WO2011000855A1 - 2-carboxamide cycloamino ureas useful as pi3k inhibitors - Google Patents

Abstract

The present invention relates to compounds of formula (I) and sails thereof, wherein the substituents are as defined in the description, to compositions and use of the compounds in the treatment of diseases ameloriated by inhibition of phosphatidylinositol 3-kinase.

Description

2-CARBOXAMIDE CYCLOAMINO UREAS USEFUL AS PI3K INHIBITORS

The present invention relates to substituted 2-carboxamide cycloamino ureas, as new phosphatidylinosilol (Pl) 3-kinase inhibitor compounds, their pharmaceutically acceptable salts, prodrugs thereof and processes for their production. This invention also relates to compositions of these compounds, either alone or in combination with at least one additional therapeutic agent, and optionally in combination with a pharmaceutically acceptable carrier. This invention still further relates to methods of use of these compounds, either alone or in combination with at least one additional therapeutic agent, in the prophylaxis or treatment of a number of diseases, in particular, those mediated by one or more of abnormal activity of growth factors, receptor tyrosine kinases, protein serlne/heroine kinases, G protein coupled receptors and phospholipid kinases and phosphatases.

Phosphatidylinositol 3-kinases (PI3Ks) comprise a family of lipid kinases that catalyze the transfer of phosphate to the D-3^* position of inositol lipids to produce phosphoinositoi-3- phosphate (PIP), phosphoinosito(-3,4-diphosphate (PIP₂) and phosphoinositol-3.4.5- triphosphate (PlP₃) that, in turn, act as second messengers in signaling cascades by docking proteins containing pleckstrin-homology, FYVE, Phox and other phosphαlipid-bindmg domains into a variety of signaling complexes often at the plasma membrane

((Vanhaesebroeck et aL Annu. Rev. Biochem 70:535 (2001); Katso et al._r Annυ. Rev. Cell Dev. Biol. 17:615 (2001)). Of the two Class 1 PI3Ks, Class 1A PI3Ks are heterodimers composed of a catalytic p110 subunit (α, p, δ isoforms) constitutive^ associated with a regulatory subunit that can be pβδα, p55α, p50u_s p85β or ρ55γ. The Class 1B sub-class has one family member, a heterodimer composed of a catalytic p11Oy subunit associated with one of two regulatory subunits, p101 or p84 (Fruman et al., Annυ Rev. Biochem. 67:481 (1998); Sυire et ai., Curr. Biol. 15:566 (2005)). The modular domains of the p85/55/50 subunits include Src Homology (SH2) domains that bind phosphotyrosine residues in a specific sequence context on activated receptor and cytoplasmic tyrosine kinases, resulting in activation and localization of Class 1A PI3Ks. Class 1B PI3K is activated directly by G protein-coupled receptors that bind a diverse repertoire of peptide and non-peptide ligands {Stephens et al.. Ce// 89:105 (1997)); Katso et al., Annu. Rev. Cell Dev. Biol. 17:615-675 (2001)). Consequently, the resultant phospholipid products of class I PI3K link upstream receptors with downstream cellular activities including proliferation, survival, chemotaxis, cellular trafficking, motility, metabolism, inflammatory and allergic responses, transcription and translation (Cantley et al., Ce// 64:281 (1991); Escobedo and Williams_: Nature 335:85 (1988); Fantl et al., Ce// 69:413 (1992)).

!n many cases, PIP2 and P1P3 recruit Akt, the product of the human homoiogue of the viral oncogene v-Akt, to the plasma membrane where it acts as a nodal point for many

intracellular signaling pathways important for growth and survival (Fantl et ai., Ce// 69:413- 423(1992); Bader et al., Nature Rev. Cancer 5:921 (2005); Vivanco and Sawyer, Nature Rev. Cancer 2:489 (2002)). Aberrant regulation of PI3K. which often increases survival through Akt activation, is one of the most prevalent events in human cancer and has been shown to occur at multiple levels. The tumor suppressor gene PTEN, which

dephosphorylates phosphoinositides at the 3^* position of the inositol ring and in so doing antagonizes PI3K activity, is functionally deleted in a variety of tumors. In other tumors, the genes for the p110« isoform, PIK3CA, and for Akt are amplified and increased protein expression of their gene products has been demonstrated In several human cancers.

Furthermore, mutations and translocation of p85α that serve to up-regulate the p85-p110 complex have been described in human cancers. Finally, somatic missense mutations in PIK3CA that activate downstream signaling pathways have been described at significant frequencies in a wide diversity of human cancers (Kang at el., Proc. Natl. Acad. Sc/. USA 102:802 (2005); Samuels et a\., Science 304:554 (2004); Samuels et al., Cancer Cell 7.561- 573 (2005)). These observations show that deregulation of ρhosphoinositoi-3 kinase and the upstream and downstream components of this signaling pathway is one of the most common deregulations associated with human cancers and proliferative diseases (Parsons et ai., Nature 436:792 (2005); Hennessey at el.. Nature Rev. Drug Disc. 4:988-1004 (2005)).

In view of the above, inhibitors of PI3Ks would be of particular value in the treatment of proliferative disease and other disorders. Selectivity towards the PI3K u isoform is desirable, and further desirable properties include improved pharmacokinetic properties and/or chemical stabiiity.

WO2004/096797 discloses certain thiazole derivatives as inhibitors of P13 kinase and their use as pharmaceutical.

WO 2005/021519 also discloses certain thiazole derivatives as inhibitors of PI3 kinase and their use as pharmaceutical. It has now been found that the 2-carboxamide cycioamino ureas of the formula I given below have advantageous pharmacological properties and inhibit, for example, the PI3 kinases (phosphatidylinositol 3-kinase). In particular, preferably, these compounds show selectivity for PI3K alpha versus beta and/or deita and/or gamma subtypes in the biochemical and/or in the ceiiular assay. A further property which is preferably desirable for compounds of formula I includes improved stability, for example, improved chemical stability e.g. in solid form and/or in buffer solution. Hence, the compounds of formula I are suitable, for example, to be used in the treatment of diseases depending on the PI3 kinase (in particular PI3K afpha, such as those showing somatic mutation of PIK3CA or germNne mutations or somatic mutation of PTEN), especiaiiy proliferative diseases such as tumor diseases and

leukaemias.

In a first aspect, the present invention provides compounds of formula I,

<0

wherein.

A an unsubstituted or substituted aryl ring or unsubstituted or substituted heterocyclic ring fused to the rest of the molecule at the positions indicated by the symbol *:

X-Y is <CHj)_r or 0(CHj)₁ or (CH₂),O wherein,

r is 1, 2 or 3;

t is 1 or 2;

n is 0, 1 or 2;

q is O₁ 1, 2, 3 or 4;

R' represents, independently at each occurrence,

halo;

hydroxy;

unsubstituted or substituted aryi; unsubstituted or substituted amino;

unsubstitutecl C₁-C₇-SiKyI;

Ci-C₇-alkyi, which is substituted one or more times by

hydroxy, C_rCra!koxy, unsubstituted or substituted amino, aryl or

heterocyclyl, and wherein aryl may be mono or poly-substituted by halo; or two R¹ substituents together form an alkandtyf to form a cyclic moiety, optionaliy substituted by hydroxy or halo; or a salt, solvate, hydrate or prodrug thereof.

The invention may be more fully appreciated by reference to the following description, including the following glossary of terms and the concluding examples. As used herein, the terms "including", "containing" and "comprising" are used herein in their open, non-iimiting sense.

Any formula given herein is intended to represent compounds having structures depicted by the structural formula as welf as certain variations or forms, in particular, compounds of any formula given herein may have asymmetric centers and therefore exist in different stereoisomer^ forms such as different enantiomeric forms. If at least one asymmetrical carbon atom is present in a compound of the formula I, such a compound may exist in optically active form or in the form of a mixture of optical isomers, e. g. in the form of a racemic mixture. Thus an asymmetric carbon atom may be present in the (R)-, (S)- or (Reconfiguration, preferably in the (Ry or (S)-configuration. AN optical isomers and their mixtures, including the racemic mixtures, are part of the present invention. Thus, any given formula given herein is intended to represent a racemate, one or more enantiomeric forms, one or more diastereomeric forms, one or more atropisomeric forms, and mixtures thereof. Furthermore, certain structures may exist as geometric isomers (e.g. cis and trans isomers), as tautomers, or as atropisomers. For example, substituents at a double bond or a ring may be present in cis- (=Z-) or trans (=E-) form. The compounds of the invention may thus be present as mixtures of isomers or preferably as pure isomers, preferably as enantiomer-pure diastereomers or pure enantiomers. Any formula given herein is intended to represent hydrates, solvates, and polymorphs of such compounds, and mixtures thereof.

Any formula given herein is also intended to represent unlabeled forms as well as

isotopicaiiy labeled forms of the compounds, lsotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine, and chlorine, such as ²H, ³H, '¹C, ¹³C₁ ^1ΛC, ^1SN, ³¹P₁ ³²P₁ ¹⁸F ³⁵S, ³⁶Ci, ¹²⁵I respectively. Various isotopicaiiy labeled compounds of the present invention, for example those into which radioactive isotopes such as ³H₁ ¹³C, and ^HC are incorporated. Such isotopicaiiy labelled compounds are useful in metabolic studies (preferably with ¹⁴C). reaction kinetic studies {with, for example ²H or ³H), detection or imaging techntques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays, or in radioactive treatment of patients. In particular, an ¹⁸F or labeled compound may be particularly preferred for PET or SPECT studies. Further, substitution with heavier isotopes such as deuterium (i.e., ²H) may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements. Isotopicaiiy labeled compounds of this invention and prodrugs thereof can generally be prepared by carrying out the procedures disclosed in the schemes or in the examples and preparations described below by substituting a readily available isotopicaiiy labeled reagent for a non-isotopicaiiy labeled reagent. Further, substitution with heavier isotopes, particularly deuterium (i.e., ²H or D) may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements or an improvement in therapeutic index. It is understood that deuterium in this context is regarded as a substituent in the compound of the formula (I). The concentration of such a heavier isotope, specifically deuterium, may be defined by the isotopic enrichment factor. The term "isotopic enrichment factor" as used herein means the ratio between the isotopic abundance and the natural abundance of a specified isotope. If a substituent in a compound of this invention is denoted deuterium, such compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation at each designated deuterium atom), at least 4000 {60% deuterium incorporation) , at least 4500 (67.5% deuterium incorporation), at least 5000 {75% deuterium incorporation)_: at least 5500 (82.5% deuterium incorporation), at least 6000 {90% deuterium incorporation), at feast 6333.3 {95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at ieast 6633.3 (99.5% deuterium incorporation). In the compounds of this invention any atom not specificaiiy designated as a particular isotops is meant to represent any stable isotope of that atom. Unless otherwise stated, when a position is designated specifically as "H" or "hydrogen", the position is understood to have hydrogen at its natural abundance isotopic composition. Accordingly, in the compounds of this invention any atom specifically designated as a deuterium (O) is meant to represent deuterium, for example in the ranges given above.

When referring to any formula given herein, the selection of a particular moiety from a iist of possible species for a specified variable is not intended to define the moiety for the variable appearing elsewhere. In other words, where a variable appears more than once, the choice of the species from a specified fist is independent of the choice of the species for the same variable elsewhere in the formula (where one or more up to all more general expressions in embodiments characterized as preferred above or below can be replaced with a more specific definition, thus leading to a more preferred embodiment of the invention,

respectively).

Where the plural form (e.g. compounds, salts, pharmaceuticai preparations, diseases and the like) is used, this includes the singular (e.g. a single compound, a single salt, a single pharmaceutical preparation, a single disease, and the fike). "A compound" does not exclude that (e.g. in a pharmaceutical formulation) more than one compound of the formula (I) (or a saft thereof) is present.

Salts are preferably the pharmaceutically acceptable salts of compounds of formula {!) if they are carrying salt-forming groups. Acids/bases required to form the salts are generally known in the field.

The following general definitions shal! apply in this specification, unless otherwise specified: Halogen (or halo) denotes fluorine, bromine, chlorine or iodine, in particular fluorine, chlorine. Halogen-substituted groups and moieties, such as alkyl substituted by halogen {halogenalkyl) can be mono-, poly- or per-haiogenated. Hetero atoms are atoms other than Carbon and Hydrogen, preferably nitrogen (N), oxygen (O) or sulfur (S), in particular nitrogen.

"Alkyl" refers to a straight-chain or branched-chain alkyl group, and includes C_halky! and more preferably C^alkyl. Such alkyl groups include, for example, methyl, ethyl, n- or iso- propyl, n-, iso-, sec- or tert-butyl, n-pentyl, n-hexyl, n-heptyl, with particular preference given to methyi, ethyl, n-propyl, iso-propyl, n-butyl and iso-butyl. Atkyl may be unsubstituted or substituted. Exemplary substituents include, but are not limited to hydroxy, alkoxy, halogen (especially fiuoro), amino and di-substituted amino, mono- or di-aikyl substituted amino, acetylamino, morphoϋnyl, aryl. An example of a substituted alkyl is trifluoromethyl.

Cycioalkyl may also be a substitυent to alkyi. An example of such 3 case is the moiety

(alkyO-cycloalkyl, such as (afkyl)-cyclopropyl or (aikyl)-cyciobutyi, e.g. methyl-cyclopropyl or methyi-cyclobutyi. A more specific example of an (alkyl)-cycioalkyl moiety includes geminai- type of substitution pattern, e.g. 1-aikyl cycioalkyl, such as 1 -methyl cydopropyl. Another example of cycloatkyl as a substitυent to alkyl is aikandiyl-cycloafkyl, such as alkandiyl- cyclopropyl, e.g. -CHu-cyclopropyl. C_rC₇-aikyi is alky! with from and including 1 up to and including 7 carbon atoms, preferably from and including 1 up to and including 4 carbon atoms (CrC^-alkyl), and is linear or branched: preferably, lower alkyl is butyl, such as n- butyl, sec-butyl, isobutyl. tert-buiyl, propyl, such as n-propyl or isopropyl, ethyl or preferably methyl.

Each alkyl part of other groups like "alkoxy", "alkoxyaikyl", "alkoxycarbonyl", "alkoxy- carbonylalkyl", "alkylsulfonyi", "alkylsulfoxyl", "alkyiamino", "halogenalkyl" shall have the same meaning as described in the above-mentioned definition of "aikyi". "C₃.₇-Cycloalkyr refers to a saturated or partially saturated, monocyclic, fused poiycycllc, or Spiro poiycycffc. carbocycie having from 3 to 7 ring atoms per carbocycle. Illustrative examples of cycioalkyl groups include the following moieties: cyclopropyl, cyclobutyl, cycipentyl and cylclohexyl. C₃-C₇-cycloa!kyl may be unsubstituted or substituted; exemplary substrtuents are provided in the definition for alkyl. C₃-C₆-cyc!oalkyl may also be a substitυent on other groups, e.g. on an aikyl group.

"Aryl" refers to an unsaturated carbocycfic aromatic ring system, preferably, having a ring system of not more than 16 carbon atoms, especially not more than 10 carbon atoms, e.g. having 6 to 16, preferably δ to 10 ring carbon atoms, is preferably mono- or bi-cyciic, and is unsubstituted or substituted. For example, aryl is unsubstituted or substituted phenyi.

"Heterocyclyl" refers to a heterocyclic radical that is unsaturated {in particular maximaiiy unsaturated, eg. carrying the highest possible number of conjugated double bonds in the riπg(s)) e.g. heteroaryl), saturated or partially saturated in the bonding ring and is preferably a monocyclic or in a broader aspect of the invention bicyclic ring; has 3-16 ring atoms, more preferably 4-10 ring atoms, wheretn at least in the ring bonding to the radical of the molecule of formula (I) one or more, preferably 1-4 ring atoms, especially one or two ring atoms are a heteroatom selected from the group consisting of nitrogen, oxygen and sulfur; the bonding ring preferably having 4-12 ring atoms, especiaily 4-7 ring atoms, for example 6-10 ring atoms, especially for heteroaryl, such as 5, 6, 9 or 10 ring atoms. The heterocyciyl may be unsubstituted or substituted by one or more, especially 1 to 3. substituents independently selected from the group consisting of alkyl or the substituents defined above for substituted alkyi and / or from one or more of the following substituents; oxo (=0), thiocarbonyl (=S), imino(-NH), imino-iower alkyl, and, for nitrogen containing heteroaryls, including N-oxides thereof.

"Treatment" includes prophylactic (preventive) and therapeutic treatment as well as the delay of progression of a disease or disorder.

"PI3 kinase mediated diseases" (especially PI3K alpha mediated diseases) are especially such disorders that respond in a beneficial way (e.g. amelioration of one or more symptoms, delay of the onset of a disease, up to temporary or complete cure from a disease) to the inhibition of a PI3 kinase, especially inhibition of PiSKalpha (where the diseases to be treated may include those showing somatic mutation of PIK3CA or germline mutations or somatic mutation of PTEN). Diseases to be treated include especially proliferative diseases such as tumor diseases, including solid tumors, leukaemias, glioblastoma, breast cancer and prostate cancer may be mentioned). Salts" {which, what is meant by "or salts thereof" or "or a salt thereof), can be present alone or in mixture with free compound of the formula I and are preferably pharmaceutically acceptable salts. Salt-forming groups in a compound of formula (I) are groups or radicals having basic or acidic properties. Compounds having at least one basic group or at least one basic radical, e.g., amino; a secondary amino group not forming a peptide bond or a pyridyl radical, may form acid addition salts, e.g., with inorganic acids, such as hydrochloric acid, sulfuric acid or a phosphoric acid; or with suitable organic carboxyiic or sulfonic acids, e.g., aliphatic mono- or di-carboxylic acids, such as trifluoroacetic acid, acetic acid, propionic acid, glycolic acid, succinic acid, maieic acid, fumaric acid, hydroxymaleic acid, malic acid, tartaric acid, citric acid or oxalic acid; or amino acids, such as argtnine or lysine; aromatic carboxyiic acids, such as benzoic acid; 2-phenoxy-benzoic acid; 2-acetoxy-benzoic acid; salicylic acid: 4-aminosalicyiic acid: aromatic-aliphatic carboxyiic acids, such as mandelic acid or cinnamic acid; heteroaromatic carboxyiic acids, such as nicotinic acid or isonicotinic acid; aliphatic sulfonic acids, such as methane-, ethane- or 2-hydroxyethanesuifonic acid: or aromatic sulfonic acids, e.g., benzene-, p-toluene- or naphthaiene-2 -sulfonic acid. When several basic groups are present mono- or poly-acid addition salts may be formed.

Compounds of formula (I) having acidic groups, a carboxy group or a phenolic hydroxy group, may form metal or ammonium saits. such as alkali metal or alkaline earth metal salts, e.g., sodium, potassium, magnesium or calcium salts; or ammonium saits with ammonia or suitable organic amines, such as tertiary monoamines, e.g., triethylamine or

tπ{2-hydraxyethyi)-amine, or heterocyclic bases, e.g., Λ/-ethyl-pipeπdine or

tyW-dimethyipiperazine. Mixtures of salts are possible.

Compounds of formula (I) having both acidic and basic groups can form internal saits.

For isolation or purification purposes it is also possible to use pharmaceutically unacceptable salts, for example picrates or perchlorates. For therapeutic use, only pharmaceutically acceptable salts or free compounds are employed (where applicable in the form of pharmaceutical preparations), and these are therefore preferred. In view of the close relationship between the novel compounds in free form and those in the form of their salts, including those salts that can be used as intermediates, for example in the purification or identification of the novel compounds, any reference to the free compounds hereinbefore and hereinafter is to be understood as referring also to the corresponding salts, as appropriate and expedient. Compounds of the present invention may also form solvates and hydrates, and as such any reference to a compound of formula (!) is therefore to be understood as referring also to the corresponding solvate and/or hydrate of the compound of formula (f). as appropriate and expedient.

The present invention also relates to pro-drugs of a compound of formula (I) that convert in vivo to the compound of formula (I) as such. Any reference to a compound of formula (f) is therefore to be understood as referring afso to the corresponding pro-drugs of the compound of formula (I), as appropriate and expedient.

Combination refers to either a fixed combination in one dosage unit form, or a kit of parts for the combined administration where a compound of the formula I and a combination partner (e.g. an other drug as explained beiow, also referred to as "therapeutic agent" or "co- agent") may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect. The terms "co-administration" or "combined administration" or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in whfch the agents are not necessarily administered by the same route of administration or at the same time. The term "pharmaceutical combination" as used herein means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredients, e.g. a compound of formula I and a combination partner, are both administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" means that the active ingredients, e.g. a compound of formula I and a combination partner, are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more active ingredients.

In preferred embodiments, which are preferred independently, collectively or in any combination or sub-combination, the invention relates to a compound of the formula I, in free base form or in salt form, wherein the substituents are as defined herein. As shown in formula I, the alpha-amide substituent is at the 2-position on the pyrrolidine ring and the stereochemistry at this position is as drawn. The ring A is preferably an unsubstituted or substituted 5- or 6-membered heterocyclic

{preferably a heteroaryl) ring containing 1 or 2 heteroatoms selected from N, S or O, wherein at least one heteroatom is N.

More preferably, ring A is selected from an unsubstituted or substituted pyridine ring, unsubstituted or substituted pyhmidine ring, unsubstituted or substituted thiazole ring, unsubstituted or substituted pyrazole ring or unsubstituted or substituted oxazole nng. More preferred is an unsubstituted or substituted pyridine ring, unsubstituted or substituted pyrimidine ring or unsubstituted or substituted thiazoie ring, Preferably, ring A is fused to the rest of the molecule of formula I through carbon atoms of ring A.

Ring A is preferably substituted by one, two or three R² groups, preferably two R² groups, most preferably one R² group, independently selected at each occurrence from,

unsubstituted or substituted d-Cy-alkyi;

unsubstituted or substituted amino;

unsubstituted or substituted C₃-C₇-cycloalky!.

Preferably, R² is selected from

unsubstituted C,-C₇-alkyl;

di(C _rC7-alkyl)amino;

CrC₆-alkyl substituted one or more times by C₃-C₇-cycioaikyl or halo {preferably fluoro);

unsubstituted C₃-C₇-Cy cloaikyi;

C₃-C₇-cycloalkyi which is substituted one or more times by halo {preferably fluoro), {haio-Ci-C₇-alkyl) or C_rC_ralkyl;

More preferably, R² is selected from methyl, t-butyl, diethylamino, cyclopropylmethyf, 2- fluoro-1 ,1-dimethylethyl or 2,2,2-trifiuorσ-1 ,1 -dimethyl-ethyl. In another embodiment, R² is selected from methyl, t-butyl, diethylamino, cyclopropylmethyl or 2-f!uoro-1 ,1-dimethylethyi.

The ring A is more preferably selected from A1 or A2 or A3 or A4 or A5 or A6:

wherein,

Z is N or CH and R² is defined as above.

Preferably, ring A is selected from A1 or A2.

X-Y preferably represents (CHj-Jr or O{CH₂)_t wherein,

r is 1, 2 or 3;

t is 1 or 2;

X-Y more preferably represents (CH_s)_r or 0(CHs)₁ wherein r is 2 and t is 1. For the

avoidance of doubt, that is, X-Y is preferably -CH₂-CH₂- or -0-CH₂-, such that in the latter case, the X in X-Y is the O in -0-CH₂-. R¹ preferably represents, independently at each occurrence. hafo;

hydroxy;

unsubstituted or substituted phenyl;

dKCi-Cy-alkytyamino;

unsubstituted C₁-C₇-BfKyI;

CrC/-alkyl, which is substituted one or more times by

hydroxy, d-Cr-alkoxy, di(Ci-C7-a!kyl)amino. di-(perdeuteroCrC7-alkyl)amino, phenyl, morpholinyi, acetyiamino, or /V-(Ci-C-ralkyl)-W-{phenylC₁-C7-alkyl}amtno, and wherein independently each phenyl may be mono or poly- substituted by halo.

R¹ more preferably represents, independently at each occurrence,

ffuoro;

hydroxy;

unsubstituted phenyl;

dimethylamino;

methyl;

methyl, which is substituted one or more times (preferably substituted once) by hydroxy, meihoxy, dimethyiamino, di-(perdeuteromethy!)amino, phenyl, morphoiinyl, acetylamino, or Λ/-(methyl)-Λ/-(phenylmethyl)am»no, and wherein independently each phenyl may be mono or poiy-substituted by fluoro.

R¹ most preferably represents, independently at each occurrence,

fiuoro;

hydroxy;

unsubstituted phenyl;

dimethylamino;

methyl;

hydroxy methyl:

methoxy methyl;

dimethylamino methyl;

di~(perdeuieromethyi)amiπo methyl;

benzyl;

morphσiin-4-yi methyl;

tø-acetyiamino methyl; /V-{rnethyl}-Λ/-(3-fluoro-phenylrnethyi)amino methyi.

An embodiment of the present invention includes compounds of the formula I wherein n is 0 or 1. Preferabiy, n is 1.

Another embodiment of the present invention includes compounds of the formuia I wherein q is 0, that is, wherein the nitrogen containing heterocyclic ring is substituted only by the amide at position 2. In this embodiment, it is preferred that n is 0 or 1, more preferably 1. Another embodiment of the present invention includes compounds of the formuia I wherein q is 1 , that is, wherein the nitrogen containing heterocyclic ring is substituted only by the amide at position 2 and a single R¹ group, in this embodiment it is preferred that n is 0 or 1 , more preferably 1. In this embodiment, the R¹ group may be substituted at position 2- {i.e. on the same carbon as that which is substituted by the amide group) or position 3- or position 4- or position 5- of the nitrogen containing heterocyclic ring.

Preferably, in this embodiment, the R¹ group is substituted at position 3 of the nitrogen containing heterocyclic ring, i.e. compounds of formula IA:

(IA)

wherein the substitutents are defined as for a compound of formula (i).

Preferably in compounds of formula IA, n is 1 , thus providing compounds wherein the nitrogen containing heterocyclic ring is a pyrrolidine ring, substituted at the 2-position by an amide having the drawn stereochermstry. and in the 3-position by an R¹ group.

Preferably, the R¹ group has a stereochemistry which is cis- to the amide at position 2, i.e. compounds according to formula (iA^!):

wherein the substiiυtents are defined as for a compound of formula (I). Preferably in compounds of formula IA¹, n is 1, thus providing compounds wherein the nitrogen containing heterocyclic ring is a pyrrolidine ring, substituted at the 2-position by an amide having the drawn stereochemistry, and in the 3-position by an R¹ group having the drawn stereochemisty, thus the amide and R¹ groups are cts- relative to each other. A further embodiment of the present invention includes compounds of the formula I wherein q is 2 or 3, thus at least two R¹ substttuents are present, each R¹ independently selected from the groups defined as for formula I herein. In this embodiment, it is preferred that at least each of two R¹ is bonded at position 3 of the pyrrolidine ring, and an optional third R¹ group, if present, is bonded elsewhere on the nitrogen containing heterocyclic ring. It is further preferred that n is 1 and the third R¹ group, if present, is bonded at the 4- or 5- position of the resultant pyrrolidine ring , i.e. to provide compounds of formula IB:

wherein the substituents are defined as for a compound of formula (I). in compounds according to formula i8, it is preferred that the third R¹ is bonded at position 4- of the pyrrolidine ring.

A further embodiment of the present invention includes compounds of the formula I wherein n is 1 , and wherein two R¹ groups are bonded at position 3 of the pyrrolidine ring, and, together form an alkandiyl, preferably a C₃-C₈-cycloalkyl. in particular a cyclopropyi, i.e. to provide compounds of formula IC:

wherein the substitutents are defined as for a compound of formula (!) and the third R¹ group is optional, and if present, is preferably bonded at position 4- of the pyrrolidine ring.

In any of the formulae (IA), (IA'), (IB) or (IC), the preferred definitions, if not otherwise stated, for ring A. X-Y. R¹ and n can also appfy.

The invention further relates to pharmaceutically acceptable prodrugs of a compound of formula (I), (IA), (IA"), (IB) and/or (IC).

The invention further relates to pharmaceutically acceptable metabolites of a compound of formula (1), (IA), (IA^:). (IB) and/or (IC).

The invention relates especially to the compounds of the formula (I), ((A), (IA'). (IB) and/or (IC) given in the Examples, as well as the methods of manufacture described herein. The present invention also relates to processes for the production of a compound of formula (I), (IA), (IA'), (IB) and/or (IC). In principle all known processes which convert two different amines into a corresponding urea derivative are suitable and may be applied by using the respective starting material.

Thus, the invention in particular relates to a process which comprises reacting a compound of formula Il

( )

wherein the sυbstitυents are as defined above, either with a compound of formula I)IA

( )

wherein the substitυents are as defined above, in the presence of an activating agent ("method A") or with a compound of formula HIS

wherein R^" is as defined above; RG represents a reactive group (such as imidazolylcarbonyl) ("method B"), in each case optionally in the presence of a diiuent and optionally in the presence of a reaction aid and recovering the resulting compound of formula f in free form or in form of a salt and, optionally converting a compound of the formula I obtainable according to method A or method B into a different compound of the formula I, and/or converting an obtainable saft of a compound of the formula I into a different sail thereof, and/or converting an obtainable free compound of the formula I into a salt thereof, and/or separating an obtainable isomer of a compound of the formula f from one or more different obtainable isomers of the formufa i.

Reaction conditions

The process may be performed according to methods known in the art. or as disclosed befow in the Examples. For example a compound of formula Ii may be reacted with a compound of formula IHA or IHB in a solvent, e.g. dimethylformamide, in the presence of a base e.g. an organic amine, e.g. triethylamine.

Where temperatures are given hereinbefore or hereinafter, "about" has to be added, as minor deviations from the numeric values given, e.g. variations of ±10 %, are typically tolerable.

Ail reactions may take place in the presence of one or more diluents and/or solvents. The starting materials may be used in equimolar amounts; alternatively, a compound may be used in excess, e.g. to function as a solvent or to shift equilibrium or to generally accelerate reaction rates.

Reaction aids, such as acids, bases or catalysts may be added in suitable amounts, as known in the field, required by a reaction and in line with generally known procedures.

Protecting groups

If one or more other functional groups, for example carboxy, hydroxy, amino, sulfhydryl or the like are or need to be protected in a starting material as described herein or any other precursor, because they should not take part in the reaction or disturb the reaction, these are such groups as are usually used in the synthesis of peptide compounds, and also of cephalosporins and penicillins, as well as nucleic actd derivatives and sugars. Protecting groups are such groups that are no longer present in the final compounds once they are removed, while groups that remain as substituents are not protecting groups in the sense used here which are groups that are added at a starting material or intermediate stage and removed to obtain a final compound. Also in the case of conversions of a compound of the formula (I), (IA), (IA'), (IB) and/or (IC) into a different compound of the formula (I), (IA), (IA¹), (IB) and/or (IC). protecting groups may be introduced and removed, if useful or required. The protecting groups may already be present in precursors and should protect the functional groups concerned against unwanted secondary reactions, such as acyiations, etheri- fications, esterifications, oxidations, soivolysis, and similar reactions, it is a characteristic of protecting groups that they lend themselves readily, i.e. without undεsired secondary reac- tions, to removal, typically by acetoiysis. protonolysis, solvoiysis, reduction, photolysis or also by enzyme activity, for example under conditions analogous to physiological conditions, and that they are not present in the end-products. The specialist knows, or can easily establish, which protecting groups are suitable with the reactions mentioned above and below. The protection of such functional groups by such protecting groups, the protecting groups themselves, and their removal reactions are described for example in standard reference works, such as J. F. W. McOroie, "Protective Groups in Organic Chemistry", Plenum Press, London and New York 1973, in T, W. Greene, "Protective Groups in Organic Synthesis", Third edition, Wiley, New York 1999, in "The Peptides"; Volume 3 (editors: E. Gross and J. Meienhofer), Academic Press, London and New York 1981, in "Methoden der organischen Chemie" (Methods of organic chemistry), Houben Weyl, 4th edition, Volume 15/1, Georg Thieme Verlag. Stuttgart 1974, in H.-D. Jakubke and H. Jescheit, "Aminosauren, Peptide, Proteine" (Amino acids, peptides, proteins), Verfag Chemie, Weinheim, Deerfield Beach, and Basel 1982, and in Jochen Lehmann, "Chemie der Kohlenhydrate: Monosaccharide und Derivate" (Chemistry of carbohydrates: monosaccharides and derivatives), Georg Thieme Veriag, Stuttgart 1974.

Optional Reactions and Conversions

A compound of the formula (I), (IA), (IA^!), (IB) and/or (IC) may be converted into a different compound of the formula (I). (IA), (IA¹), (IB) and/or (IC).

In a compound of the formula (1), (IA), (IA'), (IB) and/or (IC) wherein a substituent carries an amino or amino-C,-C₇-alkyl substituent, the amino can be converted into acylamtno, e.g. Ci-C₇-alKanoy!amino, by reaction with a corresponding d-Cr-alkanoylhalogenide, e g a corresponding chloride, in the presence of a tertiary nitrogen base, such as triethyiamine or pyridine, in the absence or presence of an appropriate solvent, such a methylene chloride, for example at temperatures in the range from -20 to 50 ⁰C, e.g. at about room temperature. Saits of a compound of formula (I)₁ (IA), (IA'), (18) and/or (IC) with a salt-forming group may be prepared in a manner known per se Acid addition sails of compounds of formula (I), (IA), (IA'), (IB) and/or (IC) may thus be obtained by treatment with an acid or with a suitable anion exchange reagent. A salt with two acid molecules (for example a dihalogenide of a compound of formula (I)₁ (!A), (!A¹), (IB) and/or (IC)) may also be converted into a salt with one acid molecule per compound (for example a monohalogenide); this may be done by heating to a melt, or for example by heating as a solid under a high vacuum at elevated temperature, for example from 130 to 170⁰C, one molecule of the acid being expelled per molecule of a compound of formula (I), (IA), (IA'), (IB) and/or (IC). Salts can usually be converted to free compounds, e.g. by treating with suitable basic compounds, for example with alkali metal carbonates, alkali meta! hydrogencarbonates, or alkali metal hydroxides, typically potassium carbonate or sodium hydroxide.

Stereoisomeric mixtures, e.g. mixtures of diastereomers, can be separated into their corres- ponding isomers in a manner known per se by means of suitable separation methods. Dia- stereomeric mixtures for example may be separated into their individual diastereomers by means of fractionated crystallization, chromatography, solvent distribution, and similar procedures. This separation may take piace either at the level of a starting compound or in a compound of formula (I)₁ (IA), (IA^r)_r (IB) and/or (IC) itself. Enantiαmers may be separated through the formation of diastereomeric safts. for example by sail formation with an enantiomer-pure chiral acid, or by means of chromatography, for example by HPLC, using chromatographic substrates with chiral ligaπds.

It should be emphasized that reactions analogous to the conversions mentioned herein may also take piace at the level of appropriate intermediates (and are thus useful in the preparation of corresponding starting materials).

Starting materials:

The starting materials of the formulae Il and Hi, as well as other starting materials meπ- tioned herein, e.g. below, can be prepared according to or in analogy to methods that are known in the art, are known in the art and/or are commercially available. Insofar as the production of the starting materials is not particularly described, the compounds are either known or may be prepared analogously to methods known in the art, e.g in WO 05/021519 or WO04/096797, or as disclosed hereinafter. Novel starting materials, as well as processes for the preparation thereof, are likewise an embodiment of the present invention. In the preferred embodiments, such starting materials are used and the reaction chosen are selected so as to enable the preferred compounds to be obtained. In the starting materials (including intermediates), which may also be used and/or obtained as salts where appropriate and expedient, the substituents are preferably as defined for a compound of the formula (f), (IA), (IA'), (IB) and/or (iC).

Pharmaceutical compositions, uses and methods of treatment

The present invention also relates to use of the compounds of formula (I)₁ (IA), (IA'),

(IB) and/or (IC) as disclosed herein as pharmaceuticals. The present invention includes in one embodiment compositions comprising a compound of formuia (i), (IA)₁ (IA'), (IB) and/or (IC), e.g. for human or veterinary use, e.g. where inhibition of PI3K is indicated. in one embodiment, the invention relates to the treatment of cellular proliferative diseases such as tumor (benign or malignant) and/or cancerous cell growth, e.g.

mediated by PI3K. Diseases may include those showing somatic mutation of PIK3CA or germline mutations or somatic mutation of PTEN. In particular, the compounds may be useful in the treatment of human or animal (e.g.. murine) cancers, including, for example, sarcoma: lung; bronchus; prostate; breast (including sporadic breast cancers and sufferers of Cowden disease); pancreas; gastrointestinal cancer; colon; rectum; colon carcinoma; colorectal adenoma, thyroid; liver; intrahepatic biie duct;

hepatocellular; adrenal gland; stomach; gastric; glioma; glioblastoma; endometrial: melanoma; kidney; renai pelvis; urinary bladder; uterine corpus; uterine cervix; vagina; ovary; multiple myeloma; esophagus; a leukaemia; acute myelogenous leukemia; chronic myelogenous leukemia; lymphocytic leukemia; myeloid leukemia; brain; a carcinoma of the brain; oral cavity and pharynx; larynx; small intestine; non-Hodgkin lymphoma; melanoma; villous colon adenoma; a neoplasia; a neoplasia of epithelial character; lymphomas; a mammary carcinoma; basal cell carcinoma; squamous ceil carcinoma; actinic keratosis; tumor diseases, including solid tumors; a tumor of the neck or head; polycythemia vera; essential thrombocythemia; and myelofibrosis with myeloid metaplasia. In other embodiments, the condition or disorder (e.g. PI3K-mediated) is selected from the group consisting of: an epidermal hyperproliferation, prostate hyperplasia, a neoplasia, a neoplasia of epithelial character, Cowden syndrome, Lhermitte-Dudos disease or Bannayan- Zonana syndrome, asthma. COPD₁ ARDS, Loffier's syndrome, eosinophilic pneumonia, parasitic (in particular metazoan) infestation (including tropica! eosinophil),

bronchopulmonary aspergillosis, polyarteritis nodosa (including Churg-Strauss syndrome), eosinophilic granuloma, eosinophil-related disorders affecting the airways occasioned by drug-reaction, psoriasis, contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, lupus erythematosus, pemphisus, epidermolysis bullosa acquisita_; autoimmune haematogica! disorders (e.g. haemolyttc anaemia, aplastic anaemia, pure red ceil anaemia and idiopathic thrombocytopenia), systemic lupus erythematosus,

polychondritis, scleroderma, Wegener granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e.g. ulcerative colitis and Crohn's disease), endocrine opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), interstitial lung fibrosis, psoriatic arthritis, glomerulonephritis, cardiovascufar diseases, atherosclerosis, hypertension, deep venous thrombosis, stroke, myocardial infarction, unstable angina, thromboembolism, pulmonary embolism, thrombolytic diseases, acute arterial ischemia, penpheral thrombotic occlusions, and coronary artery disease, reperfusion injuries, retinopathy, such as diabetic retinopathy or hyperbaric oxygen-induced retinopathy, and conditions characterized by elevated intraocular pressure or secretion of ocular aqueous humor, such as glaucoma.

For the above uses the required dosage will of course vary depending on the mode of administration, the particular condition to be treated and the effect desired In general, satisfactory results are indicated to be obtained systemically at daily dosages of from about 0.03 to 10.0 mg/kg per body weight. An indicated daily dosage in the larger mammal, e.g. humans, is in the range from about 0.5 mg to about 1 g, conveniently administered, for example, in divided doses up to four times a day or in retard form. Suitable unit dosage forms for oral administration comprise from ca. 0.1 to 500 mg active ingredient. The compounds of formula (I), (IA), (IA'), (IB) and/or (IC) may be administered by any conventional route, in particular enteraliy, e.g. orally, e.g. in the form of tablets or capsules, or parenteraliy, e.g. in the form of injectable solutions or suspensions, topically, e.g. in the form of lotions, gels, ointments or creams, by inhalation, intranasaily, or in a suppository form.

The compounds of formula (I), (IA), (IA ), (IB) and/or (IC) may be administered in free form or in pharmaceutically acceptable salt form e.g. as indicated above. Such salts may be prepared in conventional manner and exhibit the same order of activity as the free compounds.

Consequently, the invention also provides:

^« a method for preventing or treating conditions, disorders or diseases mediated by the activation of the PI3, e.g. the PI3 kinase alpha enzyme e.g. such as indicated above, in a subject in need of such treatment, which method comprises administering to said subject an effective amount of a compound of formula (i). (IA), (IA¹), (IB) and/or (!C) or a pharmaceutically acceptable salt thereof

« use of a compound of formula (I)₁ (!A), (IA'), (IB) and/or (IC). in free form or in a

pharmaceutically acceptable sait form as a pharmaceutical, e.g. in any of the methods as indicated herein.

β a compound of the formula (f), (IA), (IA'), (!B) and/or (IC) in free form or in

pharmaceutically acceptable salt form for use as pharmaceutical, e.g. in any of the methods as indicated herein, in particular for the use in one or more

phosphatidylinositol 3-kinase mediated diseases.

• the use of a compound of formula (I). (IA), (IA') , (IB) and/or (IC) in free form or in

pharmaceutically acceptable salt form in any of the methods as indicated herein, in particular for the treatment of one or more phosphatidyiinositol 3-kinase mediated diseases.

• the use of a compound of formula (I), (IA), (IA'), (IB) and/or (IC) in free form or in

pharmaceutically acceptable sait form in any of the methods as indicated herein, in particular for the manufacture of a medicament for the treatment of one or more phosphatidylinositol 3-kinase mediated diseases. PI3K serves as a second messenger node that integrates parallel signaling pathways, evidence is emerging that the combination of a PI3K inhibitor with inhibitors of other pathways will be useful in treating cancer and proliferative diseases in humans.

Approximately 20-30% of human breast cancers overexpress Her-2/neu-ErbB2. the target for the drug trastuzumab. Although trastuzυmab has demonstrated durable responses in some patients expressing Her2/neu-ErbB2. only a subset of these patients respond. Recent work has indicated that this limited response rate can be substantially improved by the combination of trastuzumab with inhibitors of PI3K or the PI3K/AKT pathway (Chan et al., Breast Can. Res. Treat. 91:187 (2005), Woods ignatoski et ai., Brit. J. Cancer 82:666 (2000), Nagata et al., Cancer Cell 6:117 (2004)).

A variety of human malignancies express activating mutations or increased levels of Her 1 /EGFR and a number of antibody and small molecuie inhibitors have been developed against this receptor tyrosine kinase including tarceva, gefitinib and erbitux. However, while EGFR inhibitors demonstrate anti-tumor activity in certain human tumors (e.g., NSCLC), they fail to increase overall patient survival in all patients with EGFR-expressing tumors. This may be rationaiized by the fact that many downstream targets of Her1/EGFR are mutated or deregulated at high frequencies in a variety of malignancies, including the P!3K/Akt pathway. For example, gefitmib inhibits the growth of an adenocarcinoma cell line in in vitro assays. Nonetheless, sub-clones of these cell lines can be selected that are resistant to gefttinib that demonstrate increased activation of the PI3/Akt pathway. Down-reguiation or inhibition of this pathway renders the resistant sub-ciones sensitive to gefitinib (Kokubo et a!,, Brit. J. Cancer 92:1711 (2005)). Furthermore, $n an in vitro model of breast cancer with a cell line that harbors a PTEN mutation and over-expresses EGFR inhibition of both the PI3K/Akt pathway and EGFR produced a synergistic effect (She et al., Cancer Ceil 8.287-297(2005)). These results indicate that the combination of gefitinib and PI3K/Akt pathway inhibitors would be an attractive therapeutic strategy in cancer.

The combination of AEE778 (an inhibitor of Her-2/πeu/ErbB2, VEGFR and EGFR) and RAD001 (an inhibitor of mTOR. a downstream target of Akt) produced greater combined efficacy that either agent alone in a glioblastoma xenograft model (Goudar et al., MoI.

Cancer. Then 4.101-112 (2005)).

Anti-estrogens, such as tamoxifen, inhibit breast cancer growth through induction of cell cycle arrest that requires the action of the cell cycle inhibitor p27Kip. Recently, it has been shown that activation of the Ras-Raf-MAP Kinase pathway alters the phosphorylation status of p27Kip such that its inhibitory activity in arresting the cefi cycle is attenuated, thereby contributing to anti-estrogen resistance (Donovan, et ai, J. Biol. Chem. 276:40888, (2001)). As reported by Donovan et a!., inhibition of MAPK signaling through treatment with MEK inhibitor reversed the aberrant phosphorylation status of p27 in hormone refractory breast cancer ceil lines and in so doing restored hormone sensitivity. Similarly, phosphorylation of p27Kip by Akt also abrogates its role to arrest the ceil cycle (Viglietto et ai., Nat Med. 8:1145 (2002)).

Accordingly, the present invention provides, in a further aspect, compounds of formulae (I) _: (IA), (IA'), (IB) and/or (IC) for use in the treatment of hormone dependent cancers, such as breast and prostate cancers By this use, it is aimed to reverse hormone resistance commonly seen in these cancers with conventional anticancer agents.

In hematological cancers, such as chronic myelogenous leukemia (CML), chromosomal translocation is responsible for the constitutively activated BCR-AbI tyrosine kinase. The afflicted patients are responsive to imatinib. a small molecule tyrosine kinase inhibitor, as a result of inhibition of AbI kinase activity. However, many patients with advanced stage disease respond to imatinib initially, but then relapse later due to resistance-conferring mutations in the AbI kinase domain. In vitro studies have demonstrated that BCR-AbI employs the Ras-Raf kinase pathway to elicit its effects. In addition, inhibiting more than one kinase in the same pathway provides additional protection against resistance-conferring mutations.

Accordingly, in another aspect, the present invention provides the compounds of formulae (I), (IA), (IA'), (IB) and/or (IC) for use in combination with at least one additional agent selected from the group of kinase inhibitors, such as Gteevec®. in the treatment of hematological cancers, such as chronic myelogenous leukemia (CML). By this use, it is aimed to reverse or prevent resistance to said at least one additional agent.

Because activation of the P13K/Akt pathway drives cell survival, inhibition of the pathway in combination with therapies that drive apoptosis in cancer ceils, including radiotherapy and chemotherapy, will result in improved responses (Ghobriai et a!., CA Cancer J. Clin 55:178- 194 (2005)). As an example, combination of PI3 kinase inhibitor with carboplatin

demonstrated synergistic effects in both in vitro proliferation and apoptosis assays as well as in in vivo tumor efficacy in a xenograft mode! of ovarian cancer (Westfaif and Skinner, MoI. Cancer Then 4:1764-1771 (2005)).

In addition to cancer and proliferative diseases, there is accumulating evidence that inhibitors of Class 1A and 1 B PI3 kinases would be therapeutically useful in others disease areas. The inhibition of p110β, the PI3K isoform product of the PIK3CB gene, has been shown to be involved in shear-induced platelet activation (Jackson et al., Nature Medicine 11:507-514 (2005)). Thus, a PI3K inhibitor that inhibits p110β would be usefui as a singie agent or in combination in antithrombotic therapy. The isoform p1108. the product of the PIK3CD gene, is important in B cell function and differentiation (Clayton et al., J. Exp. Med. 196:753-763 (2002)), T-celi dependent and independent antigen responses (Jou et a!.. MoI, Cell. Bioi. 22:8580-8590 (2002)) and mast ceil differentiation (AIi et al., Nature 431:1007- 1011 (2004)). Thus, it is expected that p110δ-inhibitors would be useful in the treatment of B-cell driven autoimmune diseases and asthma. Finally, the inhibition of ρ110y, the isoform product of the PI3KCG gene, results in reduced T, but not B cell, response (Reif et al., J.

Immunol. 173:2236-2240 (2004)) and its inhibition demonstrates efficacy in animal models of autoimmune diseases (Camps et al., Nature Medicine 11:936-943 (2005), Barber et al., Nature Medicine 11 :933-935 (2005)). The invention further provides pharmaceutical compositions comprising at least one compound of formula (I), (IA), (iA¹), (IB) and/or (IC), together with a pharmaceutically acceptable excepient suitable for administration to a human or animal subject, either alone or together with another therapeutic agent, for example another anticancer agent. The invention further provides methods of treating human or animal subjects suffering from a cellular proliferative disease, such as cancer. The invention thus provides methods of treating a human or animal subject in need of such treatment, comprising administering to the subject a therapeutically effective amount of a compound of formula (I), (IA)₁ (IA'), (IB) and/or (IC) either alone or in combination with one or more other therapeutic agents, e.g. other anticancer agents, in particular, compositions writ either be formulated together as a combination therapeutic or administered separately Suitable anticancer agents for use with a compound of formula I include, but are not limited to, one or more compounds selected from the group consisting of kinase inhibitors, anti-estrogens, anti androgens, other inhibitors, cancer chemotherapeutic drugs, alkylating agents, chelating agents, biological response modifiers, cancer vaccines, agents for antisense therapy as set forth below:

A. Kinase lnhibitors:_Kinase inhibitors for use as anticancer agents tn conjunction with a compound of the formula (I), (IA), (IA'), (IB) and/or (fC) include inhibitors of Epidermal

Growth Factor Receptor (EGFR) kinases such as small molecule quinazolines, for example gefitinib (US 5457105, US 5616582, and US 5770599), ZD-6474 (WO 01/32651), erlotinib (Tarceva®, US 5,747,498 and WO 96/30347), and lapatinώ (US 6,727,256 and WO

02/02552); Vascular Endothelial Growth Factor Receptor (VEGFR) kinase inhibitors, including SU- 11248 (WO 01/60814), SU 5416 (US 5,883,113 and WO 99/61422), SU 6668 (US 5,883,113 and WO 99/61422), CHiR-258 (US 6,605,617 and US 6,774,237), vatalanib or PTK-787 (US 6.258,812), VEGF-Trap (WO 02/57423), B43-Genistein (WO-09606116), fenretinide (retinoic acid p-hydroxyphenylamine) (US 4,323,581), IM-862 (WO 02/62826), bevacizumab or Avastin® (WO 94/10202), KRN-951, 3-[5-(methylsulfonylpiperadine methyl)- indoiyij-quinoione, AG-13736 and AG-13925, pyrroio[2,1 -fjt1 ,2,43triazines. ZK-304709, Vegiin®, VMDA-3601 , EG-004, CEP-701 (US 5,621 ,100), Candδ (WO 04/09769); Erb2 tyrosine kinase inhibitors such as pertuzumab (WO 01/00245), trastuzumab, and πtuximab: Akt protein kinase inhibitors, such as RX-0201; Protein Kinase C (PKC) inhibitors, such as LY-317615 (WO 95/17182), and perifosine (US 2003171303); Raf/Map/MEK/Ras kinase inhibitors including sorafenib (BAY 43-9006), ARQ-350RP, LErafAON. BMS-354825 AMG- 548, and others disclosed in WO 03/82272; Fibroblast Growth Factor Receptor (FGFR) kinase inhibitors; Cell Dependent Kinase (CDK) inhibitors, including CYC-202 or roscovitine (WO 97/20842 and WO 99/02162); Platelet-Derived Growth Factor Receptor (PDGFR) kinase inhibitors such as CHIR-258, 3G3 mAb, AG-13736. SU-11248 and SU6668; and Bcr- AbI kinase inhibitors and fusion proteins such as STI-571 or Gleevec® (imatinib).

B. Anti-Estrogens:_Estrogen-targeting agents for use in anticancer therapy in conjunction with a compoound of formula (I)₁ (IA), (IA ), (IB) and/or (IC) include Selective Estrogen Receptor Modulators (SERMs) including tamoxifen, toremifene, raloxifene; aromatase inhibitors including Arimidex® or anastrozole; Estrogen Receptor Downregulators (ERDs) including Faslodex® or fulvestrant.

C. Anti>Androgeπs:_Androgen-targeting agents for use in anticancer therapy in conjunction with a compound of formula (I). (IA), (IA'), (IB) and/or (IC) include flutamide, bicalulamide, finasteride, aminoglutethamide, ketoconazole, and corticosteroids. O. Other tnhibitors:.Other inhibitors for use as anticancer agents in conjunction with a compound of formula {)), (IA)₁ (IA'), (IB) and/or (IC) include protein farnesy! transferase inhibitors including tipifarnib or R-115777 (US 2003134846 and WO 97/21701), BMS- 214662, AZD-3409. and FTI-277; topoisomerase inhibitors including merbarone and diflomotecan (BN-80915); mitotic kinesin spindle protein (KSP) inhibitors including SB- 743921 and MKI-833; proteasome modulators such as bortezomib or Velcade® (US

5,780,454), Xt-784; and cyclooxygenase 2 (COX-2) inhibitors including non-steroidal antiinflammatory drugs I (NSAJDs).

E. Cancer Chemotherapeutic Drugs: Particular cancer chemotherapeutic agents for use as anticancer agents in conjunction with a compound of formula (I), (IA), (IA¹), (IB) and/or

(IC) include anastrozole (Arimidex®), bicalutamide (Casodex®), bleomycin sulfate

(Blenoxane®), busulfan (Myleran®), busulfan injection (Busulfex®), capecitabine (Xeloda®), N4-pentoxycarbonyl-5-deoxy-5-flυorocytidine_t carbopiatin (Parapiatin®), carmustine

(BiCNU®). chlorambucil (Leukeran®), cisplatin (Platinol®), cladribiπe (Leustatin®), cyclophosphamide (Cytoxan® or Neosar®}, cytarabine, cytosine arabinoside (Cytosar-U®), cytarabtne liposome injection (DepoCyt®), dacarbazine (DTIC-Dome®), dactinomycin (Actinomycin D, Cosmegan), daunorυbicin hydrochloride (Cerubidine®), daunorubicin citrate liposome injection (OaunoXome®), dexamethasone, docetaxel (Taxotere®, US

2004073044). doxorubicin hydrochloride (Adriamycin®, Rubex®), etoposide (Vepesid®), fiudarabine phosphate (Fludara®), 5-f!υorouracil (Adrucil®, Efudex®), flutamide (Eulexin®), tezacitibine, Gemcitabine (diffuorodeoxycitidrne), hydroxyurea (Hydrea®), ldarubicin

(Idamycin®), ifosfamide (IFEX®), irinotecan (Camptosar®). L-asparaginase (ELSPAR®). ieucovorin calcium, meiphaian (Atkeran®), 6-mercaptopurine (Purinethol®), methotrexate (Fofex®), mitoxantrone (Novantrone®), myfotarg, paclitaxel (Taxol®). phoenix {Yttrium90/MX- DTPA), pentostattn, polifeprosan 20 with carmustine implant (Gliadei®), tamoxifen citrate (Nolvadex®), teniposide (Vumon®), 6-thioguanine, thiotepa, tirapazamine (Tirazone®), topotecan hydrochloride for injection (Hycamptin®), vinblastine (Velban®). vincristine

(Oncovin®), and vinoreibine (Navelbrne®).

F. Alkylating Agents:_Aikylating agents for use in conjunction with a compound of formula (I), (IA), (IA¹), (IB) and/or (IC) include VNP-40101M or cioretizine, oxaliplatin (US 4,169,846,

WO 03/24978 and WO 03/04505). glufosfamrde. mafosfamide. etopophos (US 5.041 ,424), prednimustine; treosulfan; busulfan; irofluven (acylfulvene); penclomedine; pyrazoloacridine (PD-115934): 06-benzylguanine; decitabsne (5-aza-2-deoxycytidine); brostaHicin; mitomycin C (MiioExtra); TLK-286 (Teicyta®); temozolomide: trabectedfn (US 5,478,932); AP-5280 {Piatinate formulation of Cisplatin); porftromycin; and dearazide (meclorethamine).

G. Chelating Agents:_ChelaUng agents for use in conjunction with a compound of formula (I), (IA), (IA¹), (IB) and/or (IC) include tetrathiomolybdate {WO 01/60814); RP-697; Chimeric T84.66 (CT84.66); gadofosveset (Vasovist®); deferoxamine; and bleomycin optionally in combination with eiectorporatton (EPT).

H. Biological Response MocHfiers:J3iological response modifiers, such as immune modulators, for use in conjunction with a compound of formula (I), (IA), (IA^!), (IB) and/or (IC) include staurosprine and macrocy ic analogs thereof, including UCN-01, CEP-701 and midostaurin (see WO 02/30941 WO 97/07081 , WO 89/07105, US 5,621 ,100, WO

93/07153, WO 01/04125, WO 02/30941 , WO 93/08809, WO 94/06799, WO 00/27422, WO 96/13506 and WO 88/07045); squalamine (WO 01/79255); DA-9601 (WO 98/04541 and US 6,025,387); aiemtuzumab; interferons (e g. IFN-a, IFN-b etα); interleukins, specifically IL-2 or aldesleukin as well as IL-1 , IL-3, IL-4, IL-5, iL-6. IL-7, IL-8. IL-9. IL-10, IL-11 , IL-12, and active biological variants thereof having amino add sequences greater than 70% of the native human sequence; aStrβtamine (Hexaieπ®); SU 101 or ieflunomide (WO 04/06834 and US 6,331,555); imidazoquinolines such as resiquimod and imiquimod (US 4,689,338, 5.389,640, 5,268,376, 4,929,624. 5,266,575, 5,352,784, 5.494,916, 5,482,936, 5,346,905, 5,395,937, 5,238,944, and 5,525_r6i2); and SMIPs₅ including benzazoles, aπthraqui nones, thiosemicarbazones, and tryptanthrins (WO 04/87153, WO 04/54759, and WO 04/60308). i. Cancer Vaccines:.Anticancer vaccines for use in conjunction with a compound of formula (!), (IA), (IA¹), (IB) and/or (IC) include Avicine® (Tetrahedron Lett. 26:2269-70 (1974));

oregovomab (OvaRex®); Theratope® (STn-KLH); Melanoma Vaccines; Gi-4000 series (Gl- 4014, GI-4015_: and Gi-4016), which are directed to five mutations in the Ras protein;

GlioVax-1; MelaVax; Advexin® or INGN-201 (WO 95/12660): Sig/E7/LAMP-1 , encoding HPV-16 E7; MAGE-3 Vaccine or M3TK (WO 94/05304); HER-2VAX; ACTIVE, which stimulates T-cells specific for tumors; GM-CSF cancer vacαne; and Listeria monocytogenes- based vaccines.

J. Aπtisense Therapy:_Anticancer agents for use in conjunction with a compound of formula (I). (!A), (IA'), (IB) and/or (IC) also include anttsense compositions, such as AEG-35156 (GEM-640); AP-12009 and AP-11014 (TGF-beta2-specific antisense oligonucleotides); AVI- 4126; AVI-4557; AVt-4472; obitmersen (Genasense®); JFS2; apriπocarsen (WO 97/29780); GTI-2040 (R2 ribonucleotide reductase mRNA antisense oligo) (WO 98/05769); GTt-2501 (WO 98/05769); iiposome-encapsulaled c-Raf antisense oitgodeoxyπυcleotides (LErafAON) (WO 98/43095); and Sima-027 (RNAi-based therapeutic targeting VEGFR- 1 mRNA). A compound of formula (i), (IA), (IA'), (IB) and/or (iC) may also be combined in a

pharmaceutical composition with bronchiodilatory or antihistamine drugs substances. Such bronchiodilatory drugs include anticholinergic or antimuscarinic agents, in particular glycopyrrolate, ipratropium bromide, oxiiropium bromide, and tiotropium bromide, OrM3. aclidinium, CHF5407, GSK233705 and β-2- adrenoreceptor agonists such as salbutamol, terbutaline, salmeterol, carmoteroi, milveterof and, especially, indacaterol and fornπoterol. Co-therapeutic antihistamine drug substances include cetirizine hydrochloride, clemastine fumarate, promethazine, loraiadine, desloratadine diphenhydramine and fexofenadine hydrochloride. The invention provides in a further aspect a combination comprising a compound of formula (I). ('A), (IA'), (IB) and/or (IC) and one or more compounds that are useful for the treatment of 3 thrombolytic disease, heart disease, stroke, etc. Such compounds include aspirin, a streptokinase, a tissue plasminogen activator, a urokinase, a anticoagulant, antiplatelet drugs (e.g, PLAVfX; clopidogrel bisulfate), a statin (e.g., LIPITOR or Atorvastatin calcium), ZOCOR (Simvastatin), CRESTOR (Rosuvastatin), etc.), a Beta blocker (e.g., Atenolol), NORVASC (amlodipinε besyiate), and an ACE inhibitor (e.g., fisinopril)

The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IA¹), (iB) and/or (IC) and one or more compounds that are useful for the treatment of antihypertension. Such compounds Include ACE inhibitors, lipid lowering agents such as statins. LlPITOR {Atorvastatin calcium), calcium channel blockers such as NORVASC (amlodipine besyiate).

The invention provides in a further aspect a combination comprising a compound of formula (I)₁ ((A), (IA'), (IB) and/or (IC) and one or more compounds selected from the group consisting of fibrates, beta-blockers, NEPI inhibitors, Angiotensin-2 receptor antagonists and plateiet aggregation inhibitors. The invention provides in a further aspect a combination comprising a compound of formula (I)₁ (IA), (IA¹), (IB) and/or (!C) and a compound suitable for the treatment of inflammatory diseases, incfuding rheumatoid arthritis. Such compound may be selected from the group consisting of TNF-α inhibitors such as anti-TNF-α monoclonal antibodies (such as

REMICADE, CDP-870) and D2E7 (HUMIRA) and TNF receptor immunoglobulin fusion molecules (such as ENBREL), iL-1 inhibitors, receptor antagonists or soluble IL-1Rςι(e.g. KiNERET or ICE inhibitors), nonsterodial anti-inflammatory agents (NSAIDS). piroxscam, diclofenac, naproxen, flurbiprofen, fenoprofen, ketoprofen ibuprofen, fenamates, mefenamic acid, indomethacin, sυiindac, apazone, pyrazolones, phenylbutazone, aspirin, COX-2 inhibitors (such as CELEBREX (celecoxib), PREXIGE (lumiracoxib)), metalloprotease inhibitors (preferably MMP-13 selective inhibitors), p2x7 inhibitors, α2ønhibitors,

NEUROTIN, pregabalin, low dose methotrexate, leflunomide, hydroxyxchioroquine, d- peniciilamine, auranofin or parenteral or orai gold. The invention provides in a further aspect a combination comprising a compound of formula (I), (IA), (IA'). (IB) and/or (IC) and a compound suitabfe for the treatment of osteoarthritis. Such compound may be selected from the group consisting of standard non-steroidal antiinflammatory agents (hereinafter NSAID's) such as piroxicam, diclofenac, propionic acids such as naproxen, flurbiprofen, fenoprofen, ketoprofen and ibuprofen, fenamates such as mefenamic acid, indomethacin, suiindac, apazone. pyrazolones such as phenylbutazone, salicylates such as aspirin, COX-2 inhibitors such as ceiecoxib, vaidecoxib, lumiracoxib and etoricoxib, analgesics and intraarticular therapies such as corticosteroids and hyaluronic acids such as hyaigan and synvisc, The invention provides in a further aspect a combination comprising a compound of formuia (I)₁ (IA). (IA'), (IB) and/or (IC) and an antiviral agent and/or an antisepsis compound Such antiviral agent may be selected from the group consisting of Viracept, AZT, acyclovir and famciclovir. Such antisepsis compound may be selected from the group consisting of Valant.

The invention provides in a further aspect a combination comprising a compound of formuia (I), (IA). (IA¹), (IB) and/or (1C) and one or more agents selected from the group consisting of CNS agents such as antidepressants (sertraline), aπti-Parkinsonian drugs (such as deprenyi, L-dopa, Requip, Mirapex; MAOB inhibitors (such as selegine and rasagiline); comP inhibitors (sυch as Tasmar); A-2 inhibitors; dopamine reuptake inhibitors; NMDA antagonists: Nicotine agonists; Dopamine agonists; and inhibitors of neuronal nitric oxide synthase).

The invention provides in a further aspect a combination comprising a compound of formula (I), (!A), {)A'), (IB) and/or (IC) and one or more anti-Alzheimer's drugs. Such anti-Aizheimer Drug may be selected from the group consisting of donepezil, tacrine, α20inhibitors, NEUROΪIN, pregabaiin, COX-2 inhibitors, propentofyiiine or metryfonate.

The invention provides in a further aspect a combination comprising a compound of formula (I). (IA), (IA'), (IB) and/or (IC) and anosteoporosis agents and/or an immunosuppressant agent. Such osteoporosis agents ma be selected from the group consisting of EVfSTA (raloxifene hydrochloride), droioxifene, fasofoxifene or fosomax. Such immunosuppressant agents may be selected from the group consisting of FK-506 and rapamycin. In another aspect of the preferred embodiments, kits that include one or more compound of formula (I)₁ (IA), (IA'), (IB) and/or (IC) and a combination partner as disclosed herein are provided. Representative kits include a P!3K inhibitor compound (e.g.. a compound of formuia (I), (SA), (IA"), (IB) and/or (IC)) and a package insert or other labeling including directions for treating a cellular proliferative disease by administering a PI3K inhibitory amount of the compound(s).

In general, the compounds of formula (I), (IA), (IA'), (IB) and/or (IC) will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities. The actual amount of the compound of formula (I), (IA), (1A^!), (IB) and/or (IC). i.e.. the active ingredient, will depend upon numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and form of administration, and other factors. The drug can be administered more than once a day, preferably once or twice a day. All of these factors are within the skill of the attending clinician. Therapeutically effective amounts of compounds of formulas I may range from about 0.05 to about 50 mg per kilogram body weight of the recipient per day, preferably about 0.1-25 mg/kg/day, more preferably from about 0.5 to 10 mg/kg/day. Thus, for administration to a 70 kg person, the dosage range would most preferably be about 35-70 mg per day. In general, compounds of formula (I), (IA)₁ (IA'), (IB) and/or (IC) will be administered as pharmaceutical compositions by any one of the following routes: oral, systemic {e.g., transdermal, intranasal or by suppository), or parenteral (e.g., intramuscular, intravenous or subcutaneous) administration. The preferred manner of administration is oral using a convenient daily dosage regimen that can be adjusted according to the degree of affliction. Compositions can take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, or any other appropriate compositions. Another preferred manner for administering compounds of the formula I is inhalation. This is an effective method for delivering a therapeutic agent directly to the respiratory tract.

The choice of formulation depends on various factors such as the mode of drug

administration and bioavailability of the drug substance. For delivery via inhalation the compound can be formulated as liquid solution, suspensions, aerosol propel Ian ts or dry powder and loaded into a suitable dispenser for administration. There are several types of pharmaceutical inhalation devices-nebulizer inhalers, metered dose inhalers (MDf) and dry powder inhalers (DPI). Nebulizer devices produce a stream of high velocity air thai causes the therapeutic agents (which are formulated in a liquid form) to spray as a mist that is carried into the patient's respiratory tract. MDI's typically are formulation packaged with a compressed gas. Upon actuation, the device discharges a measured amount of therapeutic agent by compressed gas. thus affording a reliable method of administering a set amount of agent. DPI dispenses therapeutic agents in the form of a free flowing powder that can be dispersed in the patient's inspiratory air-stream during breathing by the device. In order to achieve a free flowing powder, the therapeutic agent is formulated with an excipient such as lactose. A measured amount of the therapeutic agent is stored in a capsule form and is dispensed with each actuation.

The inventions also relates to formulations wherein the particle size of a compound of formula I between 10 - 1000 nm, preferably 10 - 400 nm. Such pharmaceutical formulations have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area i.e., decreasing particle size. For example, U.S. 4,107,288 describes a pharmaceutical formulation having particles in the size range from 10 to 1.000 nm in which the active material is supported on a crosslinked matrix of macromolecules. U.S. 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formυiation that exhibits remarkably high bioavailability. Both documents are included by reference.

In a further aspect, the invention provides pharmaceutical compositions comprising a {therapeutically effective amount) of a compound of formula (I), (IA)₁ (IA'), (IB) and/or (IC)₁ and at least one pharmaceutically acceptable excipient. Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the compound of formula (I), (IA), (IA'), (IB) and/or (IC). Such excipieni may be any solid, liquid, semi-solid or, in the case of an aerosol composition, gaseous excipient that is generally available to one of skill in the art.

Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, mail, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like.

Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oiis, including those of petroleum, animal, vegetable or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols. Compressed gases may be used to disperse a compound of the formula I in aerosol form. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc. Other suitable pharmaceutical excipients and their formulations are described in Remington's

Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing Company, (8th ed., I990). The amount of the compound in a formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt%) basis, from about 0.01-99.99 wt% of a compound of formula ! based on the total formulation, with the balance being one or more suitable pharmaceutical excipients. Preferably, the compound is present at a level of about 1-80 wt%. The invention further relates to pharmaceutical compositions comprising (i.e. containing or consisting of ) at least one compound of formula (I), (IA), (IA'), (IB) and/or (IC) and at least one pharmaceutically acceptable excipient. Pharrnaceuticai compositions comprising a compound of formula (I), (IA), (IA¹), (IB) and/or (IC) in free form or in pharmaceutical tγ acceptable salt form in association with at least one pharmaceutical acceptable excipieπt (such as a carrier and/or diluent) may be manufactured in conventional manner by mixing the components.

Combined pharmaceutical compositions comprising a compound of formula (I), (IA), (IA^!), (IB) and/or (!C) in free form or in pharmaceutically acceptable salt form and further comprising a combination partner (either in one dosage unit form or as a kit of parts) in association with at least one pharmaceutical acceptable carrier and/or diluent may be manufactured in conventional manner by mixing with a pharmaceutically acceptable carrier and/or diluent with said active ingredients.

Consequently, the invention provides in further aspects

• a combined pharmaceutical composition, e.g. for use in any of the methods described herein, comprising a compound of formula (I), (IA), (IA¹). (IB) and/or (IC) in free form or pharmaceutically acceptable salt form in association with a pharmaceutically acceptable diluent and/or carrier.

■ a combined pharmaceutical composition comprising a compound of formula (I). (IA)₁

(IA'), (IB) and/or (IC) in free form or in pharmaceutically acceptabie salt form as active ingredient; one or more pharmaceutically acceptable carrier material(s) and / or diluents and optionally one or more further drug substances. Such combined pharmaceutical composition may be in the form of one dosage unit form or as a kit of parts.

• a combined pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I), (IA), (IA'), (IB) and/or (IC) in free form or in

pharmaceutically acceptable salt form and a second drug substance, for simultaneous or sequential administration.

» a method as defined above comprising co-administration, e.g. concomitantly or in

sequence, of a therapeutically effective non-toxic amount of a compound of formula (i), (IA)₁ (IA¹), (IB) and/or (IC) or a pharmaceutically acceptable salt thereof, and at least a second drug substance, e.g. as indicated above.

• a pharmaceutical combination, e.g. a kit, comprising a) a first agent which is a

compound of formula (1), (IA), (IA^!), (IB) and/or (IC) as disclosed herein, in free form or in pharmaceutically acceptable salt form, and b) at least one co-agent, e.g. as indicated above; whereby such kit may comprise instructions for its administration.

The following examples of compounds formυia (I), (IA), (IA'), (IB) and/or (IC) illustrate the invention without limiting the scope thereof. Methods for preparing such compounds are described.

Temperatures are measured in degrees Celsius. Unless otherwise indicated, the reactions take place at rt and the MS are obtained with ESI. The following HPLC/MS methods are used in the preparation and analysis of the Intermediates and Examples:

Methods A1 to A3 (LCMS: analytical HPLC/MS):

System: Agilent 1100 Series with Waters Micromass ZQ 2000 ESI+ and/or ESI- Column: XBridge C18_; 3 x 30 mm, 2.5 micron

Temperature; 50 ⁰C

Eluent A: H_;O_; containing 5% CH₃CN and 0.8% HCOOH

Eluent B: CH₃CN, containing 0.6% HCOOH

Flow Rate: 1.2-2.4 mL/min Method Al method Polar4a_p_100-900 and method Polar4a_pn_100-900:

Gradient: 0 ~ 2.9 mtn: 1 % to 95% of B

Method A2: method Fast4jM 00-900 and method Fast4a_pn_100-900:

Gradient: 0 - 2.4 min: 10% to 95% of B

Method A3. method Slow4a_pn_100-900:

Gradient: 0 ~ 4.4 min: 5% to 95% of B

Method B (preparative HPLC) Instrument: Waters preparative HPLC system, column; Sunfire™ Prep C18 OBD™ 5 micron 30 X 100 mm, temperature: 25 ⁰C, eiueni: gradient from 5 - 100% CH₃CN in 0,05% aqueous TFA over 20 minutes, flow rate: 30 ml/minute, detection: UV 254 nm. Method C (preparative HPLC) Instrument: Waters preparative HPLC system, column: Sunfire™ Prep C18 OBD™ 5 microm 30 X 100 mm, temperature: 25 ⁰C, eluent: gradient from 5 - 50% CH₃CN in 0.05% aqueous TFA over 20 minutes, flow rate: 30 ml/minute, detection: UV 254 nm.

Method D (Analytical HPLC): Linear gradient 2-100% CH₃CN (0.1%TFA) and H₂O (0.1% TFA) in 5 min + 1.5 min 100% CH₃CN (0.1%TFA); detection at 215 nm, flow rate 1 mL/min at 30 ⁰C. Column: Nucleosii 100-3 C18 (70 x 4mm) Method E (preparative HPLC/MS) Instrument: Gilson preparative HPLC system, column: Sunfire™ Prep C18 OBD™ 5 micron 30 X 100 mm, temperature: 25 ^βC. eluent: gradient from 5 - 100% CH₃CN in 0.05% aqueous TFA over 20 minutes, flow rate: 30 ml/minute, detection: UV 254 nm. Method F (Analytical HPLC) Instrument: Shlmadzu SIL-10A, Method: Linear gradient 2- 100% CH₃CN (0.1%TFA) and H₂O (0.1% TFA) in 4 min + 2 min 100% CH₃CN (0.1%TFA); back to -100% CH₃CN (0.1%TFA) in 3 min.; detection at 215 nm, flow rate 2 mL/min at RT. Column: NucleosH OD-5-100 C18 (150 x 4.6 mm) Method G (Analytical HPLC) Instrument:

System: Agilent 1100 Series

Column: HP Hypersii BOS C1S, 4 x 125 mm, 5 micron

Temperature: 25⁰C

Eluent A: H₂O₁ containing 0.1% v/v TFA

Eiuent B: CH₃CN₁ containing 0.1 % v/v TFA

Gradient: 10% -» 100% B in 5 min, 2.5 min with 100% B, then -» 10% B in 1 min

Flow Rate: 1.5 mL/min

Detection: UV 215 nm Method H (Analytical HPLC) Instrument:

System: Agilent 1100 Series

Column: Macherey-Nagel Nudeosil 100-3 C18HD. 4 x 125 mm, 3 micron

Temperature: 30⁰C

Eluent A: H₃O₁ containing 0.1% v/v TFA Elυent B: CH₃CN₁ containing 0.1% v/v TFA

Gradient: 2% -» 100% B in 7 min, 2 miπ with 100% B. then -> 2% B in 1 min

Flow Rate: 1.0 mUmin

Detection: UV 215 nm

Method i (LCMS: analytical HPLC/MS).

System: Waters Acqυity UPLC with Waters Micromass ZQ 2000 ESi+/~

Column: Acquity HSS T3 C 18. 2.1 x 50 mm, 1.8 micron

Temperature: 50 ⁰C

Eluent A: H₂O₁ containing 0.05% v/v HCOOH and 3.75 mM ammonium acetate

Eluent B: CH₃CN, containing 0.04% HCOOH

Gradient: 2% -> 98% B in 4.3 min. 0.7 min with 98% B₁ then -> 2% B in 0.1 min and O.S min with 2% B

Flow Rate: 1.0 mL/min

Method J (LCMS: analytical HPLC/MS):

System- Agilent 1100 Series; MS: G1946D

Column: Symmetry C8. 2 1 x 50mm, 3.5 micron

Eluent A: H₂O, containing 0.1% v/v HCOOH

Eiuent B: CH₃CN, containing 0.1 % v/v HCOOH

Gradient: 0 - 3.3 min: 5% to 95% of B

Flow Rate: 1.0 mL/min

Method K (LCMS: analytical HPLC/MS):

System: Waters Acquity UPLC

Column: Acquity HSS T3 C18, 2.1 x 50 mm, 1.8 micron

Eluent A: H₂O, containing 0,05% v/v HCOOH and 0.05% ammonium acetate

Eluent 8: acetonitrile, containing 0.04% HCOOH

Gradient: 2% -> 98% B tn 1.7 min, 0.45 min with 98% B, then -> 2% B in 0.04 min

Fiow Rate: 1.2 ml/min

Method L (LCMS: analytical HPLC/MS):

System: Waters Aquity UPLC; MS: Waters AQ Detector

Column: Aquity HSS, 1.8 urn 2.1 x 50mm, 3/pk εiυent A: H₂O, containing 0.1% v/v HCOOH

Eluent B: CH₃CN, containing 0.1% v/v HCOOH

Gradient: 0 - 1.5 miπ: 10% to 95% of B, then 1 min: 95% B

Flow Rate: 1.2 mL/min

ESi-MS:

instrument: Micromass Platform tl

Eluent: 15% v/v MeOH in H₂O containing 0.2% v/v of a 25% ammonium hydroxide solution

Flow Rate: 0.05 mL/min

!n the following examples, the abbreviations given below are used:

aim. atmosphere

CDI 1 , 1'-carbonyldiimldazole

CH₃CN aceionitnle

DAST diethylarmnosulfur trifluoride

DCE 1 ,2-dtchioroethane

DCM dichloromethane

DMF N . N-dimethy lformamide

DMSO dimethyl sulfoxide

Et₂O diethyl ether

EtOAc ethyl acetate

EtOH ethanol

eq equivalents)

h hoυr{s)

H₃O water

HPLC High Performance Liquid Chromatography

HV high vacuum

LCMS liquid chromatography coupled with mass spectrometry

LiHMDS lithium bis(trimethylsilyl)amide

MeOH methanol

mL milliliters)

min minute(s)

MS-ESI electrospray ionisation mass spectrometry

MW microwave

Intermediate A: lmidazole-1-carboxylic acid (8-teι

h]qumazolin-2-yi)-amicte

8-tert-ButyM,5-dihydro-thiazo!o[4,5-h3quinazoiin-2-ylarøine {Stage A.1, 0.319 g. 1.225 mmot) and CDI (278 mg_: 1.715 mmoi) were added to DCM {5 ml) and DMF (0.25 mi) under an argon atm. After 18 h the residue was cooled to 4 ⁰C and the precipitate was collected by filtration. The soiid was dried at 50 ⁰C in high vacuo to give the title compound as a pale yellow solid. LCMS: t_R 0.95 min and M+H 319.0 (method A2) for (8-tert-butyl-4,5-dihydro- thiazoio[4,5-h3quinazolin-2-yi)-carbamic acid methyl ester; the product of the reaction of the title compound with MeOH during the preparation of the sampie as MeOH solution. Stage A.1 : 8-tert-Butyl-4,5-dihydro-thiazolo[4,5-h]quinazolin-2-yiamine

Intermediate A.1 was obtained by two different routes. Both routes start from 2-amino-5,6- dihydro-4H-benzothiazoi-7-one and described below: Route 1 :

To a mixture of N^S-H <*fmethylamino-meth-(E)-ylidene3-7-oxo~4, 5,6 J-tetrahydro- benzothiazol-2-yi}-N,N-dimethy!-formamidine (Stage A.2, 2.2 g, 7.90 mmol) in 2- methoxyethanot (20 ml) was added at rt sodium hydroxide (1.185 g, 29.6 mmol) and 2,2- 5 dimethyl-propionamidine hydrochloride {1.620 g, 11.85 mmoi). The RM was stirred at 125 °C for 3 h. After cooling to rt, the RM was diluted with MeOH, adsorbed onto silica gei and purified by flash chromatography (CombiFlash® Companion system®, with RediSep® silica gel column, eluent: DCM / MeOH / Ammonia 95:5:0.5). LC: t_R 3.64 min (method D). MS: M+H = 261. 1 H-NMR in DMSO-d_B: 8.24 {s, 1H); 7.70 {s, 2H); 2.89 - 2.84 <m, 2H); 2.76 - 2.71 10 (m, 2H); 1.28 {s, 9H).

Stage A,2: N'-{6-[1 ~Dimethyiam{no-meth-{E)-ylidene]~7-oxo-4,5,6,7-tetrahydro-benzothia2:ol- 2-yi}-N,N-dimethy)-formamidine

^■j g

A suspension of 2-amtno-5,6~dihydro-4H-benzothiazol-7-one (3.5 g, 20.81 mmol) in dimethoxymethyldimethylamine (12 mL. 90 mmol) was heated at 100 "C with stirring for 65 h. The RM was then evaporated to dryness in vacuo and the residue was suspended in EtOAc. After 1 h at 4 ⁶C, the solid was filtered off. washed with EtOAc and then dried under 0 high vacuum at 60 ^βC to give the pure title product as brown crystals. LC: t_R 3.25 min

(method D). MS. M+H = 279. ¹H-NMR in DMSO-d₆: 8.40 (s, 1H); 7.23 (s, 1H); 3.15 (s, 3H); 3.05 (s, 6H); 2.97 (s, 3H); 2.91 (t, 2H); 2.67 (I₁ 2H).

Route 2:

Potassium carbonate (0.434 g, 3.14 mmot) was added to a mixture of N-{8-tert-butyl-4,5- dihydro~thiazoio[4,5-h]quinazolin~2-yl)~acetamide (Stage A.3, 0.38 g, 1.257 mmoi) in MeOH. The RWt was stirred at 50 ⁰C for 52 h, then cooied to rt and evaporated in vacuo to give a red mass. Water (20 mL) was added and the mixture was stirred at rt for a further 3 h. The red suspension was then cooled down to 4 ⁰C and filtered to give after drying under high vacuum the title compound as a beige solid. LCMS: t_R 0.99 min and M+H = 261 (method A3). ¹H-NMR in DMSO-d₃. 400 MHz: 8.24 (s, 1H); 7.70 (s, 2H); 2.89 - 2.84 (m, 2H); 2.76 - 2.71 <m, 2H): 1.28 (s, 9H).

Stage A.3: N-(8-tert-butyl-4.5-dihydro-thfazolo[4.5-h]quinazolin-2-yl)-acetamide

Pyridine (13 mL) was added to N-(6-formyl-7-oxo-4,5.6,7-tetrahydro-benzothtazoi-2-y!)- acetamide (Stage A.4_r 3.05 g, 12.8 mmoi) and tert.butyiamidine hydrochloride (1.788 g, 12.8 mmoi) and the mixture was heated in a sealed vessel at 160 ⁰C for 6.5 h. After cooling the reaction mixture was filtered to give a solid. The filtration mother liquor was evaporated to give further solid material. The combined solids were triturated repeatedly with hot CH₃CN and the CH₃CN mother iiquors evaporated to give a solid which was shown to be

predominantly the title product. The crude product was dissolved in ca. 10 ml of a 10 % DWSSO in MeOH to give a slightly hazy orange solution which was filtered and added dropwise to water (100 mi) at rt with stirring. The precipitate solid was collected by filtration to give the title compound as an orange solid. LCMS: t_R 1.37 min and M+H ~ 303.0 {method - 43 -

A3). ¹H-NMR in DMSO-d_s, 400 MHz: 12.40 (s. 1H); 8.44 (s, 1 H); 2.88 - 3.00 (m, 4H); 2.17 <5, 3H); 1.32 (S₁ 9H).

Stage A.4: N-(6-For myl-7-oxo-4,5,6, 7-tetrahydro-benzothtazol-2-yl)-acetamide

LiHMDS solution (1 M, 27.7 mL) was added over 10 min to a suspension of N-(7-oxo- 4,5,6,7-tetrahydro~benzothiazol-2-yi)-acetamtde (Stage A.5, 2.0 g, 9.23 mmol) in dry THF (20 mL) cooled at - 78 ⁰C under an argon atm. The RM was then stirred at - 78 ⁰C for 2.5 h and methyl formate (2.308 mL, 36.9 mmoi) added dropwise over 30 rnin. The RM was then warmed slowfy to rt and was then stirred 18 h at rt. The RM was drown out into aqueous 1 M HCI (70 mL) and extracted 3X with DCM₁ dried over Na₂SO₄ and evaporated to give a the title compound as a solid. HPLC. t_R 3.65 min (method D). MS; M-H = 237. ¹H-NMR in DMSCKi₅ (400 MHz): 12.50 (s, br, IH); 7.55 (s, 1H); 2.90 - 2.60 (m, 4H); 2.15 (s, 3H). Stage A.5: N-(7-Oxo-4,5,δ,7-tetrahydro-benzothiazo!-2-yl)-acetarnide

To acetic anhydride (80 mL) was added at rt 2-amino-5,6-dihydro-4H-benzoihiazol~7~one (10 g, 59.4 mmol) and the resulting suspension was heated to reflux. After 1.75 h stirring at reflux, the RM was allowed to cool with stirring and stirred for 18 h at rt before further cooling with an ice / NaCI bath, and a solid was colfected by filtration. The solid was then triturated twice with reflυxing acetone (10 mL then 15 mL) before filtering and drying under vacuum at 40 ⁰C to give the title product as a beige solid. HPLC: t_R 3.47 min (method D). MS: M-H = 211.1. ¹H-NMR in DMSO-d₆ (600 MHz): 12.55 (s, br, 1H); 2.84 (t. 2H); 2.48 (t, 2H); 2.17 (s, 3H); 2.065 (qt, 2H).

Intermediate B: (2S,4R)-4-Dimethylarnino-pyrrofidine-2~carboxyiic acid amide

A solution of {2S,4R)-4-dimethylamino-pyrrolidine-2-carboxylic acid methyl ester (Stage B,1 , 225 mg) and 7 M ammonia in MeOH (7 ml_) was stood for 18 h at rt in a sealed vessel. Evaporation and trituration with Et₂O gave the title compound as a white solid. Stage B.1 (2S,4R)-4-Dimethylamino-pyrrolidine-2-carbθ)!yfic acid methyl ester

A mixture of {2S,4R)-4-dimethyiamiπo-pyrrolidine-1,2-dicarboxy)ic acid 1 -benzyl ester 2~ methyl ester (Stage B.2, 420 mg), 10% palladium on carbon (80 mg) and MeOH (10 mL) was stirred for 16 h under an atm. of hydrogen. Filtration and evaporation gave the title compound which was used without punfication in the following steps.

Stage B,2 (2S,4R)-4-Dimethylamino~pyrroitdine-1.2-dicarboxylic acid 1-benzyi ester 2- methyl ester

Sodium cyaπoborohydride {200 mg) was added to a mixture of (2S,4R)-4~amino-pyrrolidine~ 1 ,2-dicarboxy!ic acid 1-benzyi ester 2-methyl ester (400 mg), formalin (0.68 ml), acetic acid (0.72 mi), triethylamine (0.2 ml) and MeOH (2 ml) and the mixture was stirred for 2 h at rt. The RiW was then partitioned between DCM and aqueous NaHCO₃ solution, the DCM layers evaporated and purified by norma! phase chromatography, eluent; gradient from EtOAc to 20 % EtOH in EtOAc. to give the predominant UV~active component. The chromatographied material was taken up with 1 M HCI, washed 2X with Et₂O, the aqueous layer basified with NaHCO₃, 3X extracted with Et₂O, dried over Na₂SO₄ and evaporated to give the title compound as a pale yeiiow oil. lntermediate C: lmidazo!e-1-carboxylic acid (8-diethylam)no-4,5~dihydro-tNazolo[4,5- h)quinazolin-2-yi)-amide

To a mixture of 2-amino-8-N,N-diethyiamiπo-4_!5-dihydrothia2olo[4₎5-h]qυinazoline (Stage C.1 , 1 g. 3.63 mrooi) in DCM (35 mL) was added CDI (1.178 g, 7.26 mmol). The RM was strirred at 40 ⁰C for 90 h. After cooling to rt, the solid was collected by filtration to give the titfe compound. HPLC; t_R 4,11 min (method D). MS: M+H ~ 334 for (8-dtethylarnino-4,5- dihydro-thiazolo(4,5-h]quinazolin-2-yi)-carbamic acid methyl ester as the product of the reaction of the titie compound with MeOH.

Stage C.1 : 2-Amino-8~diethyJamino-4,5-dihydrothiazolα[4,5-h]quinazoline

To N'-{6-[1-dimethyfamino-meth-(E)-y!idene]-7-oxo-4,5,6,7-tetrahydro-benzothiazof-2-yl}- N.N-dimethyl-formamidine (Stage A.2, 1 g, 3.59 mmol} in 2-methoxyethanof (10 mL) was added NaOH (0.539 g, 13.47 mmo!) and N,N-diethylguanidine (0.454 g, 3.94 mmol) under argon at rt. The RM was stirred for 3.5 h at 125 ⁰C and then cooled to rt. After evaporation in vacuo the residue was dissolved in 0.1 M HCi (50 mL) and washed with EtOAc. The aqueous layer was then basified with 6 N NaOH and extracted 3 X with EtOAc. the organic layers were dried over Na₂SO₄, evaporated and dried under high vacuum at 60 ⁰C to give the title compound as orange crystals. LC: t_R 3.60 min (method D). MS M+H = 276. 1H- NMR in DMSO-d6: 7.91 (s, 1H); 7.59 (s, 2H); 3.50 (q_: 4H); 2.69 {όά. 4H); 1.07 (t, 6H). intermediate D: (2S,3S)-3-Methyi-ρyrroNdine-2-carboxylic acid amide

A 4 M solution of HCi in 1 ,4-dioxan (1.5 mL) was added to a suspension of (2S,3S)-3- methyipyrrofidine~2-carboxylic acid (0.5 g) in EtOH (5 mL} at rt and the mixture heated at refiux for 20 h. The RM was evaporated and a 7 M solution of ammonia in MeOH (5.6 mL) added. The RM was stood at rt for 6 days then evaporated, the residue triturated with MeOH (0.5 ml) and filtered and washed with cold MeOH (2 mL) to give the title compound as a white solid. ¹H-NMR (d_β-DMSO, 400 MHz): 8.06 <s, 1H), 7.67 (s, 1H)₁ 3.60 (d, 1H), 3.25- 3.14 (m, 2H). 2.24-2.15 (m, 1 H), 2.09-1.98 (m. 1H), 1.57-1.45 (m, 1H), 1.13 (d, 3H). intermediate E: (R)-2-Benzyi-pyrroiιdine-2-carboxyiic acid amide

A mixture of (aRyaRHa-benzyl-S-trichioromethyl-tetrahydro-pyrroloπ ^-cjoxazoMσne (1.40 g, prepared as described by Wang and Gerrnanas Synlett 1999, 33-36.) and 7 M ammonia in MeOH (15 mi) was heated at 50 ⁶C for 3 days in a sealed vessel. The cooied RM was then evaporated and triturated with chloroform to give the title compound as a white sofid. intermediate F <S)-2-Methyl-pyrrolidine-2-carboxyNc acid amide

A soiυtion of (S)-2-methyl-pyrrolidine-2-carboxylic acid butyl ester (Stage F.1 , 2.3 g) in a 7 M solution of ammonia in MeOH {22.2 ml) was heated in a bomb at 70 ⁰C for 10 days.

Evaporation of the RM and trituration with hexanes (20 mL) gave the title compound as an off-white solid. ¹H-NMR {d_δ-DMSO, 400 MHz): 7.40 {s, IH), 6.89 (s, 1H), 2.95-2.84 (m, 1H), 2.72-2.60 (m, 1H), 2.06-1.95 (m, 1H)₁ 1.66-1.44 (m, 2H}. 1.42-1.30 (m, 1H), 1.22 (s. 3H). Stage F.1 : (S)-2-Methyl-pyrroiidine~2~carboxylic acid butyl ester

Concentrated HCI (2 ml) was added to a suspension of (S)-2-methyi-pyrroiidine-2-carboxyiic acid (2 g) in butan-1-ol (50 ml) which was heated at 60 "C for 18 h then at reflux for 4 days. The RM was evaporated, partitioned between saturated aqueous NaHCO₃ and DCM₁ 47 extracted 3X with OCM, dried over Na₂SO₄ and evaporated. The isolated oil was then kugelrohr distilled at 10 mbar to give the title compound as a clear coioriess oil from the fraction distilling at an oven temperature of 100-120 ⁰C. intermediate G; {R)-2-Methoxymethyl-pyrrolidtne-2-carboxyfic acid amide

O NH₂

A mixture of (SR^aRJ-ya-methoxymethyl-S-trichloromethyi-tetrahydro-pyrrololi^-cJoxazol-i- one (Stage G.1, 0.6 g) and 7 M ammonia in MeOH (6 mL) was stood at rt for 2 days in a sealed vessel. The RM was then evaporated to give the title compound as a pale yellow oii which was used without further purification.

Stage G.1: {3R,7aR)-7a-Methoxymethyl~3~trichloromethyl-tetrahydro-pyrrolo[1 ,2-φxazol~1~ one

o

A 1M of solution of lithium diisopropylamide in a 3:5 mixture of hexanes / THF (8.25 ml) was added dropwise to (3R,7aS)-3-trich{oromethyl-tetrahydro-pyrrofo[1,2-c]oxazol~1-one (1.51 g, prepared as described by Wang and Germanas Syntøtt 1999, 33-36.) in THF (5 ml) at - 78 °C. After stirring 30 minutes at -78 "C methoxymethylchloride (1.14 mi) was added. The RM was then allowed to warm to - 30 °C over 3 h and water was added. The aqueous layer was extracted with DCM, the combined organic layers evaporated and the residue was then purified by normal phase chromatography, eluting with DCM, to give the title compound as a pale yellow oii.

Intermediate H: (R)-2-Dimethylaminomeihyl-pyrrolidine-2-carboxylic acid amide

A mixture of (3R,7aR)-7a-dimethylaminome{hyi-3-trichforomethyf-tetrahydro-pyrrolo[1 ,2- c]oxazol-1-one (Stage H.1 , 0.26 g) and 7 M ammonia in MeOH (4 mL) was heated at 50 ⁰C for 3 days in a sealed vessel The cooled RM was then evaporated to give the title compound as a brown oil which was used without further pυrificatron. MS: M+H = 172.1.

Stage H.1 : (3R,7aR)-7a-Dimethylaminomethyl-3-trich!oromethyl-tetrahydro-pyrrolo[1 ,2- c]oxazoi-1-one

o

A 1 M of solution of lithium diisopropyiamide in a 3:5 mixture of hexanes / THF {8.25 ml) was added dropwise to (SRJaSJ-S-trichloromethyl-tetrahydro-pyrroioti ,2-c]oxazol-1-one (1.51 g, prepared as described by Wang and Germanas Synlett 1999, 33-36 ) in THF (5 ml) at - 78 "C. After stirring 30 minutes at -78 ⁰C Eschenmoser's salt (2.78 g) was added. The RM was then allowed to warm to - 40 ⁰C with vigorous stirring over 1 h and maintained for 2 h at - 40 ⁰C. Water was then added and the aqueous layer extracted with DCM, the combined organic layers dried over Na₂SO₄ and evaporated. The residue was then purified by normal phase chromatography eluting with a gradient from DCM to 20 % EtOAc in DCM to give the title compound as a paie yeffow oil (M+H ^« 301/303/305 3:3:1)

Intermediate I: d₈-(R)-2-DιmethyJaminomethyi-pyrroiidine-2-carboxylic acid amide

de-CSRJaRJ^a-Dimethylamiπomethyi-S-trichtoromethyi-tetrahydro-pyrrofofi^-cloxazoi-i-one

(Stage 1.1 , 440 mg, 1.430 rnmof) was dissolved in ammonia in MeOH (10.2 mL, 71.4 mmol) in a sealed vessel and heated at 75 °C for 5 days. The reaction mixture was evaporated and triturated 2X with CHCI₃ to give the title product as a pale brown solid.

Stage 1.1 : dβ-(3R,7aR)-7a-Dimethylaminomethyi-3-trichloromethy!-tetrahydro-pyrrolo[1.2- cJoxazoM-one

(3R,7aR)-1 -Oxo-S-trichloromethyl-dihydro-pyrroiofi ,2~c]oxazo!e-7a-carbaidehyde (obtained as described in J. Org. Chem. 2006, 71(1), 97-102, 1 g_: 3.67 mmof), dimethytamine-d_? in THF (1.0 mL, 14.09 mmoi), acetic acid (0.525 mL, 9.17 mmo!) and DCE (4 mL) were combined under argon and sodium triacetoxyborohydride (1.089 g, 5.14 mmo)) was added portionwise. After stirring at rt for 3 h the RM was taken up in DCM, and partitioned with 1 M NaOH extracting once more with DCM. The organic layers were combined then washed twice with water before being dried over Na₂SO₄. The solution was evaporated to half of its volume and 1 M HCI in H_?O was added, the layers separated and the aqueous layer washed twice with DCM. The pH of the aqueous layers were adjusted to ~8 with saturated Na₂CO₃ solution and extracted three times with DCM. The organic layers were dried over Na₂SO₄ and evaporated, to give the desired title product as a pale yellow oil.

Intermediate J: (R)-2-Hydroxymethyl-pyrrofidfne-2-carboxylic acid amide

(3R,7aR)-7a-Hydroxymethyl~3-trich!oromethyl-tetrahydro-pyrrofol1 ,2-cjoxazoM -one (Stage J.1, 308 mg, 1.122 mmoi) was added io 7 M ammonia in MeOH (8.014 mL. 56.1 mmoi) under argon and heated at 75 ⁰C in a sealed vessel for 72 h and then evaporated to give the title compound as a viscous pale brown oil which was used without further purification

Stage J.1 : (3R,7aR)-7a~Hydroxymethyi-3-trichioromethyl-tetrahydro-pyrrolo[1 ,2-cjoxazoM - one

Sodium triacetoxyborohydride (544 mg, 2.57 mmof) was added to (3R,7aR)-1-oxo-3- trichioromethyl-dihydro-pyrrololi^-φxazole^a-carbaldehyde {obtained as described in J. Org. Chem. 2006, 71(1), 97-102, 500 mg, 1.835 mmoi) in DCE (4 mL). The RM was stirred 18 h at rt then taken up in DCiVl, the organic layer washed with water, dried over Na₂SO₄ and evaporated. The crude product was purified using a 20 g RediSep© silica ge! column (etuent DCM to 10% MeOH in DCM) to give the title compound as a dear pale yellow oil. intermediate K: (R)-2~{[(3-Fluoro~benzyl)-methyl-amino]-methyl}-pyrroiidine-2-carboxylic acid amide

(SRJaRJ-Ta^^S-Fiuoro-benzyO-methyl-aminoj-methylJ-S-trichioromethyl-tetrahydro- pyrrolo[1.2-c]oxazoi-1-one (Stage K.1. 385 mg, 0.S73 mrnoi) was added to 7 M ammonia in MeOH {6.950 mL, 48.7 mmol) under argon and heated in a sealed vessel at 50 ⁰C for 6 days and then at 75 ⁰C for 5 days. The RM was then evaporated and the residue purified by flash chromatography using a 12 g RediSep® silica gei column (eiυent 5 % MeOH in DCM) to give the title compound as a yellow oil. Stage K.1 : (3R _r7aR)-7a-{[(3-Ffuoro-benzyl)-methyl-amino3-methyl}-3-trichforomethyt- tetrahydro-pyrrolo[1 ,2~c]oxazol~1 -one

Sodium triacetoxyborohydride (889 mg, 4.19 mmot) was added to a mixture of (3R,7aR)-7a- [(S-fluoro-benzyiaminoJ-methyll-S-trichloromethyi-tetrahydro-pyrroloII ^-cloxazol-i-one

(Stage K.2, 400 mg, 1.048 mmol), formaldehyde {37 % in H₂O, 0.102 mL, 1.36 mmol) and acetic acid {0.150 mL, 2.62 mmoi) in DCE (4 mL) under an argon atm. After 2 h stirring at rt the RM was partitioned between DCM and water. The combined organic layers were dried over Na₂SO₄ and evaporated to give the title compound as a pale brown oil which was used without further purification.

Stage K.2: {3R,7aR)-7a-[{3-Fluoro-benzylamino)-methyi]-3-trtchioromethyl-tetrahydro- pyrrolo[1 ,2-cloxazo!-1 -one

Sodium triacetoxyborohydride (544 mg, 2.57 mmol) was added to (3R.7aR)-1-oxo-3- trichloromethykiihydro-pyrrolop ^-cjoxazole^a-carbaldehyde {obtained as described in J Org. Chem. 2006, 71(1), 97-102, 500 mg, 1.835 mrnof), 3-fiuorobenzylamine (0.251 mL, 2.20 romoi) and acetic acid (0.263 mL, 4.59 mmol) in DCE (4 mL) under an argon atrn. The RM was stirred at rt for 3 h, then partitioned between water and DCM₁ the combined organic dried over Na₂SO₄ and evaporated to give the title compound as a pale yellow oil which was used without further purification.

Intermediate L: <S)-Azetidine-2-carboxyiϊc acid amide

A mixture of {S)-2-carbamoy!-azetidine-1-carboxyl[c acid benzyl ester {Stage L.1, 1.8 g) and 10% palladium on carbon (0.2 g) in MeOH (25 mi) was stirred under a hydrogen atm. at rt for 5 h. Filtration and evaporation gave the title compound which was used without further purification.

Stage L.1 : (S)-2-Carbamoyi-azetidine-1 -carboxylic acid benzyi ester

A mixture of (S)-azetidine-1.2-dicarboxylic acid 1-benzy! ester 2-methyl ester (2.5 g} and 7 M ammonia in MeOH (10 ml) was stood at rt for 18 h in a sealed vessel. The RM was then evaporated to give the title compound as a white solid which was used without further purification. MS: M+H 235.1 and M-H 233.1. intermediate M: (2S,4/?)-4-fluoro-pyrrolidine-2-carboxylic acid amide

A 1.25 M sofution of HCl in EtOH {2.3 ml) was added to a suspension of {2S,4R)~4-fluoro- pyrroikiine-2-carboxylic acid (0.25 g) in EtOH (2 ml) at rt and the mixture heated for 62 h at 55 ^βC. The RM was evaporated and a 7 IvI solution of ammonia in MeOH (5.6 ml) added. The RM was stood at rt for 36 h then evaporated, the residue triturated with MeOH {0.5 ml) and filtered to give the title compound as a white solid. ¹H-NMR (d_s-DMSO, 400 MHz)- 7.68 {s, 1H), 7.37 (s, 1H)₁ 5.30 (d, 1H), 3.95 (t, 1H). 3.40-3.12 (m, 2H)₁ 2.48-2.31 (m. 1H)₁ 2.02- 1.81 (m. 1H).

Intermediate N: (2S,4S)-4-Rυoro-pyrroiidine-2-carboxyiic acid amide

A mixture of (2S,4S)-2-carbamoyl-4-fiυoro-pyrroiidine-1-carbcxylic acid tert-butyl ester (1.0 g), cone. HCI (0.6 m!) and 1-butanol (10 ml) was heated for 48 h at 50 X. The RM was evaporated and partitioned DCM and aqueous NaHCO₃, the DCM layers were dried over Na₂SO₄ and evaporated. A solution of 7 M ammonia in methanol (10 mi) was added to the residue and the mixture was stood for 60 h at rt in a sealed vessel. Evaporation and trituration with EtOH gave the title compound as a white solid. Intermediate O: ( 1 S . SR )-2~Aza-bicyclo[3 1. OJhexane- 1 -carboxyiic acid am ide

A mixture of (1S,5R)-2-aza-bicyclo[3.1.0]hexane-1-carboxyNc acid ethyl ester (2.5 g, prepared by the procedure of Hercouet Tetrahedron Asymmetry 1996, 7, 1267-1268.) and 7 M ammonia in MeOH (20 m!) was heated in a sealed vessel at 80 ⁰C for 5 days. The cooied RM was evaporated and triturated with hexanes / DCM to give the title compound as a beige solid. ¹H-NMR {DMSG-d_6l 400 MHz): 7.15 {s. 1H)₁, 7.04 (s, 1 H), 3.00 - 2.91 (m, 1H), 2.67 (q, 1H), 1.94 - 1.83 (m, 1 H)₁ 1.74 - 1.67 (m, 1H)₁ 1.64 - 1.55 (m, 1 H), 1.38 - 1.31 (no, 1 H)₁ 0.90 (t, 1H)). Intermediate P: (2S,3R)-3-Methyi-pyrroltdme-2-carboxylic acid amide

53

{2S,3R)-3-Methyf-1-((S)-1-phenyl-ethyi)-pyrroHdine*2-carboxylic acid amide (Stage P.1, 1.1 g, 4.76 mmoi) and Pd on charcoai 10 % {0.101 g, 0.947 mmol) in MeOH (20 mL) was shaken under a H₂ atm. for 46 h at rt. The RM was then filtered through a Ruoropore Membrane Filter (0.2μm FG) and evaporated. The residue was dissolved in DCM and evaporated to dryness to give the title compound as white crystals MS; M+H = 129.0. ¹H- NMR Cd₆-DMSO, 600 MHz): 7,34 {s, br,1H), 7.10 (s. br,1H), 3.48 (d. 1H), 3.0.2 - 2.97 (m, 1H), 2.80 - 2.75 (m, 1H), 2.35- 2.28 (m, 1H), 1.88 - 1.81 (m, 1H)₁ 1.39 - 1.32 (m, 1H), 0.83 (d, 3H). Stage P.I: (2S,3R)-3-Methyl-1-((S)-1-phenyl-ethy))-pyrrolidine-2-carboxylic acid amide

Trimethyialuminυm in toluene <2 M, 3.23 mL) was added dropwise to a mixture of ammonium chloride (0 346 g. 8.47 mmol) in toluene (3.2 mL) at 0 ⁰C under an argon atm., with the formation of methane gas. The RM was then allowed to warm to rt, and stirred at rt for a further 15 min. before (2S.3R)-3-methyl-1 -((S)- 1 -phenyi-ethyO-pyrrolidine^-carboxylic acid methyl ester (prepared as described in Tetr. Lett. 1997, 38 (1), 85-88; 1.6 g. 6.47 mmoi) was slowly added. The RM was stirred at rt for 56 h, 1 M HCI was then added with cooling and the RM washed 3X with DCM. The aqueous phase was basified with Na₂CO₃, extracted 3X with DCM and the combined organic layers dried over Na₂SO₄. Evaporation gave the title compound as a yellowish oil. MS: M+H « 233.2. HPLC: t_R 3,17 min (method D).¹H-NMR (d₆- DMSO. 600 MHz): 7.37 - 7.33 (m. 2H), 7.30 (t, 2H), 7.25 (s, br,1H), 7.21 (t, 1H), 7.12 (s, br,1H), 3.55 (q, 1H), 3.40 (d, 1H), 2.71 (t, 1H), 2.28- 2.22 (m, 1H)₁ 2.21 - 2.16 (m, 1H), 1.71 (qt, 1H). 1.38 - 1.31 (m. 1H), 1.21 (d. 3H), 0.90 (d. 3H). Intermediate Q: (2S,4SH-Dimethylamino-pyrrolidine-2-carboxylic acid amide

A solution of (2S,4S)-4-dimethy!amino-pyrrolidine-2-carboxylic acid butyl ester (Stage Q.1, 326 mg) and 7 M ammonia in MeOH (8 ml) was stood for 18 h at rt in a sealed vessel. Fiitratioπ, evaporation and trituration with Et_?0 / MeOH gave the title compound as a beige solid.

Stage Q.i: (2S,4S)-4-Dfmethyfarnino-pyrrolidine-2-carboxylic acid butyl ester

Concentrated HC! (0.3 ml) was added to a mixture of (2S,4S)-4-dimethylamino-pyrrolidine-2- carboxylic acid methyl ester dthydrochioride (400 mg) and 1-butanoi (4 mf) and heated for 18 h at 115 ⁰C. After cooling the RM was evaporated then partitioned between DCM and aqueous NaHCO₃ solution and the DCM layers dried and evaporated to give the title compound as a brown oil which was used without further purification.

Intermediate R: (2S_;4S)-4-Hydroxy-pyrrolidiπe-2-carboxyNc acid amide

A solution of (2S_!4S)-4-hydroxy-pyrrolidine-2-carboxylic acid methyl ester hydrochloride (1 g} in a 7M solution of ammonia in MeOH {10 ml) was stirred for 18 h then evaporated and triturated with Et^O. The residue was dissofved in the minimum volume of hot MeOH and stood at 4 ⁰C for 4 h. The title compound was isolated by filtration as a white solid. intermediate S: (2S.4f?)-4-hydroxy-pyrroiidine-2-carboxylic acid amide

N^H-'

A solution of (2S,4R)-4-hydroxy-pyrrolidine-2-carboxyl!C acid benzyl ester {1 g) in 880 ammonia (5 ml) was stirred for 18 h then evaporated and triturated with Et₂O to give the title compound as a white solid. ^'H-NMR {d₆-DMSO. 400 MHz); 9.15 (s, br, 1H), 8.04 (s, 1 H)₁ 7.63 (s, 1H), 5.56 (s, 1H), 4.40 (s, 1H)₁ 4.27-4.16 (m. 1H)₁ 3.27 (d, 1H). 3.02 (d, 1H), 2.33- 2.19 (m, 1H)₁ 1.89-1.76 (m, IH). 55

intermediate T: imidazole-1-carboxyfic acid (7-tert-buiyl-4.5-dihydrQ~benzo[1 ,2-d;3.4- d']bisthiazol-2-yl)-amide

7-tert-Butyi-4,5-dihydro-benzo[1 ,2-d;3,4-d'3bisthiazol-2-yiamiπe {Stage T.1, 175 mg_r 0.659 mmof) was dissolved in DCM (10 mL), CD! {297 mg, 1.648 mmol) was then added, and the RM was stirred at rt for 2 h. The title compound was isolated by filtration, washed with DCM and dried under HV. Stage T\1 : 7-tert-Butyl-4,5-dihydro-benzo[1 ,2-d;3,4-d'Jbislhiazoi-2-ylamine

N-(7-tert-Butyl-4,5-dihydro-benzo(1 ,2-d;3,4-d']bisthiazoi-2-yl)-acetamfde (Stage T.2, 225 mg, 0.732 mmol) was dissolved in EtOH (10 mL), HCI 36% {1.48 g, 14.64 mmol) was then added, and the RM heated to reflux. After 18 hours at reflux the RM was cooled to rt and adjusted to pH 8-8 by the addition of 5% aqueous sodium bicarbonate solution, extracted with EtOAc, and washed two times with H₂O, The organic layer was dried over Na₃SO₄ and evaporated to give the title product (t_R 4.408 min (Method F)).

Stage T.2: N-{7-tert-Butyl-4,5-dihydro-benzoE1 ,2-d;3_<4-d']bisthtazol~2-yl)-acetamide

N-(6-Bromo-7-oxo-4.5,6,7-tetrahydro-benzothiazol-2-yi)-acetamide (Stage T.3, 473 mg, 1.635 mmoi) was dissolved in MeOH (10 mL), 2_:2~dtmethylthio propionamide (230 mg, 1.962 mmol) and ammonium phosphomoiybdate (307 mg. 0.164 mmol) were added, and the RM was stirred at 25 ⁰C for 20 h. The RM was then stood for 2 days before stirring at 50 ^βC for 24 h. The mixture was extracted with EtOAc/H₂O. The organic layers were dried over Na₂SO₄ and evaporated. The crude material was chromatσgraphed with 30 g of silica gel, eiuent DCM/MeOH=99:1. Fractions containing the product were evaporated and fyophilized from dioxane to give 225 mg of the titie compound as a white solid (M+H ~ 308; M-H = 306: tn 5.525 min (Method F)). Stage T.3: N-(δ-Bromo-7-oxo-4,5,δ J-tetrahydro-benzothiazol-2-yl)-acetamide

N-{7-Oxo-4,5,6,7-tetrahydro-benzothiazoi-2-yi)-acetamide (Stage T.4, 2.286 g. 10.87 mmo!) was dissolved in AcOH {60 mi), then bromine (1.74 g, 10.87 mmoi) dissolved in AcOH (10 mL) were slowly added and the RM was heated to 75 ⁰C for 20 h. The color changed from red to beige. The mixture was evaporated and the residue was dissolved in MeOH (10 mL) and precipitated with H₂O. The mixture was filtered and dried on HV. The crude material was chromatographed with MPLC C18 H₂O 0.1% TFA / CH₃CN 0.1% TFA₁ gradient 0-50%. Fractions containing the product were neutrafized with NaHCO₃, extracted with EtOAc and lyophilized from dioxane to give of the title compound as a white solid {M+H = 291; M-H ~ 289; t_R 4.29 (Method F)). ¹H-NMR (d_s-DMSO, 600.13 MHz) 12.75 (s, 1 H) 4.95 (t, 1 H), 2.95- 2.84 (m, 2H), 2.62-2.52 (m, 1 H), 2.40-2.30 (m, I H), 2.20 (s, 3H).

Stage T.4: N-(7-Oxo-4.5,6,7-tetrahydro-benzothiazo!-2-yl)-acetamide

To acetic anhydride {80 mL) was added at rt 2-amino-5,6-dihydro-4H-benzothiazo!-7-one (10 g, 59.4 mmoi) and the yellow suspension was heated to reflux. After 1.75 h stirring at this temperature, the RM was allowed to cool with stirring, and stirred overnight at rt. After further cooling with an ice / NaCI bath, the suspension was filtered. The solid was then refluxed twice with acetone (10 mL then 15 mL) and filtered. The resulting solid was dried under vacuum at 40 ⁰C overnight to afford the title compound as a beige solid (HPLC: t_R 3.47 min (Method A3), M-H = 211.1 ). ¹H-NMR in DMSO-d6 (600 MHz): 12.55 (s, br, 1H); 2.84 (t, 2H); 2.48 (t, 2H); 2.17 (s. 3H); 2.065 (qt, 2H)).

Intermediate U: Imidazole- 1-carboxylic acid [7-{2-fluoro-1 ,i-dimethyl-ethyi)-4,5-dihydro- benzo[1 ^-djS^-d'jbisthiazol^-yll-amide - 57 -

7-(2-Fluoro-1 ,1-dimethyl-ethyl)-4,5-dihydro-benzo[1 ,2-d;3,4-d']bisthiazol-2-lamine (Stage U.1 61 6 mg, 0.217 mmol) was dissolved in DCM (2 mL), and CDI (297 mg, 1.648 mmol) added to give a clear colorless solution. The RM stood overnight at rt to give a white suspension. The mixture was cooled at 4 ⁰C for 1 h and then filtered, washed with DCM and dried under vacuum to give of the title compound as a white solid (analysts of a sample in MeOH; M+H = 342.0 showed methyl carbamate product in MS; t_R 2.14 min (Method A3)).

Stage U.1 7-(2-F!uoro-1_J1-dimethyi-ethy!)-4_r5~dihydro-ben2θf1 ,2-d;3,4-d']bisthiazol-2-lamine

3-Fluoro-2,2-dimethyl~thiopropionarnide (Stage U.2. 394 mg, 2.331 mmol) was dissolved in

EtOH, N-(6-bromo-7-oxo-4,5,6,7-tetrahydro-ben20thiazol-2-yl)-acetamide (Stage T.3, 473 mg, 1.635 mmol) and ammonium phosphomolybdate (80 mg, 0.042 mmol) were then added to give a yeilow suspension. The RM was heated to reflux to give a dark blue-green suspension. The reaction mixture was stirred at 65 "C 3 days. The RM was filtered and the filtrate evaporated. The residue was taken up in DMF and purified by prep-HPLC (method E). Fractions containing the product were combined and evaporated to give the title compound as a white solid <M+H = 284.1; t₈ 1.30 min {Method A3)). Stage U.2 3-Fluoro-2,2-dimethyi-thiopropionamide

The title compound was prepared by the procedure of Boys, M. L., Downs, V. L. Synth. Commun. 200S, 36, 295. Sodium hydrogen sulphide hydrate (3.89 g. 69.4 mmol, hygroscopic) was added to a solution of 3-fiuoro-2,2-dimeihyI-propionitπie (Stage U.3, 1.17 g, 11.57 mmo!) and diethyl amine hydrochloride (7.61 g, 69.4 mmol) in 1 ,4-dioxaπe (7 mL) and H₂O (7 mL) at rt. The RM was heated to 55 °C and then stirred for 3 days at this temperature. The reaction mixture was diluted with water (50 ml) and extracted 5X with EtOAc {50 mL). The organic layers were dried over Na₂SO₄ and evaporated to give an orange oil. DCM (5 ml) was then added to give a white suspension. The suspension was filtered and the filtrate was purified with flash chromatography on silica gel eiυting with DCM. The product containing fractions were evaporated to give the titie compound as a pale yellow oil (M+H - 136.1, M-H = 134.1 ; t_R 0.69 min (Method A3)). ¹⁹F-NMR (d_e-DMSO, 400 MHz 21Sppm {t, 1 F)).

Stage U.3 3-Fluoro-2,2-dimethyl-propionitrile

3-Fluoro-2,2-dimethyf-propionamide (Stage U.4, 1.82 g, 15.28mmol) and phosphorus pentoxide {2.168 g. 15.28 mmol) were combined to give a free flowing white powder which was heated with an oil bath to a bath temperature of 180 ⁰C over 50 minutes under an argon atmosphere. A 300 mbar vacuum was then slowly applied distilling a mobile dear colourles oil which formed a low melting waxy solid on standing of the title compound. ¹⁹F-NMR (de- DMSO, 400 MHz 219.5 ppm (t, 1F)).

Stage U.4 3-FkJoro-2,2-dimethyl~prαpionamide

S-Fluoro^-dimethyl-propiony! fluoride (DE3326874 and DE3611195, 2.5 g, 20.47 mmo!) was added at 0 ⁰C to a mixture of aqueous ammonia (10 mL) and THF (20 mL). The RM was then allowed to warm to rt and stood overnight at rt. The volume was reduced by 50% under vacuum to give a thick white suspension. The suspension was extracted with

DCMZH₂O. The organic layers were dried over Na₂SO₄ and evaporated to give the title compound as a white crystalline solid. Intermediate V: lmidazole-1-carboxyiic acid (7-cyclopropylmethyl-4,5-dihydro-benzo [1 ,2- ;3,4-d]bisthiazol-2-yl)-amide

7-Cycloρropy!methyl-4_!5-dihydro~benzo[1 ,2-d;3.4-d']bisthiazol-2-yiamine (Stage V.1, 72 mg, 0.273 mmol) was dissofved in 5 mL DCM, CDI {73.9 mg, 0.410 mmol) was added, and the RM stirred at rt for 20 h. Additional CDI (37 mg, 0.205 mmo!) was added and the RM stirred at rt for a further 2 hours. The mixture was filtered, washed with DCM and filtrate was evaporated to give the title compound (M+H « 322.1; M-H = 320.2 MS-ES in MeOH shows the methyl carbamate product).

Stage V.1 7-Cyciopropytmethyl-4,5-dihydro~benzo[1 ,2-d;3,4-d']bisthiazol-2-y!amine

N^T-Cyclopropylmethyi^.δ-dihydro-beπzoti ^-diS^-d'Jbisthiazol^-yO-acetamide (Stage V.2, 180 mg, 0.589 mmol) was dissolved in EtOH (10 mL) and 36% HCI (1.193g, 11.79 mmol) added. The RM was heated to 90 ⁰C for 16 h then cooled and extracted with

EtOAc/H₂O. The organic layer was dried over Na₂SO₄ and evaporated. The crude material was chromaiographed with MPLC C18 H2O 0.1% TFA / CH₃CN 0.1% TFA, gradient 0-50%. Product containing fractions were neutralized with NaHCO₃. extracted with EtOAc and lyophilized from dioxane to give the title compound (M+H = 264.2; M-H ~ 262.1; t_R 4.183 min (Method F)).

Stage V.2 N-(7-Cyc!opropylmethyl-4,5-<iihydro-benzo[1 ,2-d;3,4-d']bisthiazo!-2-yl}-acetamide

N-(6-Bromo-7~oxo-4,5.6,7~tetrahydro-benzothiazol-2~y!)-acetamide (Stage T.3, 347 mg, 1.200 mmol) was dissolved in MeOH (10 mL) and 2-cycloproρyl-thioacetamide (Can. J. Chem 1995 Vot.73 1468-1477, 166 mg, 1.440 mmol) and ammonium phosphomoiybdate (225 mg, 0.120 mmol) were added. The RM was stirred at rt for 20 h then heated at 50 ⁰C for 3 h_: 60 ⁰C for 2 h and then refluxed for 24 h. The RM was partitioned between EtOAc/H₂O. The organic layer was dried over Na₂SO₄ and evaporated. The raw material was

chromatographied with MPLC C 18 H₂O 0.1 % TFA / CH₃CN 0.1 % TFA, gradient 0-50%. Product containing fractions were neutralized with NaHCO₃, extracted with EtOAc and iyophilized from dioxane to give the titie compound as a white solid (M+H - 306.2; M-H - 304.2; t_R 5.12 min (Method F)). 60 -

Exampie 1 : (2S,4R)-4-Dimethyiamino-pyrroltdine-1 ,2-dicarboxylic acid 2-amide 1-[(8-tert- butyl-4,5~dihydro-thiazo1of4,5-h]quinazolirv2-yl)-amide3

To a solution of imidazole-1~carbσxylic acid (8-tert-butyl-4,5-d(hydro-thiazo!o[4,5- h]quinazolin-2-yl)~amide {Intermediate A, 45.1 mg, 0.127 mmo!) in DMF (1 mL) was added (2S,4R)-4-dimethy)amtno-pyrrottdine-2-carboxylic acid amide (Intermediate B, 22 rng, 0.140 rrtmoi) and triethylamiπe (0.053 ml, 0.382 mmol). The RM was then stirred at it for 17 h and purified by preparative HPLC (method B). The product containing fractions were combined and etuted through a Bond Eiut - SCX, 300 mg cartridge. The cartridge was then washed with a 7 M solution of ammonia in MeOH and evaporated to give the title compound. MS: M+H = 444. HPLC: i_H 3.17 min (method D).

Example 2: (2S,3S}-3-Methyf-pyrroiidine-1,2-dfcarboxyiic acid 2-amide 1-[(8~diethylamino- 4, 5-dihydro-thiazolo{4,5-h]quinazoiin~2-yi)-amide]

A mixture of (2S,3S)-3-methyi-pyrroiidine-2-carboxylic acid amide (Intermediate D₁ 6.24 mg, 0.049 mmol), imidazole- 1-carboxylic acid (8-diethylamino-4_t5-dihydro-thiazolo[4,5- h]quinazoiin-2-yi)-amide (Intermediate C, 18 mg, 0.049 mmoi) and triethyiamine (0.020 mL, 0.146 rnmol) in DMF (0.4 mL) was stirred at rt for 6 h. The RM was then directly purified by preparative HPLC (method B). The product containing fractions were then filtered through a 300 mg Bond Eiut-SCX cartridge. The cartridge was then eluted with a 7 M ammonia solution in MeOH and the eiuent evaporated to give the title compound as a yellow solid. MS: M+H ^« 430.1. HPLC: t_κ 3.72 min (method D). ¹H-NMR (DMSO-d_Sl 600 MHz): 11.05 (s, I H); 8.04 (s, 1H); 7.44 (s, br, 1H); 6.95 (S₁ br. 1H); 3.78 (s. br, 1H); 3.60 - 3.50 (m, 6H); 2.82 (s, br_: 4H); 2.18 (s, br, 1H); 2.03 (s, br, 1H); 1.55 (s. br, 1H); 1.10 (t, 6H); 1.05 (d, 3H).

Example 3: (R)-2-Benzyl-pyrrotidine-1,2-dicarboxylic actd 2-amide 1-[(8-diethyiamino-4,5- dihyd ro-thiazolo[4 , 5~h]quinazolin-2 -y I ) -amide]

To a mixture of imidazole-1-carboxylic acid (8-<ϋethyiamino-4,5-dihyctro-thiazo!o[4,5- h]quinazolin-2-yl)-amide (Intermediate C, 50 mg, 0.135 mmof) in DMF (1 mL) was added (R)-2-benzyf-pyrrolidine-2-carboxylic acid amide {Intermediate E, 33.2 mg, 0.162 mmol) and trtethylamine (0 057 mL, 0.406 mmol). The RM was stirred for 21 h at 40 ⁰C and then directly purified with preparative HPLC (method B). The product containing fractions were eluted through a 300 mg Bond Eiut - SCX. cartridge. The cartridge was then eluted with 7 M ammonia-solution in MeOH and evaporated give the titie compound as a yeflow solid. MS: M+H = 506.1. HPLC: t_R 4.38 min (method D).

Example 4: {S)~2-Methy^{-pyrrolidine-1 ,2-dicarboxyiic acid 2-amide 1-[(8-diethy!amino-4,5- dihydfo-thiazolo[4,5-h]quinazolin-2-yO-amide3

To a mixture of imidazole-1 -carboxylic acid (8-diethylammo-4,5-dihydro-thia2olo[4,5- h3qϋinazolin-2-yl}-amide (Intermediate C, 75 mg, 0.203 mmol) in DMF (2 mL) was added (S)-2-methy!-pyrrolidtne-2-carboxyKc acsd amide (Intermediate F, 39 mg. 0.305 mmo!) and triethyiamme (0.085 mL. 0.609 mmol). The RM was stirred for at 40 °C 17 h and then directly purified with preparative HPLC (method B). The product containing fractions were eluted through a 300 mg Bond Elut - SCX cartridge. The cartridge was then eluted with 7 M ammonia-solution in MeOH and evaporated to give the title compound as a yellow solid MS: M+H ~ 430.2. HPLC- t_R 3.80 min (method D).

Example 5: (R)-2~Methoxymethvl-pvrrolidine~i .2-dicarboxvlic acid 2-amide 1-((8- diethy!amino-4,5-dihydro-thiazo{o[4,5-h}quinazolin-2-yi)-amide]

A mixture of imidazole-1-carboxyftc acid (8-diethylamino-4,5-dιhydro-ihiazotol4,5- h]quinazolin-2-yl)-amide (Intermediate C, 75 mg, 0.203 mmol), (R)-2-methoxymethyi- 62 pyrrofidiπe-2-carboxytic acid amide (intermediate G₁ 35.3 mg, 0.223 mmof) and

triethylamine (0.085 mL, 0.609 mmol) in DMF (2 mL) was stirred for 6 h at 40 ⁶C. After cooling to rt, the RM was dissolved in MeOH {1 mL) and directly purified by preparative HPLC (method B). The product containing fractions were eluted through a 300 mg Bond Eiut - SCX cartridge. The cartridge was then eluted with 7 M ammonia solution in MeOH and evaporated to give the title product as a yellow solid. MS: M+H = 460.1. HPLC: t_R 3.94 min (method D).

Example 6: (R)-2-Dimethylaminomethy!-pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1-[(8-tert- butyM.S-dihydro-thiazoloKS-hJquinazolin^-ylJ-amide]

imidazole-i-carboxyiic actd iβ-tert-butyl^.δ-dihydro-thiazoio^^-hlquinazolin^-ylϊ-amide (Intermediate A, 132 mg, 0.372 mmol) was added to a mixture of (R)-2- dimethyfaminomethyl-pyrrolidine~2-carboxylic acid amide (intermediate H, 70 mg, 0.409 mmol) and triethylamine (0.155 mL, 1.115 mmol) in DMF (1 mL) at rt. After 18 hours MeOH {0.5 ml) was added, the RM filtered through a PTFE membrane filter and purified by preparative HPLC (method B). The product containing fractions were combined and evaporated to remove CH₃CN and then basifted by the addition of solid NaHCO₃ to give a yellow white precipitate. After cooling to 4 ⁰C, the solid was recollected by filtration and then further purified by preparative HPLC (method C). The product containing fractions were eiuted through a 300 mg Bond Elut - SCX cartridge. The cartridge was then eluted with a 7 M ammonia in MeOH solution and evaporated to give the title product as a yellow

amorphous glass. LCMS: t_R 0.98 min and M+H « 458.1 (method A3). ¹H-NMR (CD₃OD, 400 MHz): 8.28 (s, 1H); 3.92 - 3.82 (m, 1H); 3.67 - 3.44 (m, 2H); 3.04 - 2.88 (m, 4H); 2.85 - 2 71 (m, 1H); 2.56 (s, br, 6H); 2.29 - 2.19 (m, 1H); 2.08 - 1.87 (m, 3H); 1.37 <s, 9H).

Example 7: d₆-(R)-2-Dimethylaminomethyf-pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1-[(8- tert-butyl-4,5-dihydro-thiazoio[4,5-hjquinazolin-2-yl)-amide] - 63

Imidazo)e-1 -carboxylic acid (8-tert-butyt-4,5-drhydro-thiazoio[4,5-hIquinazolin-2-yf)-amide (Intermediate A, 91 mg, 0.256 mmol) and triethylarntne (0.036 mL, 0.256 mmo!) were added to de-{R)-2-dimethylamtnomethyl-pyrro!idine-2-carboxylic acid amide (Intermediate I, 50 mg, 0.282 mmof) suspended in DMF (2 mL) under an argon atm. The RM was then stirred for 275 h at 40 ⁰C and then purified directly by preparative HPLC twice (method B and then method C). Each time, fractions containing the product were combined and eluted through a 300 mg Bond Elut - SCX cartridge. The cartridge was then eluted with a 7 M ammonia in MeOH solution and evaporated to give a yeltow solid. The solid was suspended in DCM, filtered and dried in vacuo to give the title compound as a yellow solid. LCMS: t_R 1.21 min and M+H - 464.0 (method A1 ).

Example 8: (R)-2-Hydroxymethyl-pyrrolidine-1.2-dicarboxylic acid 2-amide 1-[(8- diethylamino-4,5-dihydro-thiazolo{4,5-h]quinazolin-2-yl)-amide]

Imidazole-i-carboxyitc acid (δ-diethylamino^.S-dihydro-thiazofo^.S-hjquinazoNn^-yO-amide

(Intermediate C₁ 50 mg, 0.135 mmol) was added to a mixture of (R)-2-hydroxymethyl- pyrrolidine-2-carboxylic acid amide (Intermediate J, 25.4 mg, 0.176 mmoi) and triethylamine (0.047 mL, 0.338 mmol) in DMF (1 mL) at rt. After 18 h at ft the RM was filtered through a PTFE membrane and purified by preparative HPLC (method B). Product containing fractions the were combined and filtered through a Bond Elut - SCX cartridge. The cartridge was then eluted with a 7 M ammonia in MeOH solution and evaporated to give an orange glass which was recrystallized from MeOH / water to afford the title compound as a yeilow solid. LCMS: t_R 1.09 min and M+H - 446.0 (method A3). Exarηple 9: (R)-2~Hydroxymethyl-pyrro!fdine-1 ,2-dicarboxylic acid 2-amιde 1-[(8-tert~butyl- 4_!5-dihydro-thiazolo[4,5-h]quinazoliπ-2-yl)-amide|

!midazote-1 -carboxyiic acid (8-tert-butyl-4,5-dihydro-thiazolo[4,5~h)quinazolin-2-yi)-amide (Intermediate A, 124 mg, 0.350 mmol) was added to a mixture of <R)-2-hydroxymethyl- pyrrolidine-2-carboxylic acid amide (Intermediate J, 63 mg, 0.350 mmo!) and triethylamine (0.049 mL, 0.350 mmoi) in DMF (2 mL). The RM was stirred for 2 h at 40 °C then stood for 18 h at rt and then directly purified by preparative HPLC (method B). The product containing fractions were eiuied through a 300 mg Bond Elut - SCX cartridge. The cartndge was then etuted with 7 M solution of ammonia in MeOH and evaporated to give a yellow solid. The isolated solid was then suspended in DCM, filtered and dried to give titie compound as a pale yellow / white solid. LCMS: t_R 1.31 mm and M+H = 430.9 (method A1).

Example 10: (R)-2-{f(3-Fiuoro-benzv;)-roethyl-aminol-methvl)-pyrrolidtne-1 ,2-dicarboxylic acid 2-amide H(8-tert-buryi-4,5-dihydro-thiazolo[4,5-hjquinazolin-2-yi)-amide]

lmidazole-1 -carboxyiic acid <8-terf-butyi-4.5~dihydro-thiazolo[4 _r5-h}quinazolin-2-yi)-amide {Intermediate A, 40.1 mg, 0 113 mmol) and triethyiamine (0.047 mL, 0.339 mmo!) were added to (R)-2-{i(3-fiuoro-benzyl)-melhyl-amino]~methyl}-pyrrolidine-2-carboxylic acid amide (Intermediate K, 30 mg, 0.113 mmoi) suspended in DMF {1 mL) at rt under argon. The RIvI was stirred for 2.5 h at 40 ⁰C and then directly purified by preparative HPLC (method C). The product containing fractions were eiuted through a Bond Elut - SCX, 300 mg cartridge. The cartridge was then eiuted with a 7 M solution of ammonia in MeOH and evaporated to give a yellow solid. The sofid was triturated with DCM, filtered and dried to give the title compound as a pale yeliow solid. LCMS: t_R 0.81 min and M+H = 552.3 (method A2).

Example 11: (S)-2-Methyi-pvrrolidine-1.2-dicarboxylic acid 2-amide 1-[(8-tert-butyl-4,5- dihydro-thiazo!o[4,5-h]quinazolin-2-yi)-amide3

{S)-2-Methyl-pyrroiidine-2-carboxylic acid amide {Intermediate F₁ 22.14 mg, 0.169 mmoi) and trtethylamtne (0.035 mL, 0.254 mmol) were added to imidazole-1-carboxylic acid (8-tert- butyl-4,5-dihydro-thiazolo[4,5-hJquinazolin-2-yl)-amide (Intermediate A₁ 30 mg, 0.085 mmoi) in DMF (1 mL) under argon at rt. After stirring 16 h at rt the RM was directly purified by preparative HPLC (method 8). The product containing fractions were eiuted through a 300 mg Bond Elut - SCX cartridge. The cartridge was then eiuted with a 7 M solution of ammonia in MeOH and evaporated to give the title compound as a yeilow crystalline solid. MS: M+H - 415.1. HPLC: t_R 3.73 min (method D).

Example 12: (SJ-Pyrroltdine-i^-dicarboxylic acid 2-amide 1-[(8-diethy!amino-4_r5-dihydro- thiazolo[4 , 5~h}quinazolin-2-yi)-amide]

(S)-Pyrroltdine-2-carboxyϋc acid amide (148 mg, 1.299 mmol) and triethylamine (0.272 mL, 1.949 mmoi) were added to imidazole-1 -carboxyϋc acid (8-diethylamtno-4.5-dihydro- thiazolo{4,5-h]quinazolin-2~yi)-amide (Intermediate C. 240 mg, 0.65 mmol) and (DMF (1 mL) under argon at rt. The RM was stirred for 15 5 h at rt and then purified with preparative HPLC (method C). Product containing fractions were combined and fiflered through a Bond Elut - SCX cartridge. The cartridge was then eiuted with a 7 M solution of ammonia in WIeOH and evaporated to give the title compound as orange crystals. MS: M+H - 416.1. HPLC: t_R 3.56 min {method D).

Exampie 13: (S)-Azetidine-1,2-dtcarboxyitc acid 2-amide 1-[(8-diethylamino-4,5~dihydrσ- thiazoJo[4,5-h]quinazo!Jn-2-yl)-amide)

A mixture of (S)-azetidine-2-carboxyiic acid amide (intermediate L, 26.4 mg, 0.264 mmol), imidazoie-1-carboxyiic acid {8-dfethylamino-4_!5-dthydro-thiazolo{4,5-h]quinazolin-2-yf)-amide - 66 -

(Intβrmediate C₁ 75 mg, 0.203 mmol) and triethyiamine (0.085 mL, 0.609 mmoi) in DMF (2 mL) was stirred at 40 X for 2 h. The RM was then purified directly by preparative HPLC (method B). The product containing fractions were efuted through a 300 mg Bond Elut - SCX cartridge. The cartridge was then eluted with a 7 M solution of ammonia in MeOH and evaporated to give the title compound as a white crystalline solid. MS: M+H - 402.1. HPLC. t_R 3.56 min (method D).

Exampie 14: (SJ-Pyrrolidine-i^-dicarboxylic acid 2-amide 1-[(8-tert-buty!-4,5-dihydro- thiazoio^.δ-hjquinazolin^-ylj-amide]

(S)-Pyrrolidiπe-2-carboxylic acid amide (16 mg, 0.14 mmol) was added to a mixture of imidazole- 1 -carboxyiic acid (8-tert-buty!-4,5-dihydro-thiazQlo[4 ,5-h3quinazoKn-2-yl)-amide (Intermediate A, 45 mg. 0.127 mmol} and triethyiamine (0.053 mL, 0.381 mmol) in DMF (1 mL) at rt. The RM was stood overnight at rt, then evaporated and the residue crystailized from MeOH and water. The title compound was collected by filtration. MS: M+H = 401 1 (MS-ESI). 'H-NMR (CD₃OD, 400 MHz): 8.31 (s. 1H), 4.46 (d, 1H), 3,77 - 3.54 (m, 2H), 3.08 - 2.90 (m, 4H). 2.33 - 2.23 <m, 1 H), 2.13 ~ 2.00 (m, 3H), 1.38 (s, 9H)).

Example 15. 5-Methyf-pyrrolidine-i .2-dicarboxylic acid 2-amtde 1-[{8-diethylamino-4,5- dihydro-thiazoloj4, 5-h]qυinazoiin-2-yi)-amide]

To a suspension of imidazole- 1-carboxytic acid (δ-diethylamino^S-dihydro-thiazolo^δ- h3quinazoiin-2-yl)-amide (Intermediate C, 75 mg, 0.203 mmol) in DMF (2 mL) was added 5- methyi-pyrrolidine-2~carboxylic add amide {prepared as decribed in Arch. Pharm., 1936, 274, 40; 39 mg, 0.305 mmoi) and triethyiamine (0.085 mL, 0.609 mmol). The RM was stirred at 40 *C for 2.5 h. and then purified directly by preparative HPLC (method B). The product containing fractions were eiuted through a Bond Elut - SCX cartridge. The cartridge was then eluted with a 7 M solution of ammonia in MeOH, evaporated and the residue triturated - 67 - witb DCM to give the title compound as a yellow solid. LCMS: t_H 0.77 min and M+H ~ 430.0 (method A2).

Example 16: (2S,4R)~4-Fluoro-pyrroltdiπe-1 ,2-dicarboxylic acid 2~amide 1-[{8-diethylamιno- 4,5-dihydro-thiazolo{4,5-hjquinazolin-2-yl)-amide]

To imidazole-1-carboxyfic acid (8-diethylamino-4,5-dthydro-thiazolo[4.5-h]quinazoiin-2-y!)- arnide (Intermediate C₁ 75 mg, 0.203 mmol) in DCM (2 mL) was added (2S,4R)-4-fluoro- pyrrolidine-2-carboxylic acid amide (Intermediate M₁ 40.2 mg, 0.305 mmol} and

triethylamine (0.085 mL, 0.609 mmol). The RM was stirred at 40 ⁸C for 17.5 h and then directly purified by preparative HPLC (method 8). The product containing fractions were eluted through a Bond Elυt - SCX cartridge. The cartridge was then eluted with a 7 M solution of ammonia in MeOH and evaporated to give the title compound as a yellow solid. HPLC- t_R 3.66 min (method D). MS: M+H = 434.1.

Example 17: (2S,4S)-4-Fiuoro-pyrroiidine-1 ,2-dicarbαxyiic acid 2-amide 1-[(8-diethylamirκ>- 4,5-dihydro-thiazoio(4,5-h]quinazoiin-2-yl)-amide]

To imidazole- 1-carboxylic acid (8-diethyiamino-4,5-dihydro-thtazolo{4,5-h]quinazo!in-2-yl)- amide (Intermediate C₁ 17 mg, 0.046 mmol) in DMF (0.4 mL) was added (2S,4S)-4-fluoro- pyrrolidine-2-carboxylic acid amide (Intermediate N, Θ.08 mg, 0.046 mmol) and

triethyiamine (0.019 mL, 0.138 mmol). The RM was stirred at 40 "C for 17 h and then directly purified by preparative HPLC (method 8). The product containing fractions were eluted through a Bond Eiut - SCX cartridge. The cartridge was then efuted with a 7 M solution of ammonia in MeOH and evaporated to give the title compound as a yellow solid. HPLC: t_ft 3.55 min (method D). MS: M+H = 434.1.

Example 18: (IS.δRJ-Σ-Aza-bicydo^. i.OJhexane-i ^-dicarboxylic acid 1-amide 2~[(8-tert- butyl-4,5-dihydro-thiazolo[4,5-h]quinazolin-2-yl)-amide] - 68 -

{1S,5R)-2-Aza-bfcyc!o[3.1.0]hexane-1-carboxyfic acid amide (Intermediate O, 208 mg, 1.65 mroof) was added to a stirred mixture of imidazole- 1-carboxylic acid (8-tert-butyi-4,5-dihydro- thiazoio^δ-hjquinazolin-a-yO-amide (Intermediate A. 532 mg, 1.5 mmol) and tπethyfamine {0.627 ml, 4.50 mmol) in DMF {4 mL) at rt. After 56 and 80 hours additional portions of

(1S,5R)-2-aza-bicyclo[3.1.0]hexane-1-carboxylic acid amide (Intermediate O, 104 mg, 0.825 mmol) were added and the RM stood 18 h at rt. The RM was then filtered through a PTFE membrane and purified by preparative HPLC (method B). The product containing fractions were eiuted through a Bond Eiut - SCX cartridge. The cartridge was then eiuted with 7 M ammonia-soiution in MeOH and evaporated. The residue was purified for a second time by preparative HPLC (method B) and isolated in the same manner. The crude product was then recrystailised from a 1 :1 mixtre of water / MeOH to give the title compound as a yellow crystalline solid. LCMS t_R 1.22 mtn and M+H = 413.1 (method A3). ¹H-NMR <d_e-DMSO, 400 MHz): 11.22 (s, 1H), 8.40 (s, 1 H); 7.33 (s, br, 1H); 7.05 (s, br, 1H); 3.97 - 3.84 (m, 1H); 3.64 - 3.52 (m, 1H); 3.01- 2.83 (m. 4H); 2.28 - 2.13 (m. 1H), 1 95 - 1.74 (m, 3H); 1.33 {β, 9H); 1.04 - 0.97 (m. 1H)).

Example 19: (1S,5R)~2-Aza-bicyclo[3.1.0]hexane-1 ,2-dicarboxylic acid 1-amide 2-[(8- diethySamino~4,5-dihydro-thiazolo[4₍5-h}quinazolin-2-yl)-amtde3

To imidazole-1-carboxyiic acid {8-diethy}amino-4_r5-dihydro-thiazolo[4,5~h3qutnazoliπ-2-yl)- amide (Intermediate C. 75 mg, 0.203 mmol) in DCM (2 mL) was added (1S,5R)-2-aza- bicyc!of3.1.03hexane-1-carboxylic acid amide {intermediate O₁ 38.4 mg, 0.305 mmol) and triethylamine (0.085 mL, 0.609 mmol). The RM was stirred at 40 °C for 17.5 h and then directly purified by preparative HPLC {method B). The product containing fractions were eiuted through a Bond Elut - SCX cartridge. The cartridge was then eiuted with a 7 M solution of ammonia in MeOH and evaporated to give the title compound as a yeiiow solid. HPLC: t_R 3.73 min (method D). MS. M+H = 428.1. - 69 -

Example 20: (2S,3R)-3-MethyJ-pyrroiidine-1,2-dicarboxytic add 2-amide 1-((8-tert-butyl-4,5- dihydro-thiazoio[4_;5-h]quinazolin-2-yl)-arnide]

To imidazole- 1-carboxylic acid (8-tert-butyf-4,5-dihydro-thiazolo[4,5-h]quinazolin-2-y!)-amide (Intermediate A, 60 mg, 0.169 mmol) in DMF (1 mL) was added (2S,3R)-3~methyi- pyrrolidine-2-carboxylic acid amide (Intermediate P, 32.5 mg, 0.254 mmol) and tπethylamine (0.071 mL, 0.508 mmoJ). The RM was stirred under argon for 2 h at rt and then directly purified by preparative HPLC (method B). The CH₃CN was evaporated from the product containing fractions and the remaining liquid then eluted through a Bond Elυt - SCX cartridge. The cartridge was then eluted with a 7 M solution of ammonia in MeOH and evaporated. The residue was triturated in methanol and the title compound collected as white crystals following filtration and drying. HPLC: t_R 3.66 (method D). MS: M+H = 415.1. 1H-NMR (CD₃OD₁ 600 MHz): 7.96 (S, 1H), 4.04 (d, IH), 3.47 (t_r 1H), 3.18 (q, 1H), 2.71 - 2.67 (m. 2H), 2.64 - 2.58 (m, 2H). 2.24 - 2.15 (m, 1H), 1.76 (s, br, 1 H), 1.53 (s, br, 1H), 1.03 (s, 9H)₁ 0.78 <d, 3H).

Example 21 : (2S,3R)-3-Methyi-pyrrofidine-1 ,2-dicarboxylic acid 2-amide 1-((8-diethyiamino- 4.5-dihydro-thiazoio[4,5-h]quinazolin~2~yl)-amide]

To imidazole-1-carboxyiic acid (8~diethylamino-4,5-dihydro-thiazoio[4,5-h]quinazofin-2-yl}- amide (Intermediate C, 82 mg, 0.222 mmol) in DMF (1.5 mL) was added under argon (2S,3R)-3-methyl-pyrro!idine-2-carboxylic acid amide (intermediate P. 42.7 mg, 0 333 mmol) and tπethylamine (0.093 mL, 0.666 mmol). The RM was stirred at rt for 2 h and then directly purified by preparative HPLC (method B). The CH₃CN was removed under vacuum from the product containing fractions and the remaining solution then efuted through a Bond Efut - SCX cartridge. The cartridge was then eluted with a 7 M ammonia solution in MeOH. evaporated and the residue triturated with methanol to give the title compound as a white crystalline sofid. HPLC: t_R 3.74 (method D) MS: M+H = 430.1. ¹H-NMR (CD₃OD, 600 MHz): - 70 -

7.62 (s, 1H), 4.03 (d, 1H)₁ 3.46 (t, 1 H)₁ 3.26 (q, 4H). 3.17 (q. 1 H)₁ 2.54 (s, 4H), 2.24 - 2.15 (rn, 1H)_: 1.80 - 1.72 (m. 1H)₁ 1.58 - 1.47 (m. 1H), 0.83 (t, 6H), 0.77 (d. 3H).

Example 22: (2S,4S)-4-Dtmethylamino-pyrrolidfne-1 ,2-dlcarboxylic acid 2-amide 1-[(8- diethylamino-4,5-dfhydro-thiazoio[4,5-h3quinazolin-2~yl)-amide]

To imidazole-1-carboxyiic acid (8-diethylamino-4,5-dihydro~thiazolo[4,5-h3quinazolin-2-yl)- amide (Intermediate C, 60 mg, 0.162 mmol) in DMF (1.5 mL) was added (2S,4S)-4- dimethylamino-pyrrolidιne-2-carboxylic acid amide (Intermediate Q, 28.1 mg, 0.179 mmol) and triethylamine (0.068 mL. 0.487 mmoi)- The RM was stirred at 40 ⁰C for 17 h and then directly purified by preparative HPLC (method B). The product containing fractions were passed through a Bond Elut - SCX cartridge. The cartridge was then eluted with a 7 M ammonia solution in MeOH. The solution was evaporated to give the title compound. HPLC; t_R 3.23 min (method D). MS; M+H = 459.1.

Example 23: 5-Phenyl-pyπOiidine-1,2-dicarboxyi*c acid 2-amide 1~[(8-diethylamino-4,5- df hyd ra-thiazolo[4 , 5-hjq uinazof in~2-y l)-amide 3

To a suspension of imidazole-1-carboxylic acid (8-diethylamiπo-4,5-dihydro-thtazolo[4,5- h3quinazolin-2-yl)-amide (Intermediate C, 65 mg, 0.176 mmol) In DMF (2 mL) were added 5- phenyl-pyrrolidine-2-carboxylic acid amide (prepared as described in patent US 3164597.

Example 42, 50.2 mg, 0.264 mmoi) and triethylamine (0.074 mL, 0.528 mmol). The RM was stirred at 40 ⁰C for 2 h and then directiy purified by preparative HPLC (method B). The product containing fractions were passed through a Bond Elut - SCX cartridge. The cartridge was then eluted with a 7 M ammonia solution in WIeOH. The solution was evaporated and the residue was triturated in DCM to give the title compound as a yellow solid. LCMS: t« 0.99 min and M+H = 492.0 (method A2). Example 24: Azetidine-1,2-dicarboxy!ic acid 2-amide 1-[(8-tert-butyl-4,5-dihydro-thiazolo[4,5- h]qutnazo!in-2-yi)-amide]

To a solution of imidazole- 1-carboxyiic acid (8-tert-butyi-4.5-dihydro-thiazolo[4,5- h]quiπazolin-2-yi)-amide (Intermediate A, 100 mg, 0.282 mmo!) in DMF (2 mL) were added azetidine-2-carboxylic acid amide (56.5 mg, 0.564 mmo!) and triethylamine (0.118 mL, 0.846 mmol). The RM was stirred under argon atm. at rt for 16 h and then directly purified by preparative HPLC (method B), The product containing fractions were passed through a Bond Elυt - SCX cartridge. The cartridge was then eluted with a 7 M ammonia solution in MeOH. The solution was evaporated and the residue purified by Rash chromatography on siiica gei, eluting with DCM / MeOH 95:5 containing 0.5 % 880 HN₃ to give the title compound as a yeiiow solid. HPLC: t_R 3.55 mtn (method D). MS: M+H - 387.1.

Exampie 25: (S)-Azetidine-1.2-dicarboxylic acid 2-amide 1-[(8-tert~butyi-4,5-dihydro- thiazoloH, 5-h]quinazolin-2-yi)-amidej

(S)-Azetidine~2~carboxyiic acid amide (Intermediate L, 68.1 mg, 0.680 mmol} was added to a stirred mixture of imidazoie-1-carboxylic acid {δ-tert-buty^.S-dihydro-thiazoio^S- h]quinazolin-2~yl)-amide (Intermediate A, 241 mg, 0.680 mmol) and triethylamine (0.284 mL, 2.040 mmol) in DMF (3 mL) at rt. The RM was allowed to stand 66 h at rt and then directly purified by preparative HPLC (method B). The product containing fractions were evaporated to remove the CH₃CN and then basified with NaHCO₃. The aqueous phase was then extracted 4X with 10 % MeOH in DCM, the combined organic layers dried over Na₂SO* and evaporated to give a solid which was triturated with MeOH / water to give the title compound as an off-white crystaline solid. LCMS: t_R 1.08 min and M+H = 386.9 (method A3).

Example 26: (2S,4S)-4-Hydroxy-ρyrrotidine-1 ,2-dicarboxy!ic acid 2-amide H(8-diethySamino- 4.5-dihydro-thiazofof4,5-h]quinazoitn-2~yl)-amide3 - 72 -

To a suspension of imidazole- 1-carboxyiic acid (8-diethyiamino-4,5-dihydro-thiazolo[4,5- h]quinazoiin~2-yi)-amide (Intermediate C, 75 mg, 0.203 mmol) in DMF (2 ml_) were added {2S,4S)-4-hydroxy-pyrrotidine-2-carboxylic acid amide (intermediate R, 39.6 mg, 0.305 mmol) and irieihyiamine (0.113 mL, 0.812 mmol). The RM was stirred at 40 ^βC for 2.5 h and then directfy purified by preparative HPLC (method B). The product containing fractions were passed through a Bond Elυt - SCX cartridge. The cartridge was then eluted with a 7 M ammonia solution in MeOH. The solution was evaporated to give the title compound as a yellow solid. HPLC. t_R 3.44 min (method D). MS; M+H = 432.1.

Example 27: (2S,4R)-4-Hydroxy-pyrrolidtne-1.2-dicarboxylic acid 2-amide 1-[(8-dieihylamino- 4,5-dihydro-thiazolo{4,5-h3qutnazolin-2~yi}~amideJ

To a suspension of imidazole- 1-carboxy Hc acid (8-diethyfamino-4,5-dihydro-thiazo!o[4,5- h]quinazoiin~2-yi)~amide (Intermediate C₁ 75 mg. 0.203 mmol} rn DMF (2 mL) were added (2S,4R)-4-hydroxy-pyrrolidine-2-carboxylic acid amide (Intermediate S, 39.6 mg, 0.305 mmol) and triethylamine (0.113 mL. 0.812 mmoi). The RM was stirred at 40 ³C for 4.5 h and then directly purified by preparative HPLC (method B). The product containing fractions were passed through a Bond Elut - SCX cartridge. The cartridge was then eiυted with a 7 W! ammonia solution in MeOH. The solution was evaporated and the residue was recrystaiiised from DCM to give the title compound as a yellow solid. HPLC: t_R 3.31 min (method D). MS: M+H = 432.1.

Example 28: (S)-Pyrrolidine-1 ,2-dicarboxyltc acid 2-amide 1-[(7-tert-butyl-4,5-dihydro- benzo[1 ,2-d;3,4-d']bisthiazol-2-yl}-amide3

- 73 -

L-Proliπamide (59.4 mg, 0.521 mmo!) and TEA (0.121 ml__r 0.868 mmol} were added to imidazoie-i-carboxylic acid ξT-tert-butyl^.S-dihydro-benzoli ^-dia^-d'lbisthjazol^-yO-amide (Intermediate T₁ 156 mg, 0.434 mmol) in DMF (1 mL). The RM was stirred at rt for 10 miπ. The mixture was extracted with EtOAc/H_sO. The organic layer was dried over Na2SO4 and evaporated. The crude material was chromatographied with MPLC C18 H2O 0.1 % TFA / CH₃CN 0.1% TFA, gradient 0-50%. Produci containing fractions were neutralized with NaHCO₃, extracted with EtOAc and iyophiiized from dioxane to give the title compound as a white solid (M+H = 406; M-H = 404; t_R 4.75 min (Method F). ¹H-NMR (d_e-DMSO, 600.13 MHz) 10.80 (S, 1H) 7.40 (s, 1H), 6.98 (s, 1H), 4.30 (S₁ 1H) 3.65-3.55 (m 1H)₁ 3.48-3.38 (m, 1H), 3.10 (t, 2H), 2.94 (t, 2H), 2.14-2.05 (m, 1H), 1.95-1.78 (m, 3H), 1.40 (s, 9H)).

Example 29: {S)-2-Methyl-pyrroffdtne-1,2-dicarboxylic acid 2-amide 1-[(7-terf-butyi-4,5- dthydro-benzo[1,2-d;3,4-d']bisthiazo!-2-yl)-amide3

(S)-2-Methyi-pyrro!idine-2-carboxylic acid amide (Intermediate F, 7.7 mg, 0.060 mmoi) and TEA (0.014 mL, 0.100 mmol) were added to imidazole- 1-carboxy lie acid (7-tert-butyl-4,5- dihydro-benzofi ^-diS^-d'jbfsthiazol^-yO-amide (intermediate T, 18 mg, 0.050 mmol) in DMF (3 mL). The RM was stirred at rt for 10 min. then extracted with EtOAc/H₂O. The organic layer was dried over Na₂SO₄ and evaporated. The crude material was

chromatographied with MPLC C 18 H₂O 0.1 % TFA / CH₃CN 0.1 % TFA₁ gradient 0-50%. Product containing fractions were neutralized with NaHCO₃, extracted with EtOAc and lyophiiized from dioxane to give the title compound as a white solid (M+H - 420; M-H = 418; t_R 4.875 min (Method F). ¹H-NMR (d_θ-DMSO, 600.13 MHz) 10.60 (s, br. 1 H) 7.68 (s, 1H), 6.86 (s, 1H), 3.68-3.60 (m 1H), 3.60-3.50 (m 1 H)₇ 3.08 (t, 2H), 2.90 (t, 2H), 2.10-1.98 (m, 1H), 1.90-1.68 (m, 3H), 1.48 (s, 3H), 1.37 (s, 9H)).

Example 30: (S)-Azetidine"1,2-dicarboxyiic aαd 2-amide 1-[{7-tert-butyl-4,5-dihydro- benzo[1 ,2-d;3_r4-d'jbisthiazol-2-yl)-amide]

- 74 -

(S)-Azetidine-2-carboxyiic acid amide {intermediate L, 37.1 mg. 0.370 mmol) and TEA (0.14 mL, 1.010 mmol) were added to i imidazole- 1-carboxy lie acid (7-tert~butyl~4,5-dihydro- benzop ^-diS^-d'jbisthiazol^-ylJ-amide (Intermediate T, 121 mg, 0.337 mmo!) in DMF (2 mL). The RM was stirred for 5 min and then stood for 2 days at rt. The RM was filtered and directly purified by Prep. HPLC (method E). Product containing fractions were combined and fiitered through a Bond Elute - SCX, 300 mg cartridge. The cartridge was then washed with 7 M ammonia-solution in MeOH (2 ml). The filtrate was evaporated to give the title compound as a white solid (M+H ~ 391.8; M-H * 389.8; t_R 1.84 min (Method A3). ¹H-NMR {de-DMSO, 400 MHz) 11.12 (β, 1H) 7.52 (s, 1H)₁ 7.30 (s, 1H). 4.74*4.62 (m, 1H), 3.92 (t, 2H), 3.08 (t, 2H)₁ 2.90 (t, 2H)₁ 2.46-2.36 (m, 1 H), 2.18-2.02 (m, 1H), 1.39 (s, 9H)).

Example 31: (2S,4R)-4~Dimethy!amino-pyrrolidine~1 ,2-dicarboxylic acid 2-amide 1-[(7-tert~ butyl-4,5-dihydro-benzo{1 ,2-d;3_r4-d^l]bisthiazol-2-yl)-amide3

(2S.4R)-4-Dtmethylamino-pyrroiidine-2-carboxyiic acid amide (Intermediate B, 9.33 mg, 0.059 mmol) and TEA (0.019 ml, 0.135 mmo!) were added to imidazole- 1-carboxylic acid (7- tert-butyM.S-dihydro-benzop ^-djS^-d'Jbisthtazol^-yO-amide (intermediate T. 19.4 mg, 0.054 mmol) in DMF (1 ml).. The RM was stirred for 5 min and then stood overnight at rt. The RM was filtered and directly purified by Prep.HPLC (method E). Fractions containing the product were combined and filtered through a Bond Bute - SCX, 300 mg cartridge. The cartridge was then washed with 7 M ammonia-solution in MeOH. The filtrate was evaporated to give the title compound as a white solid (M+H = 449.1 ; M-H = 447.3; t_R 1.47 min (Method A3). ¹H-NMR (d_e-DMSO, 400 MHz) 7.40 (s, 1H), 7.00 (s, 1H), 4.44-4.25 (m. 1H), 3.86-3.76 (m 1 H), 3.35-3.25 (m 1 H), 3.08 (t, 2H), 2.92 (t, 2H), 2.96-2.78 (m, 1H), 1.18 (s, br, 6H), 2.08-1.85 (m, 2H), 1.38 (s, 9H)).

Example 32: (S)-Pyrrolidine-1 ,2-dicarboxy!ic acid 2-amide 1-{(7-(2-fluoro-1,1-dimethyl-ethy!)- 4_l5-dihydro-benzo[1 ,2-d;3,4~d^rjbtsthia2ol-2~yl]-arrtide} - 75 -

L-Prolinamide {23.98 mg, 0.210 mmot) and TEA (0.080 mL. 0.573 mmol} were added to imidazote-1-carboxylic acid |;7-{2-fluoro-1 ,1-dimethyl-ethyi)-4_l5-dihydro-benzoπ,2~d;3,4- d']bisthiazϋi-2-ylJ-amide (Intermediate U, 72.1 mg, 0.191 mmol) in DMF (1 mL).. The RM was stirred for 5 min and then stood overnight at rt. The RM was evaporated and then triturated with MeOH (2 mL) and H₂O (1 mL). The mixture was cooled to 4 ⁰C. The suspension was filtered and washed with cold MeOH/H₂O=2:1 and the solid dried under HV at 40 ⁰C to give the title compound as a white solid (M+H = 424.0; M-H - 422.1 ; t_R 1.7 min {Method A3). ¹H-NMR (d₈-OMSO, 400MHz) 7.19 (s, 1H), 6.96 (s, 1H), 4.58 (S₁ 1H) 4.44 (β, 1H), 4.28 {s, br, 1H) 3.64-3.50 (m 1H), 3.48-3.38 <m 1H). 3.10 (t, 2H), 2.92 (t, 2H)₁ 2.18- 1.98 (m. 1H), 1.34-1.78 (m, 3H), 1.38 (s, 6H) ¹⁹F-NMR {d6-DMSO, 600.13 MHz) 219ppm (t. 1F)).

Exampie 33: (S)-Py rro!idine-1 ,2-dicarboxyiic acid 2-amide 1-[(7~cyclopropylmethyl-4,5- dιhydro-benzo[1 ,2-d;3,4-d']bisthiazoi-2-yi)-amidej

L-Prolinamide {16.7 mg, 0.147 mmol) and TEA (0.027 mL. 0.196 mmol) were added to imidazole-1-carboxyiic acid (7-cyclopropyimethyl-4,5-dihydro-benzo [1 ,2-:3,4-d']bisthiazoi-2- yi)-amfde (Intermediate V, 35 mg, 0.098 mmol) in DMF (1.5 mL). The RM was stirred at rt for 15 min and then extracted with EtOAc/H₂O. The organic layer was dried over Na₂SO₄ and evaporated. The crude materia! was chromatographied with MPLC C18 H₂O 0.1% TFA / CH₃CN 0.1% TFA₁ gradient 0-50%. Product containing fractions were neutralized with NaHCO₃, extracted with EtOAc and lyophiiized from dioxane to give the title compound as a white solid (M+H ~ 404; M-H - 402; t_R 4.49 min (Method F). ¹H-NMR (d_e-DMSO, 600.13 MHz) 10.78 (S, 1H) 7.40 (S, 1H), 6.98 (s, 1H), 4.28 (s, br. 1H) 3.65-3.55 (m. 1H)₁ 3.48-3.38 (m, 1H)₁ 3.08 (t, 2H), 2.97 (t, 2H). 2.84 (d, 2H)₁ 2.14-2.04 (m, 1H), 1.93-1.72 (m, 3H), 1.10 (q, 1H), 0.60-0.50 (m, 2H), 0.40-0.38 (m. 2H)). - 76 -

Examole 34: (2S,3S)-3-Methyl-pyrrolidine-1 ,2-dicarboxylic acicl 2-amide 1 ~[(7-tert-buty 1-4,5- djhydro-benzoti ^-d^^-d'jbisthiazot^-ylj-arnide]

(2S,3S)-3-Methyl-pyrrolidine-2-carboxyiic acid amide (Intermediate D, 13.37 mg, 0.104 mmol) and TEA (0.039 mL 0.278 mmoi) were added to imidazole- 1 -cart oxy lie acid (7-tert- butyi-4,5-dihydro-benzoi;i ,2-d;3,4-d']bisthiazot-2-y!)-amide (Intermediate T, 25 mg, 0.070 mmol) in DMF {2 mL). The RM was stirred at rt for 10 min and then extracted with

EtOAc/H₂O. The organic layer was dried over Na_sSO^ and evaporated. The crude material was lyophilized from dioxane without further purification to give the title compound as a white solid (M+H = 420.1 ; M-H = 418.1 ; t_R 4.85 min (Method F). ¹H-NMR (d_e-DMSO, 600.13 MHz) 10.78 (S, br. 1H) 7.44 (s. br, 1H), 6.97 (s, br. 1H)₁ 3.90-3.70 (m. 1H) 3.62-3.42 (m, 2H)₁ 3.08 (t, 2H), 2.94 (t, 2H)₁ 2.22-2.12 (m. 1H), 2.06-1.94 (m. 1H), 1.58-1.48 (m, 1 H), 1.39 (s, 9H)₁ 1.04 (d, 3H)). Example 35: (1S,5R)-2-Aza-bicyclop.1.0]hexane-1 ,2~dicarboxylic acid 1-amide 2-[(7-tert- butyi-4,5-dihydro-benzot1,2-d;3_!4-d']bisthiazol-2-yi)-amide]

The titie compound was synthesized in a similar manner as described for Example 34 using intermediate O instead of intermediate D.

(M+H ~ 418.0; M-H = 416.1 ; t_R 4.90 min (Method F). ¹H-NMR (de-DMSO, 600.13 MHz)

10.78 (s, br. 1 H) 7.40 (s, br, 1H), 7.06 (S₁ br, 1H), 3.92-3.82 (m, 1H) 3.62-3.52 (m, 1H), 3.08 (t. 2H), 2.94 (t, 2H), 2.26-2.14 (m. 1H), 1.92-1.72 <m, 3H)₁ 1.39 (s, 9H), 1.05-0.95 <m_: 1 H)).

Example 36: (2S,3S}-3-(Acetyiamino-methyl)-pyrro}idine-i ,2-dicarboxy!fc acid 2-amide 1-[{8- tert-buty}-4,5-dihydro-thiazoJo[4,5-h}quinazoiin-2-yl)-amide] - 77 -

Triethylamine (0.339 mmol) was added to a solution of imidazole- 1-carboxylic acid (8-tert- buty!-4,5-dihydro-thiazoiot4,5-h3quina2θiin-2-yt)-amide (intermediate A) (0.113 mmot) and (2S,3S)-3-(aoetylamino-methyl)-pyrrofidiπe-2-carboxyiic acid amide (Stage 36.1) (0.135 mmol} at rt. After stirring for 85 min, the reaction mixture was concentrated. The residue was purified by silica gel column chromatography followed by trituration with Et₂O to afford the title compound as a yellow solid. HPLC-. t_R - 4.20 min (method H); LCMS: t_R= 1.48 rrtin, IM+Hf 472 (method I); TLC: R_f = 0.14 (9:1 CH₂CI₂ZMeOH); ¹H-NMR (d₆-DMSO, 600 MHz): 11.15 (br s, 1H), 8 41 (S, 1H)₁ 7.81 (br s, 1H), 7.53 (br s, IH)₁ 7.13 (br s, 1H), 4.28 (m. 1H), 3.74 (m, 1H)₁ 3.40 (m, 1 H), 3.25 (m, 1H), 2.98 (m, 2H), 2.93 (m, 3H)_r 2.42 (m, 1H), 2.02 (m, 1H)₁ 1.82 (s. 3H)₁ 1.74 (m, 1H)₁ 1.33 (s, 9H).

Stage 36.1 : (2S,3S)-3-(Acetylamino-methyl)-pyrrolidfne-2-carboxyiic acid amide

A mixture of (2S₁3S)-3-(aceiylarnino-methyl)-1 -((S)- 1 -pheny!-ethyi)-pyrrolidine-2~carboxyl!c acid amide (Stage 36,2) (0.48 mmol) and 10% Pd on charcoal, wet with 50% H2O (Aldrich 330108) (0.096 mmol) in MeOH (5 mL) was hydrogenated for 6.5 h at rt. The reaction mixture was then filtered through a Fiuoropore Membrane Filter (0.2 μm FG) and

evaporated. The residue was dissolved in CH₂CI_? and evaporated to dryness to afford the title compound as an off-white solid. ESI-MS: [M+HJ⁺ 186; TLC: R, ~ 0.08 (200:20: 1

CH₂CI₂/MeOH/conc. NH₄OH).

Stage 36.2: {2S.3S)-3-fAcetviamino-methvπ-1-((S)-1"phenvl-ethvl)-pyrroiidine-2-carboxvlic acid amide

- 78 -

Thioacetic acid {2.312 mmol) was added to (2S,3S)-3-azidomethyi-1-((S)-1-phenyl-ethyi)- pyrroJidine-2-carboxylic acid amide (Stage 36.3) (0.578 mmol) at rt with the formation of nitrogen gas. After stirring for 16 h, the reaction mixture was diluted with Et₂O, the solids were removed by filtration and the filtrate was concentrated. The residue was purified by siiica gel column chromatography to afford the title compound as a iight yellow oil (thiol odor). HPLC: fe = 3.71 min (method H); LC-MS: t_R- 0.64 rnin, [M+H]⁺ 290 (method I); TLC: R_f ~ 0.38 (200-20 1 CH₃CI₂/MeOH/conc. JNHOH).

Stage 36.3: (2S,3S)-3-AzidomethyM-((S)-1-phenyl-ethyl)-pyπOlidine-2-carboxylic acid amide

Trimetnyialuminum in toluene (2 M, 15.95 mmol) was added dropwise to a mixture of NH_nCI (15.95 mmol) in toluene (2 mL) at 0 ⁰C with the formation of methane gas. The reaction mixture was aliowed to warm to it stirred for a further 15 min and then slowly treated with a solution of (2S.3S)-3-a2idomethyl~1-((S)-1-phenyt-ethy!)-pyrro!idine-2-carboxyKc acid methyl ester (Stage 36.4) (7.98 mmo!) in toluene (8 mL) Additional reagent prepared from NK.CI (15.95 mmof) in toluene (2 mL) and trimethylafuminurn in toiuene (2 M. 15.95 mmoi) at 0⁰C was added after 18 h. After stirring for 44 h, the mixture was cooled to 0^cC, quenched with 1M HCi and then washed with CH₂CI₂ (3X). The aqueous phase was basified with a 1:1 saturated solution of NaHCO₃/saturated solution of Rochefle's salt and extracted with THF (10X). The combined organic layers were dried (Na₂SO₄), filtered and concentrated. The residue was purified using a RediSep^® silica gel column to afford the title compound as a yellow oil. HPLC: t_R = 2.50 min (method G); ESI-MS: [M+H]⁺ 274; TLC- R, * 0.26 (3:1 Hex/EtOAc). Stage 36.4: (2S,3S)-3-Azidomethyt-1-((S)-1 -phenyl-ethylj-pyrrolidine^-carboxylic actd methyl ester

- 79 -

Sodiυm azide (5.34 mmof) was added to a solution of (2S,3R)-3-iodomethyl-1-((S)~1 -phenyl- ethyi)-pyrrolidine~2-carboxy!ic acid methyl ester (Stage 36.5) (3.56 mmol) in DMF (30 mL) at rt. After 18 h, the reaction mixture was poured onto water and extracted with MTBE (2X). The combined organic phases were washed with brine, dried (Na₅SO₄), filtered and concentrated. The residue was purified using a RediSep^® silica gei column to to afford the title compound as a brown oil HPtC: t_R = 3.26 min (method G); ESI-MS; (M+H]^* 289.

Stage 36.5: (2S_!3R)-3-lodomethy!-1-((S)-1-phenyl-ethyl)-pyrrolidine-2-carboxyftc acid methy! ester

A solution of [but-3-enyl-((S)-1-phenyl~ethyl)-amtnoJ-acetic acid methyl ester (432555-77-6] (20.22 mmol) tn THF (10 mL) was slowly added to a soiutson of lithium diisoprσpylamtde (24.26 mmol) in 1:2 hexanes/THF {30 mL) at -78°C. The reaction mixture was warmed to 0^βC, stirred for 1 h and then re-cooled to -78°C. A solution of zinc bromide (50.5 mmoi) in Et₂O (40 mL) was added and the reaction mixture was then warmed to rt. After stirring for 1 h, the mixture was cooled to OX and iodine (22.24 mmol) was added in portions. The reaction mixture was stirred at 0⁰C for 2 h and at rt for another 2 h, diluted with Et₂O and then successively washed with a saturated solution of Na₂S₂O₃ and a saturated solution of NHΛC!. The aqueous layers were each back-extracted with Et₂O. The combined organic phases were dried (Na₂SO₄), filtered and concentrated. The residue was purified by silica gel column chromatography to afford the title compound as a red oii. HPLC: t_R = 3.46 min (method G); ESl-MS: IM+H]^*374.

Example 37: (2S,3S)-3-Morpholin-4-yimethyl-ρyrrolidine-1,2-dicarboxylic acid 2-amide 1~[(8- tert-buiyl-4,5-dihydro-thiazolo[4,5-h3qutnazolfn-2-y0-amide3

Triethylamine (0.423 mmol) was added to a solution of imidazole- 1-carboxylic acid {B-tert- butyi-4,5-dthydro-thiazolo[4,5-h]quinazolin-2-yl)-amide (intermediate A) (0.141 mmol) and - 80 -

(2S₁3S)-3-(acetytamino-methyl)-pyrrolidine-2-carboxylic acid amide (Stage 37.1) (0.155 mmol) in DMF (0.5 mL) at it After sttrππg for 3 h, the reaction mixture was concentrated. The residue was purified by silica ge! column chromatography to afford the title compound as a white solid. HPLC: t_R = 4.04 min (method H); LCMS: t_ft= 1.36 min, FjVH-H]⁺ 500 (method f); TLC: R, ~ 0.09 (19.1 CH₂Ci₂/Me0H); ¹H-NMR (d₆-DMSO, 600 MHz)-. 11 15 (br β. 1 H), 8 39 (m, 1 H)₁ 7.37 (br s, 1 H), 7.05 (s, 1 H)₁ 4.27 (m, 1H). 3.70 (m, 1H), 3.59 (m. 4H), 3.42 (m, 1H), 2.97 (m, 2H)₁ 2.90 (m, 2H), 2.58 (m, 1H)₁ 2.38 (m, 4H), 2.35 (m, 1H)₁ 2.17 (m, 1H)₁ 2.02 (m, IH), 1.75 (m, 1 H)₁ 1.32 (s, 9H). Stage 37.1 : <2S.3S)-3-Morphoiin-4-ylmethyt-pyrrolidine-2-carboxylic acid amide

A mixture of (2S,3S)-3-morphoiin-4-y!methyi-1-((S)-1-phenyl-ethyl)-pyrrolidine-2-carboxyltc acid amide (Stage 37.2) (1 046 mmol) and 10% Pa on charcoal wet with 50% H2O {Aldπch 330108) (0.105 mmol) in MeOH (5 mL) was hydrogenated for 6.5 h at it The reaction mixture was then filtered through a Fluoropore Membrane Filter {0.2 μm FG) and

evaporated. The residue was dissolved in CH₂CI₂ and evaporated to dryness to afford the title compound as colorless oii. ESI-MS: [M+Hf 214; TLC: R_f - 0.14 (200:20:1

CHaCyMeOH/conc. NH₄OH).

Stage 37.2: f2S.3S)-3-lv1orphoiin-4-vlmethvl-1-f(S)-1-phenyl-ethyl)-pyrrolidine-2-carboxylic acid amide

Trimethylaluminum in toluene (2 M₁ 2.89 mmol) was added dropwise to a mixture of NH₄CI (2.89 mmoi) in toiuene (3 mL) at 0 ⁰C with the formation of methane gas. The reaction mixture was allowed to warm to rt, stirred for a further 15 min and then sfowly treated with a solution of (2S,3S)-3-morpholin-4-yimethyi-1-((S)-1-phenyl-ethyl)-pyrrolidine-2-carboxylic acid methyl ester (Stage 37.3) (1.444 mmol) in toluene {9 mL). Additional reagent prepared from NH₄CI (2.89 rnmol) in toluene (2 mL) and trimethylaJuminum in toluene (2 M, 2 89 mmol) at O^βC was added after 18 h. After stirring for 60 h, the mixture was cooled to O⁰C₁ quenched with 1M HCI and then washed with CH₂C)₂ (3X). The aqueous phase was basified with a 1:1 saturated solution of NaHCO₃/saturated solution of Rochelfe's salt and extracted with THF (10X). The combined organic layers were dried (Na₂SCX_t), filtered and

concentrated. The residue was purified by silica gel column chromatography to afford the title compound as a yellow oil. HPLC: t_R - 2.18 min (method G); ESI-MS; [M+H]⁺ 318.

StaaeJZJ: (2S,3S}-3-Morpholin-4-ylmethyi-1 -((S)- 1 ~phenyl-ethyl)-pyrroltdine-2-carboxy!ic acid methyl ester

A mixture of(2S_l3R)-3-iodomethy}-1-((S)-1-phenyi-ethyl)-pyrroiidfne-2-carboxylic acid methyl ester {Stage 36.S) (7.07 mmoi), K₂CO₃ (21.22 mmol) and morphoiine {10.61 mmol} in CH₃CN (24 mL) was stirred at 50⁰C for 62 h. The reaction mixture was poured onto ice water and extracted with EtOAc (3X). The combined organic layers were successively washed with water and brine, dried (Na₂SO₄), filtered and concentrated. The residue was purified using a RediSep^® silica gel column to afford the title compound as a yellow oil. HPLC: t_R = 2.56 min (method G); ESI-MS. [M+HJ⁺ 333. Example 38: (2S,3R)-3-Hydroxy-pyrrolidine-1.2-dicarboxy!ic acid 2-amide 1-[{8-tert-butyi-4,5- dihydro-thiazolo[4,5-h]quinazolin-2-yf)-amide]

The title compound was synthesized using methodology as described for Exampie 20 using (2S,3R)-3-hydroxy-pyrrolidine-2-carboxylic acid amide (H. Fukushima et al. Bioorg. Med. Chem. 2004_; 12, 6053; H. Ji et al. J Med. Chem. 2006, 49(21), 6254) instead of

intermediate P. - 82 -

LCMS: t_R - 1.45 min, M+H - 417.0, M-H = 415 (method J). ¹H-NMR (Cf₀-DMSO₁ 600.13 MHz): 12-11 (s, br, 1H) 8.4 (s, 1H), 7.2-6.9 (m, 2H)₁ 5.2 (s, 1H)₁ 4.4 (s, 1H). 4.25 <s, br. 1H), 3.6 <m, 1H); 3.45 {m, 1H), 2.95 (m. 2H)₁ 2.9 (m, 2H), 2.0 (m, 1H), 1.9 (m. 1H), 1.3 (s. 9H).

Exampie 39: (2S,3R)-3-Methyl-pyrrotidine-1,2-dicarboxy!Jc acid 2-amide 1-[(7-tert-butyl-4,5- dihydro-benzop^-d.S^-d'Jbisthiazoi^-ylJ-amide]

The title compound was synthesized using methodology as described for Example 34 using (2S,3R)-3-methy!-pyrrotfdine-2~carboxyiic acid amide (intermediate P) instead of

intermediate O.

LCMS: t_R = 1.32 min, M+H = 420.0, M-H = 418.1 (method J). ¹H-NMR (dβ-DMSO, 400 MHz): 1065 {s, br. 1H) 7.39 (s, br. 1H)₁ 6.99 (s, br. 1H), 4.2 (m, 1H), 3.67 (t, 1H)₁ 3.3 (m, 1H)₁ 3.08 (t, 2H). 2.93 (t. 2H). 2.38 (m, 1H), 1.95 (m. 1H), 1.7 (m, 1 H)₁ 1.39 {s, 9H), 0.97 {d 3H). Synthesis scheme:

- 83 -

Example 40: <2S,3R)-3-Methy!-pyrroiidine~1 ,2-dicarboxylic acid 2-amide 1~[{8-methyl-4H-5- oxa-14hia-3,7<liaza-cyclopenta{a]naphthaten-2-yl)-amide]

The title compound was prepared starting from imidazoie-1-carboxySic acid (8-methyl-4H-5- oxa~1-thia-3,7-diaza-cyciopenta[a]naphthaien-2-yl)-arnide (Stage 40.1) using synthetic methodology described in the preparation of Example 20.

LCMS: t_R = 0.29 min, M+H = 374.0, M-H = 372 (method J). ¹H-NMR 1 H-NMR (CD₃OD, 400 MHz): 7.9 {s, 1H), 7.0 (s, 1H). 5.27 (s. 2H), 4.38 (d, 1H), 3.8 (άά, 1H). 3.5 {m, 1H), 2.5 (m, 1H), 2.4 (s_: 1H). 2 08 <m, 1 H)₁ 1.95 (m, 1H), 1.12 (d, 3H).

Stage 40.1 : imidazoie-i-carboxylic acid (8-methyi-4H-5-oxa-1-thia-3,7-diaza~

cyciopenfca[a]naphthalen~2-yi)-amide

lmidazole-1-carboxyiic acid (8-methyi-4H-5-oxa-1-thia~3.7-diaza-cyclopenta[a}naphlhalen~2~ yl)-amide was prepared from N-(8-methyt-4H-5-oxa-1~thia-3,7-diaza- cyclopenta[a3naρhthalert-2-yl)-acetamide (Stage 40.2) using synthetic methodology as described for the preparation of intermediate A. Stage 40.2: N-(8-methyl-4H-5-oxa- 1 -thia-3_!7-dtaza-cyc!opentafa]naρhthalen-2-y!)-acetamide

A mixture of 463 mg (1.53 mmol) N-[4-{4-bromo-6-methyi-pyridin-3-yioxymethyl)-thiazol-2- yi]-acetamide (Stage 40.3), 900 mg (2.71 mmol) cesium carbonate, 30.4 mg (0.135 mmol) palladium acetate and 81 mg (0.271 mmol) tributylphosphine tetrafluoroborate in 3 mL DMF was stirred at 115°C for 7 h under argon. Then the reaction mixture was poured onto water, EtOAc was added and, after filtration over a layer of Hyflo Super Gel medium (Fluka 56678), the filtrate was extracted with EtOAc (2X). The combined organic layers were washed with - 84 - water and brine, dried (MgSO,,) and filtered. The filtrate was concentrated in vacuo to leave a residue that was purified on silica gel (~~100% EtOAc in heptane) to afford 93 mg of the title compound as a solid. LCMS: t_R = 0.27 miπ, M+H - 262, M-H 260 (method J). Stage 40.3: N-[4-(4-Bromo-6-methyl-pyridin-3-yloxymethyl)-thia2θi-2-yl)-acetamtde

To a solution of 270 mg (1.44 mmoi) 4-bromo-6-methyl-pyridin-3-oi (Stage 40.4) in DMF (5 mL), 44.8 mg NaH {1.87 mmol) was added and this mixture was stirred for 1 h at it 301 mg (1.58 mmol) 2~acetamido-4-(chloromethyl)-1,3-thiazoie (Apoflo ORI 5549) was added and stirring was continued at rt for another 17 h. The reaction mixture was poured on water and extracted with EtOAc (2X). The combined organic layers were washed with water and brine, dried (MgSO₄) and filtered. The filtrate was concentrated in vacuo to leave 350 mg of the title compound (white solid) considered sufficiently pure without further purification. LCMS: t_R « 1.36 min, M+H = 342 (⁷⁶Br), 344 (^9fBr) (method J).

Stage 40.4: 4-Bromo-6-methyl-pyπdin-3-ol

920 mg {3.05 mmol) 4-bromα-5-methoxymethoxy-2-methyl~pyridine (Stage 40.5) were dissolved in 5 mL MeOH, HC? cone. (1 mL, 12 mmol) was added and the reaction mixture was stirred for 2 h at rt. While concentrating the mixture in vacuo, the title compound (as hydrochloride) crystallized. Filtration afforded 570 mg white crystals. ¹H-NMR (d₆-DMSO, 400 MHz): 8.1S (s, 1H), 8.04 (s, 1H), 2.53 (s, 3H).

Staoe 40.5: 4- Bromo-5-methoxy methox y-2 -methyl-py rid i ne

A solution of 1000 mg {6.53 mmoi) 5-methoxymethoxy-2-methyl-pyridine {J.-P. Behr et at. Bioorg. Med. Chem. Lett. 2003, 13(10), 1713) in 10 mL THF was cooled to -78⁰C, where - 85 -

4.03 mL (6.85 mmol) t-BuLi (1 7M solution tπ pentane) was added. The resulting mixture was stirred under argon for 1 h, then 2.126 g (6.53 mmol) 1,2-dtbromotetrachioroeihane (in 5 mL THF) was added. Stirring was continued for 1 h at -78⁰C and the reaction mixture was warmed to rt. Saturated NH₄Ci solution was added and the aqueous mixture was extracted with EtOAc (2X). The combined organic layers were washed with H₂O and brine, dried (MgSO₄) and filtered. The filtrate was concentrated in vacuo to leave a residue that was purified on siiica gel (EtOAc / hexane = 1:1) to afford 920 mg of the title compound as an oil. LCMS: t_R - 0.29 min, M+H * 232 (⁷⁹Br), 234 (⁸¹Br) (method J). Example 41: (2S,3S)-3-Moφholin-4-ylmethyl-pyrrolidine-1,2-dicarboxylic acid 2-amide 1 -[(T- tert-butyl^.S-dihydro-benzofi ^-d^^-d'jbisthiazol^-yO-amidej

The title compound was synthesized using methodology as described for Example 34 using (2S_>3S)-3-moφhoiin-4-ylmethyl-pyrrol»dine-2-carboxylic acid amide (Stage 37.1) instead of intermediate D.

LCMS: t_R ^« 0.68 min, M+H = 505.3.0, M-H ~ 503.2 (method J). ¹H-NMR (d_e-DMSO, 600.13 MHz): 10.65 (s, b. 1H), 7.4 (s. b, 1H), 7.05 (s, b, 1H), 4 3 (s, b, 1H), 3.7 (m, 1 H)₁ 3.6 (m, 4H), 3.3 (m, 1H), 3.1 (t. 2H), 2.9 (t, 2H), 2.6 (m, 1 H), 2.4 (m, 1H)₁ 2.35 (m. 4H), 2.15 (m, 1H), 2.0 (m, 1H), 1.75 (m, 1H), 1.35 (s, 9H).

Example 42: (2S,3R)-3-Methoxymethyl-pyrrolidrne-1,2-dicarboxylic acid 2-amide 1-[(8-tert- butyl-4,5-dihydro-thtazoio[4,5-h]quina2θlin-2-yl)-amide}

Triethylamine (0.525 mmoi) was added to a solution of imidazoles -carboxylic acid (8-tert- butyl-4,5-dihydro-thiazolo[4,5~h}quinazolin-2-yl)-amide (Intermediate A) (0.175 mmol) and (aS.SRJ-S-methoxymethyl-pyrrolidine^-carboxyiic acid amide (Stage 42.1) (0.192 mmol) in DMF (0.7 mL) at rt. After stirring for 3 h, the reaction mixture was concentrated. The residue - 86 - was purified by silica gel column chromatography to afford the title compound as a white solid. HPLC: t_ft ~ 2.84 min (method G); LCMS: t_R= 1.71 min, [M+H)⁺445 {method I); TLC: R_f = 0.41 (19:1 CH₂CyMeOH); ¹H-NMR (d_ε-DMSO, 600 MHz): 11.15 (br s, 1H)₁ 8.40 (8, 1 H), 7.42 (br s, 1H), 7.05 (br s, 1H)₁ 4.27 (m, 1H), 3.74 (m, 1H), 3.46 (m, 1H), 3.42 (m, 1H)₁ 3.24 (S, 3H)₁ 3.16 {m, 1H). 2.98 {m, 2H)₁ 2.91 (m, 2H), 2.54 (m. 1H), 2.03 (m, 1H), 1.77 (m, 1 H), 1.32 (s, 9H).

Stage 42. V. (2S,3R)-3-Methoxymethyl-pyrroNdine-2-carboxylic acid amide

The title compound was prepared in analogy to the procedure described in Stage 37 1 but (2S,3R)-3-methoxymethy!-1 -((S)- 1 -phenyl-ethyl)-pyrroiidine-2-carboxylic acid amide

(Stage 42.2) was used instead of (2S,3S)-3-morpholin-4-yimethy]-1-{{S)-1-phenyl~ethy!)~ pyrrolidine-2-carboxyiic acid amide.

The title compound was obtained as a white solid. ESi-MS: [M+H]⁺ 159.

Staoe 42.2: (2S_!3R)-3~Methoxymethyl-1 -((S)- 1-pheπyl-eihyl) -pyrrol idine-2-carboxyiic acid amide

The title compound was prepared in analogy to the procedure described in Stage 37.2 but {2S,3R)-3-methoxymethyl-1-({S)-1-phenyi-ethyl)~pyrrolidine-2-carboxylic acid methy! ester

{Stage 42.3) was used instead of {2S,3S)-3-morpholin^-ylmethyi-1-((S)-1-phenyl-ethyl}- pyrroiidine-2-carboxylic acid methyl ester.

The title compound was obtained as a yellow oil. HPLC- t_R = 2.35 mm {method G); LC-MS: t_H~ 0.47 min, [M+Hf 263 {method K); TLC" R, = 0.05 (1 :1 Heptanes/EtOAc).

Stage 42.3: {2S,3R)-3-Methoxymethyi-1-{{S)-1 -pheny{~ethyl)-pyrro}idine~2-carboxylic acid methyl ester - 87 -

A mixture of (3aR_:6aS)-1-((S)-1-phenyl-ethyl)-hexahydro-furo[3,4-b]pyrrol-6-one [805246-48- 4] {17.05 mmoi), KOH (71.60 mmoi) and iodomethane (68.20 mmot) in toluene {79 mL) was stirred at 80⁰C for 1.5 h. The reaction mixture was cooled to rt and partitioned between water and MTBE. The aqueous layer was extracted with MTBE (3X). The combined organic Jayers were dried (Na_KSO₄), filtered and concentrated. The residue was purified by silica gel column chromatography to afford the titie compound as a yellow oil. HPLC: t_R = 2.98 min (method G); LC-MS: t_R= 0.69 miπ, [M+Hj⁺ 278 (method K); TLC: R_f = 0.25 (1 :3 Heptanes/EtOAc). Example 43: (2S,3S)-3-Dimethylaminomethyl-pyrrolidfπe-1 ,2-dicarboxyfic add 2-amide 1-1(8- tert-butyl-4₎5-dihydro-thiazolo[4,5-h]quina2θfiπ-2-yl)-amide]

Trieihyiamine {0.305 mmoi) was added to a solution of imidazole-1-carboxylic acid (8-tert- butyM,5-dihydro-thtazolo[4,5-h]quinazobn-2-yl)-amide (Intermediate A) {0.102 mmol) and (2S.3S)-3-dfmethylaminomethy1-pyrro!idine-2~carboxylic acid amide {Stage 43.1 ) (0.102 mmoi) in DMF (0.3 mL) at rt. After stirring for 0.5 h, the reaction mixture was concentrated and dried overnight under vacuum at 50^βC. The residue was suspended in EtOAc (1 mL), filtered and dried under vacuum to afford the titie compound as a white solid. HPLC: t_R = 4.01 min (method H); LCMS: t_R= 1.33 min, {M+HJM58 (method I); TLC: R_f - 0.08 (4:1 CH₂CIjZMeOH); ¹H-NMR (d₆-DMSO, 600 MHz): 11.14 (br s, 1H), 8.40 (s, 1H), 7.42 (br s, 1H)₁ 7.06 (br s, 1H)₁ 4.27 (m, 1H). 3.71 (m, 1H)₁ 3.42 (m, 1H), 2.98 (m, 2H), 2.90 (m, 2H)₁ 2.52 (m, 1H), 2.33 (m, 1H), 2.18 (m. 1H), 2.18 (s, 6H), 2 01 {m, 1H), 1.72 (m, 1 H)₁ 1.32 (s, 9H).

Stage 43.1 : (2S,3S)-3-Dimethylaminomethyi-pyrrolidine-2-carboxylic acid amide

The tilfe compound was prepared in analogy to the procedure described in Stage 37.1 but

(2S.3S)-3-dimethylaminomethyl-1 -((S)-1-phenyl-ethyl)-pyrrolidine~2-carboxylic acid amide

(Stage 43.2) was used instead of (2S,3S)-3-morpholin-4-yimethyi-1-((S)-1-phenyl-ethyl)- pyrroiidine-2-carboxylic acid amide. Also, the hydrogenatton was performed under 4 bar pressure.

The title compound was obtained as a yellow oii. ESi-MS: [M-H-if 172.

Stage 43.2: (2S.3S)-3-Dimethγlaminomethvl-1 -{{SH-phenvl-ethyl)-pvrrolidine-2-carboxyiic acid amide

A mixture of (2S.3S)-3-aminomemyl~1~((S)-1-pheny!-ethy!)-pyrrolidine-2-carboxylic acid amide {Stage 43.3) (0.418 mmoi), sodium cyanoborohydride {2.86 mmol) and 37% aqueous formaldehyde {2.14 mmol) in MeOH (3.3 mL) was stirred at 55°C for 16 h. The reaction mixture was cooied to rt and concentrated. The residue was purified using a RediSep^® silica gei column to afford the title compound as a white foam. HPLC: t_R 3.59 min (method H); LC- MS: t_R= °-^{86 min} _> IM⁺Hf 276 (method I); TLC: R_f ~ 0.13 (9:1 CH₂Ci^MeOH).

Stage 43.3: (2S,3S)-3-Aminomethy!-1 -{(S)-1 -phenyl-ethyO-pyrrolidine^-carboxyϋc acid amide

A mixture of (2S,3S)-3-azidomethyf-1-((S)-1-phenyl-ethyi)-pyrrolidine-2-carboxylic acid amide

(Stage 36.3) (0.723 mmol) and tripheπylphosphine (0.867 mmol) in THF (3 mL) was stirred at rt for 25 h. The reaction mixture was concentrated to afford the crude title compound as a light brown solid. HPLC: t_R 3.53 min {method H); ESi-MS: [M+H]⁺ 248.

Example 44: (2S.3R)-3~Methyl-pyrroiidine-1.2-dicarboxylic acid 2-amide 1-{[8-(2,2,2-trifluoro- 1 , 1 -dimethyl-ethyl)-4,5-dihydro-thiazoio[4,5-h]quιnazolin-2-yl]-amide} - 89 -

Triethylamine {1.714 mmof) was added to a solution of imidazole-1-carboxylic acid [8-{2.2 ,2-trifluoro-1.1-dimethyf-ethyl)-4,5-dfhydro-thiazoio[4.5-hJquinazo!in-2-yl3-amfde (Stage 44.1) (0.490 mmol) and {2S,3R)-3~nnethyf-pyrrofidine-2~carboxyKc acid amide (intermediate P) (0.979 mmol) in DMF (1.5 mL) at rt. After stirring for 1.5 h, the reaction mixture was concentrated. The residue was diluted with a saturated solution of NaHCO₃ and extracted with EtOAc (2X). The combined organic layers were successively washed with water and brine, dried (Na₂SO₄), filtered and concentrated. The residue was purified using a RediSep^® silica gel column to to afford the title compound as a beige solid. HPLC; t_R ~ 5.77 min (method H); LCMS: t_R~ 2.18 min, {M+H]^*469 (method I); TLC: R₁- = 0.16 (19:1

CH₂CI₂ZMeOH); ¹H-NMR (U₅-DMSO₁ 600 MHz): 11.19 (br s, 1H), 8.50 (s, 1H)₁ 7.43 (br s, 1H). 7.01 (br s, 1H), 4.18 (m, 1H)₁ 3.72 (m, 1H), 3.40 (m, 1H), 3.03 (m, 2H), 2.94 (m, 2H), 2.38 (m, 1H), 1.97 (m, 1H), 1.70 (m, IH). 1.58 (s, 6H), 0.99 (d, 3H). Stage 44.1 : Imidazole-1-carboxylic acid [8-(2,2,2-trifluoro-1 , 1-dimethyl-ethyl)-4.5-dihydro- thrazolo[4,5-h]quinazoiin-2-y!j-amide

The title compound was prepared in analogy to the procedure described for Intermediate A but tn Stage A.3 3,3,3-trifiuoro-2,2-dimethyl-propionamidine hydrochloride (Stage 44.2) was used instead of lert-butylamidine hydrochloride.

The title compound was obtained as a beige solid. HPLC: t_R - 6.73 rnin (method H); LCMS. t_R~ 1.11 min, [IvHH]⁺ 373 (method J). Note : for characterization purposes, the title compound was dissolved in MeOH --> methyl carbamate derivative. Stage 44.2: 3,3,3-Trif!uoro~2,2-dtmethyl-propionamidine hydrochloride - 90 -

3,3,3-Trifluoro-2,2-dimethyl-propionitπte (Stage 44.3) (12.40 mmoi) was added to a solution of sodium methoxide (freshly prepared from 48.40 mmol sodium metai and 102 ml_ MeOH) at rt. After 4 h, acetic acid (48.40 mmol} and then NH₄CI (14.88 mmol) were slowly added and the reaction mixture was then heated to 7O⁰C for 40 h. After concentrating (40⁰C, 100 mbar) the reaction mixture, the residue was suspended in acetone, filtered and dried under vacuum to afford the titie compound as a white solid. ESI-MS: [M+H]^"1 155.

Stage 44.3: 3.3.3-Trifluoro-2.2-dimethyi-propionitrile

A mixture of 3,3,3-trifiuoro-2,2-dfmethyl-propionamide (Stage 44.4) (121.2 mmol) and phosphorus pentoxide (121.2 mmol) was slowly heated to 200⁰C and the resulting distillate collected. The title compound was obtained as a colorless iiqυid. Stage 44.4: S.S.S-Trifluoro^.Σ-dimethyl-propiortarnide

Oxaly! chloride (140.8 mmoi) was added dropwise to a solution of 3,3.3-iπffuoro-2,2- dimethyi-propionic acid [889940-13-0] (128 mmoi) in CHjCI₂ (128 ml.) at 0⁰C. Added a few drops of DMF until gas evolution was observed and then continued stirring for 30 min. After warming to rt and stirring overnight, the reaction mixture was concentrated (4OX. 00 mbar). The residue was dissolved in THF (128 ml_), cooled to OT and then slowiy treated with a solution of concentrated aqueous ammonia (64 mL). After stirring at 0⁰C for 30 min and then at rt for 4 h, the reaction mixture was concentrated to half its volume to give a thick white suspension. After filtering and drying, the title compound was obtained as a white sofid. ESI- MS: [M+Hl^* 156.

Example 45: (aS^RH-Methoxymethyt-pyrrclidine-i ^-dicarboxylic acid 2-amide 1-{[8~<2,2.2- trifluoro-1 , 1 -dimethyl-ethyl)-4,5-dihydro-thiazolo[4_!5-h]quinazolin-2-yl3-amide}

Triethyiamiπe (1714 mmoi) was added to a solution of imidazoie-1-carboxyiic acid [8-(2,2 ,2~triftuoro-1.1-dimethyl-ethy!)-4,5-dihydro-thiazoio[4,5-h]quina2θtfn-2-yl}-amide (Stage 44.1) (0.490 mmoi) and (2S,3R)-3-methoxymethyl~pyrrolidtne-2~carboxy!ic acid amide (Stage 42.1) (0.0.979 mmof) tn DMF (1.5 mL) at it After stirring for 2 h, the reaction mixture was concentrated. The residue was diluted with a saturated solution of NaHCO₃ and extracted with EtOAc (2X) The combined organic layers were successively washed with water and brine, dried (Na₂SO₄), filtered and concentrated The residue was purified using a RediSep^® silica gel column to to afford the title compound as a beige solid. HPLC: t_R ~ 5.71 min (method H); LCMS: t_H~ 2.15 min, [M+H]⁺499 (method I); TLC: R_f ~ 0,40 (19:1

CH₂CI₂ZMeOH); ^'H-NMR (d_s-DMSO, 600 MHz): 11.23 (br s, 1H), 8.50 (s. 1H), 7.42 (br s, 1H), 7.06 (br s_r 1H). 4.27 (m, 1H), 3.74 (m, 1 H), 3.46 (m. 1H)₁ 3.42 (m, 1H)₁ 3.24 (s, 3H), 3.16 (m, 1H), 3.03 (m, 2H), 2.94 (m, 2H), 2 55 (m, 1H), 2.03 (m, 1H), 1.77 (ID, 1H), 1.58 (s, 6H). Example 46: (2S_!3R)-3-Methy[-pyrrolidtne-i ,2~dicarboxySic acid 2-amide 1 -f(8-tert-butyl-4H-5- oxa- 1 -thia-3,7-diaza-cyciopenta[ajnaphthalen-2-yi)-amide]

LCMS: t_R ~ 0.50 min, M+H = 416, M-H = 414 (method L). ¹H-NMR (d₆*DMSO, 400 MHz): 8.05 (s, 1H)₁ 7.37 (bs, 1H)₁ 7.09 (s, 1H)₁ 6.97 (bs, 1 H). 5.31 (s, 2H), 4.18 (m, 1H)₁ 3.69 (dd, 1H)₁ 3.39 (m, 1H), 2.35 (m, 1H), 1.95 (m, 1H)₁ 1.71 (m, 1H), 1.27 (s, 9H), 0.975 (d, 3H).

The titie compound was prepared from 2-tert-buty!-5-methoxymethoxy-pyridine using synthetic methodology as described for the preparation of Example 40. The starting material, 2-tert-butyl-5-methoxymethoxy-pyridine was prepared from 2-bromo-5- methoxymethoxy-pyridine as described befow.

2-tert-Butyl-5~methoxymethoxy-pyridine: - 92 -

6.69g (74.7 mmo!) copper(l)cyanide in 15 ml dry THF was cooled to -75⁰C, where 149 ml {149 mmol) of a 1M tert-butylmagnesium chloride solution was added drop-wise. Stirring was continued for 40 min. After that. 4.07g {18.57 mmol) 2-bromo-5-methoxymetho3cy-pyridine {Zhong, W. et at. WO2G08147547) dissolved in 30 mi dry THF were added drop-wise. The reaction mixture was stirred at -75°C for 1 h and then allowed to reach room temperature, where stirring was continued for another 6 h. Then 30ml of 25% aqueous ammonia was added to the reaction mixture. The mixture was filtered and extracted twice with CH₂CIj. The combined organic layers were washed with water, dried (MgSO₄), filtered and concentrated in vacuo. The residue was purified by chromatography on silicagel (EtOAc, heptane) to yield 2.64 g of the pure title compound as an oil. LCMS: t_R = 0.55 min, M÷H = 196 (method K).

Example 47: (2S,3S)-3-Dimethylaminomethyl-pyrroffdine-1 ,2-dicarboxylic acid 2 -amide 1-[{8- tert-butyi-4H-5-oxa-1-thia-37-diaza-cyclopenta[ajnaphthalen-2-yl)-amide]

The title compound was prepared using synthetic methodology described for the preparation of Example 46 and using {2S,3S)~3-dimethylaminomethyl~pyrrolidine-2-carboxylic acid amide (Stage 43.1) instead of (2S.3R)-3-methyl-pyrro!idine-2-carboxylic acid amide in the last step of the synthesis.

LC-MS: t_R » 0.24 min, M-H « 457 (method L). ¹H-NMR (d₆-DMSO, 400 MHz): 11.15 (bs. 1H), 8.03 (S, 1H), 7.35 (s. 1H), 7.07 {s, 1H), 7.0 (s, 1 H), 5.28 (β. 2H), 4.23 (m. 1 H), 3.65 (m_s 1 H). 3.40 (m, 1H)₁ 2.6-2.45 (m, 2H)₁ 2.30 (m, 1H), 2.17 (S₁ 6H), 2.15 (m, 1H)1.70 (m, 1H), 1.27 (s, 9H). Example 48: (2S_:3R)-3-Methyl-pyrrolidine-1,2-dicarboxylic acid 2-amide 1-{[8-(2,2,2-trifluoro- 1 , 1 -dimethyi-ethyl)-4H-5-oxa-1 -thia-3,7-diaza-cyclopentata3naphthalen-2-yl]-amide} - 93 -

H₂N '

LC-MS: t_R = 1.59 min, M+H = 470 (method F). ¹H-NMR (d₆-DMSO, 400 MHz): 11.25 {bs, 1H)₁ 8.15 (s, 1H)₁ 7.42 (s, 1H), 7.34 <s, 1 H), 7.00 (s, 1H), 5.40 (s, 2H)₁ 4.19 (s. 1H)₁ 3.71 (m, 1H)₁ ca. 3.4 (m, 1H), 2.5-2.35 (m, 1H), 1.99 (m, 1H), 1.68 (m, 1H)₁ 1.56 (s, 6H), 0.99 (d, 3H).

The title compound was prepared starting from 4-bromo-5-methoxyme.hoxy-2-{2,2,2- tπfluoro-1,1-dimethyl-ethyl)-pyridine using synthetic methodology as described for the preparation of Examples 40 and 42. 4-8romo-5-methoxymetboxy-2-<2,2,2-trifluoro-1 ,1 -dtmetbyi-ethyl)-pyridine was prepared as follows.

- 94 -

a) 4-Bromo-5-methoxymethoxy-2-(2,2,2-trifluoro-1,1-dimethyl-ethyl)-pyridine:

The title compound was prepared using synthetic methodology as described for the preparation of Example 40, stage 40.5. as an oil. LCMS (method L): t_B = 1.26 min, Wt+H ~ 328 (⁷⁹Br), 330 (⁸¹Br) . b) 5-Methoxymethoxy-2-(2,2,2-trifluoro-1 , 1-dimethyi-ethyl)-pyridine

1.7 g (4.13 mmol) methanesuifonic acid 2,2,2-trifluoro-1-(5-meihoxymethoxy-pyπdin-2-yl)-1- methyi-ethyl ester was dissolved in 20 ml dichloromethane. The reaction mixture was cooled to 0⁰C where 2.065 ml (4.13 mmoi) trimethylaluminum was added slowly. The reaction mixture was stirred at room temperature for 20 h. After that water was added slowly and the mixture was extracted 2 times with EtOAc. The combinded organic layers were washed with water and brine, dried (MgSO₄), filtered and concentrated in vacuo. The residue was purified by chromatography on siiicagel (EtOAc, heptane) to yield to afford 0.55 g of the pure title compound. LCMS (method L): t_R = 1.09 min, M+H - 250. c) Methanesuifonic acid 2,2,2-trifluoro-1-(5-methoxymethoxy-pyridin-2-yl}-1 -methyl-ethyl ester

To a stirred mixture of 0.213 g (8.44 mmof) sodium hydride in 6 mi dry THF, 1.06 g (4.22 mmol) lH-trifluoro^-fS-methoxymethoxy-pyridin^-yO-propan^-o! (dissolved in 4.9 ml dry THF) was added dropwise at 0⁰C. After completion of the addition, stirring was continued for 3 h at room temperature. Then methanesulfonyi chloride (dissolved in 7.3 ml dry THF) was added at room temperature and stirring was continued for another 2 h. Then water and sat. NaHCOs soln. were added. This mixture was extracted 2 times with EtOAc. The combmded organic layers were washed with water and brine, dried (MgSO₁^₁ filtered and concentrated - 95 - in vacuo to afford 1.7 g of the title compound, which was used directly in the next step.

LCMS (method L): t_R = 0.96 min, M+H ~ 330. d) 1 , 1 , 1 -Trifiuoro-2~{5-methoxymethoxy-pyridin-2-yl)-propan-2-ol

A mixture of 1.48 g (4.58 mmol) 5-methoxymethoxy-2-(2,2,2-trifluoro-1-methyl~1- tπmethylsiianyloxy-ethyi)-pyridinβ and 5mi (10 mmoi) 2N HCi in 15ml THF was stirred at room temperature for 2 h. After that the reaction mixture was poured on water and a pH of 1- 2 was adjusted by the addition of 2N HCf The reaction mixture was extracted 2 times with EtOAc. The combinded organic layers were washed with water and brine, dried (MgSO*). filtered and concentrated in vacuo to afford 1.06g of the title compound as an oii (88% pure), which was used in the next step without purification. LCMS (method L): i_R - 0.88 min, M+H = 252. e) 5-Methoxymethoxy-2-(2,2_l2~trifluoro-1-methy!-1-trimethylsilanyloxy-ethyl)-pyridine

A mixture of 1.12 g (6.18 mmol) 1-{5-methoxymethoxy-pyrid$n-2-yi)-ethanone, 1055 g (7.42 mmo!) trimethyl(trifluorrnethyl)silane and 0.025 g (0.309 mmol) sodium acetate in 9 ml DMF was stirred for 1 h at 0⁰C and 1 h at room temperature. After that the reaction mixture was poured on water and a pH of 1-2 was adjusted by the addition of 2N HCI The reaction mixture was extracted 2 times with EtOAc. The combinded organic layers were washed with water and brine, dried (MgSO,,), filtered and concentrated in vacuo. The residue was purified by chromatography on sificagel (EtOAc, heptane) to yield 1.87 g of the pure title compound as an oil. LCMS (method L): t_R - 1.38 min, M+H - 324. f) 1-{5-Methoxymethoxy-pyridin-2-yl)~ethanone.

NaH was added to a soiution of 1 g (7.29 mmoi) 1-{5-hydroxy-pyridin-2-yl)-ethanone

(Anichem) in 15 ml DMF at 0⁰C. After stirring this mixture for 1 h, 0.78 mf (8.75 mmol) - 96 -

MOMCt was added at O⁰C. Then the reaction mixture was stirred at room temperature for 2h. The reaction mixture was poured on water and extracted 2 times with EtOAc. The

combinded organic layers were washed with water and brine, dried (MgSO₄), filtered and concentrated in vacuo. The residue was purified by chromatography on silicagel (EtOAc, heptane) to yield 1 12 g of the pure title compound as an oil. LCMS {method L): t_R ~ 0.66 min, M+H = 182.

Example 49: (2S,3R)-3-Methyl-pyrro!idine-1 ,2-dicarboxyltc acid 2-amide 1-{[7-(2,2,2- trifluoro-i.i-dimethyl-ethyO^.S-dihydro-benzoti^-d^.^d'Jbisthiazol^-yπ-amide}

LCMS: t_B = 0.S7 min, M+H = 474, M-H = 414 (method L). ¹H-NMR (d₆-DMSO_s 400 MHz): 10.7 (bs, 1H), 7.37 (S₁ 1 H)₁ 6.97 (s, 1H)₁ 4.18 (m, 1 H), 3.69 (dd, 1 H)_S 3.39 (m, 1H)₁ 3.14 (t, 2H), 2.95 (t, 2H), 2.34 (m, 1 H), 1.94 (m. 1H), 1.68 (m, 1H), 1.62 (s, 6H)₁ 0 965 (d, 3H).

The title compound was prepared from 2,2-dimethyl-thiopropionamide using synthetic methodology as described for the preparation of Example 39. The starting material, 3,3,3- trifluoro^^-dimethyi-thiopropionamide was prepared as described befow:

Preparation of 3,3,3-trifluoro-2,2-dimethy!-thiopropionamide: a) S^.S-Trifluoro^^-diroethyl-propionamide

A mixture of 2 g (12.81 mmoi) S.S.S-trifiuoro-a.a-dimethylpropionic acid (Aldrich), 2.077 g (12.81 mmol) carbonyl-diimidazole and 5.55 ml (64.1 mmol) aqueous ammonia in 50 ml CH₂CI₂ was stirred at room temperature for 20 h. After that, diethyl ether was added and the resulting mixture was washed with 0.1 N HCL₁ 0.1 N NaOH₁ water and brine. The organic layer was dried (MgSO₄), filtered and concentrated in vacuo to afford 1.15 g of the title compound as white crystals, that were used in the next step without further purification. MS: M+H = 156. - 97 - b) 3,3,3-Trifluoro-2.2-dirnethyUhiopropionamide

A mixture of 1.05 g (6.77 mmol) 3,3,3-trifluoro-2,2-dirnethyl-propionamide and 1.48 g {3.66 mmol) Lawesson's reagent in 32 mi dry THF was stirred at reflux temperature for 20 h. After that the reaction mixture was cooled to room temperature and concentrated in vacuo. The residue was purified by chromatography on silicagel (heptane, EtOAc) to afford 0.81 g of the title compound as pure white crystals. MS: M+H - 172.

Using (2S,3R)-3-methoxymethy!-pyrrolidine-2-carboxylic acid amide (Stage 42.1) rn the last step of the synthesis the following example was prepared in the same way:

Example 50: (2S.3R)-3-Methoxymethyi-pyrrolidine-i,2-dicarboxylic acid 2-amide 1-{[7- (2,2,2-trifluoro-i , 1-dimethyl-ethyl)-4,5-dihydro-benzo{1 ,2-d;3,4-d'3btsthiazol-2-yi]-amide}

LC-MS: t_R = 0.96 min, M+H = 504. M-H = 502 (method L)-¹H-NMR (d_β-DMSO, 400 MHz): 10.76 (bs, 1H)₁ 7.34 (bs. 1H), 7.02 (be, 1H)₁ 4.29 (m, 1H), 3.45 (m. 1H), 3.42 (m, 2H), 3.22 (s, 3H)₁ 3.14 (m. 3H). 2.97 (m, 2H), 2.48 (ro. 1H), 1.97 (m, 1H), 1.75 (m, 1 H), 1 62 (β, 6H).

Example 51: (2S,3S)-3-Dimethylaminomethyl-pyrrolidine-1,2-dicarboxyfic acid 2-amide 1- ((7-tert-butyl-4,5-dihydro-benzo[1 ,2-d;3,4-d^l}bisthiazol-2-yi)-amide3

The title compound was prepared using synthetic methodology described for the preparation of Example 39 and using (2S,3S)-3~drmethylaminomethyl-pyrrolidine-2-carboxylic acid amide (Stage 43.1) instead of {2S_I3R)-3-methyl-pyrroiidine-2-carboxyfic acid amide in the fast step of the synthesis. - 98 -

LC-MS-. t_R - 0.91 min, M+H ~ 463, M-H = 461 (method L)-¹H-NMR (d_s-DMSO, 400 MHz): 10.7 (bs, 1H). 7.36 (s, 1H). 7.01 (bs, 1H), 4.28 (rn, 1H), 3.67 (dd, 1H), 3.39 (m, 1H), 3.07 (m, 2H). 2.92 (m, 2H), 2.5-2.44 (m, 2H), 2.30 (m, 1H), 2.14 (s, 6H), 1.95 (m, 1H), 1.40 (m, 1H), 1.36 (s, 9H).

Efficiency as Pi3 kinase inhibitors

PI3K KinaseGio assay: 50 nL of compound dilutions were dispensed onto black 384-well low volume Non Binding Styrene (NBS) plates (Costar Cat. No. NBS#3676). L-a- phαsphatidyiinosito! (Pl)₁ provided as 10 mg/mi solution in methanol, was transferred into a glass tube and dried under nitrogen beam. It was then resuspended in 3% OctylGlucoside (OG) by vortexing and stored at 4^DC. The KinaseGio Luminescent Kinase Assay (Promega, Madison/Wi, USA) is a homogeneous HTS method of measuring kinase activity by quantifying the amount of ATP remaining in solution following a kinase reaction,

5 μL of a mix of Pi/OG with the PI3K subtype were added (Table 1). Kinase reactions were started by addition of 5 μl of ATP-mix containing in a final volume 10 μL 10 mM TRIS-HC! pH

7.5, 3mM MgCl₂, 50 mM NaCf, 0.05% CHAPS. 1mM DTT and 1 μM ATP, and occurred at room temperature. Reactions were stopped with 10 μl of KinaseGio and plates were read 10 mins later in a Synergy2 reader using an integration time of 0.1 seconds per well. 2.5 μM of a pan-class 1 PI3 kinase inhibitor (standard) was added to the assay plates to generate the 100% inhibition of the kinase reaction, and the 0% inhibition was given by the solvent vehicle

(90% DMSO in water). The standard was used as a reference compound and included in all assay piates in the form of 16 dilution points in duplicate.

Table 1 PI3Ks by KinaseGio: assay conditions and reagent protocol

Cloning of P!3Ks - 99 -

The PI3Kα_f PI3Kβ and PI3KS constructs are fusion of p85α iSH2 domain and the respective p110 isoforms. The ρ85α fragment and p110 isσform genes were generated by PCR from first strand cDNA generated by RT-PCR from commercial RNA from placenta, testis and brain as described beiow. The PI3Kγ construct was obtained from Roger Williams lab, MRC Laboratory of Molecular Biology, Cambridge, UK (November, 2003) and is described (Pacold, Michael E.; Suire, Sabine; Perisic, Olga; Lara-Gonzalez, Samuel; Davis, Colin T.; Walker, Edward H.; Hawkins, Phillip T.; Stephens, Len; Eccleston, John F.; Wifliams, Roger L. Crystal structure and functional analysis of Ras binding to its effector phosphoinositide 3-kinase gamma. Cell (2000), 103(6), 931-943).

: e cons ruc or acu ov rus - was genera e y a ree-par ligation comprised of a p85 fragment and a p110o fragment cloned into vector pBiue8ac4.5. The p85 fragment was derived from plasmid p 1661-2 digested with Nhe/Spe. The p110α fragment derived from is clone was verified by sequencing and used in a LR410 as a Spel/Hindlll fragment. For the generation of the baculovirus expression vector LR410 the gateway LR reaction to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector was used,. The cloning vector pBlueBac4.5 (Invitrogen) was digested with Nhe/HindlH. This resulted in the construct PED 153.8. The p85 component (iSH2) was generated by PCR using ORF 318 {described above) as a template and one forward primer KAC 1028 (5'- GCTAGCATGCGAGAATATGATAGAT-TATATGAAG-AATATACC) (SEQ ID NO. 1) and two reverse primers, KAC1029 (δ'-GCCTCCACCAC-CTCCGCCTG- GTTTAATGCTGTTCATACGTTTGTC) (SEQ ID NO. 2) and KAC1039 (5'- TACTAGTC-CGCCTCCAC-CACCTCCGCCTCCACCACCTCCGCC) (SEQ ID NO. 3). The two reverse primers overlap and incorporate the 12x GIy linker and the N- terminal sequence of the p1 10α gene to the Spel site. The 12x GIy linker replaces the single GIy linker in the SV1052 construct. The PCR fragment was cioned into pCR2.1 TOPO (invitrogen). Of the resulting clones, p 1661-2 was determined to be correct by sequencing. This plasmid was digested with Nhe and Spe! and the resulting fragment was gef-iso!ated and purified for sub-cloning.

The p110α cloning fragment was generated by enzymatic digest of clone LR410 (see above) with Spe I and Hindlii. The Spel site is in the coding region of the p110α gene. The resulting fragment was gel-isolated and purified for sub-cloning. The cloning vector, pBlueBac4.5 (Invitrogen) was prepared by enzymatic digestion with

Nhe and Hindi! I. The cut vector was purified with Qiagen column and then dephosphorylated with Calf Intestine aJkaitne phosphatase (CiP) (BioLabs). After completion of the CtP reaction the cut vector was again column purified to generate the final vector. A three-part ligation was performed using Roche Rapid ligase and the vendor specifications. The final piasmid was verified by sequencing.

Kinase domain.

PI3Kβ constructs and proteins

BV949: PCR products for the inter SH2 domain (iSH2) of the p85 P!3Kα, PI3Kβ and Pi3Kδ subunii and for the fuli-fength p110β subunit were generated and fused by overlapping PCR. The iSH2 PCR product was obtained from first strand cDNA generated by RT-PCR from commercial human RNA from placenta, testis and brain (Clontech), initially using primers gwG130-p01 (5¹-

CGAGAATATGATAGATTATATGAAGAAT-S") (SEQ IO No. 5) and gwG130-p02 <5'- TGGTTT-AATGCTGTTCATACGTTTGTCAAT-3') (SEQ ID No. 6). Subsequently, in a secondary PCR reaction Gateway recombination AttB1 sites and linker sequences were added at the 5'end and 3'end of the p85 iSH2 fragment respectively, using primers gwG130-p03 (δ'-GGGACAAGTT-

TGTACAAAAAAGCAGGCTACGAAGGAGATATACATATGCGAGAATATGATAGAT TATATGAAGAAT-3') (SEQ ID No. 7) and gwG130-p05 (5'- ACTGAAGCATCCTCCTC-CTCCTCCT- CCTGGTTTAATGCTGTTCATACGTTTGTC-3') (SEQ (D No. 8). The p110β fragment was obtained by PCR using as template a p110β clone (from unknown source that was sequence verified) using primers gwG13G-p04 (5^!~ ATTAAACCAGGAGGAGGAGGAGGAGGATGCTT-

CAGTTTCATAATGCCTCCTGCT -3^') (SEQ ID No. 9) which contains linker sequences and the 5'end of p110β and gwG130-p06 (5'- AGCTCCGTGATGGTGATGGTGATGTGCTCCAGATC-TGTAGTCTTTCCGAA-

CTGTGTG-3¹) (SEQ ID No. 10) which contains sequences of the 3^!end of p110-β fused to a Histidine tag. The p85-iSH2/ p110β fusion protein was assembled by an overlapping PCR a reaction of the linkers at the 3'end of the iSH2 fragment and the 5'end of the p110β fragment, using the above mentioned gwG130-ρ03 primer and a primer containing an overlapping Histidine tag and the AttB2 recombination sequences (5'~

GGGACCACTTTGTACAAGAAAGCTGGGTTTAAGCTCCGTGATGGTGATGGTGA TGTGCTCC-3') (SEQ IO No. 11). This final product was recombined in a Gateway (invitrogen) OR reaction into the donor vector pDONR201 (invitrogen) to generate the ORF253 entry clone. This clone was verified by sequencing and used in a Gateway LR reaction (invitrogen) to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector for generation of the baculovirus expression vector LR280. This LR280 has an amino acid mutation in the p85 sequence.

Kinase domain.

o.

Kinase domain.

PI3Kγ construct and protein

Construct obtained from Roger Williams lab, MRC Laboratory of Molecular Biology, Cambridge, UK (November, 2003). Description of the construct in (Pacold, Michael E.; Suire, Sabine; Perisic, Olga; Lara-Gonzaiez, Samuel; Davis. Colin T.; Walker, Edward H.; Hawkins, Phillip T.; Stephens, Len; Eccleston, John F.; Williams, Roger L. Crystal structure and functional analysis of Ras binding to its effector phosphoinositide 3-kinase gamma. Cell (2000), 103(6), 931-943). Constructs

Pt3Kδ construct and protein

BV1060: PCR products for the inter SH2 domain (iSH2) of the ρ85 subυnit and for the full-length p110δ subunit were generated and fused by overlapping PCR. The iSH2 PCR product was generated by using as a template the ORF318 (see above) and the primers gwG130-p03 (5'- GGGACAAG-

TTTGTACAAAAAAGCAGGCTACGAAGGAGATATACATATGC- GAGAATATGATAGATTATATGAAGAAT-3') (SEQ ID No. 7) and gwG154-pO4 (5¹- TCCTCCTCCT-CCTCCTCCTGGTTTAATGCTGTTCATACGTTTGTC-S¹) (SEQ ID No. 14). The p110δ fragment was obtained from first strand cDNA generated by RT- PCR from commercial human RNA from placenta, testis and brain (Clontech), using initially primers gwG154-pO1 (5^J- ATGCCCCCTGGGGTGGACTGCCCCAT-S¹) (SEQ ID No. 15) and gwG154-pO2 (S'-CTACTGCCTGT-TGTCTTTGGACACGT-S') (SEQ ID No. 16). In a subsequent PCR reaction linker sequences and a Histidine tag was added at the 5'end and 3^!end of the p110δ fragment respectively, using primers gw154~pO3 (5'-ATTAAACCAGGAGGAGGAGGAGGAGGACCCCCTGGGGTGGAC- TGCCCCATGGA-3') (SEQ IO No. 17) and gwG154-pO6 (5¹-

AGCTCCGTGATGGTGATGGTGAT-GTGCT- CCCTGCCTGTTGTCTTTGGACACGTTGT-S¹) (SEQ ID No. 18).The p85-iSH2/ p110δ fusion protein was assembled in a third PCR reaction by the overlapping linkers at the 3'end of the iSH2 fragment and the 5'end of the p110δ fragment, using the above mentioned gwG130-p03 primer and a primer containing an overlapping Histidine tag and the Gateway (Invitrogen) AttB2 recombination sequences (5'-GGG- ACCACTTTGTACAAGAAAGCTGGGTTTAA-

GCTCCGTGATGGTGATGGTGAGTGCTCC-S¹) (SEQ !D No. 19). This final product was recombined in a Gateway OR reaction into the donor vector pDONR201 (fnvitrogen) to generate the ORF319 entry done. This clone was verified by sequencing and used in a Gateway LR reaction (Invitrogen) to transfer the insert into the Gateway adapted pBlueBac4.5 (Invitrogen) vector for generation of the baculovirus expression vector LR415.

1141 WKTKVTV¹W]-AH WSKDNRQEL GGAHHHHHH (SEQ ID No. 20)

Purification of PI3Kα, PI3Kβ and PI3Ky constructs

PI3Kα, Pf3Kβ and PI3Kγ were purified in two chromatographic steps: immobilized metal affinity chromatography (IMAC) on a Ni sepharose resin (GE Heaithcare) and gel filtration utilizing a Superdex 200 26/60 column (GE Healthcare). AK buffers were chilled to 4°C and lysis was performed chilled on ice. Column fractionation was performed at room temperature. All buffers used to purify PI3Kβ contained 0.05% Triton X100 in addition to what is described below.

Typically frozen cells from 10 L of Tn5 ceil culture were resuspended in "Lysis Buffer" 20 mM Tris-CI, pH 7.5, 500 mM NaCI, 5% glycerol, 5 mM imidazole, 1 mM NaF. 0.1ug/ml okadaic acid (OAA), 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free (20 tablets/1 L buffer, Roche Applied Sciences), benzonase (25U/mL buffer, EMD Biosciences) at a ratio of 1 :6 v/v pellet to Lysis Buffer ratio, and mechanically fysed by douncing 20 strokes using a tight-fitting pestle. The lysate was centrifuged at 45,000 g for 30 minutes, and the supernatant was loaded onto a pre-equilibrated IMAC column (3 mL resin/100 rr.L lysate). The column was washed with 3-5 column volumes of Lysis Buffer, followed by a second wash of 3-5 column volumes with 20 mM Tris-Ci, pH 7.5, 500 mM NaCI, 5% glycerol, 45 mM imidazole, 1 mM NaF₁ 0.1μg/mL OAA_S 5 mM BME, 1x Complete protease inhibitor cocktail - EDTA-free. Protein was eluted with 20 mM Tris-CI, pH 7.5, 0.5 M NaCI, 5% glycerol, 25G mM imidazole, 1 mM NaF, 0.1μg/mL OAA, 5 mM BME₁ 1x Complete protease inhibitor cocktail - EDTA-free. Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly. The protein was further purified by gel filtration on a Superdex 200 26/60 column equilibrated in 20 mM Tris-CI, pH 7.5, 0.5 M NaCl, 5% glycerol, 1 mM NaF, 5 mM DTT, 1x Complete protease inhibitor cocktail - EDTA-free. Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly. An equal volume of Dialysis Buffer (20 mM Tris-CI, pH 7.5, 500 mM NaCI, 50% glycerol, 5 mM NaF, 5 mM DTT) was added to the pool and than dralyzed against Dialysis Buffer two changes (one change overnight). Protein was stored at - 2O⁰C.

Purification of PI3K5

PI3K5 was purified in three chromatographic steps: immobilized metal affinity chromatography on a Ni Sepharose resin (GE Healthcare), gel filtration utilizing a Superdex 200 26/60 column (GE Healthcare), and finally a ion exchange step on a Q-HP column (GE Heaithcare). Af! buffers were chilled to 4⁰C and lysis was performed chilled on ice. Column fractionation was performed at room temperature.

Typically frozen ceils from 10 L of Tn5 ceil culture were resuspended in "Lysis Buffer" 20 mM Tris-Ci. pH 7.5, 500 mM NaCI, 5% glycerol, 5 mM imidazole, 1 mM NaF, 0.1 μg/mL okadaic acid (OAA)₁ 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free (20 tablets/1 L buffer, Roche Applied Sciences), benzonase (25U/mL lysis buffer, EMD Biosciences) at a ratio of 1 :10 v/v pellet to Lysis Buffer ratio, and mechanically iysed by douncing 20 strokes using a tight-fitting pestle. The lysate was centπfuged at 45,000 g for 30 minutes, and the supernatant was loaded onto a pre-equlitbrated IMAC column (5 rriL resin/100 mL lysate). The column was washed with 3-5 column volumes of Lysis Buffer, followed by a second wash of 3-5 column voiumes with 20 rnM Tris-CI, pH 7.5, 500 mM NaCi, 5% glycerol, 40 mM imidazole, 1 mM NaF, 0.1ug/mL OAA, 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free. Protein was eluted with 20 mM Tris-CI, pH 7.5, 500 mM NaCI₁ 5% glycerol. 250 mM imidazole, 1 mM NaF₁ 0.1 μg/mL OAA, 5 mM BME, 1 x Complete protease inhibitor cocktail - EDTA-free. Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly. The protein was further purified by gel filtration on a Sυperdex 200 equilibrated in 20 mM Tris-CI, pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM NaF, O.tug/mL OAA, 5 mM DTT, 1 x Complete protease inhibitor cocktail - EDTA-free. Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly. These fractions were diluted 1 :10 v/v pool volume to buffer ratio with "Buffer A" 20 mM Tris-CI, pH 8.2, 5% glycerol, 1 mM NaF , 0.1μg/mL OAA, 5 mM DTT and loaded onto a prepared Q-HP column. After sample loading is completed we wash with Buffer A and 5% "Buffer B" 20 mM Tris-Cl, pH 8.2, 1 M NaCi. 5% glycerol, 1 mM NaF, 0.1ug/mL OAA, 5 mM DTT for 3-5 column volumes. We elute the protein using a 5%-30% gradient of Buffer B. Typically the protein elutes at ~200 mM NaCl. Pertinent fractions were analyzed by SDS-PAGE and pooled accordingly. An equal volume of Dialysis Buffer (20 mM Tris-CI, pH 7.5, 500 mM NaCl, 50% glycerol, 1 mM NaF. 0.1μg/mL OAA, 5 mM DTT) was added to the pool and then dialyzed against Dialysis Buffer two changes (one change overnight). Protein was stored at -2O⁰C. The following results were obtained using the above described assays.

n.d. « not done.

Claims

CLAlMS

1. A compound of formula

wherein,

A is an unsubstituted or substituted aryl ring or unsubstituted or substituted heterocyclic ring fused to the rest of the moiecυie at the positions indicated by the symbol *; X-Y is (CH₂), or O(CH₂)_t or (CH₂)(O wherein,

r is 1 , 2 or 3;

t is 1 or 2;

n is 0, 1 or 2;

q is O₁ 1. 2, 3 or 4;

R¹ represents, independently at each occurrence,

halo;

hydroxy.

unsubstituted or substituted aryl;

unsubstituted or substituted amino;

unsubstituted C]-C₇-alkyl;

CrCy-afkyl, which is substituted one or more times by

hydroxy, d-Cy-alkoxy, unsubstituted or substituted amino, aryi or heterocyciyl, and wherein aryl may be mono or poly-substituted by hafo; or two R^! substituents together form an afkandiyl to form a cyclic moiety, optionaHy substituted by hydroxy or halo, or a salt thereof.

2. A compound according to Claim 1 , wherein

Ring A is substituted by one, two or three R⁷ groups, independently selected at each occurrence from,

unsubstituted or substituted d-Cv-aikyl;

unsubstituted or substituted amino;

unsubstituted or substituted C₃-C₇-cyc!oaikyl,

or a sait thereof.

3. A compound according to claim 1 or claim 2, wherein

R² is selected from

unsubstituted CrCr-alkyl;

di{Ci-C₇-alkyl)amiπo,

C-t-Cr-alkyi substituted one or more times by C₃-C₇-cycloaikyl or halo; unsubstituted C₃-Cr-cycioalkyi;

Ci-C₇-cycJoatkyi which is substituted one or more times by halo, (halo-Ci-

C_ralkyl) or d-Cy-alkyl,

or a sait thereof.

4. A compound according to any preceding claim, wherein

ring A is an unsubstituted or substituted 5- or 6-membered ring containing 1 or 2 heteroatoms selected from N. S or O, wherein at least one heteroatom is N, or a salt thereof.

5. A compound according to any preceding claim, wherein

ring A is selected from an unsubsiituted or substituted pyridine ring, unsubstituted or substituted pyrimidine ring or unsubstituted or substituted thiazoie ring,

or a salt thereof.

6 A compound according to any preceding claim, wherein

X-Y represents (CHJX or O(CH₂)_t wherein r is 2 and t is 1.

7. A compound according to any preceding claim, wherein

R¹ represents, independently at each occurrence,

halo; hydroxy;

unsubstituted or substituted phenyl;

di(CrC_j~alkyl)aroino;

unsubstituted C_rC-_/-alkyi;

CrCy-alkyl, which is substituted one or more times by

hydroxy, Ci-Cτ-alkoxy, di{C_rC₇-aikyl)amino, di-{perdeuteroCrC₇-alkyf)amino, phenyl, morpholinyl, acetylamino, or ΛMCi^-alkylHVφhenylCrCr-alkyOamino, and wherein independently each phenyl may be mono or poly-substituted by hato.

8. A compound according to any preceding claim, wheretn

n is 1 and q is 1.

9. A compound according to claim 1 , selected from:

(2S,4R)-4-Dimethylamϊno-pyrroitdine-1 ,2-dicarboxylic acid 2~amide 1-[(8-tert-butyl~4,5~ dihydro-ihtazolo{4,5-h]quinazolin-2-y!)-amide3;

(2S,3S)-3-Methyl-pyrrolidine-1 ,2-dicarboxyJic acid 2-amide 1-[(8-diethylamino-4,5- dihydro-thiazolo[4, 5-h]q ui nazoS»n-2- yi)-amide] ;

<R)-2-Benzyi-pyrroitdine-1,2-dicarboxy)fc acid 2-amide 1-l(8-cfiethylamino-4,5-dihydro- thiazoio{4,5~h)qu)nazolin-2-yl)-amide];

(S)-2-Methy[-ρyrrofidine-1 ,2-dicarboxyiic acid 2-amide 1-[(8~diethylamino-4,5-dihydro- thiazoto[4,5-h]quinazolin-2-yi)-amide];

{R)-2-Methoxymethyl-pyrroiidine-1,2-dicarboxylic acid 2-amide 1~[<8-diethyiamino-4,5- dihydro-thiazolo[4,5-h]quinazolin-2-y!)-amide];

{R)-2-Dimethylaminomethyl-pyrrolidine-1,2-dicarboxyHc acid 2-amide 1-[(8-tert-butyl- 4,5~dihydro-thiazoio[4,5-h]quinazolin-2-yl)-amide];

d_e-(R)-2-Dimethylaminomethyi-pyrro!idine-1 _:2-dicarboxyiic acid 2-amide 1-[(8-tert-butyl- 4,5-dihydro-thiazolo{4,5-h3quinazolin-2-yl)-amide3;

(R)-2-Hydroxymethyl-pyrrolidine-1.2-dicarboxylic acid 2-amide 1-[(8-diethyfamino-4,5- dihydro-thiazolo{4,5-h]quinazolin-2-yi)-amide3

{R)-2-Hydroxymethyl-pyrrolidine-1 ,2-dicarboxyiic acid 2~amide 1-[(8-tert-butyl-4,5- dihydro-thiazolo[4_:5-h]quinazoSin-2-y!)-amide]

(R)-2-{{{3-Fluoro-benzyl)-methyl-amrno3-methyt}-pyrroiidine-1 ,2-dicarboxylic acid 2- amide 1-[{8-tert-butyl-4,5-dthydro-thiazolo[4_:5-h]quina2θlin-2-yl)-amide]; {S)-2-Methy!-pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1-[(8-tert-butyl-4,5-dihydro~ thiazoio[4_:5-h]quinazolin-2-yi)-amide];

{S)-Pyιτo!idine-1 ,2-dicarboxylic acid 2-amide 1-[(8-diethylamino-4,5~dihydro- thiazolo[4,5-h]quinazoiin-2-yl)-amide|;

(S)-Azetidine-I ,2-dicarboxylic acid 2-amide 1-[(8-diethy!amino-4,5-dihydro-thiazolo[4,5- h]qυinazolin-2-yl)-amide];

(S)-Pyrrolidine-1,2-dicarboxylic acid 2-amide 1-[(8-tert-butyl-4.5~dihydro-thiazolo[4,5- h]quinazolin-2-yl)-amide];

S-Methyi-pyrroiidine-i ^-dicarboxylic acid 2-amide 1-[{8-diethylaminα-4.5-dihydro- thiazoJo[4 ,5-h]quinazolin-2-yi)-amide):

{2S_l4R)-4-Ftuoro-pyrro!fdiπe-1 ,2-dicarboxylic acid 2-amide 1-[(8-diethyfamino-4.5- dihydro-thtazolo{4_i5-h]qutnazo!iπ-2-yi)-amidej;

(2S,4S)-4-Flυoro-pyrrolidtne-1.2-dicarboxytic acid 2-amide 1-[{8-diethylamiπo-4,5- dthydro-ihiazoiol4,5-h]quinazoiin~2-yi)-amide];

(1 S.5R)-2-Aza-bicyclo[3.1.0]hexane-1 ,2-dicarboxyiic acid 1 -amide 2~[{8-tert-butyi-4,5- dfhydro-thiazoio[4,5-h]quinazolin-2-yl)-amide];

(1S.5R)-2-Aza-btcycio[3.1.0]hexane-1 ,2-dicarboxylic acid 1 -amide 2-[(8-diethylamino- 4,5-dihydro-thiazo1o{4.5-h]quinazoiin-2-yl)-amide];

{2S,3R)-3-Methyl-pyrroftdfne-1,2-dicarboxyffc acid 2-amide 1-((8-tert-bυtyl-4,5-dihydro- thiazoioK^-hjquinazolin^-yi^amideJ;

{2S,3R)-3-Methyl-pyrroJidine-1.2-dicarboxylic acid 2-amide 1-[(8-diethyiamino-4.5- dihydro-thiazolo[4,5-h3qυinazofin-2-yi)-amide);

(2S,4S)-4-Dimethylamfno-pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1-[(8-diethylamino- 4_!5-dihydro-thiazoio[4,5-h]quinazolin-2-yi)-amide3;

5-Phenyi-pyrroiidine-1.2-dicarboxyttc acid 2-amide 1 ~[(8-diethylam ino-4,5-dihyd roth iazolo[4 , 5-hjquinazoiin -2-yl)-amide] ;

Azetidine-1,2-dicafboxy)ic acid 2-amide 1-[{8-tert-butyi-4,5-dihydro-thiazofo[4,5- h]quinazo!fn-2-yi)-amide]; (S)-Azetidine-1 ,2-dicarboxyiic acid 2-amide 1 -[(8-tert-butyi-4,5- dihydro-thiazo!o[4,5-h)quinazoiin-2-y!)-amide3;

{2S,4S)-4-Hydroxy-pyrrolidine-1 ,2-dιcarboxylic acid 2-amide 1-{{8-diethylaminc-4,5- dihydro-thiazolo{4,5-h]qυina2θiin-2-yi)-amidej;

(2S,4R)-4-Hydroxy-pyrroiidine-1 ,2-dicarboxyiic acid 2-amide 1-[(8-diethyiamino-4,5- dihydro-thiazoloH^-hlquinazoliπ-Σ-yO-amide]; WO 2011Λ «55 PC17EP2«1 «/«59254

- 113 -

(S)-Pyrrolidine-1,2~dicarboxyiic acid 2-amide 1-[{7-tert-buty!-4,5-dihydrc~benzo[1 ,2- d;3,4-d'3bisthiazoi-2-yl)-amide];

(S)-2-Methy!-pyrroiidine-1 ,2-dicarboxylic acid 2-amide 1-[(7-tert-buty)-4_r5-diftydro- benzot1,2-d;3,4-d'JbisthJazol-2-yl)-amfde];

(Sj-Azetidine-1 ,2-dicarboxylic acid 2-amide 1-[<7-tert-butyl-4,5-dfhydro~benzo[1 ,2- d;3_r4-d'}bisthiazol~2-yl)-amidej;

(2S_!4R)-4-DJmethyiamino-pyrro!tdine-1,2-dicarboxylic acid 2~amide 1 -[{7-tert-buty 1-4,5- dihydro-benzoli^-d-.S^-d'jbisthiazol-Σ-ylJ-amidej;

(S)-Pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1~{{7-(2-fluoro-1 ,1~dimethyl~ethyl}-4,5- dihydro-benzo[1 _:2-d;3,4-c_'}bisthiazol-2~yl]-amide};

(S)-Pyrrolidine-1,2-dicarboxylic acid 2-amide 1-[{7-cyciopropyimethyt-4,5-dihydro- benzo[1 ,2-d;3,4~d']bisthtazol~2-yl)-amide];

(2S_l3S)-3-Methyl-pyrrolιdtne-1,2-dicarboxyifc acid 2-amide 1-[(7-tert-butyf-4_!5-dihydro- benzop,2-d;3,4-d']b_fSthfazol-2-yl)~amide];

(1S,5R)-2-Aza-bicycio[3.1.0]hexane-1.2-dicarboxylic acid 1-amide 2-[(7-teιi-butyi-4,5- dihydro-benzo[1,2-d;3,4-d']bisthiazol-2-yi)-amide];

{2S,3S)-3-(Acetyiamiπo-methyi)-pyrro!idine-i _l2-dfcarboxyfic acid 2-amide 1-[(8-tert~ butyi-4,5-dihydro-thiazolof4,5-hJquinazolfn-2-yi)-amide];

(2S,3S)-3-Morphoiin-4-ylmethyl-pyrrolidine-1 _!2-<Jicarboxylic acid 2-amide 1-[<8-tert- butyi-4, 5-dihydro-thiazolo[4, 5-h]qυinazollπ-2-yi)~amide];

(2S,3R)-3-Hydroxy-pyrroiidine-1,2-dicarboxylic acid 2-amide 1-[(8-tert-butyi-4.5- dihydro-thiazoio[4,5-h]quinazof(π-2-yl)-amide];

(2S,3R)-3-Methyl-pyrrolidine-1 ,2-dicarboxyiic acid 2-amide 1-[{74ert-bυty!-4,5-dihydro- benzo[1 ,2-d;3,4-d']bisthiazoi-2-yt)-amide];

(2S.3R)~3-Methyl-pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1~[{8-methyl-4H-5-oxa-1- thia-3,7-diaza-cyclopenta{a3πaphthalen-2-yl)-amide];

(2S,3S)-3-Morphotin-4-yfmethyl-pyrrolidine-1.2-dicarboxyiJC acid 2-amJde 1-[(7-tert- butyl^.S-dihydro-benzofi ^-diS^-d'Jbisthiazol^-yO-amide];

(2S,3R)-3-Methoxymethyl-pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1~[(8-tert-buty 1-4,5- dihydro~ihiazoto[4,5-hJquinazolin-2-yl)-amide];

{2S,3S)-3-Dimethyiaminomethyl-pyrroiidine-1 ,2-dicarboxylic acid 2-amide 1-[(8-tert- butyi-4,5-dihydro-thiazoio[4_t5-h]qυiπazoifn-2-yl)~amide];

{2S,3R)-3-Methyl-pyrroiidine-1,2-dicarboxy!ic acid 2-amide 1-{[8~(2.2,2-triffuoro-1 ,1- dimethyl-ethyf)-4.5-dihydro-thiazolo(4,5-hJquiπazolin-2-ylj-amide}: (2S,3R)-3-Methoxymethyl-pyrrolidine-1 ,2-dicarboxylic acid 2-amide 1~{[8-(2,2,2- tfifluoro-1 , 1 -dimethyl-ethylM.δ-dihydroΛhiazoloK.δ-htøuinazolin^-ylJ-arnide};

(2S,3R)-3-Methyl-pyrro}fdine-1 ,2-dicarboxylιc acid 2-amide 1-[{8-tert-butyl-4H-5-oxa-1- thia-3,7-diaza-cyciopeπta[a]naphthalen-2-yl)-amtde];

(2S,3S)-3-Dimethylaminomethyl-pyrroiidine-1,2-dicarboxylic acid 2-amide 1-[(8-tert- butyl-4H-5-oxa-1-thia-3,7-diaza-cyclopenta[a]naphthaien-2-yl)-amide3;

(2S_r3R)-3-Methyi-pyrτolidine-1 ,2~dicarboxyiic acid 2-amide 1-{[8-(2,2,2-trifluσro-1 ,1- dimethyl-ethyiMH-δ-oxa-i-thia-SJ-diaza-cyclopentataJnaphthafen^-yll-amide};

(2S,3R}-3-Methyf-pyrfolidine-1,2-dicarboxyfic acid 2-amide 1-{[7~(2,2,2-trifluoro-1,1- dimethyl-ethyi)-4,5-dihydro-benzo[1 ,2~d;3,4-d>isthiazo!-2-yl]-amide};

(2S,3R)-3-Methoxyinethyl-pyrroiidine-1 _l2-dicarboxylic acid 2-amide 1 -{[7-(2.2,2- tπfluoro-1,1-dimethyl-ethyS)-4,5-dihydro~benzot1.2-d;3_I4-d^l3bisthiazoi-2-ylJ-amide};

(2S,3S)-3-Dimethy!aminomethyl-pyrroltdine-1,2-dicarboxyiic acid 2-amide 1-[(7~tert- butyiA5-dihydro-benzo[1 ,2-d;3,4-d'3bisthJazol-2-yl)-amide}.

10. A pharmaceutical composition comprising a compound of formula (I), according to any of Claims 1 to 9, or a pharmaceutically acceptable salt thereof, and optionally a further therapeutic agent, together with a pharmaceutically acceptable carrier.

11. A compound of the formula (I), according to any one of Claims 1 to 9, or

pharmaceutically acceptable salt thereof, for use in the treatment of a lipid and/or protein kinase dependent disease.

12. Use of a compound of formula (!)_; according to any one of Claims 1 to 9, or a

pharmaceutically acceptable salt thereof, for the preparation of a pharmaceutical composition for use in the treatment of a lipid and/or protein kinase dependent disease.

13. A method of treatment of a disease that responds to inhibition of a lipid and/or protein kinase, which comprises administering a prophyiactically or therapeutically effective amount of a compound of formula (I) according to any one of Claims 1-9, or a pharmaceutically acceptable salt thereof, to a warm-blooded animalin need of such treatment. - 115 - A compound for use according to Claim 11. or the use of a compound according to claim 12, or a method of treatment according to claim 13, wherein the disease is a lipid kinase dependent disease dependent on a Class I P!3K. A compound for use according to Ciaim 11 , or the use of a compound according to claim 12, or a method of treatment according to claim 13, wherein the disease is a lipid

Kinase dependent disease dependent on a Class I P!3K selected from the group consisting of PI3Kaipha, PI3Kbeta, PI3Kdeita, PI3Kgamma. A compound for use according to Ciaim 11 , or the use of a compound according to claim 12, or a method of treatment according to claim 13, wherein the disease is a proliferative disease; a benign or malignant tumor; a cancer selected from sarcoma; lung; bronchus; prostate; breast (including sporadic breast cancers and sufferers of

Cowden disease); pancreas; gastrointestinal cancer; colon; rectum; colon carcinoma; colorectal adenoma; thyroid; iiver; intrahepatic bile duct; hepatocellular; adrenal gland; stomach; gastric; glioma; glioblastoma; endometrial; melanoma; kidney; renal pelvis; unnary bladder; uterine corpus; uterine cervix; vagina; ovary; multiple myeloma;

esophagus; a leukaemia; acute myelogenous leukemia; chronic myelogenous leukemia; lymphocytic leukemia; myeloid leukemia; brain; a carcinoma of the brain; oral cavity and pharynx; larynx; small intestine; non-Hodgkin lymphoma; melanoma; villous colon adenoma; a neoplasia; a neoplasia of epithelial character; lymphomas; a mammary carcinoma; basal cell carcinoma; squamous cell carcinoma; actinic keratosis; tumor diseases, including solid tumors: a tumor of the neck or head;

polycythemia vera; essential thrombocythemia; and myelofibrosis with myeloid metaplasia.