WO2011004397A1 - Nucleic acid primers, probe and method for detection of neisseria gonorrhoeae - Google Patents
Nucleic acid primers, probe and method for detection of neisseria gonorrhoeae Download PDFInfo
- Publication number
- WO2011004397A1 WO2011004397A1 PCT/IN2010/000457 IN2010000457W WO2011004397A1 WO 2011004397 A1 WO2011004397 A1 WO 2011004397A1 IN 2010000457 W IN2010000457 W IN 2010000457W WO 2011004397 A1 WO2011004397 A1 WO 2011004397A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gonorrhoeae
- probe
- detection
- neisseria gonorrhoeae
- avidin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
Definitions
- the present invention relates to nucleic acid primers and probe for detection of Neisseria gonorrhoeae.
- N. gonorrhoeae is the causative agent of gonorrhoea, a bacterial sexually transmitted infection (STI). More particularly, the present invention relates to a novel oligonucleotide probe sequence, which is useful for the detection of N. gonorrhoeae with very high specificity and sensitivity. The said probe is able to detect N. gonorrhoeae amongst other Non-Neisseria gonorrhoeae Neisseria strains (NgNS) and other Gram negative Bacteria (GNB).
- NgNS Non-Neisseria gonorrhoeae Neisseria strains
- GNB Gram negative Bacteria
- the probe sequence in addition to being highly specific for N. gonorrhoeae can also be used as a primer for in vitro amplification of opa gene of N. gonorrhoeae.
- the said probe may be immobilized on different biomaterials for detecting N. gonorrhoeae by hybridization technology using a biosensor, thereby allowing rapid, reliable and cost-effective detection of gonorrhoea in invasive and possibly non-invasive samples.
- the present invention provides an alternative diagnostic method that can potentially eliminate the hassels of culturing bacterial strains and simultaneously increase the sensitivity and specificity of detecting gonorrhoea. - BACKGROUND OF INVENTION
- Gonorrhoea is a bacterial sexually transmitted infection (STI) caused by Neisseria gonorrhoeae.
- STI sexually transmitted infection
- Microscopy and culture are the two conventional methods used for its diagnosis.
- the diagnosis can be made by direct microscopy of stained smears of urethral discharge (sensitivity and specificity > 95%).
- sensitivity and specificity > 97%.
- women it has a limited sensitivity and specificity (approximately 40%). Therefore, in asymptomatic male patients, female patients and when a definitive test of cure is required, specimens need to be cultured. Standard culture techniques have been described in the WHO manual, Laboratory Diagnosis of Gonorrhoea, WHO Regional Publication, South-East Asia Series.
- the clinical specimen i.e., endocervical/urethral swab is plated on selective media, preferably two (one with and one without inhibitors).
- the culture plates are then incubated at 36 0 C in an atmosphere of 5% CO 2 for 24 hrs to 48 hrs following which they are inspected for appearance of N. gonorrhoeae colonies. Suspected colonies are subjected to Gram stain, oxidase and Superoxol test. Organism presumptively identified as N. gonorrhoeae are confirmed by Rapid Carbohydrate Utilization Tests (RCUT). These methods and procedures are laborious, time consuming and limited to detection of living cells only.
- RCUT Rapid Carbohydrate Utilization Tests
- gonorrhoea infertility, Pelvic Inflammatory Disorders (PID), ophthalmia, foetal loss, disseminated infection
- PID Pelvic Inflammatory Disorders
- ophthalmia foetal loss
- disseminated infection is significantly reduced by early and appropriate treatment.
- gonorrhoea has been identified as a co-factor in HIV transmission and this new association provides an important reason for proper and timely treatment of gonorrhoea.
- Numerous epidemiological studies suggest that there is approximately two to five-fold greater risk of acquiring HIV in the presence of gonorrhoea. The susceptibility to HIV is removed by effective treatment resolving the inflammatory infiltrate. Therefore, there is a need to actively diagnose and effectively treat gonorrhoea.
- Neisseria The genus Neisseria includes two species pathogenic for humans: Neisseria gonorrhoeae and Neisseria meningitidis.
- N. gonorrhoeae is known to cause asymptomatic infections in a large majority of patients but whenever isolated/detected, it is always considered to be a pathogen.
- N. meningitidis is known to colonize individuals in throat/ nasopharynx without causing disease and its carrier state is well known.
- N. gonorrhoeae has a 93% homology with N. meningitidis at DNA level.
- Neisseria specific probes have been described in US 5162199, titled “ ⁇ fe/sser/a-specific DNA probe", which can detect at least one of the pathogenic Neisseria species, Neisseria gonorrhoeae and/or Neisseria meningitidis under hybridization conditions by the detection of hybrid formation.
- NAATs Nucleic Acid amplification tests
- a drawback of this method is that 5-10% of N. gonorrhoeae strains do not contain the plasmid; therefore assays that target cppB gene may fail to detect upto 10% of the cases. Whether a particular strain contains the plasmid is dependant to some extent on the geographical area in which the strain is found. Thus, this method can only detect infection with strains having the plasmid and will not detect strains that do not contain the plasmid. Such a test will not be reliable and accurate if used in areas where the strains do not have the plasmid.
- PCR assays perform well in detecting gonococcal infection on the invasive genital specimens i.e., endocervical and urethral swabs but the sensitivity decreases considerably, giving upto 50% false negatives, when urine samples were used. Also, PCR has been tested only on symptomatic patients so its performance in asymptomatic patients is not known. Besides, a high false positivity of PCR has been reported, especially in commercial assays due to cross reactions with commensal Neisseria sp.
- Miyada et al have described a N. gonorrhoeae specific probe based on ORF gene in US 5525717 titled “Support based nucleotide probe for Neisseria gonorrhoeae” and US 6020461 "Hexapeptides of Neisseria gonorrhoeae”.
- Birkenmeyer et al have described probes and primers based on pilin gene (pilE) in US 5453355 titled “Oligonucleotides and methods for the detection of Neisseria gonorrhoeae”.
- pilin genes based assays lack sensitivity.
- opa gene is a multicopy gene (9—11 copies) of N. gonorrhoeae. Targeting a multicopy gene will provide a low detection limit and hence enable us to diagnose asymptomatic infections where the bacterial load is very low.
- a DNA fragment containing fewer than about 12 nucleotides is believed to have insufficient complexity to be specific for a given organism.
- Nucleic acids do not require complete homology to hybridize.
- the homologous and partially homologous nucleic acid sequences can be made to hybridize by adjusting the hybridization conditions to increase or decrease the stringency i.e., by adjusting the hybridization temperature or salt content of the buffer.
- the inventors of the present invention realized that there exists a dire need to provide a 15 to 20 mer oligonucleotide probe, which could bind to a specific stretch of the opa gene of Neisseria gonorrhoeae and thus, useful for its detection with a very high sensitivity and specificity.
- the main object of the present invention is thus to provide primers and probes useful for the rapid detection of Neisseria gonorrhoeae regardless of the metabolic state, which obviates the disadvantages associated with traditional detection techniques done by culturing.
- Another object of the present invention is to provide an oligonucleotide probe capable of hybridizing to a unique nucleotide sequence from opa gene, which is a multicopy gene of Neisseria gonorrhoeae, thereby improving the detection limit to enable diagnosis of asymptomatic infections using biosensor technology.
- Yet another object is to provide a system to detect the hybridization electrochemically thereby improving the sensitivity (upto femtomolar concentration) and specificity.
- Still another object is to provide a probe that can distinguish not only the two pathogenic Neisseria species but can also differentiate it from other Non-Neisseria gonorrhoeae Neisseria species (NgNS) and other Gram-negative bacteria.
- NgNS Non-Neisseria gonorrhoeae Neisseria species
- Yet another object is to provide a nucleic acid probe for use in biosensors capable of detecting Neisseria gonorrhoeae in all types of clinical samples.
- a further object of the invention is to provide a biosensor, wherein the results are based on the amplification of the signal and not on target DNA, which is liable to be affected by the presence of inhibitors in biological fluids.
- the present invention provides nucleic acid primers and probe useful for the detection of Neisseria gonorrhoeae, wherein the said probe is represented by SEQ ID 1, having the sequence "CGGTGCTTCATCACCTTAG".
- the nucleic acid probe sequence of the present invention is highly specific for Neisseria gonorrhoeae as seen on performing BLAST and is present in opa A,C,D,E,F,H,IJ,K,opacity protein variant VO, V28 gene.
- the hybridization is detected electrochemically.
- the sensitivity of the process is very high (upto femtomolar concentration) and so is the specificity. Even a one base mismatch gives a difference in the signal and hence can be differentiated.
- the probe is specific in providing no signal with Non- Neisseria gonorrhoeae Neisseria species (NgNS) and other gram negative bacteria (GNB).
- NgNS Non- Neisseria gonorrhoeae Neisseria species
- GNB gram negative bacteria
- the current invention and its proposed usage as a biosensor is based on the amplification of the signal.
- the biosensor utilizes the recognition layer (comprising of the probe DNA immobilized onto the solid support) that will hybridize with the analyte (target DNA) and with the help of transducer trigger a usable signal for electronic read-out.
- the present invention provides nucleic acid probes for use in biosensors capable of detecting Neisseria gonorrhoeae in all types of clinical samples without being affected by inhibitors. Accordingly, the present invention provides a pair of oligonucleotide primers for the specific amplification of opa gene of Neisseria gonorrhoeae by PCR, consisting of:
- the forward nucleotide primer of SEQ ID No. 1 or its complement useful as a probe for the detection of Neisseria gonorrhoeae.
- the probe is labelled with biotin and the labelled probe is useful for detection of Neisseria gonorrhoeae.
- the nucleic acid probe is specific in providing no signal with Non-N. gonorrhoeae Neisseria strains (NgNS) and other Gram negative Bacteria (GNB).
- NgNS Non-N. gonorrhoeae Neisseria strains
- GNB Gram negative Bacteria
- the hybridized regions of the probe of SEQ ID 1 or its complement, and the target nucleic acid sequence or its complement have 95-100% complementarity.
- an electrochemical method for the species specific detection of Neisseria gonorrhoeae with high sensitivity and specificity comprising the steps of:
- nsPANI nanostructured polyaniline
- ITO Indium tin oxide
- step (b) immobilizing 2 ⁇ l of avidin (lmg/ml) onto the ns-PANI/ITO surface as obtained in step (a) followed by washing the avidin-ns-PANI/ITO surface;
- step (e) incubating the BdNG-avidin-nsPANI/ITO electrode as obtained in step (d) with the test sample to be tested for Neisseria gonorrhoeae;
- detecting the presence of Neisseria gonorrhoeae in the test sample by evaluating the hybridization of the target nucleic acid sequence present in the test sample with the BdNG-avidin-nsPANI/ITO electrode, which is done by monitoring the oxidation/reduction peak of methylene blue indicator determined by Cyclic voltammetry (CV)/ Differential Pulse Voltammetry (DPV) measurements.
- the decrease in the magnitude of methylene blue redox peak indicates the presence of N. gonorrhoeae in the sample.
- the concentration of complementary target (dNG) and non-complementary target (dNG' ) oligonucleotide solution is in the range of 1 X 10 "6 M to 1 X lO "16 M for 60 seconds at 25° C.
- the method determines the presence of N. gonorrhoeae in both invasive as well as non-invasive samples.
- the method has high detection sensitivity upto 10 "16 M of DNA.
- the method detects upto single base pair mismatch in target DNA providing high specificity.
- kits for the detection of Neisseria gonorrhoeae comprising of oligonucleotide primer of Seq ID No. 1, or the complement thereof along with buffers and instructional manual for operating the said kit.
- a biosensor for the detection of Neisseria gonorrhoeae wherein it comprises:
- a transducer capable of amplifying the oxidation/reduction signal of methylene blue, monitored by Cyclic Voltammetry (CV), Differential Pulse Voltammetry (DPV) transducer and the like.
- CV Cyclic Voltammetry
- DUV Differential Pulse Voltammetry
- the oligonucleotide of SEQ. ID 1 is used in the form of a probe for detection of N. gonorrhoeae in clinical samples using hybridization in solution with methylene blue as hybridization monitor agent followed by electrochemical detection.
- the immobilization support is selected from polyaniline electrodes, screen printed carbon electrodes, gold electrodes, sol-gel derived matrices, metal oxides, polymers and conducting polymers.
- the biosensor for the detection of Neisseria gonorrhoeae is based on amplification of the signal obtained.
- the presence of target DNA i.e., DNA of N. gonorrhoeae is determined by monitoring the oxidation/reduction peak of methylene blue indicator (electrochemical detection) at pulse height of 5OmV, pulse width of 70ms.
- the CV/DPV of the immobilized probe is monitored after methylene blue (MB, 40 ⁇ M) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl.
- methylene blue (MB, 40 ⁇ M) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl.
- the magnitude of peak decreases indicating the presence of N. gonorrhoeae in the sample.
- the decrease in the magnitude of methylene blue redox peak indicates the presence of N. gonorrhoeae in the sample.
- the absence of MB peak after hybridization with the complementary synthetic oligomer is attributed to steric inhibition of MB packing/intercalation between double helix of the hybrid.
- Neisseria gonorrhoeae nucleic acids can be detected in clinical samples, bacterial culture and PCR products.
- a rapid and reliable test that can be successfully carried out for the presence of Neisseria gonorrhoeae in clinical samples. Presence of a bacterial culture is not necessary for this and thus the method of the present invention obviates the need for additional biochemical tests normally required to distinguish N. gonorrhoeae from other Neisseria sp.
- a newly identified region of the N. gonorrhoeae genome is used to detect N. gonorrhoeae nucleic acids in clinical samples by hybridization using biosensor technology or amplification assays.
- nucleic acid probes and amplification primers have been developed for the specific identification of N. gonorrhoeae without any cross- reactivity with other Neisseria sp.
- a unique nucleotide sequence from opa gene which is a multicopy gene of Neisseria gonorrhoeae has been described thereby improving the detection limit to upto femtomolar concentrations of DNA, thereby enabling diagnosis of asymptomatic infections where a low detection limit is crucial.
- Detection can be accomplished electrochemically using the biosensor technology or by amplification assays.
- the method described herein provides a high degree of accuracy with respect to the detection of N. gonorrhoeae with substantial minimization or virtual elimination of false positive readings, as this assay has the capability of detecting even a single base mismatch in the target DNA when biosensor technology is used.
- Figure 2 Shows sensitivity of PCR: It depicts the gel picture of PCR put up using different dilutions of this DNA extracted from WHO C strain of N. gonorrhoeae. A band of 188 bps could be detected upto 10° dilutions (Lane 6).
- Figure 3 Shows specificity of PCR:
- Figure 3a and 3b depict gel pictures of PCR put up from DNA extracted from N. gonorrhoeae and other related and non-related bacteria.
- the primers specifically amplified the N. gonorrhoeae opa gene to give a band of around ' 188 bps- Lane 4 in Figure 3a and Lane 2 in Figure 3b. No band was seen in the gel for other related and unrelated bacteria
- Figure 4 Detection of N. gonorrhoeae in clinical samples: It depicts gel picture of PCR done on DNA extracted from clinical samples (Endocervical swabs in females and urethral discharge in males). Lanes 2,3,4,5 are positive clinical samples giving a band of around 188 bps.
- Figure 5 Shows immobilization of Probe DNA on polyaniline matrix in PBS in presence of Methylene blue: Figure 5 depicts the Differential pulse voltammograms (DPV) of - (i)Bare ITO,
- Figure 6 Shows sensitivity of Probe DNA using Polyaniline as a matrix in PBS in presence of Methylene blue.
- Figure 6 depicts Differential pulse voltammogarms of BdNG-avidin- PANI/ITO after hybridization with complementary target probe (dNG) concentration lO "6 M - 10 "15 M, at pulse height of 50 mV and pulse width of 70 ms, after methylene blue (MB, 20 ⁇ M) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl).
- the detection limit of dNG-BdNG-avidin-PANI/ITO electrode is 10 ⁇ 16 M.
- Figure 7 Shows specificiaty of Probe DNA on polyaniline matrix in PBS in presence of Methylene blue.
- Figure 7 depicts Differential pulse voltammograms (DPV) of - (Hi)N. meningitidis spiked swab sample
- MgCl 2 Magnesium chloride bps: base pairs
- NASBA Nucleic Acid Sequence Based Amplification
- LAMP Loop-mediated Amplification Assay
- the WHO standard strains of N. gonorrhoeae have been procured from the WHO collaborative centre for STD and HIV, Australia.
- the oligonucleotide probe and primer sequences were designed using the available software and from the gene sequences available in the GenBank database. For selecting a conserved sequence the different opa gene types of Neisseria gonorrhoeae were aligned by using ClustalX. The conserved sequence was then analyzed using Primer3 software available online for determining the suitable primers. The selected oligonucleotide sequence was then analyzed for non-specific binding using BLAST.
- the primer sequences that were obtained are: Forward Primer (FP) represented by SEQ ID 1: 5' CGGTGCTTCATCACCTTAG 3' Reverse Primer (RP) represented by SEQ ID 2: 5' GGATTCATTTTCGGCTCCTT 3'.
- the sequences have been validated by GenBank.
- GenBank accession numbers for the same are (GenBank PUID SNUM 9716120 2706 Ng_opa).
- SEQ ID No. 1 serves both as the forward primer for the amplification of the opa gene of Neisseria gonorrhoeae as well as the probe for the detection of Neisseria gonorrhoeae in clinical samples.
- the oligonucleotide functions as a primer when used for amplification of the target sequence.
- the same oligonucleotide acts as probe when it is functionally modified and is used for capture and/or detection of the target sequence.
- the probe has an added advantage of identifying multiple opa types in the sample, thus increasing its sensitivity.
- the obtained oligonucleotide sequences are unique to N. gonorrhoeae and hybridize by way of complementary base pair binding to a nucleic acid sequence from N. gonorrhoeae that contains complementarity, termed as "target sequence for the probe".
- target sequence for primer is the DNA sequence which is being amplified using the forward and the reverse primer such that the forward primer binds to the 3' end of the sequence and the reverse primer binds to the 5' end of the sequence by means of complimentary base pairing.
- the length of the probe sequence is 19-mer.
- the probe of the present invention is relatively short, therefore it can be efficiently made by an automated DNA synthesizer. Chemical synthesis of the probe makes it possible to easily produce large numbers of purified probes with specific nucleotide sequences rather than relying on the difficult recombinant procedures of isolating and purifying the genetic information from a natural source.
- Primer 19 mer forward primer (SEQ ID No. 1) and 20 mer reverse primer (SEQ ID No. 2) were desgined in the lab and were ordered to M/s Sigma for synthesis. The primers were reconstituted in sterile double distilled water to give a 100 ⁇ M stock solution. This was further diluted to give a working stock of 10 ⁇ M concentration.
- PCR reaction mix Taq polymerase, dNTPs were procured from Bangalore Genie (# 105924, 105405)
- Electrophoresis buffer For preparation of 5X TBE, Trizma base (Sigma # T1503), EDTA (Merck # MH8M581674) and Boric acid (Sigma # B-6768) were used.
- Probe 5 -biotin end labeled 19-mer probe (Lot#262509 ⁇ 01) specifically targeting opa gene (a multi-copy gene) of N. gonorrhoeae (BdNG)- SEQ ID No.l, a complementary target sequence (dNG) SEQ ID No.3, a non-complementary target sequence (dNG ) SEQ ID No.4 were procured from Sigma.
- Solid support Indium -tin-oxide (ITO) coated glass plates (0.25 cm 2 ) have been obtained from Balzers, UK and monomer solution of aniline was obtained from Sigma- Aldrich (USA).
- ITO Indium -tin-oxide
- Reagents for Biosensor N-(3-dimethyl amino propyl)-N-ethyl carbodiimide hybrochloride (EDC), N-hydroxy succinimide (NHS), Tris buffer, ethylene diamine tetra acetic acid (EDTA), potassium monohydrogen phosphate, potassium dihydrogen phosphate, methylene blue (MB), avidin been procured from Sigma-Aldrich (USA).
- Amplification by PCR The oligonucleotide sequences (SEQ ID No. 1 & 2) mentioned in the present invention or the complimentary sequence thereof can be used as primers in any methods of amplification which includes but is not limited to PCR, SDA, NASBA, LAMP.
- the primer set represented by SEQ ID No. 1 & 2 (GenBank PUID SNUM: 9716119 2705, 9716120 2706 Ng_opa) were used to specifically amplify around 188 bps region of the opa gene of N. gonorrhoea. Amplicon.
- PCR mix used had Reaction buffer (1OmM KCl, 1OmM HCl), 15 ⁇ M MgCl 2 , Taq Polymerase (1.5 U), 200 ⁇ M of dNTP mix and 5 pmol of primers of SEQ ID No. 1 and 2 in a total volume of 25 ⁇ 1.
- PCR conditions were as follows: denaturation at 94 0 C for 45 sec, annealing at 54 0 C for 45 sec and extension at 72 0 C for 45 sec; for a total of 35 cycles.
- PCR amplicons were run on 1.5% agarose gel (Sigma A9539) stained with EtBr in IX TBE buffer. A band size of approximately 188 bps was seen in positive samples when visualized under UV light.
- the biotinylated probe represented by SEQ ID No. 1 can be used for the detection of N. gonorrhoeae in samples using hybridization (solid phase hybridization, hybridization in solution, sandwich hybridization and two-component hybridization) followed by detection by radioactive isotopes/non-radioactive label of the probe.
- hybridization solid phase hybridization, hybridization in solution, sandwich hybridization and two-component hybridization
- radioactive isotopes/non-radioactive label of the probe In the said invention, we used methylene blue as the hybridization monitoring agent. Detection using Bioelectrode:
- Nanostructured polyaniline was electrochemically deposited onto ITO coated glass plates (0.25 cm 2 working area) at 50 uA for 600 s (via two novel intermittent washings using autoclaved Millipore water after every 300s of polymerization) in monomer solution containing aniline (0.1M) in 1.0M HCl using a three-electrode electrochemical cell (Potentiostat/Galvanostat, Autolab Eco Chemie, Netherlands). Thereafter, 2 ⁇ l of avidin (1 mg/mL) (activated using 15 miM EDC and 30 mM NHS for 2 h at 25° C) was immobilized onto the nsPANI/ITO surface.
- Figure 1 Amplification of a fragment of N. gonorrhoeae genomic DNA using the opa gene derived oligonucleotides.
- Figure 2 Shows sensitivity of PCR.
- Figure 3 Shows specificity of PCR.
- Figure 4 Detection of N. gonorrhoeae in clinical samples.
- Figure 5 Shows immobilization of Probe DNA on polyaniline matrix in PBS in presence of
- Figure 6 Shows sensitivity of Probe DNA using Polyaniline as a matrix in PBS in presence of Methylene blue.
- Figure 7 Shows specificity of Probe DNA on polyaniline matrix in PBS in presence of
- Figure 8 BLAST tree view for WHO
- Figure 9 BLAST tree view for WHO G
- Example 1 Amplification of a fragment of N. gonorrhoeae genomic DNA using the opa gene derived oligonucleotides
- the oligonucleotide primer set a 19-mer forward primer 5' CCGGTGCTTCATCACCTTAG 3' (SEQ ID 1) and a 20-mer reverse primer 5' GGATTCATTTTCGGCTCCTT 3' (SEQ ID 2) were used to detect N. gonorrhoeae by specific amplification of the opa gene by PCR.
- the PCR mix contained Reaction buffer (1OmM KCl, 1OmM HCl), 15 ⁇ M MgCl 2 , Taq Polymerase (1.5 U), 200 ⁇ M of dNTP mix and 5 pmol of primers in a total volume of 25 ⁇ 1.
- PCR conditions were as follows: Denaturation at 94 0 C for 45 sec, annealing at 54 0 C for 45 sec and extension at 72 0 C for 45 sec; for a total of 35 cycles.
- PCR amplified products were analyzed on 1.5% agarose gel by ethidium bromide staining.
- Example 2 Sequencing of the amplified product: Amplicons obtained from WHO C and WHO G strains of N. gonorrhoeae were sequenced. The sequence obtained (SEQ ID No.5, 6) was checked online using BLAST. The distance tree produced following BLAST is shown in Figures 8 and 9, respectively.
- DNA was extracted from cultured colonies of WHO C and WHO G strains of N. gonorrhoeae using QiaAMP DNA mini kit. The concentration of DNA was determined spectrophotometrically. PCR was put up as per the protocol described in example 1 using different dilutions of this DNA. A band of 188 bps could be detected upto 10° dilutions (Lane 6) of DNA extracted from WHO C strain of N. gonorrhoeae. The sensitivity, as determined on analyzing the PCR amplicons by gel electrophoresis is 0.4 picograms of DNA. ( Figure 2)
- the cross-reactivity of the primers was checked with NgNS and other GNBs.
- the panel of strains comprised of standard strains of Klebsiella pneumoniae (ATCC 700603), Pseudomonas aeruginosa (ATCC 27853), Staphylococcus aureus (ATCC 25923), E. coli (ATCC 25922), and other NgNS strains like N. meningitidis (ATCC 13077 serogroup A).
- PCR was put up as per the protocol described in example 1 on DNA extracted from these strains and the amplified product was analyzed.
- the primers specifically amplified the N. gonorrhoeae opa gene to give a band of around 188 bps- Lane 4 in Figure 3a and Lane 2 in Figure 3b. No band was seen in the gel for other related and unrelated bacteria.
- PCR was done using DNA extracted from clinical samples (Endocervical swabs in females and urethral discharge in males). A total of 296 patient samples (200 females, 96 males) were processed. 51 were positive by PCR (9 females, 42 males) ( Figure 4).
- Nanostructured polyaniline was electrochemically deposited onto ITO coated glass plates (0.25 cm 2 working area) at 50 uA for 600 s (via two novel intermittent washings using autoclaved Millipore water after every 300 s of polymerization) in monomer solution containing aniline (0.1 M) in 1.0 M HCl using a three-electrode electrochemical cell (Potentiostat/Galvanostat, Autolab Eco Chemie, Netherlands). Thereafter, 2 ⁇ l of avidin (1 mg/mL) (activated using 15 mM EDC and 30 mM NHS for 2 h at 25° C) was immobilized onto the nsPANI/ITO surface.
- the avidin-nsPANI/ITO surface was then washed and subjected to 5 minutes incubation with 2 ul of 19-mer biotinylated oligonucleotide probe of SEQ ID 1 (BdNG, 1 ng/mL) in a humid chamber at 25° C.
- Example 8 Determination of Sensitivity of Probe DNA using Polyaniline as a matrix in PBS in presence of MB
- DNG 10 ⁇ 6 M
- dNG 10 ⁇ 6 M
- Example 9 Determination of Specificity of Probe DNA on polyaniline matrix in PBS in presence of MB
- DUV Differential pulse voltammograms
- Example 10 Hybridization with different Neisseria gonorrhoeae culture spiked sample
- the present invention avoids the disadvantages associated with traditional culturing techniques as it will provide rapid detection of the bacteria regardless of its metabolic state.
- the probe in the current invention is designed from the chromosomal DNA which is present in all the strains of the bacteria rather than plasmid DNA which is present in only some strains or even when present, can be lost.
- the present invention provides a nucleic acid probe that combines increased sensitivity for detection, based on the opa gene which is a multicopy gene, for N. gonorrhoeae with an increased specificity. Further the probe is specific providing no signal with Non- Neisseria gonorrhoeae Neisseria Strains (NgNS) and other gram negative bacteria (GNB).
- NgNS Non- Neisseria gonorrhoeae Neisseria Strains
- GPB gram negative bacteria
- this invention provides a means for accurate and rapid detection of N. gonorrhoeae and distinguishes specifically between the two pathogenic species of
- Neisseria N. gonorrhoeae and N. meningitidis.
- the present invention using a unique nucleotide sequence from opa gene of Neisseria gonorrhoeae with a remarkably low detection limit will enable diagnosis of asymptomatic infections using biosensor technology. This has the capability of detecting upto femtomolar concentration of the DNA.
- the present invention utilizes electrochemical detection of hybridization process, thereby providing improved sensitivity.
- the current invention and its proposed usage as a biosensor is based on the amplification of the signal. This is different from the strategy used in PCR, i.e., amplification of target DNA which is liable to be affected by the presence of inhibitors in urine.
- the present invention is capable of detecting Neisseria gonorrhoeae in all types of clinical samples.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to nucleic acid primers and probe for detection of Neisseria gonorrhoeae. The use of the probe sequence for detection of N. gonorrhoeae in clinical samples (endocervical swabs in females and urethral discharge in males) has been described along with the different biomaterials to which it can be immobilized for detection purpose by the biosensor technology. In addition to its use as a detection probe, the sequence can be used as primer for in vitro amplification of N. gonorrhoeae in clinical samples. The discriminatory capacity of the unique sequence has been established by utilizing the panel of non-N. gonorrhoeae Neisseria species (NgNS) as well as other gram-negative bacteria.
Description
NUCLEIC ACID PRIMERS , PROBE AND METHOD
FOR DETECTION OF NEISSERIA GONORRHOEAE
FIELD OF INVENTION
The present invention relates to nucleic acid primers and probe for detection of Neisseria gonorrhoeae. N. gonorrhoeae is the causative agent of gonorrhoea, a bacterial sexually transmitted infection (STI). More particularly, the present invention relates to a novel oligonucleotide probe sequence, which is useful for the detection of N. gonorrhoeae with very high specificity and sensitivity. The said probe is able to detect N. gonorrhoeae amongst other Non-Neisseria gonorrhoeae Neisseria strains (NgNS) and other Gram negative Bacteria (GNB). The probe sequence, in addition to being highly specific for N. gonorrhoeae can also be used as a primer for in vitro amplification of opa gene of N. gonorrhoeae. The said probe may be immobilized on different biomaterials for detecting N. gonorrhoeae by hybridization technology using a biosensor, thereby allowing rapid, reliable and cost-effective detection of gonorrhoea in invasive and possibly non-invasive samples. Thus, the present invention provides an alternative diagnostic method that can potentially eliminate the hassels of culturing bacterial strains and simultaneously increase the sensitivity and specificity of detecting gonorrhoea. - BACKGROUND OF INVENTION
Gonorrhoea is a bacterial sexually transmitted infection (STI) caused by Neisseria gonorrhoeae. Global estimates indicate that 62 million infections occur each year attesting to its public health importance. Current incidence figures indicate that it is the highest in 53 years.
Microscopy and culture are the two conventional methods used for its diagnosis. In male patients with urethritis, the diagnosis can be made by direct microscopy of stained smears of urethral discharge (sensitivity and specificity > 95%). However, in case of women it has
a limited sensitivity and specificity (approximately 40%). Therefore, in asymptomatic male patients, female patients and when a definitive test of cure is required, specimens need to be cultured. Standard culture techniques have been described in the WHO manual, Laboratory Diagnosis of Gonorrhoea, WHO Regional Publication, South-East Asia Series. In such culture techniques, the clinical specimen, i.e., endocervical/urethral swab is plated on selective media, preferably two (one with and one without inhibitors). The culture plates are then incubated at 360C in an atmosphere of 5% CO2 for 24 hrs to 48 hrs following which they are inspected for appearance of N. gonorrhoeae colonies. Suspected colonies are subjected to Gram stain, oxidase and Superoxol test. Organism presumptively identified as N. gonorrhoeae are confirmed by Rapid Carbohydrate Utilization Tests (RCUT). These methods and procedures are laborious, time consuming and limited to detection of living cells only. Other disadvantages of culture-based identification methods are the fastidiousness of the organism, which makes successful growth less likely if the isolation media, specimen transport, and laboratory techniques are not optimal. In addition, multiple steps are necessary for processing specimens, the quality assurance needs to be addressed at each step and the duration of time necessary from specimen collection to reporting of results is long, at least 48-72 hours, thereby resulting in delays in diagnosis and often in treatment. The principal strategy for the control of gonorrhoea involves the treatment of symptomatic cases together with contact tracing and treatment of sexual partners but these methods are failing to prevent the transmission of infection. Another problem that is a major hindrance in the control of the disease is that 50-80% women and approximately 10% of men are asymptomatic. These individuals, in whom the course of infection is asymptomatic, unknowingly contribute to the spread of the disease.
Additionally, the well recognized complications of gonorrhoea - infertility, Pelvic Inflammatory Disorders (PID), ophthalmia, foetal loss, disseminated infection, are
significantly reduced by early and appropriate treatment. Also, gonorrhoea has been identified as a co-factor in HIV transmission and this new association provides an important reason for proper and timely treatment of gonorrhoea. Numerous epidemiological studies suggest that there is approximately two to five-fold greater risk of acquiring HIV in the presence of gonorrhoea. The susceptibility to HIV is removed by effective treatment resolving the inflammatory infiltrate. Therefore, there is a need to actively diagnose and effectively treat gonorrhoea.
Several non-culture tests have been introduced as possible alternatives to gonococcal culture. Antigen based Enzyme immunoassay tests have a poor sensitivity. A number of nucleic acid hybridization assays like the GeneProbe PACE II based on 16s rRNA and the Digene Hybrid Capture II assays have also been evaluated. But the reported sensitivity and specificity values for these tests suggest that they are not as sensitive or specific as culture.
The genus Neisseria includes two species pathogenic for humans: Neisseria gonorrhoeae and Neisseria meningitidis. N. gonorrhoeae is known to cause asymptomatic infections in a large majority of patients but whenever isolated/detected, it is always considered to be a pathogen. On the other hand, N. meningitidis is known to colonize individuals in throat/ nasopharynx without causing disease and its carrier state is well known. N. gonorrhoeae has a 93% homology with N. meningitidis at DNA level.
Neisseria specific probes have been described in US 5162199, titled "Λfe/sser/a-specific DNA probe", which can detect at least one of the pathogenic Neisseria species, Neisseria gonorrhoeae and/or Neisseria meningitidis under hybridization conditions by the detection of hybrid formation. However, means for accurate and rapid detection of N. gonorrhoeae and to distinguish specifically between the two pathogenic species of Neisseria is vital.
Nucleic Acid amplification tests (NAATs) offer a high performance alternative to the conventional methods of diagnosis of gonorrhoea. Earlier efforts involved the use of cppB gene present on the cryptic plasmid pJDl. A drawback of this method is that 5-10% of N. gonorrhoeae strains do not contain the plasmid; therefore assays that target cppB gene may fail to detect upto 10% of the cases. Whether a particular strain contains the plasmid is dependant to some extent on the geographical area in which the strain is found. Thus, this method can only detect infection with strains having the plasmid and will not detect strains that do not contain the plasmid. Such a test will not be reliable and accurate if used in areas where the strains do not have the plasmid.
Several studies have shown that PCR assays perform well in detecting gonococcal infection on the invasive genital specimens i.e., endocervical and urethral swabs but the sensitivity decreases considerably, giving upto 50% false negatives, when urine samples were used. Also, PCR has been tested only on symptomatic patients so its performance in asymptomatic patients is not known. Besides, a high false positivity of PCR has been reported, especially in commercial assays due to cross reactions with commensal Neisseria sp.
Description of 16s rRNA based probes have been given in US 5173401 entitled "Detection of Neisseria gonorrhoeae", in US 6100027 entitled "Nucleic acid probes and amplification oligonucleotides for Neisseria species" and in US 5432271 entitled "Nucleic acid probes for the detection of Neisseria gonorrhoeae". However, because of the high evolutionary nucleic acid sequence conservation for rRNA gene, the specificity gets compromised. Whereas, probe based identification is often based on only one or a few mismatches in the target sequence.
Miyada et al have described a N. gonorrhoeae specific probe based on ORF gene in US 5525717 titled "Support based nucleotide probe for Neisseria gonorrhoeae" and US
6020461 "Hexapeptides of Neisseria gonorrhoeae". Birkenmeyer et al have described probes and primers based on pilin gene (pilE) in US 5453355 titled "Oligonucleotides and methods for the detection of Neisseria gonorrhoeae". However, pilin genes based assays lack sensitivity.
You Qimin has described a newly-identified region of the N. gonorrhoeae genome GC3 that can be used to detect N. gonorrhoeae nucleic acid by hybridization or amplification assay in US 5976805 titled "Neisseria gonorrhoeae specific DNA fragment-GC3". However, the exact region of this fragment is not described in literature.
Reference may be made to PCT/NL05/00574, wherein Hermans et al have described an 8-mer oligonucleotide that is capable of hybridizing to the 5' untranslated region of opa gene of N. gonorrhoeae. It may be noted that opa gene is a multicopy gene (9—11 copies) of N. gonorrhoeae. Targeting a multicopy gene will provide a low detection limit and hence enable us to diagnose asymptomatic infections where the bacterial load is very low. However, a DNA fragment containing fewer than about 12 nucleotides is believed to have insufficient complexity to be specific for a given organism. Nucleic acids do not require complete homology to hybridize. The homologous and partially homologous nucleic acid sequences can be made to hybridize by adjusting the hybridization conditions to increase or decrease the stringency i.e., by adjusting the hybridization temperature or salt content of the buffer.
Reference is made to Singh et.al , Biosensors and Bioelectronics, vol 24, issue 7, March 15 , 2009 , 2232-2238) wherein a 20 mer probe has been disclosed having (55% GC content), however, short probes having less GC content are preferred compared to the long ones, because they facilitate finding unique sequence matches while forming fewer, and less stable, hairpin structures and displaying more uniform hybridization behavior overall.
Therefore, keeping in purview the drawbacks of the hitherto known prior art, the inventors of the present invention realized that there exists a dire need to provide a 15 to 20 mer oligonucleotide probe, which could bind to a specific stretch of the opa gene of Neisseria gonorrhoeae and thus, useful for its detection with a very high sensitivity and specificity.
OBJECTS OF THE INVENTION
The main object of the present invention is thus to provide primers and probes useful for the rapid detection of Neisseria gonorrhoeae regardless of the metabolic state, which obviates the disadvantages associated with traditional detection techniques done by culturing.
Another object of the present invention is to provide an oligonucleotide probe capable of hybridizing to a unique nucleotide sequence from opa gene, which is a multicopy gene of Neisseria gonorrhoeae, thereby improving the detection limit to enable diagnosis of asymptomatic infections using biosensor technology.
Yet another object is to provide a system to detect the hybridization electrochemically thereby improving the sensitivity (upto femtomolar concentration) and specificity.
Still another object is to provide a probe that can distinguish not only the two pathogenic Neisseria species but can also differentiate it from other Non-Neisseria gonorrhoeae Neisseria species (NgNS) and other Gram-negative bacteria.
Yet another object is to provide a nucleic acid probe for use in biosensors capable of detecting Neisseria gonorrhoeae in all types of clinical samples.
A further object of the invention is to provide a biosensor, wherein the results are based on the amplification of the signal and not on target DNA, which is liable to be affected by the presence of inhibitors in biological fluids.
SUMMARY OF THE INVENTION
The present invention provides nucleic acid primers and probe useful for the detection of Neisseria gonorrhoeae, wherein the said probe is represented by SEQ ID 1, having the sequence "CGGTGCTTCATCACCTTAG". The nucleic acid probe sequence of the present invention is highly specific for Neisseria gonorrhoeae as seen on performing BLAST and is present in opa A,C,D,E,F,H,IJ,K,opacity protein variant VO, V28 gene.
In the present invention, the hybridization is detected electrochemically. The sensitivity of the process is very high (upto femtomolar concentration) and so is the specificity. Even a one base mismatch gives a difference in the signal and hence can be differentiated. The probe is specific in providing no signal with Non- Neisseria gonorrhoeae Neisseria species (NgNS) and other gram negative bacteria (GNB). The current invention and its proposed usage as a biosensor is based on the amplification of the signal. The biosensor utilizes the recognition layer (comprising of the probe DNA immobilized onto the solid support) that will hybridize with the analyte (target DNA) and with the help of transducer trigger a usable signal for electronic read-out. This is different from the strategy used in PCR i.e., amplification of target DNA which is liable to be affected by the presence of inhibitors in urine. Therefore, it is an aspect of the present invention to provide nucleic acid probes for use in biosensors capable of detecting Neisseria gonorrhoeae in all types of clinical samples without being affected by inhibitors.
Accordingly, the present invention provides a pair of oligonucleotide primers for the specific amplification of opa gene of Neisseria gonorrhoeae by PCR, consisting of:
(i)a forward primer represented by SEQ ID 1, having the sequence of
"CGGTGCTTCATCACCTTAG";
(ii)a reverse primer represented by SEQ ID 2, having the sequence of
"GGATTCATTTTCGGCTCCTT".
In another aspect of the invention is provided the forward nucleotide primer of SEQ ID No. 1 or its complement useful as a probe for the detection of Neisseria gonorrhoeae.
In amother embodiment of the invention, the probe is labelled with biotin and the labelled probe is useful for detection of Neisseria gonorrhoeae.
In an embodiment of the invention, the nucleic acid probe is specific in providing no signal with Non-N. gonorrhoeae Neisseria strains (NgNS) and other Gram negative Bacteria (GNB).
In yet another embodiment of the invention, the hybridized regions of the probe of SEQ ID 1 or its complement, and the target nucleic acid sequence or its complement, have 95-100% complementarity.
In yet another aspect of the invention is provided an electrochemical method for the species specific detection of Neisseria gonorrhoeae with high sensitivity and specificity, the method comprising the steps of:
(a)depositing nanostructured polyaniline (nsPANI) electrochemically onto Indium tin oxide (ITO) coated glass plates in monomer solution containing 0.1M aniline in 1 M HCl using a three-electrode electrochemical cell;
(b)immobilizing 2μl of avidin (lmg/ml) onto the ns-PANI/ITO surface as obtained in step
(a) followed by washing the avidin-ns-PANI/ITO surface;
(c)incubating the avidin-ns-PANI/ITO surface as obtained in step (b) with 2μl of labelled probe (BdNG, lng/ral) of Seq ID No. 1 and 3 to obtain nucleic acid functionalized BdNG-avidin-nsPANI/ITO electrode; (d)incubating the BdNG-avidin-nsPANI/ITO electrode as obtained in step (c) in phosphate buffer saline containing methylene blue (20μM);
(e)incubating the BdNG-avidin-nsPANI/ITO electrode as obtained in step (d) with the test sample to be tested for Neisseria gonorrhoeae;
(f) detecting the presence of Neisseria gonorrhoeae in the test sample by evaluating the hybridization of the target nucleic acid sequence present in the test sample with the BdNG-avidin-nsPANI/ITO electrode, which is done by monitoring the oxidation/reduction peak of methylene blue indicator determined by Cyclic voltammetry (CV)/ Differential Pulse Voltammetry (DPV) measurements. In yet another embodiment of the invention, the decrease in the magnitude of methylene blue redox peak indicates the presence of N. gonorrhoeae in the sample. The absence of MB peak after hybridization with the complementary synthetic oligomer is attributed to steric inhibition of MB packing/intercalation between double helix of the hybrid. In yet another embodiment of the invention, the concentration of complementary target (dNG) and non-complementary target (dNG' ) oligonucleotide solution is in the range of 1 X 10"6 M to 1 X lO"16 M for 60 seconds at 25° C.
In another embodiment of the present invention, the method determines the presence of N. gonorrhoeae in both invasive as well as non-invasive samples.
In yet another embodiment of the present invention, the method has high detection sensitivity upto 10"16 M of DNA.
In yet further embodiment of the present invention, the method detects upto single base pair mismatch in target DNA providing high specificity.
In yet another aspect of the invention is provided a kit for the detection of Neisseria gonorrhoeae, wherein the kit comprises of oligonucleotide primer of Seq ID No. 1, or the complement thereof along with buffers and instructional manual for operating the said kit.
In yet another aspect of the invention is provided a biosensor for the detection of Neisseria gonorrhoeae, wherein it comprises:
a.a nucleic acid probe of SEQ ID No.l
b.an Immobilization support;
c. a transducer capable of amplifying the oxidation/reduction signal of methylene blue, monitored by Cyclic Voltammetry (CV), Differential Pulse Voltammetry (DPV) transducer and the like.
In still another embodiment of the invention, the oligonucleotide of SEQ. ID 1 is used in the form of a probe for detection of N. gonorrhoeae in clinical samples using hybridization in solution with methylene blue as hybridization monitor agent followed by electrochemical detection.
In a further embodiment of the invention, the immobilization support is selected from polyaniline electrodes, screen printed carbon electrodes, gold electrodes, sol-gel derived matrices, metal oxides, polymers and conducting polymers.
In another embodiment of the invention, the biosensor for the detection of Neisseria gonorrhoeae is based on amplification of the signal obtained. The presence of target DNA i.e., DNA of N. gonorrhoeae is determined by monitoring the oxidation/reduction peak of methylene blue indicator (electrochemical detection) at pulse height of 5OmV, pulse width of 70ms. The CV/DPV of the immobilized probe is monitored after methylene blue (MB, 40 μM) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl. In the presence of the target DNA the magnitude of peak decreases indicating the presence of N. gonorrhoeae in the sample. Whereas, in case of PCR there is an amplification of the target nucleic acid.
In yet another embodiment of the invention, the decrease in the magnitude of methylene blue redox peak indicates the presence of N. gonorrhoeae in the sample. The absence of MB peak after hybridization with the complementary synthetic oligomer is attributed to steric inhibition of MB packing/intercalation between double helix of the hybrid.
In still another embodiment of the invention, Neisseria gonorrhoeae nucleic acids can be detected in clinical samples, bacterial culture and PCR products.
In still another embodiment of the invention, is provided a rapid and reliable test that can be successfully carried out for the presence of Neisseria gonorrhoeae in clinical samples. Presence of a bacterial culture is not necessary for this and thus the method of the present invention obviates the need for additional biochemical tests normally required to distinguish N. gonorrhoeae from other Neisseria sp.
In another embodiment of the present invention, a newly identified region of the N. gonorrhoeae genome is used to detect N. gonorrhoeae nucleic acids in clinical samples by hybridization using biosensor technology or amplification assays. In yet another embodiment of the invention, nucleic acid probes and amplification primers have been developed for the specific identification of N. gonorrhoeae without any cross- reactivity with other Neisseria sp.
In still another embodiment of the invention, a unique nucleotide sequence from opa gene which is a multicopy gene of Neisseria gonorrhoeae has been described thereby improving the detection limit to upto femtomolar concentrations of DNA, thereby enabling diagnosis of asymptomatic infections where a low detection limit is crucial.
In yet another embodiment of the invention, it is possible to qualitatively determine the presence or absence of N. gonorrhoeae. Detection can be accomplished electrochemically using the biosensor technology or by amplification assays.
In still another embodiment of the invention, the method described herein provides a high degree of accuracy with respect to the detection of N. gonorrhoeae with substantial minimization or virtual elimination of false positive readings, as this assay has the capability of detecting even a single base mismatch in the target DNA when biosensor technology is used.
Brief Description of Drawings
Figure 1 Amplification of a fragment of N. gonorrhoeae genomic DNA using the opa gene derived oligonucleotides.: It depicts the gel picture showing standardization of PCR using the WHO strains of Neisseria gonorrhoeae (n=4; WHO C, WHO G, WHO L, WHO K-
Lanes 1,2,3,4). A band of around 188 bps was seen under UV light.
Figure 2 Shows sensitivity of PCR: It depicts the gel picture of PCR put up using different dilutions of this DNA extracted from WHO C strain of N. gonorrhoeae. A band of 188 bps could be detected upto 10° dilutions (Lane 6).
Figure 3 Shows specificity of PCR: Figure 3a and 3b depict gel pictures of PCR put up from DNA extracted from N. gonorrhoeae and other related and non-related bacteria. The primers specifically amplified the N. gonorrhoeae opa gene to give a band of around' 188 bps- Lane 4 in Figure 3a and Lane 2 in Figure 3b. No band was seen in the gel for other related and unrelated bacteria
Figure 4 Detection of N. gonorrhoeae in clinical samples: It depicts gel picture of PCR done on DNA extracted from clinical samples (Endocervical swabs in females and urethral discharge in males). Lanes 2,3,4,5 are positive clinical samples giving a band of around 188 bps.
Figure 5 Shows immobilization of Probe DNA on polyaniline matrix in PBS in presence of Methylene blue: Figure 5 depicts the Differential pulse voltammograms (DPV) of - (i)Bare ITO,
(ii)biotinylated probe DNA immobilized (BdNG) onto polyaniline through avidin- biotin coupling (BdNG- avidin -PANI/ITO electrode),
(iii)BdNG-avidin-PANI/ITO electrode after hybridization with complementary target DNA sequence (dNG),
(iv)BdNG-avidin-PANI/ITO electrode after treating with Non-complementary target
DNA sequence (dNG' ) and
(v)BdNG-avidin-PANI/ITO electrode after treating with one base mismatch DNA sequence (OBM), using MB as redox indicator
Decrease in MB peak was seen after hybridization with the complementary target DNA sequence(dNG)
Figure 6 Shows sensitivity of Probe DNA using Polyaniline as a matrix in PBS in presence of Methylene blue. Figure 6 depicts Differential pulse voltammogarms of BdNG-avidin- PANI/ITO after hybridization with complementary target probe (dNG) concentration lO"6 M - 10"15 M, at pulse height of 50 mV and pulse width of 70 ms, after methylene blue (MB, 20 μM) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl). The detection limit of dNG-BdNG-avidin-PANI/ITO electrode is 10~16 M.
Figure 7 Shows specificiaty of Probe DNA on polyaniline matrix in PBS in presence of Methylene blue. Figure 7 depicts Differential pulse voltammograms (DPV) of - (Hi)N. meningitidis spiked swab sample
(W)N. meningitidis DNA from culture
(v)£. coli spiked swab sample
(vdE.coli DNA from culture of ATCC 25922
(vii)BdNG-avidin-PANI/ITO electrode
(viii)N. gonorrhoeae spiked swab sample
(ix)N. gonorrhoeae positive swab sample from patients
(x)N. gonorrhoeae DNA irom culture
Decrease in MB peak was seen after hybridization with the N. gonorrhoeae culture, spiked swab sample, positive patient swab sample. No decrease in the peak height was observed after exposing the electrode with N. meningitidis and E. coli culture and spiked swab sample
DETAILED DESCRIPTION OF THE INVENTION List of the abbreviations used: DNA: Deoxyribonucleic acid dNTP: Deoxiribonucleoside triphosphate
MgCl2: Magnesium chloride bps: base pairs
ATCC: American Type Culture Collection A: Adenine T: Thymine
G: Guanine
C: Cytosine
STD: Sexually Transmitted Diseases HIV: Human Immunodeficiency Virus WHO: World Health Organization
PCR: Polymerase Chain Reaction
SDA: Strand Displacement Assay
NASBA: Nucleic Acid Sequence Based Amplification LAMP: Loop-mediated Amplification Assay
Bacterial Isolates
A panel of strains comprising of N. gonorrhoeae (WHO standard strains n= 4; WHO C, WHO G, WHO K, WHO L), Klebsiella pneumoniae (ATCC 700603), Pseudomonas
aeruginosa (ATCC 27853), Staphylococcus aureus (ATCC 25923), E. coli (ATCC 25922), N. meningitidis (ATCC 13077 serogroup A) were used. The WHO standard strains of N. gonorrhoeae have been procured from the WHO collaborative centre for STD and HIV, Australia.
Primer/Probe selection
The oligonucleotide probe and primer sequences were designed using the available software and from the gene sequences available in the GenBank database. For selecting a conserved sequence the different opa gene types of Neisseria gonorrhoeae were aligned by using ClustalX. The conserved sequence was then analyzed using Primer3 software available online for determining the suitable primers. The selected oligonucleotide sequence was then analyzed for non-specific binding using BLAST. The primer sequences that were obtained are: Forward Primer (FP) represented by SEQ ID 1: 5' CGGTGCTTCATCACCTTAG 3' Reverse Primer (RP) represented by SEQ ID 2: 5' GGATTCATTTTCGGCTCCTT 3'.
The sequences have been validated by GenBank. The accession numbers for the same are (GenBank PUID SNUM 9716120 2706 Ng_opa). It is noteworthy to mention here that the oligonucleotide sequence represented by SEQ ID No. 1 serves both as the forward primer for the amplification of the opa gene of Neisseria gonorrhoeae as well as the probe for the detection of Neisseria gonorrhoeae in clinical samples. The oligonucleotide functions as a primer when used for amplification of the target sequence. The same oligonucleotide acts as probe when it is functionally modified and is used for capture and/or detection of the target sequence.
As all the opa types were considered while selecting the sequence, the probe has an added advantage of identifying multiple opa types in the sample, thus increasing its
sensitivity. The obtained oligonucleotide sequences are unique to N. gonorrhoeae and hybridize by way of complementary base pair binding to a nucleic acid sequence from N. gonorrhoeae that contains complementarity, termed as "target sequence for the probe". "Target sequence for primer" is the DNA sequence which is being amplified using the forward and the reverse primer such that the forward primer binds to the 3' end of the sequence and the reverse primer binds to the 5' end of the sequence by means of complimentary base pairing. The length of the probe sequence is 19-mer. Since the probe of the present invention is relatively short, therefore it can be efficiently made by an automated DNA synthesizer. Chemical synthesis of the probe makes it possible to easily produce large numbers of purified probes with specific nucleotide sequences rather than relying on the difficult recombinant procedures of isolating and purifying the genetic information from a natural source.
Primers: 19 mer forward primer (SEQ ID No. 1) and 20 mer reverse primer (SEQ ID No. 2) were desgined in the lab and were ordered to M/s Sigma for synthesis. The primers were reconstituted in sterile double distilled water to give a 100 μ M stock solution. This was further diluted to give a working stock of 10 μ M concentration.
PCR reaction mix: Taq polymerase, dNTPs were procured from Bangalore Genie (# 105924, 105405) Electrophoresis buffer: For preparation of 5X TBE, Trizma base (Sigma # T1503), EDTA (Merck # MH8M581674) and Boric acid (Sigma # B-6768) were used.
Probe: 5 -biotin end labeled 19-mer probe (Lot#262509~01) specifically targeting opa
gene (a multi-copy gene) of N. gonorrhoeae (BdNG)- SEQ ID No.l, a complementary target sequence (dNG) SEQ ID No.3, a non-complementary target sequence (dNG ) SEQ ID No.4 were procured from Sigma. Solid support: Indium -tin-oxide (ITO) coated glass plates (0.25 cm2) have been obtained from Balzers, UK and monomer solution of aniline was obtained from Sigma- Aldrich (USA).
Reagents for Biosensor: N-(3-dimethyl amino propyl)-N-ethyl carbodiimide hybrochloride (EDC), N-hydroxy succinimide (NHS), Tris buffer, ethylene diamine tetra acetic acid (EDTA), potassium monohydrogen phosphate, potassium dihydrogen phosphate, methylene blue (MB), avidin been procured from Sigma-Aldrich (USA).
METHODS:
Amplification by PCR: The oligonucleotide sequences (SEQ ID No. 1 & 2) mentioned in the present invention or the complimentary sequence thereof can be used as primers in any methods of amplification which includes but is not limited to PCR, SDA, NASBA, LAMP. Here the present invention has been used to carry out PCR. The primer set represented by SEQ ID No. 1 & 2 (GenBank PUID SNUM: 9716119 2705, 9716120 2706 Ng_opa) were used to specifically amplify around 188 bps region of the opa gene of N. gonorrhoea. Amplicon. The PCR mix used had Reaction buffer (1OmM KCl, 1OmM HCl), 15 μ M MgCl2, Taq Polymerase (1.5 U), 200 μ M of dNTP mix and 5 pmol of primers of SEQ ID No. 1 and 2 in a total volume of 25 μ 1. PCR conditions were as follows: denaturation at 940C for 45 sec, annealing at 54 0C for 45 sec and extension at 72 0C for 45 sec; for a total of 35 cycles.
Detection of amplicon by Electrophoresis: The PCR amplicons were run on 1.5% agarose
gel (Sigma A9539) stained with EtBr in IX TBE buffer. A band size of approximately 188 bps was seen in positive samples when visualized under UV light.
With different strains of N. gonorrhoeae different sizes of amplicons are obtained. We sequenced two different amplicons obtained from amplification of two different strains of N. gonorrhoeae. The sequences are mentioned below. One was 186 bps long (WHO C- SEQ ID No.5), the other (WHO G- SEQ ID No. 6) was 190 bps long. A variation of 2-6 bps has been observed for different strains and different opa types. When the amplified sequence was checked online using BLAST it showed a match with opa E gene for opacity protein (emb|X52369.1), opa I gene for opacity protein (emb|X52365.1), opa D gene for opacity protein (emb|X52372.1), opa F gene for opacity protein (emblX52368.1), opa K gene for opacity protein (emb|X52364.1), opa J gene for opacity protein (emb 1X52371.1) of N. gonorrhoeae. In addition, it matched with N. gonorrhoeae Pile gene for outer membrane Pile (emb|X12625.1) and N. gonorrhoeae protein coding gene for putative nitrogen regulatory protein II (pFLOBHOO).
Probe for Biosensor
The biotinylated probe represented by SEQ ID No. 1 can be used for the detection of N. gonorrhoeae in samples using hybridization (solid phase hybridization, hybridization in solution, sandwich hybridization and two-component hybridization) followed by detection by radioactive isotopes/non-radioactive label of the probe. In the said invention, we used methylene blue as the hybridization monitoring agent. Detection using Bioelectrode:
(i)Preparation of solid support: Nanostructured polyaniline (nsPANI) was electrochemically deposited onto ITO coated glass plates (0.25 cm2 working area) at 50 uA for 600 s (via two novel intermittent washings using autoclaved Millipore water after
every 300s of polymerization) in monomer solution containing aniline (0.1M) in 1.0M HCl using a three-electrode electrochemical cell (Potentiostat/Galvanostat, Autolab Eco Chemie, Netherlands). Thereafter, 2 μl of avidin (1 mg/mL) (activated using 15 miM EDC and 30 mM NHS for 2 h at 25° C) was immobilized onto the nsPANI/ITO surface.
(ii)Probe immobilization: The avidin-nsPANI/ITO surface was then washed and subjected to 5 minutes incubation with 2 μl of 19-mer biotinylated oligonucleotide probe of SEQ ID No.l (BdNG, 1 ng/mL) in a humid chamber at 25° C. (iii)Characterization and hybridization studies: Differential pulse voltammograms (DPV) of
•Bare ITO,
•biotinylated probe DNA immobilized (BdNG) onto polyaniline through avidin- biotin coupling (BdNG-avidin-PANI/ITO electrode),
*BdNG-avidin-PANI/ITO electrode after hybridization with complementary target DNA sequence (dNG),
•BdNG-avidin-PANI/ITO electrode after treating with Non-complementary target DNA sequence (dNG' ) and
•BdNG-avidin-PANI/ITO electrode after treating with one base mismatch DNA sequence (OBM), were done at pulse height of 50 mV and pulse width of 70 ms, after methylene blue (MB, 20 μM) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl.
Brief Description of Accompanying Drawings
Figure 1 : Amplification of a fragment of N. gonorrhoeae genomic DNA using the opa gene derived oligonucleotides.
Figure 2 Shows sensitivity of PCR. Figure 3 Shows specificity of PCR.
Figure 4 : Detection of N. gonorrhoeae in clinical samples.
Figure 5 Shows immobilization of Probe DNA on polyaniline matrix in PBS in presence of
Methylene blue.
Figure 6 Shows sensitivity of Probe DNA using Polyaniline as a matrix in PBS in presence of Methylene blue.
Figure 7 Shows specificity of Probe DNA on polyaniline matrix in PBS in presence of
Methylene blue.
Figure 8: BLAST tree view for WHO C Figure 9: BLAST tree view for WHO G
EXAMPLES
The following examples are given by way of illustration and therefore should not be construed to limit the scope of the present invention.
Example 1: Amplification of a fragment of N. gonorrhoeae genomic DNA using the opa gene derived oligonucleotides
The oligonucleotide primer set, a 19-mer forward primer 5' CCGGTGCTTCATCACCTTAG 3' (SEQ ID 1) and a 20-mer reverse primer 5'
GGATTCATTTTCGGCTCCTT 3' (SEQ ID 2) were used to detect N. gonorrhoeae by specific amplification of the opa gene by PCR.
The PCR mix contained Reaction buffer (1OmM KCl, 1OmM HCl), 15 μ M MgCl2, Taq Polymerase (1.5 U), 200 μ M of dNTP mix and 5 pmol of primers in a total volume of 25 μ 1. PCR conditions were as follows: Denaturation at 940C for 45 sec, annealing at 54 0C for 45 sec and extension at 72 0C for 45 sec; for a total of 35 cycles. PCR amplified products were analyzed on 1.5% agarose gel by ethidium bromide staining. Figure 1 shows the standardization of PCR using the WHO strains of Neisseria gonorrhoeae (n=4; WHO C, WHO G, WHO L, WHO K- Lanes 1,2,3,4). A band of around 188 bps was seen under
UV light.
Example 2: Sequencing of the amplified product: Amplicons obtained from WHO C and WHO G strains of N. gonorrhoeae were sequenced. The sequence obtained (SEQ ID No.5, 6) was checked online using BLAST. The distance tree produced following BLAST is shown in Figures 8 and 9, respectively.
Example 3: Determination of the sensitivity of PCR
DNA was extracted from cultured colonies of WHO C and WHO G strains of N. gonorrhoeae using QiaAMP DNA mini kit. The concentration of DNA was determined spectrophotometrically. PCR was put up as per the protocol described in example 1 using different dilutions of this DNA. A band of 188 bps could be detected upto 10° dilutions (Lane 6) of DNA extracted from WHO C strain of N. gonorrhoeae. The sensitivity, as determined on analyzing the PCR amplicons by gel electrophoresis is 0.4 picograms of DNA. (Figure 2)
Example 4: Determination of specificity of PCR
The cross-reactivity of the primers was checked with NgNS and other GNBs. The panel
of strains comprised of standard strains of Klebsiella pneumoniae (ATCC 700603), Pseudomonas aeruginosa (ATCC 27853), Staphylococcus aureus (ATCC 25923), E. coli (ATCC 25922), and other NgNS strains like N. meningitidis (ATCC 13077 serogroup A). PCR was put up as per the protocol described in example 1 on DNA extracted from these strains and the amplified product was analyzed. The primers specifically amplified the N. gonorrhoeae opa gene to give a band of around 188 bps- Lane 4 in Figure 3a and Lane 2 in Figure 3b. No band was seen in the gel for other related and unrelated bacteria.
Example 5: Detection of N. gonorrhoeae in clinical samples
PCR was done using DNA extracted from clinical samples (Endocervical swabs in females and urethral discharge in males). A total of 296 patient samples (200 females, 96 males) were processed. 51 were positive by PCR (9 females, 42 males) (Figure 4).
Nanostructured polyaniline (nsPANI) was electrochemically deposited onto ITO coated glass plates (0.25 cm2 working area) at 50 uA for 600 s (via two novel intermittent washings using autoclaved Millipore water after every 300 s of polymerization) in monomer solution containing aniline (0.1 M) in 1.0 M HCl using a three-electrode electrochemical cell (Potentiostat/Galvanostat, Autolab Eco Chemie, Netherlands). Thereafter, 2 μl of avidin (1 mg/mL) (activated using 15 mM EDC and 30 mM NHS for 2 h at 25° C) was immobilized onto the nsPANI/ITO surface. The avidin-nsPANI/ITO surface was then washed and subjected to 5 minutes incubation with 2 ul of 19-mer biotinylated oligonucleotide probe of SEQ ID 1 (BdNG, 1 ng/mL) in a humid chamber at
25° C.
Example 7: Immobilization of Probe DNA on polyaniline matrix in Phosphate Buffer Saline (PBS) monitoring methylene blue (MB) oxidation
Differential pulse voltammograms (DPV) of - (i)Bare ITO,
(ii)biotinylated probe DNA immobilized (BdNG) onto polyaniline through avidin- biotin coupling (BdNG- avidin- PANI/ITO electrode),
(iii)BdNG- avidin -PANI/ITO electrode after hybridization with complementary target DNA sequence (dNG),
(iv)BdNG-avidin-PANI/ITO electrode after treating with Non-complementary target DNA sequence (dNG' ) and
(v)BdNG- avidin -PANI/ITO electrode after treating with one base mismatch DNA sequence (OBM),
was done at pulse height of 50 mV and pulse width of 70 ms, after methylene blue (MB, 20 μM) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl. It was found that MB peak seen at -250 mV is absent after hybridization with the dNG target suggesting presence of dsDNA at the electrode surface. Interestingly, MB peak appears when it is incubated with dNG' , OBM indicating non-hybridization at BdNG-avidin-PANI/ITO surface. (Figure 5). Thus, this indicates that the developed probe is specific for the N. gonorrhoeae target DNA.
Example 8: Determination of Sensitivity of Probe DNA using Polyaniline as a matrix in PBS in presence of MB
Differential pulse voltammograms (DPV) of BdNG-avidin-nsPANI/ITO electrode after hybridization with different dNG concentrations such as: (i) dNG= 10~6 M, (ii) dNG=
10"7 M (iii) dNG= 10"8 M (iv) dNG= 10"9 M (v) dNG= 10"10 M (vi) dNG= 10~u M (vii)
dNG= 10"12 M (viii) dNG= 10"13 M (ix) dNG= 10'14 M (x) dNG= 10"15 M (xi) dNG= 0.5 X 10"lδ M (xii) dNG= 1 X 10'16 M was done at pulse height of 50 mV and pulse width of 70 ms, after MB (40 μM) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl. It was observed that MB peak height decreases with increase in the dNG concentration indicating enhanced number of double stranded DNA molecules at the surface. It may be noted that we have not observed any change in the MB peak height due to hybridization with dNG <10"16 M. Hence, the detection limit of dNG-BdNG-avidin-PANI/ITO electrode is 10~16 M. (Figure 6)
Example 9: Determination of Specificity of Probe DNA on polyaniline matrix in PBS in presence of MB
Differential pulse voltammograms (DPV) of -
(Ϊ)N. meningitidis spiked swab sample
(ii)iV. meningitidis DNA from culture
(iii)E. coli spiked swab sample
(jv)E.coli DNA from culture of ATCC 25922
(v)BdNG-avidin-PANI/ITO electrode
(vi)Λ/. gonorrhoeae spiked swab sample
(vii)N. gonorrhoeae positive swab sample from patients
(viii)N. gonorrhoeae DNA from culture was done at pulse height of 50 mV, and pulse width of 70 ms, after MB (20 μM) pretreatment at +0.1 V for 10 s in 0.05 M phosphate buffer of pH 7.0 containing 0.9% NaCl. DNA hybridization or presence of dsDNA at electrode surface was observed as the absence/decrease in MB peak after hybridization with the N. gonorrhoeae culture spiked
swab sample, positive patient swab sample. However, no decrease in the peak height was observed after exposing the STD electrode with N. meningitidis and E. coli culture and spiked swab samples. The results revealed that the electrode is highly specific and can distinguish the presence of N. gonorrhoeae from other species like N. meningitidis and E. coli. (Figure 7)
Example 10: Hybridization with different Neisseria gonorrhoeae culture spiked sample
Patient' s swab samples were used for DNA extraction using QIAamp DNA Mini Kit. This sample was then denatured at 7O0C and given a cold shock by subsequently keeping in ice. DNA immobilized electrode was able to detect the presence of the complementary target sequence in N. gonorrhoeae culture (0.5 McFarland) 108 cells/ml spiked sample and N. gonorrhoeae culture positive swab sample of patients. (Figure 7).
Advantages:
•The present invention avoids the disadvantages associated with traditional culturing techniques as it will provide rapid detection of the bacteria regardless of its metabolic state.
•The probe in the current invention is designed from the chromosomal DNA which is present in all the strains of the bacteria rather than plasmid DNA which is present in only some strains or even when present, can be lost.
•The present invention provides a nucleic acid probe that combines increased sensitivity for detection, based on the opa gene which is a multicopy gene, for N. gonorrhoeae with an increased specificity. Further the probe is specific providing no signal with Non- Neisseria gonorrhoeae Neisseria Strains (NgNS) and other gram negative bacteria (GNB).
•Further, this invention provides a means for accurate and rapid detection of N. gonorrhoeae and distinguishes specifically between the two pathogenic species of
Neisseria (N. gonorrhoeae and N. meningitidis).
•The present invention using a unique nucleotide sequence from opa gene of Neisseria
gonorrhoeae with a remarkably low detection limit will enable diagnosis of asymptomatic infections using biosensor technology. This has the capability of detecting upto femtomolar concentration of the DNA.
•The present invention utilizes electrochemical detection of hybridization process, thereby providing improved sensitivity.
• The current invention and its proposed usage as a biosensor is based on the amplification of the signal. This is different from the strategy used in PCR, i.e., amplification of target DNA which is liable to be affected by the presence of inhibitors in urine.
•Lastly, the present invention is capable of detecting Neisseria gonorrhoeae in all types of clinical samples.
Claims
1. A pair of oligonucleotide primers for the specific amplification of opa gene of Neisseria gonorrhoeae by PCR , consisting of:
i) a forward primer represented by SEQ ID 1, having the sequence of
"CGGTGCTTCATCACCTTAG"; ii)a reverse primer represented by SEQ ID 2, having the sequence of
"GGATTCATTTTCGGCTCCTT".
2. Primer as claimed in claim 1, wherein the forward primer of SEQ ID No. 1 or its complement is useful as a probe for the detection of Neisseria gonorrhoeae .
3. Primer as claimed in claim 2, wherein the probe is labelled with biotin.
4. Primer as claimed in claim 2 or 3, wherein labelled probe is useful for the detection of Neisseria gonorrhoeae.
5. Primer as claimed in any of the claims 2- 4, wherein the hybridized regions of the said probe or its complement and the target nucleic acid sequence or its complement have 95-100% complementarity.
6. Primer as claimed in any of the claims 2- 5, wherein the oligonucleotide probe is specific for Neisseria gonorrhoeae and provides no signal with Non-Λ/. gonorrhoeae Neisseria strains (NgNS) and other Gram negative Bacteria (GNB).
7. An electrochemical method for the species specific detection of Neisseria gonorrhoeae having high sensitivity and specificity, comprising the steps of: a) depositing nanostructured polyaniline (nsPANI) electrochemically onto Indium tin oxide (ITO) coated glass plates in monomer solution containing 0.1M aniline in 1 M HCl using a three-electrode electrochemical cell; b) immobilizing 2μl of avidin (lmg/ml) onto the ns-PANI/ITO surface as obtained in . step (a) followed by washing the avidin-ns-PANI/ITO surface; c) incubating the avidin-ns-PANI/ITO surface as obtained in step (b) with 2μl of biotinylated probe (BdNG, Ing/ ml) as claimed in claim 2 to obtain nucleic acid functionalized BdNG-avidin-nsPANI/ITO electrode; d) incubating the BdNG-avidin-nsPANI/ITO electrode as obtained in step (c) in phosphate buffer saline containing methylene blue (20μM); e) incubating the BdNG-avidin-nsPANI/ITO electrode as obtained in step (d) with the test sample to be tested for Neisseria gonorrhoeae; f) detecting the presence of Neisseria gonorrhoeae in the test sample by evaluating the hybridization of the target nucleic acid sequence present in the test sample with the BdNG-avidin-nsPANI/ITO electrode, which is done by monitoring the oxidation/reduction peak of methylene blue indicator determined by Cyclic voltammetry (CV)/ Differential Pulse Voltammetry (DPV) measurements.
8. The method as claimed in claim 7, wherein the oligonucleotide probe is specific for Neisseria gonorrhoeae and provides no signal with Non-N. gonorrhoeae Neisseria strains (NgNS) and other Gram negative Bacteria (GNB).
9. The method as claimed in claim 7, wherein the decrease in the magnitude of methylene blue redox peak indicates the presence of N. gonorrhoeae in the sample.
10. The method as claimed in claim 7, wherein the concentration of complementary probe sequence (dNG) is in the range of 1 X 10"6 M to 1 X 10~16 M.
11. The method as claimed in claim 7, wherein it determines the presence of N. gonorrhoeae in both invasive as well as non-invasive samples.
12. The method as claimed in claim 7, wherein detection sensitivity is upto 10~16 M of DNA.
13. The method as claimed in claim 7, wherein the method is able to detect upto single base pair mismatch in target DNA thereby providing high specificity.
14. A kit for the detection of Neisseria gonorrhoeae, wherein the kit comprises oligonucleotide primer of claim 2 , or the complement thereof along with buffers and instructional manual for operating the said kit.
15. A biosensor for the detection of Neisseria gonorrhoeae in clinical samples/ bacterial culture/ PCR products, comprising:
(i)a nucleic acid probe as claimed in claim 2;
(ii)an immobilization support;
(iii)a transducer capable of sensing the oxidation/reduction signal of methylene blue, monitored by Cyclic Voltammetry (CV), Differential Pulse Voltammetry (DPV) transducer and the like.
16. A biosensor as claimed in claim 15, wherein the immobilization support is selected from the group consisting of polyaniline electrodes, screen printed devices, conducting polymers, metal oxides, metals and nanomaterials.
17. A biosensor as claimed in claim 15, wherein the biosensor is based on amplification of the signal instead of amplification of the target nucleic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AP2012006092A AP2012006092A0 (en) | 2009-07-07 | 2010-07-07 | Nucleic acid primers, probe and method for detection of neisseria gonorrhoeae. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN1391/DEL/2009 | 2009-07-07 | ||
| IN1391DE2009 | 2009-07-07 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011004397A1 true WO2011004397A1 (en) | 2011-01-13 |
Family
ID=42797218
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IN2010/000457 Ceased WO2011004397A1 (en) | 2009-07-07 | 2010-07-07 | Nucleic acid primers, probe and method for detection of neisseria gonorrhoeae |
Country Status (2)
| Country | Link |
|---|---|
| AP (1) | AP2012006092A0 (en) |
| WO (1) | WO2011004397A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112080556A (en) * | 2020-08-13 | 2020-12-15 | 中国医学科学院病原生物学研究所 | Method for performing multiple rapid sequencing on gonococcus drug-resistant gene |
| CN114317785A (en) * | 2021-12-24 | 2022-04-12 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting gonococcus |
| US12264365B2 (en) | 2020-03-23 | 2025-04-01 | Talis Biomedical Corporation | Polynucleotides for amplification and detection of SARS-CoV-2 |
| US12275999B2 (en) | 2016-11-10 | 2025-04-15 | Talis Biomedical Corporation | Polynucleotides for the amplification and detection of chlamydia trachomatis |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5162199A (en) | 1989-06-22 | 1992-11-10 | Boehringer Mannheim Gmbh | Neisseria-specific dna probe |
| US5173401A (en) | 1989-07-14 | 1992-12-22 | Boehringer Mannheim Gmbh | Detection of neisseria gonorrohoeae |
| US5432271A (en) | 1989-05-24 | 1995-07-11 | Amoco Corporation | Nucleic acid probes for the detection of Neisseria gonorrhoeae |
| US5453355A (en) | 1990-01-26 | 1995-09-26 | Abbott Laboratories | Oligonucleotides and methods for the detection of Neisseria gonorrhoeae |
| US5525717A (en) | 1990-11-09 | 1996-06-11 | Behringwerke Ag | Support-bound nucletide probe for neisseria gonorrhoeae |
| US5976805A (en) | 1998-04-27 | 1999-11-02 | Becton Dickinson And Company | Neisseria gonorrhoeae specific DNA fragment--GC3 |
| US6100027A (en) | 1995-06-07 | 2000-08-08 | Gen-Probe Incorporated | Nucleic acid probes and amplification oligonucleotides for Neisseria species |
-
2010
- 2010-07-07 AP AP2012006092A patent/AP2012006092A0/en unknown
- 2010-07-07 WO PCT/IN2010/000457 patent/WO2011004397A1/en not_active Ceased
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5432271A (en) | 1989-05-24 | 1995-07-11 | Amoco Corporation | Nucleic acid probes for the detection of Neisseria gonorrhoeae |
| US5162199A (en) | 1989-06-22 | 1992-11-10 | Boehringer Mannheim Gmbh | Neisseria-specific dna probe |
| US5173401A (en) | 1989-07-14 | 1992-12-22 | Boehringer Mannheim Gmbh | Detection of neisseria gonorrohoeae |
| US5453355A (en) | 1990-01-26 | 1995-09-26 | Abbott Laboratories | Oligonucleotides and methods for the detection of Neisseria gonorrhoeae |
| US5525717A (en) | 1990-11-09 | 1996-06-11 | Behringwerke Ag | Support-bound nucletide probe for neisseria gonorrhoeae |
| US6020461A (en) | 1990-11-09 | 2000-02-01 | Behringwerke Aktiengesellschaft | Hexapeptides of Neisseria gonorrhoeae |
| US6100027A (en) | 1995-06-07 | 2000-08-08 | Gen-Probe Incorporated | Nucleic acid probes and amplification oligonucleotides for Neisseria species |
| US5976805A (en) | 1998-04-27 | 1999-11-02 | Becton Dickinson And Company | Neisseria gonorrhoeae specific DNA fragment--GC3 |
Non-Patent Citations (10)
| Title |
|---|
| ANSARI ANEES A ET AL: "Sol-gel derived nano-structured zinc oxide film for sexually transmitted disease sensor.", THE ANALYST, vol. 134, no. 5, May 2009 (2009-05-01), pages 997 - 1002, XP009139631, ISSN: 1364-5528 * |
| ARORA KAVITA ET AL: "Ultrasensitive DNA hybridization biosensor based on polyaniline", BIOSENSORS & BIOELECTRONICS, vol. 23, no. 5, December 2007 (2007-12-01), pages 613 - 620, XP002603849, ISSN: 0956-5663 * |
| DEMPSEY J A ET AL: "Physical map of the chromosome of Neisseria gonorrhoeae FA1090 with locations of genetic markers, including opa and pil genes.", JOURNAL OF BACTERIOLOGY, vol. 173, no. 17, September 1991 (1991-09-01), pages 5476 - 5486, XP002606599, ISSN: 0021-9193 * |
| GERAATS-PETERS C W M ET AL: "SPECIFIC AND SENSITIVE DETECTION OF NEISSERIA GONORRHOEA IN CLINICAL SPECIMENS BY REAL-TIME PCR", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 43, no. 11, 1 November 2005 (2005-11-01), AMERICAN SOCIETY FOR MICROBIOLOGY, WASHINGTON, DC, US, pages 5653 - 5659, XP008058231, ISSN: 0095-1137, DOI: 10.1128/JCM.43.11.5653-5659.2005 * |
| KAUSHIK AJEET ET AL: "A nanostructured cerium oxide film-based immunosensor for mycotoxin detection.", NANOTECHNOLOGY, vol. 20, no. 5, 55105, 4 February 2009 (2009-02-04), pages 1 - 8, XP002603850, ISSN: 1361-6528 * |
| PATEL M K ET AL: "Electrochemical DNA sensor for Neisseria meningitidis detection", BIOSENSORS AND BIOELECTRONICS, vol. 25, no. 12, 15 August 2010 (2010-08-15), ELSEVIER BV, NL, pages 2586 - 2591, XP027077350, ISSN: 0956-5663, [retrieved on 20100424], DOI: 10.1016/J.BIOS.2010.04.025 * |
| PRABHAKAR NIRMAL ET AL: "Polyaniline based nucleic acid sensor.", THE JOURNAL OF PHYSICAL CHEMISTRY. B 17 APR 2008 LNKD- PUBMED:18335925, vol. 112, no. 15, 17 April 2008 (2008-04-17), pages 4808 - 4816, XP002603848, ISSN: 1520-6106 * |
| SINGH R ET AL: "STD sensor based on nucleic acid functionalized nanostructured polyaniline", BIOSENSORS AND BIOELECTRONICS, vol. 24, no. 7, 15 March 2009 (2009-03-15), ELSEVIER BV, NL, pages 2232 - 2238, XP025959005, ISSN: 0956-5663, [retrieved on 20081211], DOI: 10.1016/J.BIOS.2008.11.030 * |
| SINGH RENU ET AL: "Polyaniline/carbon nanotubes platform for sexually transmitted disease detection.", JOURNAL OF MOLECULAR RECOGNITION : JMR, vol. 23, no. 5, September 2010 (2010-09-01), pages 472 - 479, XP002603851, ISSN: 1099-1352 * |
| SINGH, BIOSENSORS AND BIOELECTRONICS, vol. 24, no. 7, 15 March 2009 (2009-03-15), pages 2232 - 2238 |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12275999B2 (en) | 2016-11-10 | 2025-04-15 | Talis Biomedical Corporation | Polynucleotides for the amplification and detection of chlamydia trachomatis |
| US12264365B2 (en) | 2020-03-23 | 2025-04-01 | Talis Biomedical Corporation | Polynucleotides for amplification and detection of SARS-CoV-2 |
| CN112080556A (en) * | 2020-08-13 | 2020-12-15 | 中国医学科学院病原生物学研究所 | Method for performing multiple rapid sequencing on gonococcus drug-resistant gene |
| CN112080556B (en) * | 2020-08-13 | 2022-05-27 | 中国医学科学院病原生物学研究所 | Method for performing multiple rapid sequencing on gonococcus drug-resistant gene |
| CN114317785A (en) * | 2021-12-24 | 2022-04-12 | 苏州中科先进技术研究院有限公司 | Primer probe composition, kit and method for detecting gonococcus |
Also Published As
| Publication number | Publication date |
|---|---|
| AP2012006092A0 (en) | 2012-02-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2021277704B2 (en) | Methods and compositions for detecting bacterial nucleic acid and diagnosing bacterial vaginosis | |
| US8628926B2 (en) | Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith | |
| DK2844762T3 (en) | TESTING FOR ANTIBIOTIC SENSITIVITY USING PROBRIOSOMAL RNA PROBLEMS | |
| JP7839936B2 (en) | Composition and method for detecting bacterial nucleic acids and diagnosing bacterial vaginosis | |
| WO2011004397A1 (en) | Nucleic acid primers, probe and method for detection of neisseria gonorrhoeae | |
| JP4956699B2 (en) | Polynucleotide probes for detection and quantification of Candida albicans and Candida dubliniensis | |
| WO2016038351A1 (en) | Methods of detection of multidrug resistant bacteria | |
| HK40054528A (en) | Kits for detecting bacterial nucleic acid and diagnosing bacterial vaginosis | |
| HK40054528B (en) | Kits for detecting bacterial nucleic acid and diagnosing bacterial vaginosis | |
| KR19980701522A (en) | Nucleic Acid Amplification Oligonucleotides and Probes to Lyme Disease Associated Borrelia for Borrelia Associated with Lyme Disease | |
| HK1150864A (en) | Probe and primer for tubercle bacillus detection, and method of detecting human tubercle bacillus therewith |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10747085 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10747085 Country of ref document: EP Kind code of ref document: A1 |
