 1 L buffer (20 mM Tris HCl pH 8.0, 200 mM KCl, 0.25 EDTA, 2 mM mercaptoethanol) for 16-20 h at 4 ° C with shaking.
Purification sur colonne échangeuse d'anions Purification on anion exchange column
Suite à la dialyse l'échantillon est centrifugé 10 min à 4100 rpm et le surnageant ajouté à la colonne MonoQ (Healthcare Biosciences), et les échantillons récupérés sont soumises à une dernière dialyse en tampon (20 mM TrisHCI pH 8 ;
200 mM KCI ; 0,25 mM EDTA ; 5 mM DTT ; 20% glycérol) pendant 3 h à 4°C. La concentration protéique des différentes fractions est déterminée par la méthode de Bradford. Following dialysis the sample is centrifuged for 10 min at 4100 rpm and the supernatant added to the MonoQ column (Healthcare Biosciences), and the recovered samples are subjected to a final dialysis buffer (20 mM TrisHCI pH 8; 200 mM KCI; 0.25 mM EDTA; 5 mM DTT; 20% glycerol) for 3 h at 4 ° C. The protein concentration of the different fractions is determined by the Bradford method.
Dosage des protéines par la méthode de Bradford Protein assay by the Bradford method
Le dosage des protéines a été réalisé par la méthode de Bradford. A 800 μL de la solution contenant la protéine, 200 μL de réactif Bio-Rad sont ajoutés. Après 15 min d'incubation à température ambiante, l'absorbance est lue à 595 nm. La concentration en protéines est déterminée en référence à une gamme étalon de sérum albumine bovine (2 à 20 μg/mL). The protein assay was performed by the Bradford method. At 800 μL of the solution containing the protein, 200 μL of Bio-Rad reagent are added. After 15 min of incubation at room temperature, the absorbance is read at 595 nm. The protein concentration is determined by reference to a standard range of bovine serum albumin (2 to 20 μg / ml).
Analyse de la protéine sur SDS-PAGE Protein analysis on SDS-PAGE
Afin de visualiser les différentes étapes de purification, un échantillon est prélevé à chaque étape, additionné de tampon de charge en conditions dénaturantes, et dénaturé 5 min à 1000C. In order to visualize the different purification steps, a sample is taken at each step, added with loading buffer under denaturing conditions, and denatured for 5 min at 100 ° C.
Les échantillons sont analysés par électrophorèse en conditions dénaturantes, dans un gel constitué d'une partie supérieure concentratrice et d'une partie inférieure séparatrice. La migration s'effectue à 120 volts. Le gel est ensuite soumis à la coloration de blue de Coomasie pour mettre en évidence les protéines. La présence et la pureté de la protéine sont déterminées par comparaison à un kit de marqueurs (6,5 à 200 kDa, Bio-Rad). The samples are analyzed by electrophoresis under denaturing conditions, in a gel consisting of a concentrating upper part and a lower separating part. The migration is at 120 volts. The gel is then stained with Coomasie blue to demonstrate protein. The presence and purity of the protein are determined by comparison with a marker kit (6.5-200 kDa, Bio-Rad).
4- Immunodétection de protéines transférées (western blot) 4- Immunodetection of transferred proteins (western blot)
Les protéines présentes dans les échantillons sont préalablement résolues par SDS-PAGE puis transférées sur une membrane de nitrocellulose (Hybond TM ECLTM, Amersham Biosciences) dans un tampon de transfert (25 mM Tris base, 192 mM glycine, 20% éthanol) pendant 16 h à 4°C et 90 mA. La membrane est bloquée avec une solution de TTBS (10 mM Tris-HCI pH 7,4 ; 150 mM NaCI, 1 % Tween 20) avec 5% BSA pendant 1 h à TA. Pour détecter la protéine Rad51 , la membrane est tout d'abord incubée avec un anticorps monoclonal de souris anti- Rad51 (Rad51 Ab- 1 (NeoMarkers) clone 51 Rad01 ) dilué au 1/10.000 dans le tampon TTBS additionnée de 1 % BSA, pendant 1 h à température ambiante. The proteins present in the samples are previously resolved by SDS-PAGE and then transferred to a nitrocellulose membrane (Hybond TM ECL ™, Amersham Biosciences) in transfer buffer (25 mM Tris base, 192 mM glycine, 20% ethanol) for 16 hours. at 4 ° C and 90 mA. The membrane is blocked with a solution of TTBS (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% Tween 20) with 5% BSA for 1 hour at RT. To detect the Rad51 protein, the membrane is first incubated with an anti-Rad51 mouse monoclonal antibody (Rad51 Ab-1 (NeoMarkers) clone 51 Rad01) diluted 1: 10,000 in TTBS buffer supplemented with 1% BSA, for 1 h at room temperature.
Après l'incubation, 3 lavages de 5 min sont effectués avec du TTBS. La membrane est alors incubée pendant 45 min avec un deuxième anticorps, anti-souris marqué avec Alexa-Fluor 700 (Molecular Probes) dilué au 1/10000 en TTBS. A partir de cette étape la membrane est protégée de la lumière. Des lavages successifs sont réalisés dans du tampon TTBS pendant 45 min au totale. La détection de la protéine
est réalisée en scannant la membrane à l'aide d'un scanner Odyssey (Infrared Imaging System, LI-COR Biosciences), qui détecte la fluorescence du fluorophore IRDye 700. Le marqueur de masse molaire est également détecté. After the incubation, 3 washes of 5 min are carried out with TTBS. The membrane is then incubated for 45 minutes with a second antibody, anti-mouse labeled with Alexa-Fluor 700 (Molecular Probes) diluted 1/10000 in TTBS. From this stage the membrane is protected from light. Successive washes are performed in TTBS buffer for 45 min in total. Detection of the protein is performed by scanning the membrane using an Odyssey (Infrared Imaging System, LI-COR Biosciences) scanner, which detects the fluorescence of the IRDye 700 fluorophore. The molar mass marker is also detected.
5 - SELEX 5 - SELEX
Afin d'amplifier la banque utilisée pour les différents tours de sélection, deux différents types de PCR ont été utilisées : une PCR dite classique avec les amorces P1 et P2, qui vont produire des ADN double brin. Ainsi qu'une PCR asymétrique avec seulement P1 , qui permet d'obtenir des ADN simple brin. In order to amplify the library used for the different rounds of selection, two different types of PCR were used: a so-called conventional PCR with primers P1 and P2, which will produce double-stranded DNAs. As well as an asymmetric PCR with only P1, which makes it possible to obtain single-stranded DNAs.
PCR classique Classical PCR
L'amplification d'ADN simple brin, a été réalisée avec les amorces P1 et P2 1 à 1 μM, dans un tampon Tris-HCI pH 8,8, 75 m M, 10 mM de KCI, 20 mM de BSA, 0,01 % de Tween 20, 0,05% de nonidet P40 en présence de 200 ng d'ADN simple brin, 0,4 mM de dNTPs, 3 mM de MgC^, et 2,5 U de l'enzyme Taq DNA Polymérase (Invitrogen) pour un volume final de 50 μL. Une dénaturation de 5 min à 94°C est effectuée pour la séparation initiale des brins de l'ADN, suivie de 30 cycles comprenant successivement une étape de dénaturation de 1 min à 94°C, une étape d'accrochage des amorces de 20 sec à 56°C et d'une étape d'extension de 30 sec à 72°C, suivi d'une extension finale de 5 min. The amplification of single-stranded DNA was carried out with primers P1 and P2 1 at 1 μM, in Tris-HCl buffer pH 8.8, 75 mM, 10 mM KCl, 20 mM BSA, 0, 01% Tween 20, 0.05% nonidet P40 in the presence of 200 ng single stranded DNA, 0.4 mM dNTPs, 3 mM MgCl 2, and 2.5 U of the Taq DNA polymerase enzyme ( Invitrogen) for a final volume of 50 μL. A denaturation of 5 min at 94 ° C. is carried out for the initial separation of the strands of the DNA, followed by 30 cycles successively comprising a denaturation step of 1 min at 94 ° C., a primer attachment step of 20 sec. at 56 ° C and an extension step of 30 sec at 72 ° C, followed by a final extension of 5 min.
PCR asymétrique Asymmetric PCR
Pour l'obtention des ADN simple brin, une amplification a été réalisée dans le même milieu que celui décrit ci-dessus, mais en utilisant comme matrice un aliquote d'ADN double brin (5 ng) obtenu par la PCR classique, et qui a été purifié préalablement à l'aide du kit MinElute (Qiagen). Pour la procédure de sélection la PCR asymétrique a été réalisée avec l'amorce P1. Pour le marquage des ADN on utilise la même amorce mais marquée avec le fluorophore IRDyeδOO. Le programme de PCR est le même que pour la PCR classique, seul le nombre de cycles a été diminué à 25 à la fin de sélection. To obtain the single-stranded DNAs, an amplification was carried out in the same medium as that described above, but using as matrix an aliquot of double-stranded DNA (5 ng) obtained by the conventional PCR, and which previously purified using the MinElute Kit (Qiagen). For the selection procedure the asymmetric PCR was carried out with the primer P1. For the labeling of the DNAs, the same primer is used but labeled with the IRDyeδOO fluorophore. The PCR program is the same as for conventional PCR, only the number of cycles was decreased to 25 at the end of selection.
Purification à partir de produits PCR Purification from PCR products
La purification de l'ADN obtenu par PCR (classique ou asymétrique) est réalisé avec le "MinElute® PCR Purification Kit" (Qiagen) et en utilisant le protocole préconisé dans ce kit. The purification of the DNA obtained by PCR (classical or asymmetric) is carried out with the "MinElute® PCR Purification Kit" (Qiagen) and using the protocol recommended in this kit.
Extraction et purification d'ADN à partir du gel
Afin de récupérer l'ADN provenant de complexes ADN-RAD51 dans un gel d'agarose ou de polyacrylamide, le complexe est excisé du gel et ensuite purifié avec le kit QIAEX II (Qiagen), selon les instructions du fournisseur. Extraction and purification of DNA from the gel In order to recover the DNA from RAD51-DNA complexes in an agarose or polyacrylamide gel, the complex is excised from the gel and then purified with the QIAEX II kit (Qiagen) according to the supplier's instructions.
Quantification des ADN Quantification of DNA
La quantification des ADN purifiés se fait par mesure de l'absorbance à 260 nm avec un biophotomètre (Eppendorf). Une absorbance égale à 1 correspond à une concentration d'ADN simple brin de 40 μg/cm3 ou d'ADN double brin de 50 μg/cm3. Quantification of the purified DNAs is by measuring the absorbance at 260 nm with a biophotometer (Eppendorf). An absorbance equal to 1 corresponds to a concentration of single-stranded DNA of 40 μg / cm3 or double-stranded DNA of 50 μg / cm3.
- SELEX contre le peptide L1 - SELEX against L1 peptide
Pour effectuer la sélection des aptamères contre le peptide L1 , un système avidine- biotine a été utilisé, qui permet d'isoler les complexes « ADNsb- peptide L1 biotinylé ». To select for aptamers against the L1 peptide, an avidin-biotin system was used, which makes it possible to isolate the "biotinylated Ls-peptide-L1" complexes.
Avant chaque cycle de sélection la banque d'ADNsb est dénaturée à 900C pendant 5 min, puis refroidie rapidement dans la glace, suivie de 15 min à température ambiante. Afin d'éviter de sélectionner des ADNsb qui aurait pu interagir avec l'avidine, une contre-sélection a été réalisée systématiquement avant chaque tour. Celle-ci consiste à incuber la banque d'ADNsb (1 μM) avec la résine avidine (80 μl_) dans le tampon de sélection A (10 mM Tris-HCI pH 7,9; 30 mM KCI, 100 mM NaCI) pendant 15 min à 37°C dans un volume total de 250 μL. La solution contenant la résine est déposée dans une colonne. Les ADN non retenus sont utilisés pour effectuer un tour de sélection avec le peptide L1 biotinylé. La solution contenant la banque d'ADN (1 μM) est incubée avec le peptide biot-L1 (10 μM au premier tour, et 0,2 μM au cinquième tour, Tableau III.1 chapitre III) pendant 15 min à 37°C. L'incubation se poursuit en présence de 600 μL de résine avidine pendant 15 min, puis la solution est déposée dans une colonne. Suite aux lavages, les complexes «biot-L1/ ADNsb » sont élues en 8 fractions de 300 μL avec un tampon PBS renfermant 2 mM biotine. L'absorbance des fractions est mesurée à 280 nm pour repérer les fractions les plus concentrées. L'ADN est extrait des fractions enrichies en complexes Rad51 -ADNsb par une extraction au phénol- chloroforme. Before each round of selection, the ssDNA library is denatured at 90 ° C. for 5 min, then rapidly cooled in ice, followed by 15 min at room temperature. In order to avoid selecting ssDNAs that could have interacted with avidin, a cross-selection was performed systematically before each round. This consists in incubating the ssDNA library (1 μM) with the avidin resin (80 μl) in the selection buffer A (10 mM Tris-HCl pH 7.9, 30 mM KCl, 100 mM NaCl) for 15 minutes. min at 37 ° C in a total volume of 250 μL. The solution containing the resin is deposited in a column. Unretained DNAs are used to perform a round of selection with the biotinylated L1 peptide. The solution containing the DNA library (1 μM) is incubated with the biot-L1 peptide (10 μM in the first round, and 0.2 μM in the fifth round, Table III.1 Chapter III) for 15 min at 37 ° C. . The incubation is continued in the presence of 600 .mu.l of avidin resin for 15 min, then the solution is deposited in a column. Following the washes, the "biot-L1 / ssDNA" complexes are eluted in 8 fractions of 300 μl with a PBS buffer containing 2 mM biotin. The absorbance of the fractions is measured at 280 nm to identify the most concentrated fractions. The DNA is extracted from the fractions enriched in Rad51 -DNAsb complexes by phenol-chloroform extraction.
La phase aqueuse est récupérée par centrifugation (5 min à 4000 rpm), traité à l'éthanol et l'ADN précipité. L'ADNsb obtenu est amplifié comme décrit précédemment. Ces derniers peuvent être utilisés pour un nouveau tour de sélection. Extraction phénol-chloroforme The aqueous phase is recovered by centrifugation (5 min at 4000 rpm), treated with ethanol and the precipitated DNA. The ssDNA obtained is amplified as previously described. These can be used for a new selection round. Phenol-chloroform extraction
A un volume déterminé de solution contenant l'ADN, le même volume de solution phénol-chloroforme est ajouté, et mélangé vigoureusement. Les phases
aqueuses et organiques sont séparées après centrifugation à 6000 rpm pendant 7 min. La phase aqueuse est récupérée. At a determined volume of solution containing the DNA, the same volume of phenol-chloroform solution is added, and mixed vigorously. The phases aqueous and organic are separated after centrifugation at 6000 rpm for 7 min. The aqueous phase is recovered.
Précipitation à l'éthanol Precipitation with ethanol
La solution aqueuse contenant l'ADN est ajustée en concentration de cations en ajustant à 0,3 M d'acétate de sodium, et le volume finale déterminé. Deux volume de l'éthanol 100% à 200C sont ajoutés à la solution, et précipité à -200C pendant au moins 2 h. La solution est ensuite centrifugée pendant 10 min à 10 000 rpm et 4°C.The aqueous solution containing the DNA is adjusted to a concentration of cations by adjusting to 0.3 M sodium acetate, and the final volume determined. Two volumes of 100% ethanol at 20 ° C. are added to the solution and precipitated at -20 ° C. for at least 2 hours. The solution is then centrifuged for 10 min at 10,000 rpm and 4 ° C.
Le culot est séché et repris dans de l'eau stérile. The pellet is dried and taken up in sterile water.
- SELEX contre la protéine humaine Rad51 - SELEX against the human protein Rad51
La procédure SELEX est initiée avec l'ADN simple brin provenant de la banque initiale. The SELEX procedure is initiated with single-stranded DNA from the initial library.
Dès le deuxième tour de sélection, les ADNsb sont obtenus par PCR asymétrique, comme décrit précédemment. Le traitement des ADNsb a été réalisé dans les mêmes conditions que celles décrites pour le peptide L1. From the second round of selection, the ssDNAs are obtained by asymmetric PCR, as described above. The treatment of the ssDNAs was carried out under the same conditions as those described for the L1 peptide.
Les ADNsb (autour de 4 μM) sont incubées avec la protéine Rad51 (2 μM au The ssDNAs (around 4 μM) are incubated with the Rad51 protein (2 μM
1 er tour et 0,05 μM au 7ème tour, tableau III.2, chapitre III) dans le tampon de sélection B (20 mM Tris-HCI pH 7,9 ; 2 mM MgCI2, 1 mM ATP, et KCI de 30 à 70 mM) pendant 30 min à 300C. Dans cette étude la séparation des ADNsb liées et libres est réalisée par gel de retard (gel d'agarose 1 % ou de polyacrylamide en conditions natives pour les 2 derniers tours), le complexe ADNRad51 est excisé et récupéré à partir du gel. Les ADNsb sont amplifiés par PCR, comme décrit précédemment. 1st round and 0.05 μM in the 7th round, Table III.2, Chapter III) in the selection buffer B (20 mM Tris-HCl pH 7.9, 2 mM MgCl 2 , 1 mM ATP, and KCI 30 at 70 mM) for 30 min at 30 ° C. In this study the separation of the bound and free ssDNAs is carried out by delay gel (1% agarose gel or polyacrylamide in native conditions for the last 2 laps), the complex ADNRad51 is excised and recovered from the gel. The ssDNAs are amplified by PCR as previously described.
Après sept tours de sélection les ADN simples brins obtenus sont amplifiés par PCR avec les amorces P1 et P2, clones, puis séquences. After seven rounds of selection, the single-stranded DNAs obtained are amplified by PCR with primers P1 and P2, cloned, and then sequenced.
Clonage des séquences sélectionnées Cloning of selected sequences
Les fragments d'ADN double brin nécessaires au clonage ont été obtenus par The double-stranded DNA fragments required for cloning were obtained by
PCR classique en utilisant comme matrice 200 ng d'ADN simple brin (provenant du dernier tour de sélection), 0,4 mM de dNTPs, 3 mM de MgCI2, 1 μM des amorces P1 et P2 et 2,5 U de l'enzyme Pfu DNA polymérase haute fidélité (Promega) dans un volume final de 50 μL. Classical PCR using as template 200 ng of single-stranded DNA (from the last round of selection), 0.4 mM dNTPs, 3 mM MgCl 2 , 1 μM primers P1 and P2 and 2.5 U of the high-fidelity Pfu DNA polymerase enzyme (Promega) in a final volume of 50 μL.
L'ADN purifié à l'aide du kit MinElute kit (Qiagen) a été quantifié par absorbance à 260 nm. Par la suite, 160 ng d'ADN ont été mis en présence de 10 ng du plasmide pCR®-Blunt IITOPO® (Kit Zéro Blunt®TOPO®PCR Cloning, Qiagen)
(Figure 11.1 ), dans un tampon comprenant 50 mM Tris HCI pH 7,4 ; 1 mM EDTA, 2 mM DTT, 0,1 % Triton X-100, 100 μg/mL de BSA et 50% de glycérol. DNA purified using the MinElute kit kit (Qiagen) was quantified by absorbance at 260 nm. Subsequently, 160 ng of DNA were placed in the presence of 10 ng of the pCR®-Blunt IITOPO® plasmid (Zero Blunt®TOPO®PCR Cloning Kit, Qiagen). (Figure 11.1), in a buffer comprising 50 mM Tris HCl pH 7.4; 1 mM EDTA, 2 mM DTT, 0.1% Triton X-100, 100 μg / ml BSA and 50% glycerol.
Pour la transformation, 6 μl_ du milieu de clonage sont mélangés avec la souche chimiquement compétente E.coli TOPO10, selon le protocole fourni par le fabricant. Le vecteur pCR®-Blunt II-TOPO® permet une sélection directe des recombinants via l'interruption du gène létal ccdB ύ'E.coli. Dans le vecteur, le gène ccdB a été fusionné à l'extrémité 5' de la séquence du gène LacZα, codant pour l'extrémité C-terminale du fragment protéique LacZα La ligation d'un produit de PCR franc, obtenu à l'aide de l'enzyme Pfu DNA Polymerase (Promega), interrompt l'expression du gène de fusion LacZα- ccdB et assure, après transformation, la croissance des recombinants positifs. Les transformants sont étalés sur boites gélosée LB en présence de kanamycine 50 μg/mL et incubés dans une étuve à 37°C. Les cellules qui ne contiennent pas le vecteur ne se développent pas. Les colonies isolées sont cultivées dans un milieu liquide LB kanamycine 50 μg/mL pendant 12 h à 37°C. Les plasmides ont été purifiés avec le kit QIAprep®Spin (Qiagen) en utilisant les protocoles d'extraction préconisés par le fournisseur. Le séquençage a été réalisé avec l'amorce « M13 reverse ». For the transformation, 6 .mu.l of the cloning medium are mixed with the chemically competent E.coli TOPO10 strain, according to the protocol provided by the manufacturer. The vector pCR®-Blunt II-TOPO® allows direct selection of recombinants via the interruption of the lethal gene ccdB ύ'E.coli. In the vector, the ccdB gene was fused at the 5 'end of the LacZα gene sequence, coding for the C-terminal end of the LacZα protein fragment. The ligation of a free PCR product, obtained using of the enzyme Pfu DNA Polymerase (Promega), interrupts the expression of the LacZα-ccdB fusion gene and ensures, after transformation, the growth of the positive recombinants. The transformants are plated on LB agar plates in the presence of kanamycin 50 μg / mL and incubated in an oven at 37 ° C. Cells that do not contain the vector do not grow. The isolated colonies are cultured in a liquid LB kanamycin 50 μg / mL medium for 12 h at 37 ° C. The plasmids were purified with the QIAprep®Spin kit (Qiagen) using the extraction protocols recommended by the supplier. Sequencing was performed with the "M13 reverse" primer.
- Techniques pour l'étude de l'interaction protéine-acide nucléique - Techniques for studying the protein-nucleic acid interaction
Ge/ de retard et évaluation de l'affinité des aptamères Ge / delay and assessment of aptamer affinity
La technique de retardement sur gel permet d'étudier les interactions protéine/acide nucléique in vitro. Le principe est basé sur la différence de migration electrophorétique entre le complexe protéine-ADN et l'ADN seul (Figure II.2). Plus l'interaction est importante, plus la quantité d'ADN « ralenti » est importante. Ce retard peut être visualisé sur un gel d'agarose ou sur un gel de polyacrylamide en conditions natives. The gel retardation technique makes it possible to study the protein / nucleic acid interactions in vitro. The principle is based on the difference in electrophoretic migration between the protein-DNA complex and the DNA alone (Figure II.2). The greater the interaction, the more "slowed down" DNA is important. This delay can be visualized on an agarose gel or on a polyacrylamide gel under native conditions.
Les ADN marqués à l'IRDyeδOO ont été obtenus par PCR en utilisant l'amorce P1 marqué avec ce fluorophore. Les complexes « protéine-ADN marqués » sont formés dans un milieu réactionnel final de 10 μL. Une quantité fixe d'ADN (aptamère) est incubée avec des concentrations croissantes de protéine Rad51 , dans le tampon de sélection B (20 mM Tris- HCI pH 7,9 ; 2 mM MgCI2, 30 mM KCI, 1 mM ATP) additionné de 5 mM DTT et 0,5% Tween, pendant 30 min à 37°C. DNA labeled with IRDyeδOO were obtained by PCR using the P1 primer labeled with this fluorophore. "Labeled protein-DNA" complexes are formed in a final reaction medium of 10 μl. A fixed amount of DNA (aptamer) is incubated with increasing concentrations of Rad51 protein, in selection buffer B (20 mM Tris-HCl pH 7.9, 2 mM MgCl 2, 30 mM KCl, 1 mM ATP) supplemented with 5 mM DTT and 0.5% Tween, for 30 min at 37 ° C.
Les complexes sont résolus dans un gel d'agarose 1 %, ou sur un gel de polyacrylamide natif à 6%. Le gel est ensuite scanné dans un scanner Odyssey
Infrared Imaging System (LICOR Biosciences). Les bandes obtenues sont quantifiés à l'aide du logiciel Odyssey. The complexes are resolved in a 1% agarose gel, or on a 6% native polyacrylamide gel. The gel is then scanned into an Odyssey scanner Infrared Imaging System (LICOR Biosciences). The resulting bands are quantified using the Odyssey software.
Pour calculer le Kd apparent de chaque aptamère, une concentration constante d'aptamère (2,5 nM) marqué à NRD800 est incubée 30 min à 37°C avec des concentrations croissantes de Rad51 (0 à 1 μM). Les produits sont alors résolus par gel de retard. Les bandes correspondant au complexe Rad51 -aptamère, ainsi que la bande correspondant à l'aptamère seul sont quantifiées. Pour obtenir les valeurs de Kd, nous avons exprimé l'intensité de fluorescence du complexe par rapport à l'intensité totale du puits (ADN complexée + ADN libre). Le Kd correspond à la concentration de Rad51 nécessaire pour lier 50% de l'ADN. Le graphe, ainsi que les courbes de tendance ont été réalisés avec le logiciel SigmaPlot. To calculate the apparent Kd of each aptamer, a constant concentration of aptamer (2.5 nM) labeled with NRD800 is incubated for 30 min at 37 ° C with increasing concentrations of Rad51 (0 to 1 μM). The products are then solved by a delay gel. The bands corresponding to the Rad51 -aptamer complex, as well as the band corresponding to the aptamer alone, are quantified. To obtain the Kd values, we expressed the fluorescence intensity of the complex relative to the total intensity of the well (complexed DNA + free DNA). Kd is the concentration of Rad51 needed to bind 50% of the DNA. The graph, as well as the trend curves were made with SigmaPlot software.
Méthode dot-blot et évaluation de l'affinité d'une banque d'ADN Dot-blot method and evaluation of the affinity of a DNA library
Lors de la sélection des aptamères contre le peptide L1 , l'affinité des ADN sélectionnés a été évaluée par le système de dot-blot. Les ADN marqués à NRD800 (10 nM) sont incubés avec des concentrations croissantes en Rad51 (0 à 1 μM) dans le tampon de sélection A, pendant 30 min à 37°C, dans un volume totale de 10 μL. Les échantillons sont dilués à 50 μL final, puis déposés sur une membrane (HAWP 0,45 μm, Millipore) immobilisée dans le système bio-dot (Bio-Rad). Cette membrane a été préalablement traitée à l'alkali avec 0,5 M KOH pendant 20 min (Pileur et al., 2003) pour éviter l'accrochage non spécifique des ADN sur la membrane. Une fois les complexes déposés, la membrane est lavée et scannée. Les spots sont ensuite quantifiés avec le logiciel Odyssey. L'intensité de fluorescence est directement proportionnelle à la quantité d'ADNsb liée à la protéine Rad51 retenue sur la membrane. La normalisation de spots est faite par soustraction du bruit de fond. Upon selection of aptamers against the L1 peptide, the affinity of the selected DNAs was assessed by the dot-blot system. The NRD800 labeled DNAs (10 nM) are incubated with increasing concentrations of Rad51 (0 to 1 μM) in the selection buffer A, for 30 min at 37 ° C, in a total volume of 10 μl. The samples are diluted to 50 μL final, then deposited on a membrane (HAWP 0.45 μm, Millipore) immobilized in the bio-dot system (Bio-Rad). This membrane was previously treated with alkali with 0.5 M KOH for 20 min (Pileur et al., 2003) to avoid nonspecific cling of the DNAs on the membrane. Once the complexes are deposited, the membrane is washed and scanned. The spots are then quantified with the Odyssey software. The fluorescence intensity is directly proportional to the amount of ssDNA bound to the protein Rad51 retained on the membrane. Spot normalization is done by subtracting the background noise.
Pontage chimique de Rad51 Chemical bridging of Rad51
La protéine Rad51 (2 μM) préalablement dialysée dans un tampon PBS avec une unité de dialyse (Slide A layer®Mini Dialysis Units, Pierce), a été incubée seule, ou avec différentes concentrations d'ADN sélectionnées pendant 10 min à température ambiante, dans un tampon contenant 20 mM phosphate, 50 mM NaCI, 1 mM MgC^ and 1 mM d'ATP. La réaction de pontage chimique (Figure II.3) a été initiée avec l'adition BS3 (bis[sulfosuccinimidyl]suberate, Pierce) à 50 μM et laissée pendant 30 min à température ambiante. Les réactions sont ensuite arrêtées par l'incubation pendant 15 min avec 50 mM Tris-HCI pH 7,5. Les produits sont séparés sur un gel SDS-PAGE 10%, suivi d'un western blotting. La membrane a été scannée
et la quantification des bandes correspondantes à Rad51 a été effectuée à l'aide du logiciel Odyssey. The Rad51 protein (2 μM) previously dialyzed in a PBS buffer with a dialysis unit (Slide A Layer®Mini Dialysis Units, Pierce), was incubated alone, or with different concentrations of DNA selected for 10 min at room temperature, in a buffer containing 20 mM phosphate, 50 mM NaCl, 1 mM MgCl 2 and 1 mM ATP. The chemical bridging reaction (Figure II.3) was initiated with the addition of BS3 (bis [sulfosuccinimidyl] suberate, Pierce) at 50 μM and left for 30 min at room temperature. The reactions are then stopped by incubation for 15 min with 50 mM Tris-HCl pH 7.5. The products are separated on a 10% SDS-PAGE gel, followed by a western blotting. The membrane has been scanned and the quantization of the bands corresponding to Rad51 was performed using the Odyssey software.
Les fonctions ester du crosslinker BS3(ou un analogue DSS) réagissent avec les groupes aminé de protéines (-NH2) et forment une fonction amide, très stable, résistante aux conditions dénaturantes. The ester functions of crosslinker BS3 (or a DSS analog) react with the amino groups of proteins (-NH2) and form an amide function, very stable, resistant to denaturing conditions.
Réaction d'échange de brins Strand exchange reaction
Cette étude est basée sur la capacité de la protéine Rad51 à échanger les brins d'ADN homologues. La réaction a été réalisée selon Takizawa et collaborateurs This study is based on the ability of the Rad51 protein to exchange homologous DNA strands. The reaction was carried out according to Takizawa and collaborators
(4). L'oligonucléotide simple brin utilisé est nommé Rec58 (58 nt). L'ADN double brin (32 pb) est formé par hybridation des oligonucléotides nommés Rec32 et IRD-Rec32. (4). The single-stranded oligonucleotide used is named Rec58 (58 nt). Double-stranded DNA (32 bp) is formed by hybridization of the oligonucleotides Rec32 and IRD-Rec32.
La protéine Rad51 (0,5 μM) a été incubée avec l'ADN simple brin de 58 nt (100 nM) et en présence ou non des différents aptamères, dans un tampon contenant 20 mM Tris-HCI pH 8,0 ; 1 mM ATP, 1 mM DTT, 100 μg/mL BSA, 20 mM MgCb, 2 mM créatine phosphate, 75 μg/mL créatine kinase et 2% glycérol, à 37°C for 15 min. La réaction a été initiée par l'adition de l'ADN double brin (32 pb) marqué à NRD, et qui présente une partie d'homologie de séquence avec la séquence de 58 nucléotides. La réaction est arrêtée après 1 h d'incubation à 37°C par l'addition de 0,7 % SDS et 0,7 mg/mL protéinase K (Roche Molecular Biochemicals), puis incubé 10 min à 37°C. Les échantillons sont ensuite séparés dans un gel de polyacrylamide 15% en conditions natives, dans un tampon TBE, à 120 volts pendant 90 min environ. La détection de l'ADN marqué et la quantification de produits se font à l'aide du scanner Odyssey. The Rad51 protein (0.5 μM) was incubated with the 58 nt single-stranded DNA (100 nM) and in the presence or absence of the different aptamers, in a buffer containing 20 mM Tris-HCl pH 8.0; 1 mM ATP, 1 mM DTT, 100 μg / mL BSA, 20 mM MgCb, 2 mM creatine phosphate, 75 μg / mL creatine kinase and 2% glycerol, at 37 ° C for 15 min. The reaction was initiated by the addition of the NRD-labeled double-stranded DNA (32 bp), which has a sequence homology portion with the sequence of 58 nucleotides. The reaction is stopped after 1 h of incubation at 37 ° C by the addition of 0.7% SDS and 0.7 mg / ml proteinase K (Roche Molecular Biochemicals), then incubated for 10 min at 37 ° C. The samples are then separated in a 15% native polyacrylamide gel in TBE buffer at 120 volts for about 90 minutes. The detection of labeled DNA and the quantification of products are done using the Odyssey scanner.
- Spectroscopie - Spectroscopy
La spectroscopie de fluorescence a été utilisée pour étudier l'interaction de la protéine Rad51 avec l'ADN, ainsi que des techniques de dichroïsme circulaire qui renseignent sur les structures secondaires des ADN et des protéines. Ces deux techniques font appel à un phénomène d'absorption de la lumière. Fluorescence spectroscopy was used to study the interaction of the Rad51 protein with DNA, as well as circular dichroism techniques that provide information on the secondary structures of DNAs and proteins. Both of these techniques use a phenomenon of absorption of light.
Conditions expérimentales de mesures de CD et absorbance Experimental conditions of CD measurements and absorbance
Les spectres CD des aptamères (100 μM en nucléotides) ou de Rad51 (0,5 et 1 μM) ont été déterminés à l'aide d'une cuvette de quartz de 0,2 x 1 cm à quatre faces (Hellma) dans un spectromètre J-810 (Jasco) avec des paramètres: largeur de fente : 2 nm ; temps de réponse : 0,125 sec ; intervalle de mesure : 0,1 s ; et 2 accumulations de mesure. Les spectres ont été mesurés dans 150 μL finale dans un tampon contenant 20 mM Tris-HCI pH 7,5 ; 2 mM MgCI2, 30 mM KCI. Le tampon a
été filtré sur nitrocellulose et dégazé. Les spectres ont été pris à 200C, sauf indication contraire. Les spectres d'absorbance ont été obtenus dans un spectromètre J-810 (Jasco) à 260 nm. La température initiale a été 200C, puis augmenté à 80°C, à raison de 1 °C par min. La valeur de la température de fusion (Tm) a été obtenue après les analyses des courbes. CD spectra of aptamers (100 μM nucleotides) or Rad51 (0.5 and 1 μM) were determined using a four-sided 0.2 x 1 cm quartz dish (Hellma) in a J-810 spectrometer (Jasco) with parameters: slot width: 2 nm; response time: 0.125 sec; measurement interval: 0.1 s; and 2 measurement accumulations. Spectra were measured in final 150 μL in buffer containing 20 mM Tris-HCl pH 7.5; 2 mM MgCl 2 , 30 mM KCl. The buffer has was filtered on nitrocellulose and degassed. The spectra were taken at 20 ° C., unless otherwise indicated. Absorbance spectra were obtained in a J-810 (Jasco) spectrometer at 260 nm. The initial temperature was 20 ° C. and then increased to 80 ° C., at a rate of 1 ° C. per minute. The value of the melting temperature (Tm) was obtained after the analyzes of the curves.
Traitement statistique des résultats Statistical treatment of results
Lorsque les expériences sont réalisées en triplicata ou plus, les valeurs présentées correspondent aux moyennes ± écartype de « n » expériences indépendantes. Les différences entre les moyennes pour les résultats présentés on été évalues statistiquement avec le test de Man & Whitney. Les résultats ont été jugés statistiquement significatifs si p < 0.01. When the experiments are carried out in triplicate or more, the values presented correspond to the means ± deviation of "n" independent experiments. Differences between averages for the presented results were statistically evaluated with the Man & Whitney test. The results were judged statistically significant if p <0.01.
Analyse des motifs et de structure avec MEME et MFoId Pattern and structure analysis with MEME and MFoId
La recherche des motifs consensus a été réalisée avec chaque cluster séparément, et analysée avec le logiciel MEME (Multiple EM for Motif Elicitation, EM étant lui-même le sigle de « Expectation Maximization ») (5) (6) (http://meme.nbcr.net/meme/cgi-bin/meme.cgi). Les paramètres utilisés ont été : un maximum de 8 motifs recherchés par cluster, avec une longueur du motif minimum de 6 et maximum de 50, et avec le maximum de nombre d'occurrences du motif. The search for consensus motifs was carried out with each cluster separately, and analyzed with the MEME software (Multiple EM for Motif Elicitation, EM being itself the acronym for "Expectation Maximization") (5) (6) (http: // meme.nbcr.net/meme/cgi-bin/meme.cgi). The parameters used were: a maximum of 8 searched patterns per cluster, with a minimum pattern length of 6 and maximum of 50, and with the maximum number of occurrences of the pattern.
La prédiction de structures secondaires des aptamères a été réalisée avec le logiciel MFoId (http://mfold.bioinfo.rpi.edu) (7) avec les conditions : 1 M NaCI et 37°C. Résultats The prediction of secondary structures of the aptamers was carried out with the software MFoId (http://mfold.bioinfo.rpi.edu) (7) with the conditions: 1 M NaCl and 37 ° C. Results
Séquences des aptamères sélectionnés Sequences of selected aptamers
Toutes les séquences obtenues par la procédure SELEX sont présentées dans le tableau 1 ci-après.
All the sequences obtained by the SELEX procedure are presented in Table 1 below.
Tableau 1 Table 1
Séquences retenues après SELEX contre HsRad51 (clusters 2, 3, 4, 5) Sequences retained after SELEX against HsRad51 (clusters 2, 3, 4, 5)
Exemple nomenclature utilisée: A1 = Aptamère 1 = Clone 1 Example nomenclature used: A1 = Aptamer 1 = Clone 1
Cluster 2 Cluster 2
>clone7 > clone7
TAGGGAATTCGTCGACGGATCCCCGTCAGGGTTCGCACTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCCCGTCAGGGTTCGCACTCCAGGTCGACGCATGCGCC
>clonel8 > clonel8
TAGGGAATTCGTCGACGGATCCCCGTCAGGGTTCGCACTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCCCGTCAGGGTTCGCACTCCAGGTCGACGCATGCGCC
>clone47 > clone47
TAGGGAATTCGTCGACGGATCCAGTCAACAACTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCAGTCAACAACTCCAGGTCGACGCATGCGCC
>clone58 > clone58
TAGGGAATTCGTCGACGGATCCTCAAGTTATGTGGGCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCTCAAGTTATGTGGGCTCCAGGTCGACGCATGCGCCG
>clone67 > clone67
TAGGGAATTCGTCGACGGATCCGAGGCGGAAACTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGAGGCGGAAACTCCAGGTCGACGCATGCGCCG
>clone75 > clone75
TAGGGAATTCGTCGACGGATCCCCCTGACACGATCGCTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCCCCTGACACGATCGCTCCAGGTCGACGCATGCGCC
>clone79 > clone79
TAGGGAATTCGTCGACGGATCCCGATACGCACTACAAACTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGATACGCACTACAAACTCCAGGTCGACGCATGCGCCG
>clone89 > clone89
TAGGGAATTCGTCGACGGATCCTGATCGGACTTTACCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCTGATCGGACTTTACCTCCAGGTCGACGCATGCGCCG
Cluster 3 Cluster 3
>clonelO > clonelO
TAGGGAATTCGTCGACGGATCCAGTCCGTGGTTAGGGAATTCGTCGACGGATCCCTCCAGGTCGAC GCATGCGCCG TAGGGAATTCGTCGACGGATCCAGTCCGTGGTTAGGGAATTCGTCGACGGATCCCTCCAGGTCGAC GCATGCGCCG
>clone48 > clone48
TAGGGAATTCGTCGACGGATCCGAGGAAACACGGGGTGTGGCTAGCCTCCAGGTCGACGCAT GCGCC TAGGGAATTCGTCGACGGATCCGAGGAAACACGGGGTGTGGCTAGCCTCCAGGTCGACGCAT GCGCC
>clone64 > clone64
TAGGGAATTCGTCGACGGATCCTGCGTGGTTAGGGATTCGTCGACGGATCCCTCCAGGTCGA CGCATGCGCC TAGGGAATTCGTCGACGGATCCTGCGTGGTTAGGGATTCGTCGACGGATCCCTCCAGGTCGA CGCATGCGCC
>clone68 > clone68
TAGGGAATTCGTCGACGGATCCAGTCCGTGGTTAGGGAATTCGTCGACGGATCCTCCAGGTC GACGCATGCGCC TAGGGAATTCGTCGACGGATCCAGTCCGTGGTTAGGGAATTCGTCGACGGATCCTCCAGGTC GACGCATGCGCC
>clone90 > clone90
TAGGGAATTCGTCGACGGATCCAGTCCGTGGATAGGGAATTCGTCGACGGATCCGCAGGCTC CAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCAGTCCGTGGATAGGGAATTCGTCGACGGATCCGCAGGCTC CAGGTCGACGCATGCGCCG
Cluster 4 Cluster 4
>clone3
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG > clone3 TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone6 > clone6
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone9 > clone9
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACTATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACTATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clonel7 > clonel7
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC( TGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCACCGATCGTTC (TGCCTCCAGGTCGACGCATGCGCCG
>clone22 > clone22
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone27 > clone27
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCGTGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCGTGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone30 > clone30
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone41 > clone41
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone42 > clone42
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGGACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGGACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone52 > clone52
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAGCTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAGCTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCC
>clone55 > clone55
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone72 > clone72
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCTGGCATCTCCTGGGACATGAACTCGTTCG CTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCTGGCATCTCCTGGGACATGAACTCGTTCG CTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone80 > clone80
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
>clone82 > clone82
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACCCGTTC GCTTATATGCCTTCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACCCGTTC GCTTATATGCCTTCAGGTCGACGCATGCGCCG
>clone84 > clone84
TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCATGGGAGCCGGCATCTCCTGGGACCATGAACTCGTTC GCTTATATGCCTCCAGGTCGACGCATGCGCCG
Cluster 5 Cluster 5
>clonel > clonel
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC
>clone2 TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC > clone2
TAGGGAATTCGTCGACGGATCCAGTGTGCCCGGGGAGCGGGCTTGGCGCGAGGTTGGATCCA CTACTGGGATCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCAGTGTGCCCGGGGAGCGGGCTTGGCGCGAGGTTGGATCCA CTACTGGGATCTCCAGGTCGACGCATGCGCCG
>clone5 > clone5
TAGGGAATTCGTCGACGGATCCGGGACGCGCCAAAAGCTGGTCGAGTGCGAGTGTTGTGAAC GGATGGTGGTCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGGGACGCGCCAAAAGCTGGTCGAGTGCGAGTGTTGTGAAC GGATGGTGGTCTCCAGGTCGACGCATGCGCCG
>clonell > clonell
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCCG
>clonel2 > clonel2
TAGGGAATTCGTCGACGGATCCCGCTTTTTAGGACACGGTTCGACTGACTTTGGCGCCTAGA TTGGATTAAGCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCGCTTTTTAGGACACGGTTCGACTGACTTTGGCGCCTAGA TTGGATTAAGCTCCAGGTCGACGCATGCGCCG
>clonel3 > clonel3
TAGGGAATTCGTCGACGGATCCATCCTCAAAGGTTGGACACACATCAATAATAATTGTTCTT GTGGGCTCGCGCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCATCCTCAAAGGTTGGACACACATCAATAATAATTGTTCTT GTGGGCTCGCGCTCCAGGTCGACGCATGCGCCG
>clonel4 > clonel4
TAGGGAATTCGTCGACGGATCCGACTCGGACGGAGAATAGAGTTGCGTAACTCAATTATGCA CCGAGGGGGACTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGACTCGGACGGAGAATAGAGTTGCGTAACTCAATTATGCA CCGAGGGGGACTCCAGGTCGACGCATGCGCCG
>clonel5 > clonel5
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTGCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTGCTCCAGGTCGACGCATGCGCCG
>clonel 6 > clonel 6
TAGGGAATTCGTCGACGGATCCAGTCCGTGGCTAGGGAATTCGTCGACGGATCCAGTCCGTG GTTAGGGAATTCGTCGACGGATCCCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCAGTCCGTGGCTAGGGAATTCGTCGACGGATCCAGTCCGTG GTTAGGGAATTCGTCGACGGATCCCCTCCAGGTCGACGCATGCGCCG
>clone24 > clone24
TAGGGAATTCGTCGACGGATCCAGTCTACAAACAGTGTCGCCTGAAGTTATTTCGCTGCTTG GTTCTACGGACTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCAGTCTACAAACAGTGTCGCCTGAAGTTATTTCGCTGCTTG GTTCTACGGACTCCAGGTCGACGCATGCGCCG
>clone29 > clone29
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTGATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTGATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC
>clone31 > clone31
TAGGGAATTCGTCGACGGATCCGGTAGACCAGGGCTGATCGGCGGGGTCGGCGCAGAGATGT GTAAGGATAGCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGGTAGACCAGGGCTGATCGGCGGGGTCGGCGCAGAGATGT GTAAGGATAGCTCCAGGTCGACGCATGCGCCG
>clone36 > clone36
TAGGGAATTCGTCGACGGATCCATGGCCGAGGCGTGCGTGGGATGGGACACTGCCTGAGGGG TGCACCCAACCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCATGGCCGAGGCGTGCGTGGGATGGGACACTGCCTGAGGGG TGCACCCAACCTCCAGGTCGACGCATGCGCCG
>clone37 > clone37
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC
>clone38 > clone38
TAGGGAATTCGTCGACGGATCCGGGACGCGCCAAAAGCTGGTCGAGTGCGAGTGTTGTGAAC GGATGGTGGTCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGGGACGCGCCAAAAGCTGGTCGAGTGCGAGTGTTGTGAAC GGATGGTGGTCTCCAGGTCGACGCATGCGCCG
>clone45 > clone45
TAGGGAATTCGTCGACGGATCCTGCGTGGTTAGGGAATTCGTCGACGGATCCTGCGTGGTTA GGGAATTCGTCGACGGATCCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCTGCGTGGTTAGGGAATTCGTCGACGGATCCTGCGTGGTTA GGGAATTCGTCGACGGATCCCTCCAGGTCGACGCATGCGCCG
>clone49 > clone49
TAGGGAATTCGTCGACGGATCCACGGGCCGGGCTTCCTAGACAGGGTGTGTTATCGTGGTGT CGGCACGGTGCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCACGGGCCGGGCTTCCTAGACAGGGTGTGTTATCGTGGTGT CGGCACGGTGCTCCAGGTCGACGCATGCGCCG
>clone53 > clone53
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC
>cl one 60 TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC > cl one 60
TAGGGAATTCGTCGACGGATCCGTTTAACCGTGTGATCTGTGTTCTGCGCAATCTTGGTGCA GCGGGCCAACCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGTTTAACCGTGTGATCTGTGTTCTGCGCAATCTTGGTGCA GCGGGCCAACCTCCAGGTCGACGCATGCGCCG
>clone62 > clone62
TAGGGAATTCGTCGACGGATCCTGGTGGCAGGTGGGACGTGAGCGCGGAGCACGGAGGCGCC AGACTCGTGACTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCTGGTGGCAGGTGGGACGTGAGCGCGGAGCACGGAGGCGCC AGACTCGTGACTCCAGGTCGACGCATGCGCCG
>clone63 > clone63
TAGGGAATTCGTCGACGGATCCGAAGGATCCGGCAGTGGAGCTTGGTGTGGAACGTTTAGCA TCCAAAGGTGCTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCGAAGGATCCGGCAGTGGAGCTTGGTGTGGAACGTTTAGCA TCCAAAGGTGCTCCAGGTCGACGCATGCGCC
>clone69 > clone69
TAGGGAATTCGTCGACGGATCCGACTCGGACGGAGAATAGAGTTGCGTAACTCAATTATGCA CCGAGGGGGACTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGACTCGGACGGAGAATAGAGTTGCGTAACTCAATTATGCA CCGAGGGGGACTCCAGGTCGACGCATGCGCCG
>clone71 > clone71
TAGGGAATTCGTCGACGGATCCGAAAGTTGCCGACTGGGATGTTTTCACTTGGGGTAAGGAA CGGGGGGGTCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCGAAAGTTGCCGACTGGGATGTTTTCACTTGGGGTAAGGAA CGGGGGGGGTCTCCAGGTCGACGCATGCGCCG
>clone76 > clone76
TAGGGAATTCGTCGACGGATCCAGTGGCGGAGGGGTGCATGGCCGCGGGGGTGCCGTGGGCT ATACTTCGATCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCAGTGGCGGAGGGGTGCATGGCCGCGGGGGTGCCGTGGGCT ATACTTCGATCTCCAGGTCGACGCATGCGCCG
>clone77 > clone77
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG TCGGAGCCTTCTCCAGGTCGACGCATGCGCC
>clone78 > clone78
TAGGGAATTCGTCGACGGATCCTGGTCATCGCGGTGTGGTGGTACGGAGATCTTGGTCTACA GCTCCTTGGCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCTGGTCATCGCGGTGTGGTGGTACGGAGATCTTGGTCTACA GCTCCTTGGCTCCAGGTCGACGCATGCGCCG
>clone83 > clone83
TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG ACGGATCCCCTCCAGGTCGACGCATGCGCCG TAGGGAATTCGTCGACGGATCCCACGTAGTGGGATCAGGCCCGCGTAATGGTTGCAGTCTGG ACGGATCCCCTCCAGGTCGACGCATGCGCCG
>clone87 > clone87
TAGGGAATTCGTCGACGGATCCGCCTAGAACGCTCCCGCACAGGGTACGGTGGGATGTGGGT TGGGGCTACCCTCCAGGTCGACGCATGCGCCG
TAGGGAATTCGTCGACGGATCCGCCTAGAACGCTCCCGCACAGGGTACGGTGGGATGTGGGT TGGGGCTACCCTCCAGGTCGACGCATGCGCCG
Analyse in silico des séquences des aptamères sélectionnés In silico analysis of selected aptamer sequences
Cette analyse in silico consiste à comparer toutes les séquences 2 à 2, ce qui a permis de construire une «matrice de distance » représentative de leur homologie respective. Dans cette matrice où chaque ligne/colonne représente une séquence, plus deux séquences nucléotidiques sont proches, plus la distance qui les sépare sera faible. Inversement, plus deux séquences sont éloignées, plus la distance qui les sépare sera grande. Cette matrice de distance peut être représentée sous la forme d'un arbre hiérarchique. L'approche des inventeurs a consisté alors à isoler les séquences similaires pour un seuil donné. Le seuil fixé pour cette analyse a permis d'identifier 6 clusters de séquences d'ADN. Pour une meilleure visualisation des résultats, la distribution des séquences est représentée en utilisant une analyse des données en composante principale (ACP) Jackson, (9). On recherche pour cela les axes de représentation (i.e. les composantes) qui expliquent le maximum de variance associé à la distance entre chaque séquence. On prend ainsi en compte les deux composantes les plus significatives. La première composante prend en compte 84,36% des écarts de données, et la deuxième composante prend en compte 7,8%, soit un total de 92,16% de la variation initiale du SELEX représentée par ces deux axes. Cette filtration et la représentation associée donne un aperçu de la distribution des données en fonction de la similarité des séquences (Figure 8). This in silico analysis consists in comparing all the sequences 2 to 2, which made it possible to construct a "matrix of distance" representative of their respective homology. In this matrix where each row / column represents a sequence, the closer two nucleotide sequences are, the smaller the distance between them. Conversely, the more distant two sequences are, the greater the distance that separates them. This distance matrix can be represented as a hierarchical tree. The inventors' approach was then to isolate the similar sequences for a given threshold. The threshold set for this analysis allowed us to identify 6 clusters of DNA sequences. For a better visualization of the results, the sequence distribution is represented using an analysis of the principal component data (PCA) Jackson, (9). To do this, we search for the representation axes (i.e. the components) that explain the maximum variance associated with the distance between each sequence. This takes into account the two most significant components. The first component takes into account 84.36% of the data discrepancies, and the second component takes into account 7.8%, ie a total of 92.16% of the initial variation of SELEX represented by these two axes. This filtration and the associated representation gives an overview of the distribution of the data according to the similarity of the sequences (Figure 8).
Chaque nuage de point sera alors considéré comme représentatif d'un cluster. Each point cloud will then be considered representative of a cluster.
Une analyse détaillée des clusters montre que les clusters les plus éloignés du centre de la représentation (i.e. barycentre des données) renferment les séquences les plus divergentes (i.e.vahance la plus élevée par rapport à la moyenne des autres séquences). A detailed cluster analysis shows that the clusters farthest from the center of the representation (i.e. barycenter of the data) contain the most divergent sequences (i.e.vahance the highest compared to the average of the other sequences).
Chaque séquence obtenue est associée à un cluster donné. Les aptamères retenus pour la suite sont indiqués dans chaque cluster (A7, A13, A30, A45, A47, A48, A77, A79 et A90). Each sequence obtained is associated with a given cluster. The aptamers retained for the following are indicated in each cluster (A7, A13, A30, A45, A47, A48, A77, A79 and A90).
Effet des aptamères sur l'activité d'échange de brins de Rad51 Effect of aptamers on Rad51 strand exchange activity
Des essais portant sur l'activité d'échange de brins de Rad51 ont été réalisés pour évaluer l'effet des inhibiteurs de l'invention. Le protocole de Takizawa et collaborateurs (4) a été utilisé. Brièvement, la protéine Rad51 est incubée avec un ADN simple brin substrat de 58 nucléotides (nt). La réaction est initiée par l'addition d'un ADN double brin de 32 pb marqué avec un fluorophore (IRDyeδOO), qui
présente un brin homologue à la séquence de 58 nt. Lorsqu'il existe une activité d'échange de brins, on observe l'apparition d'une bande d'ADN simple brin de 32 nt. Strand exchange activity assays of Rad51 were performed to evaluate the effect of the inhibitors of the invention. The protocol of Takizawa et al. (4) was used. Briefly, the Rad51 protein is incubated with a single-stranded substrate DNA of 58 nucleotides (nt). The reaction is initiated by the addition of a 32 bp double-stranded DNA labeled with a fluorophore (IRDyeδOO), which has a strand homologous to the sequence of 58 nt. When there is a strand exchange activity, the appearance of a single-stranded DNA band of 32 nt is observed.
Les séquences de l'invention, ne présentant pas toutes des tailles identiques, les concentrations sont exprimées en équivalent « nucléotides » (concentration en nucléotides = concentration molaire x nombre de nucléotides de la séquence entière) afin d'homogénéiser les résultats. Les concentrations molaires sont présentées dans le Tableau 2 ci-dessous. La taille de chaque aptamère est indiquée. Les concentrations molaires (nM) et en équivalent nucléotides (5μM) utilisées pour l'étude de l'activité d'échange de brins sont présentées. The sequences of the invention, not all having identical sizes, the concentrations are expressed in "nucleotide" equivalent (nucleotide concentration = molar concentration x number of nucleotides of the entire sequence) in order to homogenize the results. The molar concentrations are shown in Table 2 below. The size of each aptamer is indicated. The molar concentrations (nM) and nucleotide equivalent (5 μM) used for the study of strand exchange activity are presented.
Tableau 2 Table 2
Pour tester l'effet des aptamères sur l'activité d'échange de brins, la protéine Rad51 est incubée avec l'ADN simple brin substrat en présence ou en absence des aptamères. Ensuite, l'apparition de la bande d'ADNsb de la réaction est détectée et quantifiée. To test the effect of aptamers on strand exchange activity, the Rad51 protein is incubated with substrate single-stranded DNA in the presence or absence of aptamers. Then, the appearance of the ssDNA band of the reaction is detected and quantified.
Les résultats sont donnés dans les figures 1A et 1 B: (A) L'inhibition de l'activité recombinase de Rad51 (0,5 μM) par les aptamères sélectionnés (5 μM en nucléotides) a été détectée par séparation des produits sur un gel de polyacrylamide en conditions natives. Le contrôle ADN double brin (ADNdb) et l'activité contrôle en absence d'aptamère sont également montrés. (B) Les gels ont été scannés et les bandes d'intérêt quantifiées avec le logiciel Odyssey (LI-COR). La quantification de 3
expériences indépendantes est présentée après normalisation par rapport au contrôle. The results are given in FIGS. 1A and 1B: (A) The inhibition of the Rad51 recombinase activity (0.5 μM) by the selected aptamers (5 μM nucleotides) was detected by separating the products on a polyacrylamide gel under native conditions. Double-stranded DNA control (dsDNA) and control activity in the absence of an aptamer are also shown. (B) The gels were scanned and the interest bands quantified with the Odyssey software (LI-COR). Quantification of 3 Independent experiments is presented after normalization versus control.
L'ADNdb marqué seul migre dans un gel natif de polyacrylamide sous la forme d'une seule bande. En l'absence d'aptamère, l'activité d'échange de brins conduit à l'apparition d'une bande d'ADN simple brin (ADNsb) (puits 2, activité contrôle). Cette activité d'échange de brins sera considérée comme activité de référence (égale à 1 dans la figure IB). L'activité est ensuite évaluée en présence des différents aptamères (puits 3 à 11 ). The labeled dsDNA alone migrates in a native polyacrylamide gel as a single band. In the absence of aptamer, the strand exchange activity leads to the appearance of a single-stranded DNA (ssDNA) band (well 2, control activity). This strand exchange activity will be considered as a reference activity (equal to 1 in FIG. 1B). The activity is then evaluated in the presence of the different aptamers (wells 3 to 11).
Les résultats obtenus montrent que tous les inhibiteurs testés présentent un effet inhibiteur de l'activité recombinase de Rad51. Les aptamères A79, A13 et A30 inhibent l'activité d'environ 70-80% (soit 83 nM pour A79 et 53 nM pour A13 et A30). The results obtained show that all the inhibitors tested show an inhibitory effect on the Rad51 recombinase activity. A79, A13 and A30 aptamers inhibit activity by about 70-80% (ie 83 nM for A79 and 53 nM for A13 and A30).
Les résultats obtenus montrent que les aptamères sélectionnés en augmentant l'astringence lors des tours de sélection, la concentration en sel et le ratio Rad51 : ADN ont un effet inhibiteur sur l'activité d'échange de brins de Rad51. The results obtained show that the aptamers selected by increasing the astringency during selection rounds, the salt concentration and the Rad51: DNA ratio have an inhibitory effect on the Rad51 strand exchange activity.
En présence des aptamères A79, A30 et A13, l'activité d'échange de brins (ou activité recombinase) est diminuée d'un facteur proche de 4. In the presence of aptamers A79, A30 and A13, the strand exchange activity (or recombinase activity) is decreased by a factor close to 4.
Une analyse statistique des résultats (test de Mann & Whitney) indique que l'effet inhibiteur de A79 est significatif (p < 0,01 ) en comparaison à d'autres aptamères de taille similaire (A7, A47 et A48). L'inhibition observée en présence des aptamères A30 et A13 est également statistiquement significative (p < 0,01 ) par rapport à l'effet des aptamères A45, A77 et A90, de taille similaire. A statistical analysis of the results (Mann & Whitney test) indicates that the inhibitory effect of A79 is significant (p <0.01) compared with other aptamers of similar size (A7, A47 and A48). Inhibition observed in the presence of A30 and A13 aptamers is also statistically significant (p <0.01) compared to the effect of aptamers A45, A77 and A90, of similar size.
Il est à noter la différence sur l'inhibition de l'activité recombinase par les aptamères A79 et A47, appartenant au cluster 2. Leur composition nucléotidique et leurs respectives structures secondaires déterminées avec MFoId 37°C sont très similaires. On observe notamment dans ces structures secondaires une différence au niveau de la taille de la boucle fermée (Figure 2). It should be noted the difference in the inhibition of the recombinase activity by A79 and A47 aptamers, belonging to cluster 2. Their nucleotide composition and their respective secondary structures determined with MFoId 37 ° C are very similar. In particular, these secondary structures exhibit a difference in the size of the closed loop (FIG. 2).
Caractérisation des inhibiteurs de l'invention Characterization of the inhibitors of the invention
Affinité des aptamères pour Rad51 Affinity of aptamers for Rad51
Les aptamères A30, A13 et A79 ont été marqués par un fluorophore Aptamers A30, A13 and A79 were labeled with a fluorophore
(IRDyeδOO) et leur affinité relative vis-à-vis de la protéine évaluée par la technique de gel de retard. Les résultats sont donnés sur la Figure 3 (A) Les différents aptamères marqués à l'IRDyeδOO (2,5 nM) sont incubés en présence de concentrations croissantes de Rad51 (0-1 μM). Après séparation du milieu réactionnel par
électrophorèse en gel d'agarose 1.5%, les bandes correspondant à l'aptamère libre et lié à Rad51 sont quantifiées. Dans chaque expérience, l'intensité de la bande correspondant à l'aptamère libre est prise comme référence (100%). (B) Les bandes correspondant aux aptamères libres et liés sont quantifiées et les résultats exprimés en % d'aptamères liés à la protéine. La constante de dissociation (Kd apparent) de chaque aptamère est calculée à partir de l'équation de la courbe de tendance. Le Kd correspond à la concentration de Rad51 à laquelle 50% de l'ADN est libre. (IRDyeδOO) and their relative affinity for the protein evaluated by the delay gel technique. The results are given in FIG. 3 (A). The different aptamers labeled with IRDyeδOO (2.5 nM) are incubated in the presence of increasing concentrations of Rad51 (0-1 μM). After separation of the reaction medium by 1.5% agarose gel electrophoresis, the bands corresponding to the free aptamer and bound to Rad51 are quantified. In each experiment, the intensity of the band corresponding to the free aptamer is taken as reference (100%). (B) The bands corresponding to the free and bound aptamers are quantified and the results expressed in% of aptamers bound to the protein. The dissociation constant (apparent Kd) of each aptamer is calculated from the equation of the trend curve. Kd is the concentration of Rad51 at which 50% of the DNA is free.
Les aptamères marqués à NRD sont incubés avec des concentrations croissantes en Rad51 et résolus sur un gel d'agarose. Le gel est scanné et les bandes quantifiées. NRD-labeled aptamers are incubated with increasing concentrations of Rad51 and resolved on an agarose gel. The gel is scanned and the bands quantified.
Les résultats montrent que le Kd apparent est de 40 ± 6 nM pour A79, de 72 ± 25 nM pour A30, et de 76 ± 12 nM pour A13. L'affinité de la banque initiale utilisée pour la sélection a également été évaluée et présente un Kd apparent majeur à 200 nM, ce qui nous confirme que les aptamères sélectionnés présentent une affinité accrue vis-à-vis de Rad51. The results show that the apparent Kd is 40 ± 6 nM for A79, 72 ± 25 nM for A30, and 76 ± 12 nM for A13. The affinity of the initial library used for selection was also evaluated and shows an apparent major Kd of 200 nM, which confirms that the aptamers selected have an increased affinity for Rad51.
Les aptamères A13 et A30 présentent des valeurs de Kd apparent très similaires. Ces deux aptamères ont également des effets similaires sur l'inhibition de l'activité recombinase, ainsi que sur la liaison à l'ADN et sur l'oligomérisation de Rad51. Comme décrit précédemment, A79 paraît moduler Rad51 d'une manière différente de A13 et A30. The aptamers A13 and A30 have apparent similar Kd values. These two aptamers also have similar effects on the inhibition of recombinase activity, as well as on DNA binding and on the oligomerization of Rad51. As previously described, A79 appears to modulate Rad51 in a manner other than A13 and A30.
Spécificité des aptamères pour Rad51 Specificity of aptamers for Rad51
Afin de confirmer la spécificité des aptamères de l'invention, leur interaction avec l'homologue bactérien RecA, a été testée. Les expériences ont également été réalisées par gel retard. Les aptamères A30 et A79 marqués à NRDyeδOO (2,5 nM) sont incubés en présence de concentrations croissantes de RecA (0-1000 nM). In order to confirm the specificity of the aptamers of the invention, their interaction with the bacterial homologue RecA was tested. The experiments were also performed by gel delay. The A30 and A79 aptamers labeled with NRDyeδOO (2.5 nM) are incubated in the presence of increasing concentrations of RecA (0-1000 nM).
Après séparation du milieu réactionnel par électrophorèse en gel d'agarose 1.5%, aucune bande correspondant au complexe RecAaptamère n'est observée. Les résultats sont donnés sur les Figures 4A et 4B. After separation from the reaction medium by 1.5% agarose gel electrophoresis, no band corresponding to the RecAaptamer complex is observed. The results are given in Figures 4A and 4B.
Les résultats obtenus font nettement apparaître que A30 et A79 n'interagissent pas avec la protéine RecA ajoutée à des concentrations allant jusqu'à The results obtained clearly show that A30 and A79 do not interact with the RecA protein added at concentrations up to
1 μM, ce qui démontre la très haute sélectivité vis-à-vis de la protéine Rad51 humaine des aptamères inhibiteurs de l'invention.
Etudes structurales des aptamères A30 et A79 1 μM, which demonstrates the very high selectivity with respect to the human Rad51 protein of the inhibitor aptamers of the invention. Structural studies of aptamers A30 and A79
Les aptamères A79 et A30 ont été fragmentés de façon à prendre en compte les différentes parties de la séquence, et à maintenir des structures secondaires. Les structures obtenues sont représentées sur les Figures 5A et 5 B: (A) L'aptamère A30 a été fragmenté en 3 segments A30-1 , A30-2, et A30-3 correspondant respectivement aux segments 1 -31 , 32-62, 63-94 de la séquence entière. (B) Les structures secondaires prévisionnelles de l'aptamère A30 entier et des fragments A30-1 , A30-2, et A30-3 obtenues par MFoId à 37°C sont présentées. The aptamers A79 and A30 were fragmented to take into account the different parts of the sequence, and to maintain secondary structures. The structures obtained are shown in FIGS. 5A and 5B: (A) aptamer A30 was fragmented into 3 segments A30-1, A30-2, and A30-3 respectively corresponding to segments 1 -31, 32-62, 63-94 of the entire sequence. (B) The predicted secondary structures of the entire aptamer A30 and the A30-1, A30-2, and A30-3 fragments obtained by MFoId at 37 ° C are presented.
Les séquences des différents segments des aptamères ont été analysées avec le logiciel en ligne MFoId (7) (http://mfold.bioinfo.rpi.edu/). The sequences of the different segments of the aptamers were analyzed with the online software MFoId (7) (http://mfold.bioinfo.rpi.edu/).
L'aptamère A30, de 94 nucléotides (nt) a été découpé en 3 fragments d'environ 32 nt. Les structures secondaires prévisionnelles des différents fragments ont également été déterminées (Figure 5). The A30 aptamer 94 nucleotides (nt) was cut into 3 fragments of about 32 nt. The predicted secondary structures of the different fragments were also determined (Figure 5).
L'aptamère A79 de 60 nt a été découpé en 4 fragments de tailles comprises entre 23 et 38 nt. Les structures secondaires prévisionnelles des différents fragments ont été également déterminées. Les résultats ont donnés sur la Figure 6: (A) L'aptamère A79 a été fragmenté en 4 segments A79-1 , A79-2, A79-3 et A79-4 correspondant respectivement aux segments 1 -35, 23-58, 12-49 et 27-49 de la séquence entière. (B) Les structures secondaires prévisionnelles de l'aptamère entier et les fragments A79-1 , A79-2, A79-3 et A79-4 obtenues par MFoId a 37°C sont présentées. The aptamer A79 60 nt was cut into 4 fragments of sizes between 23 and 38 nt. The predicted secondary structures of the different fragments were also determined. The results are given in Figure 6: (A) A79 aptamer was fragmented into 4 segments A79-1, A79-2, A79-3 and A79-4 respectively corresponding to segments 1 -35, 23-58, 12 -49 and 27-49 of the entire sequence. (B) The predicted secondary structures of the whole aptamer and the A79-1, A79-2, A79-3 and A79-4 fragments obtained by MFoId at 37 ° C are presented.
Les résultats montrent que les deux aptamères (A30 et A79) forment des structures en tige- boucle connues pour favoriser la stabilité des acides nucléiques simples brins (ADN et ARN). Cette stabilité est également liée à la composition en bases, l'appariement entre guanine (G) et cytosine (C) favorisant la stabilité par rapport à l'appariement entre adénine (A) et thymine (T), dû au nombre de liaisons hydrogènes (3 liaisons pour G-C, contre 2 liaisons pour A-T). De plus, l'aptamère A30 comporte 61 % de nucléotides G-C et 59% pour A79, ce qui contribue à la stabilisation de leur structure. La structure d'A30 est plus complexe, formant 4 boucles fermées, ainsi que 3 tiges avec plusieurs liaisons G-C (..G = -13,20 kcal/mol à 37°C, déterminé par MFoId). L'aptamère A79 forme une structure visiblement moins complexe, avec un nombre plus faible de liaisons G-C qu'A30 (..G = -6,07 kcal/mol à 37°C, déterminé par MFoId).
Étude de la structure des aptamères The results show that both aptamers (A30 and A79) form stem-loop structures known to promote the stability of single-stranded nucleic acids (DNA and RNA). This stability is also linked to the composition of bases, the pairing between guanine (G) and cytosine (C) favoring stability with respect to the pairing between adenine (A) and thymine (T), due to the number of hydrogen bonds (3 links for GC, against 2 links for A-T). In addition, aptamer A30 has 61% nucleotide GC and 59% A79, which contributes to the stabilization of their structure. The structure of A30 is more complex, forming 4 closed loops, as well as 3 stems with several GC bonds (G = -13.20 kcal / mol at 37 ° C, determined by MFoId). A79 aptamer forms a visibly less complex structure, with a lower number of GC bonds than A30 (g = -6.07 kcal / mol at 37 ° C, determined by MFoId). Study of the aptamer structure
La structure des aptamères a été étudiée en utilisant le dichroïsme circulaire (CD, pour Circular Dichroism). La température induit des changements dans la structure des acides nucléiques. Le spectre des aptamères A79 et A30 a été étudié à différentes températures, pour des longueurs d'onde comprises entre 220 et 340 nm. Les résultats sont donnés sur la Figure 7: (A) Des spectres CD ont été obtenus à 200C et à 800C dans un tampon TrisHCI. Les 2 aptamères présentent une courbe positive à 275 nm et une courbe négative à 245 nm. (B) Des courbes CD des aptamères ont été mesurés à longueur d'onde constante de 275 nm. Des courbes en fonction de la température ont été obtenues, en montant la température de 20°C à 800C et en descendant la température. (C) Des courbes d'absorbance ont été mesurées à 260 nm avec des variations de températures comme décrit en (B). The structure of aptamers was studied using circular dichroism (CD, for Circular Dichroism). The temperature induces changes in the structure of the nucleic acids. The spectrum of aptamers A79 and A30 has been studied at different temperatures, for wavelengths between 220 and 340 nm. The results are given in FIG. 7: (A) CD spectra were obtained at 20 ° C. and at 80 ° C. in a TrisHCI buffer. The 2 aptamers have a positive curve at 275 nm and a negative curve at 245 nm. (B) CD curves of aptamers were measured at a constant wavelength of 275 nm. Curves as a function of temperature were obtained by raising the temperature from 20 ° C. to 80 ° C. and lowering the temperature. (C) Absorbance curves were measured at 260 nm with temperature variations as described in (B).
L'amplitude du signal à ces deux longueurs d'onde est maximale à 20°C, et diminue d'environ 50% lorsque la température atteint à 80°C, ce qui reflète une perte de la structure. Cet effet majeur peut être expliqué par une chiralité des aptamères moins importante induite par un plus faible appariement et empilement des bases à 800C. The signal amplitude at these two wavelengths is maximum at 20 ° C, and decreases by about 50% when the temperature reaches 80 ° C, reflecting a loss of structure. This major effect can be explained by a lower chirality of aptamers induced by weaker pairing and stacking of bases at 80 ° C.
Des courbes CD et UV ont été obtenues en augmentant la température (de 20°C à 80 °C) et par la suite en descendant la température (de 800C à 20°C). Les spectres CD montrent un point d'inflexion, qui correspond à un changement de la structure de l'aptamère, et qui corresponde au Tm (température de fusion). Ceci peut être visualisé également dans les courbes d'absorbance UV. La Tm pour l'aptamère A79 est de 55°C et la Tm pour A30 est de 400C. CD and UV curves were obtained by increasing the temperature (from 20 ° C. to 80 ° C.) and subsequently by lowering the temperature (from 80 ° C. to 20 ° C.). The CD spectra show a point of inflection, which corresponds to a change in the aptamer structure, and which corresponds to the Tm (melting temperature). This can be visualized also in the UV absorbance curves. The Tm for aptamer A79 is 55 ° C and the Tm for A30 is 40 ° C.
La composition en bases des aptamères A30 et A79 montre qu'ils présentent 61 % et 59% de bases G-C. Ce haut contenu en liaisons G-C pourrait expliquer la présence de structures secondaires. L'aptamère A30 contient 30% de G, 31 % de C, 18% de A et 21 % de T. L'aptamère A79 contient 27% de G, 32% de C, 25% de A et 16% de T.
Références Bibliographiques The base composition of aptamers A30 and A79 shows that they have 61% and 59% GC bases. This high content of GC bonds could explain the presence of secondary structures. A30 aptamer contains 30% G, 31% C, 18% A and 21% T. The aptamer A79 contains 27% G, 32% C, 25% A and 16% T. Bibliographical References
1 - Tuerk et GoId 1990,, Science 249: 505-510 1 - Tuerk and GoId 1990 ,, Science 249: 505-510
2 - Ellington et Szostak, 1990, 346: 812-822 2 - Ellington and Szostak, 1990, 346: 812-822
3 - Fukusaki et al., 2000, Bioorg med Chem lett 10: 423-5 3 - Fukusaki et al., 2000, Bioorg med Chem lett 10: 423-5
4 - Takisawa et al., 2004, gènes to CeIIs, 9, 781 -790 4 - Takisawa et al., 2004, genes to CeIIs, 9, 781-790
5 - Bailey & Elkan, 1994, Proc Int Conf Intell Syst Mol Biol, 2, 28-36, 5 - Bailey & Elkan, 1994, Proc Int. Intell. Syst Mol Mol, 2, 28-36,
6 - Bailey et al., 2006, Nucl.Acids Res.34: W369-373 6 - Bailey et al., 2006, Nucl.Acids Res. 34: W369-373
7 - Zucker, 2003, Nucl.Acids Res.31 : 3406-3415, 7 - Zucker, 2003, Nucl.Acids Res.31: 3406-3415,
8 - Bradford, 1976, Anal Biochem, 72, 248-254, 8 - Bradford, 1976, Anal Biochem, 72, 248-254,
9 - Jackson, 1991 , A User's Guide to Principal Components, Wiley N. Y.
9 - Jackson, 1991, A User's Guide to Principal Components, Wiley N. Y.
Claims
Revendications claims
1 - Aptamères susceptibles d'être obtenus par la technique SELEX dans laquelle une banque d'ADN simple brin (ADNsb) synthétique contenant une région centrale aléatoire entourée de régions constantes aux extrémités 5' et 3', utilisées comme sites de fixation pour les amplifications, est incubée avec une molécule cible, les ADN ayant interagi avec la cible étant seuls retenus et amplifiés pour un nouveau tour de sélection, pour enrichir la banque en séquences interagissant spécifiquement avec la protéine cible, les ADN sélectionnés étant clones, 1-Aptamers obtainable by the SELEX technique in which a synthetic single-stranded DNA (ssDNA) library containing a random central region surrounded by constant regions at the 5 'and 3' ends, used as fixation sites for amplifications , is incubated with a target molecule, the DNAs having interacted with the target being alone retained and amplified for a new round of selection, to enrich the bank in sequences interacting specifically with the target protein, the selected DNAs being cloned,
caractérisés en ce que characterized in that
- la molécule cible est la protéine Rad51 , cette protéine étant incubée avec une banque d'ADNsb, en présence d'un tampon de sélection renfermant MgC^ et ATP, the target molecule is the Rad51 protein, this protein being incubated with an ssDNA library, in the presence of a selection buffer containing MgCl 2 and ATP,
- le complexe ADN-Rad51 formé est séparé par électrophorèse et l'ADN retardé extrait du gel, the formed DNA-Rad51 complex is separated by electrophoresis and the delayed DNA extracted from the gel,
- à chaque tour de sélection, l'ADN sélectionné est ré-amplifié à l'aide des amorces P1 et P2, puis uniquement avec l'amorce P1 , et l'affinité relative vis- à-vis de Rad51 est évaluée, at each round of selection, the selected DNA is re-amplified using the primers P1 and P2, then only with the primer P1, and the relative affinity with respect to Rad51 is evaluated,
- l'astringence étant augmentée durant la sélection, - the astringency being increased during the selection,
- les ADNsb issus du dernier tour de sélection sont isolés, clones dans des piasmides, les plasmides étant ensuite extraits, purifiés et séquences, the ssDNAs from the last round of selection are isolated, cloned in plasmids, the plasmids then being extracted, purified and sequenced,
- les séquences sélectionnées sont regroupées sur la base de leurs similarités et de la présence de motifs consensus, the selected sequences are grouped on the basis of their similarities and the presence of consensus patterns,
les aptamères ainsi sélectionnés présentant un effet inhibiteur de l'activité recombinase de Rad51 d'au moins 70%, plus spécialement d'au moins 80%. the aptamers thus selected having an inhibitory effect on the Rad51 recombinase activity of at least 70%, more especially at least 80%.
2 - Aptamères selon la revendication 1 , caractérisés en ce qu'ils présentent un Kd apparent de l'ordre de 40 à 90 nM et comportent environ 60% de bases G-C. 2 - Aptamers according to claim 1, characterized in that they have an apparent Kd of the order of 40 to 90 nM and comprise about 60% G-C bases.
3 - Aptamères selon la revendication 1 ou 2, caractérisés en ce qu'ils répondent aux séquences SEQ ID N°2-10. 3 - Aptamers according to claim 1 or 2, characterized in that they correspond to the sequences SEQ ID No. 2-10.
4 - Aptamères selon l'une quelconque des revendications 1 à 3 pour une utilisation comme inhibiteurs de Rad51. 4 - Aptamers according to any one of claims 1 to 3 for use as inhibitors of Rad51.
5 - Compositions pharmaceutiques, caractérisées en ce qu'elles renferment une quantité thérapeutiquement efficace d'au moins un apatamère selon l'une
quelconque des revendications 1 à 3, en association avec un véhicule pharmaceutiquement inerte. 5 - Pharmaceutical compositions, characterized in that they contain a therapeutically effective amount of at least one apatamer according to one of any of claims 1 to 3 in association with a pharmaceutically inert carrier.
6 - Compositions pharmaceutiques selon la revendication 5, caractérisées en ce qu'elles se présentent sous une forme destinée à une administration par voie orale, injectable, parentérale.
6 - Pharmaceutical compositions according to claim 5, characterized in that they are in a form intended for oral administration, injectable, parenteral.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR09/03778 | 2009-07-31 | ||
FR0903778A FR2948663B1 (en) | 2009-07-31 | 2009-07-31 | "APTAMERS THAT INHIBIT THE ACTIVITY OF THE HUMAN PROTEIN Rad51 AND THEIR BIOLOGICAL APPLICATIONS" |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2011013040A1 true WO2011013040A1 (en) | 2011-02-03 |
Family
ID=41571515
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IB2010/053343 WO2011013040A1 (en) | 2009-07-31 | 2010-07-22 | Aptamers which inhibit the activity of the human rad51 protein, and biological uses thereof |
Country Status (2)
Country | Link |
---|---|
FR (1) | FR2948663B1 (en) |
WO (1) | WO2011013040A1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040224335A1 (en) * | 1995-06-07 | 2004-11-11 | Gilead Sciences, Inc. | Methods and compositions for treatment of tumors using nucleic acid ligands to platelet-derived growth factor |
-
2009
- 2009-07-31 FR FR0903778A patent/FR2948663B1/en not_active Expired - Fee Related
-
2010
- 2010-07-22 WO PCT/IB2010/053343 patent/WO2011013040A1/en active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040224335A1 (en) * | 1995-06-07 | 2004-11-11 | Gilead Sciences, Inc. | Methods and compositions for treatment of tumors using nucleic acid ligands to platelet-derived growth factor |
Non-Patent Citations (15)
Title |
---|
BAILEY ET AL., NUCL.ACIDS RES., vol. 34, 2006, pages W369 - 373 |
BAILEY; ELKAN, PROC INT CONF INTELL SYST MOL BIOL, vol. 2, 1994, pages 28 - 36 |
BRADFORD, ANAL BIOCHEM, vol. 72, 1976, pages 248 - 254 |
CERCHIA LAURA ET AL: "Nucleic acid-based aptamers as promising therapeutics in neoplastic diseases.", METHODS IN MOLECULAR BIOLOGY (CLIFTON, N.J.) 2007, vol. 361, 2007, pages 187 - 200, XP009128952, ISSN: 1064-3745 * |
DATABASE EMBL [online] 26 March 2008 (2008-03-26), "DNA aptamer specifically binding to 8-OHdG.", XP002566650, retrieved from EBI accession no. EMBL:DJ128960 Database accession no. DJ128960 * |
FUKUSAKI ET AL., BIOORG MED CHEM LETT, vol. 10, 2000, pages 423 - 5 |
MARTINEZ S.F ET AL.: "Targeting human Rad51 by specific DNA aptamers induces inhibition of homologous recombination", BIOCHIMIE, 14 August 2010 (2010-08-14), pages 1 - 7, XP002612769 * |
NOMME JULIAN ET AL: "Inhibition of filament formation of human Rad51 protein by a small peptide derived from the BRC-motif of the BRCA2 protein", GENES TO CELLS, vol. 13, no. 5, May 2008 (2008-05-01), pages 471 - 481, XP002566649, ISSN: 1356-9597 * |
OGURO AKIHIRO ET AL: "RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis.", RNA (NEW YORK, N.Y.) APR 2003, vol. 9, no. 4, April 2003 (2003-04-01), pages 394 - 407, XP002566648, ISSN: 1355-8382 * |
SLUPIANEK ARTUR ET AL: "Selective Anti-Leukemia Targeting of the Interaction Between BCR/ABL and Mammalian RecA Homologs", BLOOD, vol. 112, no. 11, November 2008 (2008-11-01), & 50TH ANNUAL MEETING OF THE AMERICAN- SOCIETY-OF-HEMATOLOGY; SAN FRANCISCO, CA, USA; DECEMBER 06 -09, 2008, pages 79 - 80, XP009128889, ISSN: 0006-4971 * |
TAKISAWA ET AL., GENES TO CELLS, vol. 9, 2004, pages 781 - 790 |
TRUJILLO CLEBER A ET AL: "Development of the anti-VEGF aptamer to a therapeutic agent for clinical ophthalmology.", CLINICAL OPHTHALMOLOGY (AUCKLAND, N.Z.) DEC 2007, vol. 1, no. 4, December 2007 (2007-12-01), pages 393 - 402, XP002566647, ISSN: 1177-5467 * |
TUERK; GOLD, SCIENCE, vol. 249, 1990, pages 505 - 510 |
ULRICH HENNING: "DNA AND RNA APTAMERS AS MODULATORS OF PROTEIN FUNCTION", MEDICINAL CHEMISTRY, BENTHAM SCIENCE PUBLISHERS LTD, BUSSUM, NL, vol. 1, no. 2, 1 March 2005 (2005-03-01), pages 199 - 208, XP001248936, ISSN: 1573-4064 * |
ZUCKER, NUCL.ACIDS RES., vol. 31, 2003, pages 3406 - 3415 |
Also Published As
Publication number | Publication date |
---|---|
FR2948663B1 (en) | 2011-09-02 |
FR2948663A1 (en) | 2011-02-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Katayama et al. | The DnaA cycle in Escherichia coli: activation, function and inactivation of the initiator protein | |
Webster et al. | mRNA deadenylation is coupled to translation rates by the differential activities of Ccr4-Not nucleases | |
Stoltenburg et al. | Capture-SELEX: selection of DNA aptamers for aminoglycoside antibiotics | |
Grimme et al. | Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52–ssDNA complexes | |
Lunde et al. | RNA-binding proteins: modular design for efficient function | |
Harlocker et al. | Tandem binding of six OmpR proteins to the ompF upstream regulatory sequence of Escherichia coli | |
Mehta et al. | In vitro selection and characterization of DNA aptamers recognizing chloramphenicol | |
Burra et al. | Human AP-endonuclease (Ape1) activity on telomeric G4 structures is modulated by acetylatable lysine residues in the N-terminal sequence | |
Kang et al. | Novel interaction of the Z-DNA binding domain of human ADAR1 with the oncogenic c-Myc promoter G-quadruplex | |
Lee et al. | Multiple RPAs make WRN syndrome protein a superhelicase | |
Le et al. | Bacillus subtilis RecA with DprA–SsbA antagonizes RecX function during natural transformation | |
Virgilio et al. | The insertion of two 8-methyl-2′-deoxyguanosine residues in tetramolecular quadruplex structures: trying to orientate the strands | |
Kanevsky et al. | Structural determinants of TAR RNA-DNA annealing in the absence and presence of HIV-1 nucleocapsid protein | |
Jain et al. | Conformational insights into the lesion and sequence effects for arylamine-induced translesion DNA synthesis: 19F NMR, surface plasmon resonance, and primer kinetic studies | |
Fisunov et al. | Binding site of MraZ transcription factor in Mollicutes | |
Bing et al. | G-quadruplex DNA aptamers generated for systemin | |
Das et al. | Evolution of peptide nucleic acid with modifications of its backbone and application in biotechnology | |
Liano et al. | Cockayne syndrome B protein selectively resolves and interact with intermolecular DNA G-quadruplex structures | |
Joeng et al. | ssDNA aptamers that recognize diclofenac and 2-anilinophenylacetic acid | |
Vassart et al. | Sa‐L rp from S ulfolobus acidocaldarius is a versatile, glutamine‐responsive, and architectural transcriptional regulator | |
Štros | Two mutations of basic residues within the N-terminus of HMG-1 B domain with different effects on DNA supercoiling and binding to bent DNA | |
Mela et al. | Demonstration of ligand decoration, and ligand-induced perturbation, of G-quadruplexes in a plasmid using atomic force microscopy | |
Han et al. | SSO1450–a CAS1 protein from Sulfolobus solfataricus P2 with high affinity for RNA and DNA | |
Beattie et al. | The role of the DNA sliding clamp in Okazaki fragment maturation in archaea and eukaryotes | |
Kumar et al. | Binding of two DNA molecules by type II topoisomerases for decatenation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10745006 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 10745006 Country of ref document: EP Kind code of ref document: A1 |