WO2010151625A1 - Methods for treating and diagnosing glucose metabolic syndrome - Google Patents

Methods for treating and diagnosing glucose metabolic syndrome Download PDF

Info

Publication number
WO2010151625A1
WO2010151625A1 PCT/US2010/039760 US2010039760W WO2010151625A1 WO 2010151625 A1 WO2010151625 A1 WO 2010151625A1 US 2010039760 W US2010039760 W US 2010039760W WO 2010151625 A1 WO2010151625 A1 WO 2010151625A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
nematode
glycogen
expression
glucose
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/039760
Other languages
French (fr)
Inventor
Harold N. Frazier
Mark B. Roth
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fred Hutchinson Cancer Center
Original Assignee
Fred Hutchinson Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fred Hutchinson Cancer Center filed Critical Fred Hutchinson Cancer Center
Publication of WO2010151625A1 publication Critical patent/WO2010151625A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082Supracellular entities, e.g. tissue, organisms
    • G01N33/5085Supracellular entities, e.g. tissue, organisms of invertebrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/66Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood sugars, e.g. galactose
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/43504Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates
    • G01N2333/43526Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms
    • G01N2333/4353Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms from nematodes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/04Endocrine or metabolic disorders
    • G01N2800/042Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism

Definitions

  • the technical area of the description pertains to methods of screening for or detecting defects in glucose metabolism in subjects, including screening for therapeutic molecules for treating diseases in glucose metabolism.
  • This invention relates to compositions and methods useful for delaying or ameliorating human diseases associated with glucose metabolic syndrome.
  • Abnormalities of glucose metabolism are the most common errors of carbohydrate metabolism.
  • Disorders associated with elevated levels of plasma glucose have been classified into three categories: diabetes mellitus (DM) type 1 , DM type 2 and maturity onset diabetes of youth (MODY), a subtype of DM 2. Both nutrition and the genetic response to nutrients play a role in the etiology of diabetes mellitus type II.
  • Glucose metabolic syndrome includes glycogen storage disease (GSD).
  • GSD is the result of defects in the processing of glycogen synthesis or breakdown within muscles, liver, and other cell types. GSD has two classes of cause: genetic and acquired. Genetic GSD is caused by any inborn error of metabolism. Many animals utilize the hexosamine signaling pathway as a means to detect and respond to environmental nutrient supply. This nutrient sensing pathway works by converting a small percent of absorbed glucose to N- acetylglucosamine. N-acetylglucosamine is then transferred to hydroxyl groups of serine and threonine residues of a variety of substrates, creating an O-linked N-acetylglucosamine (O- glcNAc) modification.
  • O- glcNAc O-linked N-acetylglucosamine
  • One aspect of the invention is a method for identifying a therapeutic compound that restores normal glycogen accumulation, said method comprising: a) providing a nematode or an isolated nematode cell having impaired expression of a nematode gene; b) contacting said nematode or isolated nematode cell with a candidate compound; and c) comprising the step of measuring glycogen distribution; and d) selecting for a compound that changes levels of glycogen accumulation.
  • Further information regarding the following referenced C. elegans genes can be found at http://www.wormbase.org a universal repository database containing reference sequence information for all C. elegans genes.
  • An embodiment of the invention is the method for identifying a therapeutic compound, in which the nematode gene is selected from the group consisting of B0491.5, B0495.4, C02F5.9, C05C8.7, C06H2.1, C09G5.6, C09H10.3, C15C7.5, C16A3.5, C18E9.4, C23H4.1, C27A2.2, C29E4.8, C30C11.2, C33D3.1, C34B2.8, C34E10.6, C46G7.1, C47B2.4, C50D2.1, C52E4.4, C53A5.1, C53A5.6, C53B7.4, C53D5.6, C54G4.8, C56G2.6, CD4.6, D1014.3 J F01G10.1, F02E8.1, F10E7.7, F11G11.10 !
  • Another embodiment is die mediod for identifying a therapeutic compound, in which the nematode gene is selected from die group wherein the nematode gene is selected from die group consisting of B0047 AB0393. l,C05D2.1, C27H6.2, C34F11.3, C47D12.6, F22B5.2, F22D6.3, F26DI0.3, F39B2.4, F42A8.1, F54D5.11, F55A12.8, F55B11.2, K06A1.6, K08E3.6, R06F6.1, R74.1, T01G9.6, T02G5.9, T03F1.9, T04A8.14, T11G6.1, T28F3.2, W07E6.4, Y110A7A.8, Y39G10AR.7, Y39G10AR.8, Y48G1A.4, Y57G11C.19, Y80D3A.1, Y87G2A.5, Y95B8A.10, ZK1127.5, K04E7.2C48E
  • Anodier embodiment is die mediod for identifying a dierapeutic compound, in which die nematode gene is selected from the group wherein the nematode gene is selected from the group consisting of B0336.2, C03D6.1, C03D6.3, C12C8.3, , C14C10.4, C16A3.4, D1054.15, F02D10.5, F13D12.7, F26E4.8, F36F2.3, F44A6.2, F48E8.5, F54A3.3, F54C9.1, F54E7.2, F57B10.1, F58E2.9, K01G5.7, M7.1, R06A10.2, R07E4.6, R144.2, T04A8.7, T10B5.5, T21B10.7, T28F12.2, W03C9.4, W04A4.5, W06H3.3, Yl 10A7A.11, Y116A8C.42, Y32F6A.3, Y41D4B.19, Y41D4B.19, Y48G
  • Anodier embodiment is die for identifying a dierapeutic compound, in which the nematode gene also changes O-glcNAc modification of proteins, preferably selected from the group consisting of F26D10.3, F55F8.3, F59A2.1, W07E6.1, Y110A7A.8, Y39B6A.14, Y39B6A.33, Y87G2A.5, B0495.4, C56C10.3, F26H9.6, H15N14.2, H28)16.1, and W09B6.1.
  • Anodier embodiment is the method for identifying a dierapeutic compound further comprising the step of measuring the level of free glucose.
  • a further embodiment is a method in which die nematodes are subject to a glucose challenge.
  • Another embodiment is the method for identifying a therapeutic compound, in which the nematode is C. etegans. Another embodiment is the method for identifying a therapeutic compound, in which the compound is a candidate compound for treating glycogen storage disease or glucose metabolic syndrome, A further embodiment is a method, in which the disease is diabetes or obesity.
  • Another embodiment is the method for identifying a therapeutic compound, in which the nematode gene expression is impaired by siRNA.
  • Another embodiment is the method for detecting defects in glycogen synthesis or accumulation of glucose in the blood, comprising isolating cells of a subject, and measuring genetic expression of at least one human gene in the cells, wherein said human gene is a homolog of the nematode gene, preferably wherein the human gene is identified by isolating DNA from the nematode gene, and contacting said DNA with isolated DNA from a human cell under hybridization conditions that provide detection of DNA sequences have about 70% or greater nucleic acid sequence identity to the nematodes gene.
  • Another embodiment of the method is wherein genetic expression of a multiplicity of human genes is measured, preferably by changes in levels of mRNA, including by a microarray.
  • Another embodiment is wherein the genetic expression is a measure of the response of a subject to a therapeutic for treating a glucose metabolic syndrome. Another embodiment is wherein genetic expression of at least one human gene is measured by contacting protein of a sample from a subject with at least one antibody to measure expression levels of the human gene, preferably by an ELISA.
  • Another embodiment is the method for detecting defects in glucose metabolism in which the genetic expression is a measure of the response of a subject to a therapeutic for treating a glucose metabolic syndrome.
  • kits for use in the diagnosis of a glucose metabolic syndrome, or a propensity for associated diseases, in a patient includes a PCR primer complementary to an AMP deaminase nucleic acid sequence and instructions for diagnosing glucose metabolic syndrome or a propensity for associated diseases.
  • transgenic, non-human animal such as a mouse or a nematode
  • germ cells and somatic cells contain a transgene coding for a mutant polypeptide, for example, a mutant polypeptide that is derived from a human counterpart gene.
  • the transgene includes a knockout mutation.
  • the invention features cells (for example, cells isolated from a mammal, such as mouse, human, or nematode cells) isolated from the transgenic animals described above.
  • Another aspect of the invention features a method of screening for a compound that increases the storage or utilization of glycogen. This method includes (a) exposing a non- human transgenic animal whose germ cells and somatic cells contain a transgene coding for a mutant polypeptide to a candidate compound, and (b) determining the activity of the polypeptide in the transgenic animal. An increase in polypeptide activity, as compared to untreated controls, is indicative of a compound that is capable of increasing polypeptide activity.
  • the compound can be used to treat glucose metabolic syndrome, e.g., obesity.
  • the invention features a method of screening for a compound that correct the dysregulation of glycogen levels.
  • This method includes (a) exposing a non-human transgenic animal whose germ cells and somatic cells contain a transgene coding for a protein regulating glycogen storage to a candidate compound, and (b) determining the affect of the candidate compound on glycogen in the transgenic animal.
  • a change in glycogen levels, as compared to untreated controls, is indicative of a compound that is capable of correcting glycogen levels
  • the compound can be used to treat a glucose metabolic syndrome, including glycogen storage disease, obesity, or atherosclerosis.
  • Also included in the invention is a method of screening for a compound that is capable of ameliorating or delaying a glucose metabolic syndrome.
  • This method involves (a) exposing a transgenic, non-human animal whose germ cells and somatic cells contain a transgene coding for protein regulating glycogen storage to a candidate compound, and (b) monitoring the blood glucose level of the animal.
  • a compound that promotes maintenance of a physiologically acceptable level of blood glucose in the animal, as compared to untreated controls, is indicative of a compound that is capable of ameliorating or delaying a glucose metabolic syndrome.
  • the compound can be used to treat Type II diabetes.
  • Another method of screening for a compound that is capable of ameliorating or delaying obesity is also included in the invention.
  • This method involves (a) exposing a transgenic, non-human animal whose germ cells and somatic cells contain a transgene coding for a protein regulating glycogen storage to a candidate compound, and (b) monitoring the adipose tissue of the animal.
  • a compound that promotes maintenance of a physiologically acceptable level of adipose tissue in the animal, as compared to untreated controls, is indicative of a compound that is capable of ameliorating or delaying obesity.
  • a related method of the invention can be used for screening for a compound that is capable of ameliorating or delaying atherosclerosis.
  • This method involves (a) exposing a transgenic, non-human animal whose germ cells and somatic cells contain a transgene coding for a mutant AMP deaminase polypeptide to a candidate compound, and (b) monitoring the adipose tissue of the animal.
  • a compound that promotes maintenance of a physiologically acceptable level of adipose tissue in the animal, as compared to untreated controls, is indicative of a compound that is capable of ameliorating or delaying atherosclerosis.
  • the invention includes a method for identifying a modulatory compound that is capable decreasing the activity of a gene that regulates glycogen storage.
  • This method involves (a) providing a cell expressing the regulatory gene, and (b) contacting the cell with a candidate compound. A decrease in the gene expression following contact with the candidate compound identifies a modulatory compound.
  • the compound can be used to treat a glucose metabolic syndrome, including glycogen storage disease or obesity. This method can be carried out in an animal, such as a nematode.
  • the invention includes a method for die identification of a modulatory compound that is capable of increasing the expression of a regulatory gene.
  • This method involves (a) providing a cell expressing the regulatory gene, and (b) contacting the cell with a candidate compound. An increase in expression of the regulatory gene following contact with the candidate compound identifies a modulatory compound.
  • the compound can be used to treat a glucose metabolic syndrome, including glycogen storage disease or obesity. In other preferred embodiments, the compound is capable of increasing expression of the regulatory gene.
  • This method can be carried out in an animal, such as a nematode.
  • Glycogen storage disease is the result of defects in the processing of glycogen synthesis or breakdown within muscles, liver, and other cell types. GSDs are genetic disorders. Glycogen storage disease includes GSD type I (von Gierke's diseasehtt ⁇ ://en.wiki pedia.org/wiki/Glucose-6-phosphatase ' ).
  • GSD type II Pane's disease
  • GSD type III Cori's disease or Forbe's disease
  • GSD type IV Andersen disease
  • GSD type V McArdle disease
  • GSD type VI GSD type VIII, GSD type X, and Hers 1 disease
  • GSD type VII Trui's disease
  • GSD type O GSD type O.
  • C. elegans metabolic genes critical for glucose metabolism We identified C. elegans metabolic genes critical for glucose metabolism. Among these crucial genes, we determined that certain specific genes are key regulatory components that regulate glucose metabolism, and levels of glycogen. We discovered that dysregulation of AMP deaminase leads to accumulation of xylitol.
  • nematode genes are excellent candidate genes for human disease associated with glucose metabolic syndrome, e.g., glycogen storage disease, diabetes, obesity, and atherosclerosis.
  • human homologues of these regulatory genes may mediate regulation of glucose or glycogen storage in normal people and may be defective or deregulated in diabetics.
  • glucose metabolic syndrome any condition in which blood sugar levels are inappropriately elevated or lack normal metabolic regulation. Examples of such conditions include, without limitation, Type I diabetes, Type II diabetes, and gestational diabetes, glycogen storage disease and may be associated with obesity and atherosclerosis.
  • protein or “polypeptide” is meant any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation).
  • regulatory gene or “gene that regulates glycogen storage” is meant:
  • regulatory protein or “protein that regulates glycogen storage” is meant a protein encoded by a regulatory gene.
  • substantially pure is meant a preparation which is at least 60% by weight (dry weight) the compound of interest.
  • the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight the compound of interest. Purity can be measured by any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
  • isolated DNA DNA that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
  • nucleic acid By a “substantially identical" nucleic acid is meant a nucleic acid sequence which encodes a polypeptide differing only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the function of the polypeptide (assayed, e.g., as described herein).
  • the encoded sequence is at least 75%, more preferably 85%, and most preferably 95% identical at the amino acid level to the sequence of comparison.
  • nucleic acid sequences are compared a "substantially identical" nucleic acid sequence is one which is at least 85%, more preferably 90%, and most preferably 95% identical to the sequence of comparison.
  • the length of nucleic acid sequence comparison will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 110 nucleotides.
  • means for detecting any one or a series of components that sufficiently indicate a detection event of interest. Such means involve at least one label that may be assayed or observed, including, without limitation, radioactive, fluorescent, and chemiluminescent labels.
  • hybridization techniques any detection assay involving specific interactions (based on complementarity) between nucleic acid strands, including DNA-DNA, RNA-RNA, and DNA-RNA interactions. Such hybridization techniques may, if desired, include a PCR amplification step.
  • a “modulatory compound”, as used herein, is meant any compound capable of either decreasing gene expression (i.e., at the level of transcription, translation, or post- translation) or decreasing mRNA or protein levels or activity.
  • complementation is meant an improvement of a genetic defect or mutation. Complementation is generally accomplished by expressing the wild-type version of the protein in a host cell or animal bearing a mutant or inactive version of the gene.
  • oligonucleotide probes including degenerate oligonucleotide probes (i.e., a mixture of all possible coding sequences for a given amino acid sequence). These oligonucleotides may be based upon the sequence of either strand of the DNA.
  • oligonucleotide probes may be isolated from sequence databases.
  • sequences may be used to design degenerate oligonucleotide probes to probe large genomic or cDNA libraries directly.
  • General methods for designing and preparing such probes are provided.
  • These oligonucleotides are useful for regulatory gene isolation, either through their use as probes for hybridizing to complementary sequences of the gene or as primers for various polymerase chain reaction (PCR) cloning strategies. If a PCR approach is utilized, the primers are optionally designed to allow cloning of the amplified product into a suitable vector.
  • PCR polymerase chain reaction
  • oligonucleotide probes may be used for the screening of the recombinant DNA library.
  • the oligonucleotides are, for example, labeled with radioactive phosphate using methods known in the art, and the detectably- labeled oligonucleotides are used to probe filter replicas from a recombinant DNA library.
  • Recombinant DNA libraries may be prepared according to methods well known in the art, for example or may be obtained from commercial sources.
  • high stringency hybridization conditions may be employed; such conditions include hybridization at about 42 degree C. and about 50% formamide; a first wash at about 65 degree C, about 2X-SSC, and 1% SDS; followed by a second wash at about 65 degree C. and about 0.1% SDS, IX-SSC.
  • Lower stringency conditions for detecting the regulatory genes having less sequence identity to the nematode genes described herein include, for example, hybridization at about 42 degree C. in the absence of formamide; a first wash at about 42 degree C, about 6X-SSC, and about 1% SDS; and a second wash at about 50 degree C, about 6X-SSC, and about 1% SDS.
  • gene sequence-specific oligonucleotides may also be used as primers in PCR cloning strategies. Such PCR methods are well known in the art and are described. Again, sequences corresponding to conserved regions in a gene sequence (for example, those regions described above) are preferred for use in isolating mammalian counterpart gene sequences. Such probes may be used to screen cDNA as well as genomic DNA libraries.
  • Sequences obtained are then examined to identify those sequences having the highest amino acid sequence identity to the C. eiegans gene sequence.
  • an insulin responsive cell line e.g., the 3T3-L1 cell line
  • genetic transformation of such a cell line with wild type or dominantly activated versions of a cAMP deaminase gene may alter metabolism.
  • Such perturbations of metabolic control are stringent tests of candidate genes as homologues of the nematode gene.
  • mammalian candidate homologue acts in a metabolic control pathway, and is expressed in similar metabolic control tissues (liver, adipose), it is likely to function homologously to proteins expressed from C. eiegans genes.
  • Addition of a wild type or activated protein can confer on cell lines altered metabolic phenotypes. Thus supplying protein activity to such a cell line can alter its metabolism.
  • a number of screening procedures for identifying therapeutic compounds can be used in human patients.
  • compounds that down regulate or rescue expression of a nematode gene or its human homolog are considered useful in the invention.
  • the screening methods of the invention involve screening any number of compounds for therapeutically active agents by employing any number of in vitro or in vivo experimental systems. Exemplary methods useful for the identification of such compounds are detailed below.
  • the methods of the invention simplify the evaluation, identification, and development of active agents for the treatment and prevention of impaired glucose tolerance conditions, such as diabetes and obesity.
  • the screening methods provide a facile means for selecting natural product extracts or compounds of interest from a large population which are further evaluated and condensed to a few active and selective materials. Constituents of this pool are then purified and evaluated in the methods of the invention to determine their antidiabetic or anti-obesity activities or both.
  • novel drugs for the treatment of glucose metabolic syndrome conditions are identified from large libraries of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art.
  • test extracts or compounds are not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds.
  • Synthetic compound libraries are commercially.
  • libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources.
  • natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods.
  • any library or compound is readily modified using standard chemical, physical, or biochemical methods.
  • the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having anti-diabetic or anti-obesity activities.
  • the same in vivo and in vitro assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for the treatment of pathogenicity are chemically modified according to methods known in the art. Compounds identified as being of therapeutic value are subsequently analyzed using any standard animal model of diabetes or obesity known in the art.
  • Other drug screening assays may also be performed using either C. elegans worms or mammalian cell cultures. If desired, such assays may include the use of reporter gene constructs.
  • human homologs of the regulatory genes represent useful screening methods.
  • Expression of the human homologs in C elegans is accomplished according to standard methods and, if desired, such genes may be operatively linked to a gene promoter obtained from C. elegans.
  • promoters include, without limitation, the endogenous C. elegans regulatory gene promoter.
  • mammalian tissue culture cells expressing homologs to C elegans regulatory genes may be used to evaluate the ability of a test compound or extract to modulate glycogen storage or glucose metabolism. Because the signaling pathways from the ligands, receptors, kinase cascades, and downstream transcription factors are conserved from man to worm, test compounds or extracts that inhibit or activate the worm signaling proteins should also inhibit or activate their respective human homolog.
  • the invention involves the use of a reporter gene that is expressed under the control of a C. elegans gene promoter, e.g., a promoter that includes the enhancer element, such as a C. elegans regulatory gene promoter.
  • a C. elegans gene promoter e.g., a promoter that includes the enhancer element, such as a C. elegans regulatory gene promoter.
  • the enhancer element is cloned upstream of any standard reporter gene, e.g., the luciferase or green fluorescent protein (GFP) reporter genes.
  • the GFP reporter gene is used in C. elegans.
  • either the GFP or the luciferase reporter genes may used in a mammalian cell based assay.
  • the reporter gene construct is subsequently introduced into an appropriate host (e.g., C. elegans or a mammalian cell) according to any standard method known in the art. Analysis of reporter gene activity in the host organism or cell is determined according to any standard method, e.g., those methods described herein. Such reporter gene (and host cell systems) are useful for screening for drugs that modulate glucose metabolism or levels of glycogen.
  • an appropriate host e.g., C. elegans or a mammalian cell
  • Analysis of reporter gene activity in the host organism or cell is determined according to any standard method, e.g., those methods described herein.
  • Such reporter gene (and host cell systems) are useful for screening for drugs that modulate glucose metabolism or levels of glycogen.
  • the above-described reporter gene construct is introduced into wild-type C. elegans according to standard methods known in the art. If the enhancer element is operational, then it is expected that reporter gene expression is turned on. Alternatively, in mutants carrying the above-described reporter gene construct, reporter gene activity is turned off.
  • test compounds or extracts are evaluated for the ability to disrupt the signaling pathways described herein.
  • cAMP deaminase mutant worms carrying the reporter gene construct are used to assay the expression of the reporter gene.
  • the majority of worms expressing the reporter gene will have defective glycogen storage.
  • Such mutants are selected using methods described in the Examples, and reporter gene expression in the test compound or extract is assayed according to standard methods, e.g., worms are examined to reveal the presence of reporter gene expression, e.g., GFP.
  • reporter gene expression e.g., GFP.
  • Candidate compounds that suppress the regulatory gene phenotype or turn on reporter gene expression, i.e., activate signals in the absence of regulatory gene receptor are considered useful in the invention.
  • Mammalian insulin-responsive cell lines are also useful in the screening methods of the invention.
  • reporter gene constructs for example, those described above
  • Exemplary cell lines include, but are not limited to, mouse 3T3, L6, and Ll cells.
  • Introduction of the constructs into such cell lines is carried out according to standard methods well known in the art.
  • To test a compound or extract it is added to the cell line, and reporter gene expression is monitored.
  • Compounds that induce reporter gene expression in the absence of regulatory gene signaling are considered useful in the invention. Such compounds may also turn the cells into adipocytes, as insulin does.
  • test compounds identified in mammalian cells may be tested in other screening assays described herein, and, in general, test compounds may be assayed in multiple screens to confirm involvement in signaling of a regulatory gene.
  • Metabolic control by protein expressed by a regulatory gene may be tested using any known cell line, e.g., those described herein.
  • test compounds are screened for the ability to activate the phosphorylation of proteins encoded by regulatory genes in vitro.
  • the protein encoded by a regulatory gene is preferably tagged with a heterologous protein domain, for example, the mycepitope tag domain(s)., and are incubated with the C-terminal kinase domain of the regulatory protein.
  • Phosphorylation of the Smad proteins is preferably detected by immunoprecipitation using antibodies specific to the tag, followed by scintillation counting.
  • Test compounds may be screened in high throughout microtiter plate assays.
  • test compound ⁇ at effectively stimulates the phosphorylation of cAMP deaminase is considered useful in the invention.
  • compounds that activate the phosphorylation of cAMP deaminase by AKT or GSK-3 may also be identified.
  • useful therapeutic compounds include those which down regulate the expression or activity of a regulatory gene or protein.
  • regulatory gene expression is measured following the addition of candidate antagonist molecules to a culture medium of the regulatory gene-expressing cells, or cells treated to inhibit expression of the regulatory gene.
  • the candidate antagonists may be directly administered to animals (for example, nematodes or mice) and used to screen for their effects on the expression of the regulatory gene.
  • the expression of the regulatory gene is measured, for example, by standard Northern blot analysis using a nucleic acid sequence (or fragment thereof) of the regulatory gene as a hybridization probe.
  • the level of expression of the regulatory gene in the presence of the candidate molecule is compared to the level measured for the same cells, in the same culture medium, or in a parallel set of test animals, but in the absence of the candidate molecule.
  • Preferred modulators for anti-diabetic or anti-obesity purposes are those which cause a change in expression of the regulatory gene.
  • die effect of candidate modulators on expression or activity may be measured at the level of regulatory protein production using the same general approach in combination with standard immunological detection techniques, such as Western blotting or immunoprecipitation with a regulatory gene-specific antibody.
  • useful anti-diabetic or anti-obesity therapeutic modulators are identified as those which produce a change in production of the regulatory gene.
  • Antagonists may also affect activity of the regulatory protein without any effect on expression level. Phosphorylation state may be monitored by standard Western blotting using antibodies specific for phosphorylated amino acids.
  • reporter genes bearing operably linked regulatory protein binding sites may be used to directly monitor the effects of antagonists on regulatory gene activity.
  • Candidate modulators may be purified (or substantially purified) molecules or may be one component of a mixture of compounds (e.g., an extract or supernatant obtained from cells). In a mixed compound assay, expression of the regulatory gene is tested against progressively smaller subsets of the candidate compound pool until a single compound or minimal compound mixture is demonstrated to modulate regulatory gene expression.
  • Candidate regulatory gene antagonists include peptide as well as non-peptide molecules (e.g., peptide or non-peptide molecules found, e.g., in a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured).
  • non-peptide molecules e.g., peptide or non-peptide molecules found, e.g., in a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured.
  • Antagonists found to be effective at the level of cellular expression of regulatory genes or activity may be confirmed as useful in animal models (for example, nematodes or mice).
  • the compound may ameliorate the glucose metabolic syndrome, e.g., diabetic symptoms of mouse models for Type II diabetes (e.g., a db mouse model), mouse models for Type I diabetes, or models of streptozocin-induced ⁇ cell destruction.
  • a molecule which promotes a decrease in expression of a regulatory gene or regulatory protein activity is considered particularly useful in the invention; such a molecule may be used, for example, as a therapeutic to decrease the level or activity of native, cellular regulatory protein and thereby treat a glucose metabolic syndrome in an animal (for example, a human).
  • treatment with an antagonist of the invention may be combined with any other anti-diabetic or anti-obesity therapies.
  • useful therapeutic compounds are those which up regulate the expression of the regulatory gene or activity of regulatory protein.
  • expression of these genes is measured following the addition of candidate agonist molecules to a culture medium of regulatory gene-expressing cells.
  • the candidate agonists may be directly administered to animals (for example, nematodes or mice) and used to screen for effects on expression of the regulatory gene.
  • Regulatory gene-expression is measured, for example, by standard Northern blot analysis using all or a portion of one of these genes as a hybridization probe.
  • the level of expression of the regulatory gene in the presence of the candidate molecule is compared to the level measured for the same cells, in the same culture medium, or in a parallel set of test animals, but in the absence of the candidate molecule.
  • Preferred modulators for anti-diabetic or anti-obesity purposes are those which cause an increase in expression of a regulatory gene.
  • the effect of candidate modulators on expression may be measured at the level of regulatory protein production using the same general approach in combination with standard immunological detection techniques, such as Western blotting or immunoprecipitation with an appropriate antibody. Again, the phosphorylation state of these polypeptides is indicative of regulatory protein activity and may be measured on Western blots.
  • Useful anti-diabetic or anti-obesity modulators are identified as those which produce an increase in regulatory protein production.
  • Candidate modulators may be purified (or substantially purified) molecules or may be one component of a mixture of compounds (e.g., an extract or supernatant obtained from cells).
  • expression of a regulatory gene is tested against progressively smaller subsets of the candidate compound pool until a single compound or minimal compound mixture is demonstrated to modulate expression of a regulatory gene.
  • candidate compounds may be screened for those which agonize native or recombinant regulatory protein activities.
  • phosphorylation of a regulatory protein may be activated by agonists.
  • Candidate regulatory gene agonists include peptide as well as non-peptide molecules (e.g., peptide or non-peptide molecules found, e.g., in a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured).
  • non-peptide molecules e.g., peptide or non-peptide molecules found, e.g., in a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured.
  • Agonists found to be effective at the level of cellular expression of a regulatory gene or activity of a regulatory protein may be confirmed as useful in animal models (for example, nematodes or mice).
  • a molecule which promotes an increase in expression of a regulatory gene or activity of a regulatory protein is considered particularly useful in the invention; such a molecule may be used, for example, as a therapeutic to increase the level or activity of these native, cellular genes and thereby treat glucose metabolic syndrome.
  • treatment with a regulatory gene agonist may be combined with any other anti-diabetic or anti-obesity therapies.
  • Test compounds identified as having activity in any of the above-described assays are subsequently screened in any number of available diabetic or obesity animal model systems, including, but not limited to ob, db, agouti mice, or fatty rats. Test compounds are administered to these animals according to standard methods. Additionally, test compounds may be tested in mice bearing knockout mutations in the insulin receptor, IGF-I receptor, IR- related receptor, or any of the genes described herein. Compounds can also be tested using any standard mouse or rat model of Type I diabetes, e.g., a streptozin ablated pancreas model.
  • the invention involves the administration of regulatory protein or its homolog as a method for treating diabetes or obesity. Evaluation of the effectiveness of such a compound is accomplished using any standard animal model, for example, the animal diabetic model systems described above. Because these mouse diabetic models are also associated with obesity, they provide preferred models for human obesity associated Type II diabetes as well. Such diabetic or obese mice are administered C. elegans or a human counterpart to a regulatory protein according to standard methods well known in the art. Treated and untreated controls are then monitored for the ability of the compound to ameliorate the symptoms of the disease, e.g., by monitoring blood glucose, glycogen levels, ketoacidosis, and atherosclerosis. Normalization of blood glucose and insulin levels is taken as an indication that the compound is effective at treating a glucose metabolic syndrome.
  • Compounds of the invention may be administered with a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form.
  • a pharmaceutically-acceptable diluent, carrier, or excipient Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer such compositions to patients.
  • intravenous administration is preferred, any appropriate route of administration may be employed, for example, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, or oral administration.
  • Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
  • Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene- polyoxypropylene copolymers may be used to control the release of the compounds.
  • Other potentially useful parenteral delivery systems for antagonists or agonists of the invention include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
  • Regulatory molecules are administered at any appropriate concentration.
  • regulatory proteins are involved in glucose metabolism enables assays for genetic testing to identify those individuals with predispositions toward the development of glucose metabolic syndrome, such as glycogen storage disease, diabetes or obesity, by determining the presence of a mutation found in a human gene having identity to any of the C. elegans regulatory genes.
  • the development of this testing method requires that the individual be a member of a family that has multiple affected and unaffected members carrying one mutation from the list of above- listed genes.
  • a diabetic or obesity phenotype may be produced by mutations of regulatory genes found on different chromosomes, and that low resolution genetic mapping of the diabetic condition in single family pedigrees will be sufficient to favor regulatory genes over others as causing the glucose metabolic syndrome in a particular pedigree, hi one particular example, mutations associated with glucose metabolic syndrome may be found in different genes in, for example, the regulatory gene signaling pathway in each pedigree.
  • mutations in a common pathway can show complex genetic interactions, multiple regulatory gene mutations may segregate in single pedigress. These mutations can behave recessively in some genetic backgrounds and dominantly in others.
  • chromosomal marker it may be necessary to evaluate the association of inheritance patterns of several different chromosomal markers (for example, from the collection of highly polymorphic mapped DNA allelic variants) in the genomic DNAs of family members and of the clinically affected individuals. Methods commonly used in determining segregation patterns of human genetic diseases are well known in the art. In addition, methods are known in the art for determining whether individuals in a family are useful for providing information to determine co-segregation of an allele with a glucose metabolic syndrome trait, including altered glycogen levels.
  • fragments of genomic DNA are prepared from each of the available members of the family, and each distinctive DNA allelic variant of the polymorphic chromosome marker within the family is evaluated to determine which polymorphisms (i.e., chromosomal region) is linked with the glucose metabolic syndrome phenotype within a particular family.
  • the parents of the marker individual be heterozyous for a DNA allelic variant so that the segregation pattern of the DNA allelic variant linked with the diabetic or obese phenotype in the marker can be recognized.
  • the inheritance of the diabetic phenotype can be judged to be dominant or recessive, depending on the pattern of inheritance.
  • diabetes is dominantly inherited, and therefore inbred pedigrees are generally not necessary in the etiology of the diabetic condition.
  • Type II diabetes the highest rate of this kind of diabetes in the world is found in American Indians of the Pima tribe. Such families are useful for mapping one particular cause of diabetes, but, in general, diabetes is caused by mutations in a variety of genes.
  • a particular regulatory gene mutation can be associated with a particular diabetic pedigree.
  • Human regulatory gene homologues are mapped to chromosome regions using standard methods. The regulatory gene regions are PCR amplified and compared between affected and unaffected DNA samples. Mutations detected in affected individuals are expected to (but need not) map to conserved domains of the regulatory genes. Because it is known that not all carriers of known diabetes-inducing mutations show metabolic defects, we expect that some non-diabetic non-glucose intolerant family members will carry the same regulatory gene mutation as affected family members. For this reason, a correlation of affected family members with a regulatory gene mutation is more important than a correlation of nonaffected with no mutation. Those skilled in the art will know that phenotypic classification of affected and unaffected individuals can greatly enhance the power of this genetic analysis.
  • a risk factor may be calculated for an individual in a regulatory gene chromosome family in a manner similar to those described for assessing the risk of other commonly known genetic diseases that are known to run in families, e.g., Huntington's disease and cystic fibrosis.
  • regulatory gene regions are PCR amplified from patients and mutations detected in the regulatory genes using standard DNA sequencing or oligonucleotide hybridization techniques.
  • the use of such gene sequences or specific antibody probes to the products of these sequences provide valuable diagnostics, particularly in view of the likelihood there exist two classes of type II diabetics: those with defects in the TGF-beta signaling genes, and those with defects in insulin signaling genes. Such genetic tests will influence whether drugs that affect regulatory gene or signals associated with regulatory proteins are prescribed.
  • mammalian homologs corresponding to the C. elegans regulatory genes are isolated as described above. Again, standard hybridization or PCR cloning strategies are employed, preferably utilizing conserved regulatory gene motifs for probe design followed by comparison of less conserved sequences flanking these motifs. Exemplary motifs for these genes are as follows;
  • the invention includes any protein which possesses the requisite level of amino acid sequence identity (as defined herein) to regulatory gene sequence; such homologs include other substantially pure naturally-occurring mammalian regulatory proteins as well as allelic variants; natural mutants; induced mutants; proteins encoded by DNA that hybridizes to the regulatory gene DNA sequence or degenerate conserved domains of regulatory proteins (e.g., those described herein) under high stringency conditions; and proteins specifically bound by antisera directed to a regulatory protein.
  • homologs include other substantially pure naturally-occurring mammalian regulatory proteins as well as allelic variants; natural mutants; induced mutants; proteins encoded by DNA that hybridizes to the regulatory gene DNA sequence or degenerate conserved domains of regulatory proteins (e.g., those described herein) under high stringency conditions; and proteins specifically bound by antisera directed to a regulatory protein.
  • the invention further includes analogs of any naturally-occurring regulatory proteins.
  • Analogs can differ from the naturally-occurring protein by amino acid sequence differences which do not destroy function, by post-translational modifications, or by both. Modifications include in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes.
  • Analogs can also differ from the naturally-occurring regulatory protein by alterations in primary sequence.
  • cyclized peptides, molecules, and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., .beta, or gamma, amino acids.
  • the invention also includes fragments of a regulatory protein.
  • fragment means at least 20 contiguous amino acids, preferably at least 30 contiguous amino acids, more preferably at least 50 contiguous amino acids, and most preferably at least 60 to 80 or more contiguous amino acids. Fragments of such regulatory protein can be generated by methods known to those skilled in the art or may result from normal protein processing (e.g., removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events).
  • all or a portion of the regulatory protein sequence may be fused to another protein (for example, by recombinant means).
  • the regulatory protein may be fused to the green fluorescent protein, GFP.
  • GFP green fluorescent protein
  • the methods of the invention may be used to diagnose or treat any condition related to glucose metabolic syndrome or obesity in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is diagnosed or treated, the polypeptide, nucleic acid, or antibody employed is preferably specific for that species.
  • the methods of the invention may be used to diagnose or treat any condition related to glucose metabolic syndrome or obesity in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is diagnosed or treated, the regulatory protein, nucleic acid, or antibody employed is preferably specific for that species.
  • Whole Caenorhabditis elegans nematodes can be assessed for glycogen storage by exposing live animals to iodine vapor or a diluted (1:10-1:20) Lugol's iodine solution (2% I 2 in 4% KI). Both methods require 30-60s to fully react with the glycogen in the worm.
  • the color of stained glycogen in the animal is usually dark red, but can be crimson or purple/black, depending upon the branching of the glycogen in the animal.
  • a negative reaction has a yellow/brown color, which is the same color as a dilute iodine solution.
  • RNAi phenotypes that were altered by hexosamine signaling, all of the '+' and '-' clones from the original screen were tested with N2 as well as oga-1 (for '+' phenotypes) or ogt-1 (for '- * phenotypes). For each RNAi strain, both N2 and either oga-1 or ogt- 1 were assayed simultaneously for rescue of the glycogen phenotype by iodine staining.
  • C. elegans were fed glucose by incubating the animals in a glucose solution, or by growing the animals on solid media seeded with bacteria and supplemented with glucose. Animals incubated for 48 hours in a 5% glucose solution gave a very strongly positive glycogen storage reaction, while those in a 0% glucose solution did not. Animals grown on glucose-supplemented plates have at least twice the level of internal free glucose when compared to animals grown on normal media.
  • the phenotypes fall into the following categories:
  • Glycogen appears in the normal locations, but has an abnormal appearance (ab). If the glycogen appears outside the normal locations, the glycogen is not widely distributed. This phenotype can be accompanied by either more (ab+) or less (ab-) glycogen overall.
  • Glycogen appears widely distributed in the body of the worm (B). This probably indicates hypodermal or gut storage of glycogen. The phenotype is often accompanied by an overall increase in glycogen storage (B+). Less Glycogen than normal
  • AMPdeaminase results obtained from that mutant/knockdown.
  • Ten genotypes identified in the screen were given the glucosechallenge testdescribed above wherein worms arefed additional glucose on plates.
  • the level offree glucose in wild-type worms increased to 2.2 times the value inunchallenged worms.
  • the level offree glucose in worms treated with RNAi againstAMP deaminase (CDS C34F11.3) only increased 1.7 times the wild-type value.
  • these animals accumulated large quantities ofthe sugar alcohol xylitol.
  • Xylitol is not found in wild-type animals treated with glucose or inAMPdeaminaseknockdown animals that arenot treated with glucose. Both loss offunction mutations in AMP deaminase and treatmentwith xylitol have previously been associated with improved glucosehomeostasis inhumans.
  • Glycogen storage in the nematode was altered by changing the nutrient supply. Nematodes placed in buffer for 24 hrs gradually lose their glycogen, while those placed in a 5% (w/v) glucose solution accumulate glycogen for at least 48 hrs. Nematode oga-1 and ogt- 1 mutant animals lack the ability to remove and add O-glcNAc modifications to proteins, respectively. When exposed to the same conditions, ogt-1 animals were found to be more capable than wild type or oga-1 nematodes to synthesize glycogen in the presence of glucose.
  • RNAi glycogen phenotypes that were rescued through the presence of the additional mutation in oga-1 or ogt-1.
  • Fourteen RNAi clones were found to be rescued in these mutants , eight from the oga-1 phenotypes, and six from the ogt-1 phenotypes (Table 1).
  • npp-9 (F59A2.1) is a homolog of RanBP2, deficiency of which results in defects in glucose catabolism in mammalian models;
  • pod-2 which encodes acetyl-CoA carboxylase, is known to influence insulin secretion in rodents;
  • nsf-1 and VPS-32.1 are also needed for glucose derepression in yeast, a sodium-proton exchanger, is induced in the kidney in response to insulin in mammals.
  • Another major class of targets from this screen was genes involved with ribosomal biogenesis and export.
  • Six of the eight genes rescues by oga-1 are directly implicated in this process, strongly implying an interaction between ribosome biogenesis and glucose metabolism that may operate through hexosamine signaling, e.g., hsp-1, shuttles to the nucleus during environmental stress, and has glucose-regulated O-glcNAc lectin activity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Diabetes (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

What are described are methods of screening for or detecting defects in glucose metabolism in subjects, including screening for therapeutic molecules for treating diseases in glucose metabolism.

Description

METHODS FOR TREATING AND DIAGNOSING GLUCOSE METABOLIC SYNDROME
CROSS REFERENCETO RELATED APPLICATION
This application claims the benefit of U.S. Provisional Application No. 61/220,382, filed on June 25, 2009, which is hereby incorporated by reference in its entirety.
TECHNICAL FIELD
The technical area of the description pertains to methods of screening for or detecting defects in glucose metabolism in subjects, including screening for therapeutic molecules for treating diseases in glucose metabolism.
BACKGROUND
This invention relates to compositions and methods useful for delaying or ameliorating human diseases associated with glucose metabolic syndrome. Abnormalities of glucose metabolism are the most common errors of carbohydrate metabolism. Disorders associated with elevated levels of plasma glucose have been classified into three categories: diabetes mellitus (DM) type 1 , DM type 2 and maturity onset diabetes of youth (MODY), a subtype of DM 2. Both nutrition and the genetic response to nutrients play a role in the etiology of diabetes mellitus type II.
Glucose metabolic syndrome includes glycogen storage disease (GSD). GSD is the result of defects in the processing of glycogen synthesis or breakdown within muscles, liver, and other cell types. GSD has two classes of cause: genetic and acquired. Genetic GSD is caused by any inborn error of metabolism. Many animals utilize the hexosamine signaling pathway as a means to detect and respond to environmental nutrient supply. This nutrient sensing pathway works by converting a small percent of absorbed glucose to N- acetylglucosamine. N-acetylglucosamine is then transferred to hydroxyl groups of serine and threonine residues of a variety of substrates, creating an O-linked N-acetylglucosamine (O- glcNAc) modification.
At present there are few reliable methods for diagnosis of a genetic predisposition for abnormalities in glucose metabolism or GSD prior to major changes in health, including diabetes and obesity. The search for genetic markers linked to diabetes and obesity has proven difficult. There remains a need for identifying genetic targets for diagnosis and therapy in detecting, preventing or treating glucose metabolic syndromes, including GSD.
SUMMARY
One aspect of the invention is a method for identifying a therapeutic compound that restores normal glycogen accumulation, said method comprising: a) providing a nematode or an isolated nematode cell having impaired expression of a nematode gene; b) contacting said nematode or isolated nematode cell with a candidate compound; and c) comprising the step of measuring glycogen distribution; and d) selecting for a compound that changes levels of glycogen accumulation. Further information regarding the following referenced C. elegans genes can be found at http://www.wormbase.org a universal repository database containing reference sequence information for all C. elegans genes.
An embodiment of the invention is the method for identifying a therapeutic compound, in which the nematode gene is selected from the group consisting of B0491.5, B0495.4, C02F5.9, C05C8.7, C06H2.1, C09G5.6, C09H10.3, C15C7.5, C16A3.5, C18E9.4, C23H4.1, C27A2.2, C29E4.8, C30C11.2, C33D3.1, C34B2.8, C34E10.6, C46G7.1, C47B2.4, C50D2.1, C52E4.4, C53A5.1, C53A5.6, C53B7.4, C53D5.6, C54G4.8, C56G2.6, CD4.6, D1014.3J F01G10.1, F02E8.1, F10E7.7, F11G11.10! F14H8.2, F20G4.1) F23B12.5, F23H11.5, F25B4.6, F25H5.5, F26E4.6, F26E4.9, F26H9.6, F29C4.2, F29G6.3, F29G9.3, F32A7.6, F32D1.2, F33A8.1, F36A2.7, F40F4.6, F45H10.2, F46F11.5, F49C12.12, F49C12.13, F54D7.2, F54F2.1, F54H12.6, F55A3.3, F55A3.7, F56H1.4, F59C6.5, H15N14.2, H18N23.2, H28O16.1, H37A05.1, K02D10.5, K03A1.1, K04G7.4, K05C4.1, K07A12.3, K07D8.1, K08D12.1, K08E3.5, LLC1.3, M01F1.5, RlOEl 1.2, R53.4, T02H6.11, T05D4.4, T10D4.3, T13C5.1, T14B4.6, T14B4.7, T20H4.5, T23H2.5, T26A5.3, T28D9.10, VW02B12L.1, VW02B12L.1, W02F12.5, W09C5.8, Y105E8A.9, Y106G6H.3, Y110A2AL.8, Y116A8C.35, Y37D8A.14, Y45G12B.1, Y46G5A.31, Y47D3B.7, Y47G6A.23, Y48B6A.3, Y57E12AL.5, Y57G11C.12, Y57G11C.24, Y71F9AL.17, Y7ΪF9BA Y71H2B.10, Y82E9BR.15, Y82E9BR.3, ZC328.3, ZK328.5, ZK430.8, AC7.1, C04F6.1, C23G10.4, C23H3.4, C30B5.6, C36B1.4, C56C10.3, F23F1.8, F26D11.13, F27C1.7, F35H10.4, F38A5.5, F38E11.5, F39H11.5, F53G12.3, F55A12.7, F56C11.1, F57B9.10, F57B9.2, F59E10.3, H19M22.2, K07D4.3, K08E5.3, K11D9.2, R03E1.2, RlOElU, R12E2.3, T01H3.1, T14F9.1, T14G10.5, T20F5.2, W09B6.1, YlllB2A.14, Y25C1A.5, Y39B6A.12, Y49E10.1, Y55H10A.1, Y71D11A.5, ZK1058.3, ZK180.4, and ZK970.4, K10C2.4 and R05D11.3, and wherein die impaired expression of die nematode gene decreases glycogen levels.
Another embodiment is die mediod for identifying a therapeutic compound, in which the nematode gene is selected from die group wherein the nematode gene is selected from die group consisting of B0047 AB0393. l,C05D2.1, C27H6.2, C34F11.3, C47D12.6, F22B5.2, F22D6.3, F26DI0.3, F39B2.4, F42A8.1, F54D5.11, F55A12.8, F55B11.2, K06A1.6, K08E3.6, R06F6.1, R74.1, T01G9.6, T02G5.9, T03F1.9, T04A8.14, T11G6.1, T28F3.2, W07E6.4, Y110A7A.8, Y39G10AR.7, Y39G10AR.8, Y48G1A.4, Y57G11C.19, Y80D3A.1, Y87G2A.5, Y95B8A.10, ZK1127.5, K04E7.2C48E7.2, D2089.1, F14B4.3, F19F10.9, F55F8.3, K06A5.4, T23D8.3, T23D8.9, W07E6.1, Y48G1A.4, Y54E10A.15, C37C3.6, F38A6.1, Y39B6A.33, Y53C10A.3, and ZC168.5, and wherein the impaired expression of the nematode gene increases glycogen levels.
Anodier embodiment is die mediod for identifying a dierapeutic compound, in which die nematode gene is selected from the group wherein the nematode gene is selected from the group consisting of B0336.2, C03D6.1, C03D6.3, C12C8.3, , C14C10.4, C16A3.4, D1054.15, F02D10.5, F13D12.7, F26E4.8, F36F2.3, F44A6.2, F48E8.5, F54A3.3, F54C9.1, F54E7.2, F57B10.1, F58E2.9, K01G5.7, M7.1, R06A10.2, R07E4.6, R144.2, T04A8.7, T10B5.5, T21B10.7, T28F12.2, W03C9.4, W04A4.5, W06H3.3, Yl 10A7A.11, Y116A8C.42, Y32F6A.3, Y41D4B.19, Y41D4B.19, Y48G1A.5, Y55F3AR.3, Y55F3AR.3, Y6B3A.1, Y71F9AM.5, Y71G12B.i l, Y71G12B.il, ZK1151.2, ZK1290.3, ZK652.1, C29A12.3, C37H5.5, F28B3.7, F32D1.10, F53F4.11, F56A3.3, F59A2.1, KO7C5A T19B4.2, T23D8.4, T27B1.2, Y39B6A.14, and Y9C9A.8, and wherein the impaired expression of the nematode gene causes abnormal glycogen distribution.
Anodier embodiment is die for identifying a dierapeutic compound, in which the nematode gene also changes O-glcNAc modification of proteins, preferably selected from the group consisting of F26D10.3, F55F8.3, F59A2.1, W07E6.1, Y110A7A.8, Y39B6A.14, Y39B6A.33, Y87G2A.5, B0495.4, C56C10.3, F26H9.6, H15N14.2, H28)16.1, and W09B6.1.
Anodier embodiment is the method for identifying a dierapeutic compound further comprising the step of measuring the level of free glucose. A further embodiment is a method in which die nematodes are subject to a glucose challenge.
Another embodiment is the method for identifying a therapeutic compound, in which the nematode is C. etegans. Another embodiment is the method for identifying a therapeutic compound, in which the compound is a candidate compound for treating glycogen storage disease or glucose metabolic syndrome, A further embodiment is a method, in which the disease is diabetes or obesity.
Another embodiment is the method for identifying a therapeutic compound, in which the nematode gene expression is impaired by siRNA.
Another embodiment is the method for detecting defects in glycogen synthesis or accumulation of glucose in the blood, comprising isolating cells of a subject, and measuring genetic expression of at least one human gene in the cells, wherein said human gene is a homolog of the nematode gene, preferably wherein the human gene is identified by isolating DNA from the nematode gene, and contacting said DNA with isolated DNA from a human cell under hybridization conditions that provide detection of DNA sequences have about 70% or greater nucleic acid sequence identity to the nematodes gene. Another embodiment of the method is wherein genetic expression of a multiplicity of human genes is measured, preferably by changes in levels of mRNA, including by a microarray. Another embodiment is wherein the genetic expression is a measure of the response of a subject to a therapeutic for treating a glucose metabolic syndrome. Another embodiment is wherein genetic expression of at least one human gene is measured by contacting protein of a sample from a subject with at least one antibody to measure expression levels of the human gene, preferably by an ELISA.
Another embodiment is the method for detecting defects in glucose metabolism in which the genetic expression is a measure of the response of a subject to a therapeutic for treating a glucose metabolic syndrome.
The invention also includes kits for use in the diagnosis of a glucose metabolic syndrome, or a propensity for associated diseases, in a patient. One such kit includes a PCR primer complementary to an AMP deaminase nucleic acid sequence and instructions for diagnosing glucose metabolic syndrome or a propensity for associated diseases.
Yet another aspect of the invention features a transgenic, non-human animal, such as a mouse or a nematode, whose germ cells and somatic cells contain a transgene coding for a mutant polypeptide, for example, a mutant polypeptide that is derived from a human counterpart gene. In another preferred embodiment, the transgene includes a knockout mutation.
In related aspects, the invention features cells (for example, cells isolated from a mammal, such as mouse, human, or nematode cells) isolated from the transgenic animals described above. Another aspect of the invention features a method of screening for a compound that increases the storage or utilization of glycogen. This method includes (a) exposing a non- human transgenic animal whose germ cells and somatic cells contain a transgene coding for a mutant polypeptide to a candidate compound, and (b) determining the activity of the polypeptide in the transgenic animal. An increase in polypeptide activity, as compared to untreated controls, is indicative of a compound that is capable of increasing polypeptide activity. In preferred embodiments, the compound can be used to treat glucose metabolic syndrome, e.g., obesity. hi a related aspect, the invention features a method of screening for a compound that correct the dysregulation of glycogen levels. This method includes (a) exposing a non-human transgenic animal whose germ cells and somatic cells contain a transgene coding for a protein regulating glycogen storage to a candidate compound, and (b) determining the affect of the candidate compound on glycogen in the transgenic animal. A change in glycogen levels, as compared to untreated controls, is indicative of a compound that is capable of correcting glycogen levels, hi preferred embodiments, the compound can be used to treat a glucose metabolic syndrome, including glycogen storage disease, obesity, or atherosclerosis.
Also included in the invention is a method of screening for a compound that is capable of ameliorating or delaying a glucose metabolic syndrome. This method involves (a) exposing a transgenic, non-human animal whose germ cells and somatic cells contain a transgene coding for protein regulating glycogen storage to a candidate compound, and (b) monitoring the blood glucose level of the animal. A compound that promotes maintenance of a physiologically acceptable level of blood glucose in the animal, as compared to untreated controls, is indicative of a compound that is capable of ameliorating or delaying a glucose metabolic syndrome. In a preferred embodiment, the compound can be used to treat Type II diabetes.
Another method of screening for a compound that is capable of ameliorating or delaying obesity is also included in the invention. This method involves (a) exposing a transgenic, non-human animal whose germ cells and somatic cells contain a transgene coding for a protein regulating glycogen storage to a candidate compound, and (b) monitoring the adipose tissue of the animal. A compound that promotes maintenance of a physiologically acceptable level of adipose tissue in the animal, as compared to untreated controls, is indicative of a compound that is capable of ameliorating or delaying obesity.
A related method of the invention can be used for screening for a compound that is capable of ameliorating or delaying atherosclerosis. This method involves (a) exposing a transgenic, non-human animal whose germ cells and somatic cells contain a transgene coding for a mutant AMP deaminase polypeptide to a candidate compound, and (b) monitoring the adipose tissue of the animal. A compound that promotes maintenance of a physiologically acceptable level of adipose tissue in the animal, as compared to untreated controls, is indicative of a compound that is capable of ameliorating or delaying atherosclerosis.
In another aspect, the invention includes a method for identifying a modulatory compound that is capable decreasing the activity of a gene that regulates glycogen storage. This method involves (a) providing a cell expressing the regulatory gene, and (b) contacting the cell with a candidate compound. A decrease in the gene expression following contact with the candidate compound identifies a modulatory compound. In preferred embodiments, the compound can be used to treat a glucose metabolic syndrome, including glycogen storage disease or obesity. This method can be carried out in an animal, such as a nematode.
In a related aspect, the invention includes a method for die identification of a modulatory compound that is capable of increasing the expression of a regulatory gene. This method involves (a) providing a cell expressing the regulatory gene, and (b) contacting the cell with a candidate compound. An increase in expression of the regulatory gene following contact with the candidate compound identifies a modulatory compound. In preferred embodiments, the compound can be used to treat a glucose metabolic syndrome, including glycogen storage disease or obesity. In other preferred embodiments, the compound is capable of increasing expression of the regulatory gene. This method can be carried out in an animal, such as a nematode.
DETAILED DESCRIPTION
Glycogen storage disease is the result of defects in the processing of glycogen synthesis or breakdown within muscles, liver, and other cell types. GSDs are genetic disorders. Glycogen storage disease includes GSD type I (von Gierke's diseasehttρ://en.wiki pedia.org/wiki/Glucose-6-phosphatase'). GSD type II (Pompe's disease), GSD type III (Cori's disease or Forbe's disease),GSD type IV (Andersen disease), GSD type V (McArdle disease), GSD type VI (GSD type VIII, GSD type X, and Hers1 disease), GSD type VII (Tarui's disease), GSD type IX, GSD type XI (Fanconi-Bickel syndrome), and GSD type O.
We identified C. elegans metabolic genes critical for glucose metabolism. Among these crucial genes, we determined that certain specific genes are key regulatory components that regulate glucose metabolism, and levels of glycogen. We discovered that dysregulation of AMP deaminase leads to accumulation of xylitol.
These results indicate that specific nematode genes are excellent candidate genes for human disease associated with glucose metabolic syndrome, e.g., glycogen storage disease, diabetes, obesity, and atherosclerosis. Our findings indicate that the human homologues of these regulatory genes may mediate regulation of glucose or glycogen storage in normal people and may be defective or deregulated in diabetics.
By "glucose metabolic syndrome" is meant any condition in which blood sugar levels are inappropriately elevated or lack normal metabolic regulation. Examples of such conditions include, without limitation, Type I diabetes, Type II diabetes, and gestational diabetes, glycogen storage disease and may be associated with obesity and atherosclerosis.
By "protein" or "polypeptide" is meant any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation).
By "regulatory gene" or "gene that regulates glycogen storage" is meant:
(I) A C. elegans gene selected from the group consisting of B0491.5,
B0495.4, C02F5.9, C05C8.7, C06H2.1, C09G5.6, C09H10.3, C15C7.5, C16A3.5, C18E9.4, C23H4.1, C27A2.2, C29E4.8, C30C11.2, C33D3.1, C34B2.8, C34E10.6, C46G7.1, C47B2.4, C50D2.1, C52E4.4, C53A5.1, C53A5.6, C53B7.4, C53D5.6, C54G4.8, C56G2.6, CD4.6, D1014.3, F01G10.1, F02E8.1, F10E7.7, FIlGl 1.10, F14H8.2, F20G4.1, F23B12.5, F23H11.5, F25B4.6, F25H5.5, F26E4.6, F26E4.9, F26H9.6, F29C4.2, F29G6.3, F29G9.3, F32A7.6, F32D1.2, F33A8.1, F36A2.7, F40F4.6, F45H10.2, F46F11.5, F49C12.12, F49C12.13, F54D7.2, F54F2.1, F54H12.6, F55A3.3, F55A3.7, F56H1.4, F59C6.5, H15N14.2, H18N23.2, H28O16.1, H37A05.1, K02D10.5, K03A1.1, K04G7.4, K05C4.1, K07A12.3, K07D8.1, K08D12.1, K08E3.5, LLC1.3, MOlFl .5, R10E11.2, R53.4, T02H6.11, T05D4.4, T10D4.3, T13C5.1, T14B4.6, T14B4.7, T20H4.5, T23H2.5, T26A5.3, T28D9.10, VW02B12L.1, VW02B12L.1, W02F12.5, W09C5.8, Y105E8A.9, Y106G6H.3, Yl 10A2AL.8, Yl 16A8C.35, Y37D8A.14, Y45G12B.1, Y46G5A.31, Y47D3B.7, Y47G6A.23, Y48B6A.3, Y57E12AL.5, Y57G11C.12, Y57G11C.24, Y71F9AL.17, Y71F9B.4, Y71H2B.10, Y82E9BR.15, Y82E9BR.3, ZC328.3, ZK328.5, ZK430.8, AC7.1, C04F6.1, C23G10.4, C23H3.4, C30B5.6, C36B1.4, C56C10.3, F23F1.8, F26D11.13, F27C1.7, F35H10.4, F38A5.5, F38E11.5, F39H11.5, F53G12.3, F55AI2.7, F56C11.1, F57B9.10, F57B9.2, F59E10.3, H19M22.2, K07D4.3, K08E5.3, K11D9.2, R03E1.2, RlOEl 1.1, R12E2.3, T01H3.1, T14F9.1,
T14G10.5, T20F5.2, W09B6.1, Y111B2A.14, Y25C1A.5, Y39B6A.12,
Y49E10.1, Y55H10A.1, Y71D11A.5, ZK1O58.3, ZK180.4, and ZK970.4,
K10C2.4 and R05D11.3, in which impaired expression of the regulatory gene decreases glycogen levels;
(II) A C. elegans gene selected from the group consisting of
B0047.4,B0393.1,C05D2.1, C27H6.2, C34F11.3, C47D12.6, F22B5.2, F22D6.3, F26D10.3, F39B2.4, F42A8.1, F54D5.11, F55A12.8, F55B11.2, K06A1.6, K08E3.6, R06F6.1, R74.1, T01G9.6, T02G5.9, TO3F1.9, T04A8.14, T11G6.1, T28F3.2, W07E6.4, Yl 10A7A.8, Y39G10AR.7, Y39G10AR.8, Y48G1A.4, Y57G11C.19, Y80D3A.1, Y87G2A.5, Y95B8A.10, ZK1127.5, K04E7.2C48E7.2, D2089.1, F14B4.3, F19F10.9, F55F8.3, K06A5.4, T23D8.3, T23D8.9, W07E6.1, Y48G1A.4, Y54E10A.15, C37C3.6, F38A6.1, Y39B6A.33, Y53C10A.3, and ZC168.5 in which the impaired expression of the regulatory gene increases glycogen levels; or
(III) A C. etegans gene selected from the group consisting of BO336.2, C03D6.1, CO3D6.3, C12C8.3, , C14C10.4, C16A3.4, D1054.15, F02D10.5, F13D12.7, F26E4.8, F36F2.3, F44A6.2, F48E8.5, F54A3.3, F54C9.1, F54E7.2, F57B10.1, F58E2.9, K01G5.7, M7.1, R06A10.2, R07E4.6, R144.2, T04A8.7, T10B5.5, T21B10.7, T28F12.2, W03C9.4, W04A4.5, W06H3.3, Y110A7A.il, Yl 16A8C.42, Y32F6A.3, Y41D4B.19, Y41D4B.19, Y48G1A.5, Y55F3AR.3, Y55F3AR.3, Y6B3A.1, Y71F9AM.5, Y71G12B.il, Y71G12B.i l, ZK1151.2, ZK1290.3, ZK652.1, C29A12.3, C37H5.5, F28B3.7, F32D1.10, F53F4.11, F56A3.3, F59A2.1, K07C5.4, T19B4.2, T23D8.4, T27B1.2, Y39B6A.14, and Y9C9A.8.
Ln which the impaired expression of the regulatory gene causes abnormal glycogen distribution.
By "regulatory protein" or "protein that regulates glycogen storage" is meant a protein encoded by a regulatory gene.
By "substantially pure" is meant a preparation which is at least 60% by weight (dry weight) the compound of interest. Preferably the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight the compound of interest. Purity can be measured by any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
By "isolated DNA" is meant DNA that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
By a "substantially identical" nucleic acid is meant a nucleic acid sequence which encodes a polypeptide differing only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the function of the polypeptide (assayed, e.g., as described herein). Preferably, the encoded sequence is at least 75%, more preferably 85%, and most preferably 95% identical at the amino acid level to the sequence of comparison. If nucleic acid sequences are compared a "substantially identical" nucleic acid sequence is one which is at least 85%, more preferably 90%, and most preferably 95% identical to the sequence of comparison. The length of nucleic acid sequence comparison will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 110 nucleotides.
By "means for detecting" is meant any one or a series of components that sufficiently indicate a detection event of interest. Such means involve at least one label that may be assayed or observed, including, without limitation, radioactive, fluorescent, and chemiluminescent labels.
By "hybridization techniques" is meant any detection assay involving specific interactions (based on complementarity) between nucleic acid strands, including DNA-DNA, RNA-RNA, and DNA-RNA interactions. Such hybridization techniques may, if desired, include a PCR amplification step. By a "modulatory compound", as used herein, is meant any compound capable of either decreasing gene expression (i.e., at the level of transcription, translation, or post- translation) or decreasing mRNA or protein levels or activity.
By "complementation" is meant an improvement of a genetic defect or mutation. Complementation is generally accomplished by expressing the wild-type version of the protein in a host cell or animal bearing a mutant or inactive version of the gene.
Cloning Regulatory Gene Sequences
The isolation of human gene nucleic acid sequences for a gene that regulates glycogen storage is made possible using the known G elegans sequences and standard techniques. In particular, using all or a portion of the regulatory gene sequence, one may readily design oligonucleotide probes, including degenerate oligonucleotide probes (i.e., a mixture of all possible coding sequences for a given amino acid sequence). These oligonucleotides may be based upon the sequence of either strand of the DNA.
Using such motifs, may be isolated from sequence databases. Alternatively, such sequences may be used to design degenerate oligonucleotide probes to probe large genomic or cDNA libraries directly. General methods for designing and preparing such probes are provided. These oligonucleotides are useful for regulatory gene isolation, either through their use as probes for hybridizing to complementary sequences of the gene or as primers for various polymerase chain reaction (PCR) cloning strategies. If a PCR approach is utilized, the primers are optionally designed to allow cloning of the amplified product into a suitable vector.
Hybridization techniques and procedures are well known to those skilled in the art and are described. If desired, a combination of different oligonucleotide probes may be used for the screening of the recombinant DNA library. The oligonucleotides are, for example, labeled with radioactive phosphate using methods known in the art, and the detectably- labeled oligonucleotides are used to probe filter replicas from a recombinant DNA library. Recombinant DNA libraries may be prepared according to methods well known in the art, for example or may be obtained from commercial sources.
For detection or isolation of closely related gene sequences, high stringency hybridization conditions may be employed; such conditions include hybridization at about 42 degree C. and about 50% formamide; a first wash at about 65 degree C, about 2X-SSC, and 1% SDS; followed by a second wash at about 65 degree C. and about 0.1% SDS, IX-SSC. Lower stringency conditions for detecting the regulatory genes having less sequence identity to the nematode genes described herein include, for example, hybridization at about 42 degree C. in the absence of formamide; a first wash at about 42 degree C, about 6X-SSC, and about 1% SDS; and a second wash at about 50 degree C, about 6X-SSC, and about 1% SDS.
As discussed above, gene sequence-specific oligonucleotides may also be used as primers in PCR cloning strategies. Such PCR methods are well known in the art and are described. Again, sequences corresponding to conserved regions in a gene sequence (for example, those regions described above) are preferred for use in isolating mammalian counterpart gene sequences. Such probes may be used to screen cDNA as well as genomic DNA libraries.
Sequences obtained are then examined to identify those sequences having the highest amino acid sequence identity to the C. eiegans gene sequence.
For example, addition of a counterpart human gene to an insulin responsive cell line (e.g., the 3T3-L1 cell line) may accentuate insulin responsiveness. Similarly genetic transformation of such a cell line with wild type or dominantly activated versions of a cAMP deaminase gene may alter metabolism. Such perturbations of metabolic control are stringent tests of candidate genes as homologues of the nematode gene.
In addition, if that mammalian candidate homologue acts in a metabolic control pathway, and is expressed in similar metabolic control tissues (liver, adipose), it is likely to function homologously to proteins expressed from C. eiegans genes. Addition of a wild type or activated protein can confer on cell lines altered metabolic phenotypes. Thus supplying protein activity to such a cell line can alter its metabolism.
Screening Systems for Identifying Therapeutics
A number of screening procedures for identifying therapeutic compounds (e.g., antidiabetic and anti-obesity pharmaceuticals or both) can be used in human patients. In particular, compounds that down regulate or rescue expression of a nematode gene or its human homolog are considered useful in the invention. In general, the screening methods of the invention involve screening any number of compounds for therapeutically active agents by employing any number of in vitro or in vivo experimental systems. Exemplary methods useful for the identification of such compounds are detailed below.
The methods of the invention simplify the evaluation, identification, and development of active agents for the treatment and prevention of impaired glucose tolerance conditions, such as diabetes and obesity. In general, the screening methods provide a facile means for selecting natural product extracts or compounds of interest from a large population which are further evaluated and condensed to a few active and selective materials. Constituents of this pool are then purified and evaluated in the methods of the invention to determine their antidiabetic or anti-obesity activities or both.
Test Extracts and Compounds
In general, novel drugs for the treatment of glucose metabolic syndrome conditions are identified from large libraries of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources. In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.
In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their anti-diabetic and anti-obesity activities should be employed whenever possible.
When a crude extract is found to have anti-diabetic or anti-obesity activities or both, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having anti-diabetic or anti-obesity activities. The same in vivo and in vitro assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for the treatment of pathogenicity are chemically modified according to methods known in the art. Compounds identified as being of therapeutic value are subsequently analyzed using any standard animal model of diabetes or obesity known in the art.
There now follow examples of high-throughput systems useful for evaluating the efficacy of a molecule or compound in treating (or preventing) a glucose metabolic syndrome.
Other Screening Assays
Other drug screening assays may also be performed using either C. elegans worms or mammalian cell cultures. If desired, such assays may include the use of reporter gene constructs.
For example, evaluation of the effects of test compounds on glycogen levels in mutant C. elegans strains expressing particular human homologs of the regulatory genes (i.e., humanized C. elegans) represent useful screening methods. Expression of the human homologs in C elegans is accomplished according to standard methods and, if desired, such genes may be operatively linked to a gene promoter obtained from C. elegans. Such promoters include, without limitation, the endogenous C. elegans regulatory gene promoter.
Additionally, mammalian tissue culture cells expressing homologs to C elegans regulatory genes may be used to evaluate the ability of a test compound or extract to modulate glycogen storage or glucose metabolism. Because the signaling pathways from the ligands, receptors, kinase cascades, and downstream transcription factors are conserved from man to worm, test compounds or extracts that inhibit or activate the worm signaling proteins should also inhibit or activate their respective human homolog.
Reporter Gene Construct
In one particular example, the invention involves the use of a reporter gene that is expressed under the control of a C. elegans gene promoter, e.g., a promoter that includes the enhancer element, such as a C. elegans regulatory gene promoter. Other equivalent enhancer elements may also be used in the invention. The enhancer element is cloned upstream of any standard reporter gene, e.g., the luciferase or green fluorescent protein (GFP) reporter genes. In preferred embodiments, the GFP reporter gene is used in C. elegans. In other preferred embodiments, either the GFP or the luciferase reporter genes may used in a mammalian cell based assay. The reporter gene construct is subsequently introduced into an appropriate host (e.g., C. elegans or a mammalian cell) according to any standard method known in the art. Analysis of reporter gene activity in the host organism or cell is determined according to any standard method, e.g., those methods described herein. Such reporter gene (and host cell systems) are useful for screening for drugs that modulate glucose metabolism or levels of glycogen.
C. elegans
In one working example, the above-described reporter gene construct is introduced into wild-type C. elegans according to standard methods known in the art. If the enhancer element is operational, then it is expected that reporter gene expression is turned on. Alternatively, in mutants carrying the above-described reporter gene construct, reporter gene activity is turned off.
Using this on/off distinction, test compounds or extracts are evaluated for the ability to disrupt the signaling pathways described herein. In one working example, cAMP deaminase mutant worms carrying the reporter gene construct are used to assay the expression of the reporter gene. The majority of worms expressing the reporter gene will have defective glycogen storage. Such mutants are selected using methods described in the Examples, and reporter gene expression in the test compound or extract is assayed according to standard methods, e.g., worms are examined to reveal the presence of reporter gene expression, e.g., GFP. Candidate compounds that suppress the regulatory gene phenotype or turn on reporter gene expression, i.e., activate signals in the absence of regulatory gene receptor are considered useful in the invention.
Mammalian Cells
Mammalian insulin-responsive cell lines are also useful in the screening methods of the invention. Here reporter gene constructs (for example, those described above) are introduced into the cell line to evaluate the ability of a test compound or extract to modulate signaling pathways associated with metabolic control using a second construct expressing a C. elegans regulatory gene or its corresponding human homologs. Exemplary cell lines include, but are not limited to, mouse 3T3, L6, and Ll cells. Introduction of the constructs into such cell lines is carried out according to standard methods well known in the art. To test a compound or extract, it is added to the cell line, and reporter gene expression is monitored. Compounds that induce reporter gene expression in the absence of regulatory gene signaling are considered useful in the invention. Such compounds may also turn the cells into adipocytes, as insulin does.
Compounds identified in mammalian cells may be tested in other screening assays described herein, and, in general, test compounds may be assayed in multiple screens to confirm involvement in signaling of a regulatory gene.
Metabolic control by protein expressed by a regulatory gene may be tested using any known cell line, e.g., those described herein.
In Vitro Screening Methods
A variety of methods are also available for identifying useful compounds in in vitro assays. In one particular example, test compounds are screened for the ability to activate the phosphorylation of proteins encoded by regulatory genes in vitro. In these assays, the protein encoded by a regulatory gene is preferably tagged with a heterologous protein domain, for example, the mycepitope tag domain(s)., and are incubated with the C-terminal kinase domain of the regulatory protein. Phosphorylation of the Smad proteins is preferably detected by immunoprecipitation using antibodies specific to the tag, followed by scintillation counting. Test compounds may be screened in high throughout microtiter plate assays. A test compound ώat effectively stimulates the phosphorylation of cAMP deaminase is considered useful in the invention. Using these same general assays, compounds that activate the phosphorylation of cAMP deaminase by AKT or GSK-3 may also be identified.
Modulatory Compounds
Our experimental results facilitate the isolation of compounds useful in the treatment of impaired glucose metabolic syndrome that change glucose metabolism or glycogen levels in C. elegans and described above. Exemplary methods for the isolation of such compounds now follow.
Antagonists
As discussed above, useful therapeutic compounds include those which down regulate the expression or activity of a regulatory gene or protein. To isolate such compounds, regulatory gene expression is measured following the addition of candidate antagonist molecules to a culture medium of the regulatory gene-expressing cells, or cells treated to inhibit expression of the regulatory gene. Alternatively, the candidate antagonists may be directly administered to animals (for example, nematodes or mice) and used to screen for their effects on the expression of the regulatory gene.
The expression of the regulatory gene is measured, for example, by standard Northern blot analysis using a nucleic acid sequence (or fragment thereof) of the regulatory gene as a hybridization probe. The level of expression of the regulatory gene in the presence of the candidate molecule is compared to the level measured for the same cells, in the same culture medium, or in a parallel set of test animals, but in the absence of the candidate molecule. Preferred modulators for anti-diabetic or anti-obesity purposes are those which cause a change in expression of the regulatory gene.
Alternatively, die effect of candidate modulators on expression or activity may be measured at the level of regulatory protein production using the same general approach in combination with standard immunological detection techniques, such as Western blotting or immunoprecipitation with a regulatory gene-specific antibody. Again, useful anti-diabetic or anti-obesity therapeutic modulators are identified as those which produce a change in production of the regulatory gene. Antagonists may also affect activity of the regulatory protein without any effect on expression level. Phosphorylation state may be monitored by standard Western blotting using antibodies specific for phosphorylated amino acids. In addition, if the regulatory protein is transcription factors, reporter genes bearing operably linked regulatory protein binding sites may be used to directly monitor the effects of antagonists on regulatory gene activity.
Candidate modulators may be purified (or substantially purified) molecules or may be one component of a mixture of compounds (e.g., an extract or supernatant obtained from cells). In a mixed compound assay, expression of the regulatory gene is tested against progressively smaller subsets of the candidate compound pool until a single compound or minimal compound mixture is demonstrated to modulate regulatory gene expression.
Candidate regulatory gene antagonists include peptide as well as non-peptide molecules (e.g., peptide or non-peptide molecules found, e.g., in a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured).
Antagonists found to be effective at the level of cellular expression of regulatory genes or activity may be confirmed as useful in animal models (for example, nematodes or mice). For example, the compound may ameliorate the glucose metabolic syndrome, e.g., diabetic symptoms of mouse models for Type II diabetes (e.g., a db mouse model), mouse models for Type I diabetes, or models of streptozocin-induced β cell destruction. A molecule which promotes a decrease in expression of a regulatory gene or regulatory protein activity is considered particularly useful in the invention; such a molecule may be used, for example, as a therapeutic to decrease the level or activity of native, cellular regulatory protein and thereby treat a glucose metabolic syndrome in an animal (for example, a human).
If desired, treatment with an antagonist of the invention may be combined with any other anti-diabetic or anti-obesity therapies.
Agonists
Also as discussed above, useful therapeutic compounds are those which up regulate the expression of the regulatory gene or activity of regulatory protein. To isolate such compounds, expression of these genes is measured following the addition of candidate agonist molecules to a culture medium of regulatory gene-expressing cells. Alternatively, the candidate agonists may be directly administered to animals (for example, nematodes or mice) and used to screen for effects on expression of the regulatory gene.
Regulatory gene-expression is measured, for example, by standard Northern blot analysis using all or a portion of one of these genes as a hybridization probe. The level of expression of the regulatory gene in the presence of the candidate molecule is compared to the level measured for the same cells, in the same culture medium, or in a parallel set of test animals, but in the absence of the candidate molecule. Preferred modulators for anti-diabetic or anti-obesity purposes are those which cause an increase in expression of a regulatory gene.
Alternatively, the effect of candidate modulators on expression may be measured at the level of regulatory protein production using the same general approach in combination with standard immunological detection techniques, such as Western blotting or immunoprecipitation with an appropriate antibody. Again, the phosphorylation state of these polypeptides is indicative of regulatory protein activity and may be measured on Western blots. Useful anti-diabetic or anti-obesity modulators are identified as those which produce an increase in regulatory protein production.
Candidate modulators may be purified (or substantially purified) molecules or may be one component of a mixture of compounds (e.g., an extract or supernatant obtained from cells). In a mixed compound assay, expression of a regulatory gene is tested against progressively smaller subsets of the candidate compound pool until a single compound or minimal compound mixture is demonstrated to modulate expression of a regulatory gene. Alternatively, or in addition, candidate compounds may be screened for those which agonize native or recombinant regulatory protein activities. In one particular example, phosphorylation of a regulatory protein may be activated by agonists.
Candidate regulatory gene agonists include peptide as well as non-peptide molecules (e.g., peptide or non-peptide molecules found, e.g., in a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured).
Agonists found to be effective at the level of cellular expression of a regulatory gene or activity of a regulatory protein may be confirmed as useful in animal models (for example, nematodes or mice).
A molecule which promotes an increase in expression of a regulatory gene or activity of a regulatory protein is considered particularly useful in the invention; such a molecule may be used, for example, as a therapeutic to increase the level or activity of these native, cellular genes and thereby treat glucose metabolic syndrome.
If desired, treatment with a regulatory gene agonist may be combined with any other anti-diabetic or anti-obesity therapies.
Animal Model Systems
Compounds identified as having activity in any of the above-described assays are subsequently screened in any number of available diabetic or obesity animal model systems, including, but not limited to ob, db, agouti mice, or fatty rats. Test compounds are administered to these animals according to standard methods. Additionally, test compounds may be tested in mice bearing knockout mutations in the insulin receptor, IGF-I receptor, IR- related receptor, or any of the genes described herein. Compounds can also be tested using any standard mouse or rat model of Type I diabetes, e.g., a streptozin ablated pancreas model.
In one particular example, the invention involves the administration of regulatory protein or its homolog as a method for treating diabetes or obesity. Evaluation of the effectiveness of such a compound is accomplished using any standard animal model, for example, the animal diabetic model systems described above. Because these mouse diabetic models are also associated with obesity, they provide preferred models for human obesity associated Type II diabetes as well. Such diabetic or obese mice are administered C. elegans or a human counterpart to a regulatory protein according to standard methods well known in the art. Treated and untreated controls are then monitored for the ability of the compound to ameliorate the symptoms of the disease, e.g., by monitoring blood glucose, glycogen levels, ketoacidosis, and atherosclerosis. Normalization of blood glucose and insulin levels is taken as an indication that the compound is effective at treating a glucose metabolic syndrome.
Therapy
Compounds of the invention, including but not limited to, a regulatory protein and its homologs, and any antagonist or agonist therapeutic agent identified using any of the methods disclosed herein, may be administered with a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer such compositions to patients. Although intravenous administration is preferred, any appropriate route of administration may be employed, for example, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, or oral administration. Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
Methods well known in the art for making formulations are found in, for example, "Remington's Pharmaceutical Sciences." Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene- polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for antagonists or agonists of the invention include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
Regulatory molecules are administered at any appropriate concentration.
Pedigree Analysis and Genetic Testing
The discovery described herein that regulatory proteins are involved in glucose metabolism enables assays for genetic testing to identify those individuals with predispositions toward the development of glucose metabolic syndrome, such as glycogen storage disease, diabetes or obesity, by determining the presence of a mutation found in a human gene having identity to any of the C. elegans regulatory genes. In one embodiment, the development of this testing method requires that the individual be a member of a family that has multiple affected and unaffected members carrying one mutation from the list of above- listed genes. Those skilled in the art will understand that a diabetic or obesity phenotype may be produced by mutations of regulatory genes found on different chromosomes, and that low resolution genetic mapping of the diabetic condition in single family pedigrees will be sufficient to favor regulatory genes over others as causing the glucose metabolic syndrome in a particular pedigree, hi one particular example, mutations associated with glucose metabolic syndrome may be found in different genes in, for example, the regulatory gene signaling pathway in each pedigree. In addition, because mutations in a common pathway can show complex genetic interactions, multiple regulatory gene mutations may segregate in single pedigress. These mutations can behave recessively in some genetic backgrounds and dominantly in others.
Those skilled in the art further understand that, to determine disease linkage with a chromosomal marker, it may be necessary to evaluate the association of inheritance patterns of several different chromosomal markers (for example, from the collection of highly polymorphic mapped DNA allelic variants) in the genomic DNAs of family members and of the clinically affected individuals. Methods commonly used in determining segregation patterns of human genetic diseases are well known in the art. In addition, methods are known in the art for determining whether individuals in a family are useful for providing information to determine co-segregation of an allele with a glucose metabolic syndrome trait, including altered glycogen levels.
Here, fragments of genomic DNA (e.g., RFLP fragments) are prepared from each of the available members of the family, and each distinctive DNA allelic variant of the polymorphic chromosome marker within the family is evaluated to determine which polymorphisms (i.e., chromosomal region) is linked with the glucose metabolic syndrome phenotype within a particular family. It is preferred that the parents of the marker individual be heterozyous for a DNA allelic variant so that the segregation pattern of the DNA allelic variant linked with the diabetic or obese phenotype in the marker can be recognized. The inheritance of the diabetic phenotype can be judged to be dominant or recessive, depending on the pattern of inheritance. Most diabetes is dominantly inherited, and therefore inbred pedigrees are generally not necessary in the etiology of the diabetic condition. With respect to Type II diabetes, the highest rate of this kind of diabetes in the world is found in American Indians of the Pima tribe. Such families are useful for mapping one particular cause of diabetes, but, in general, diabetes is caused by mutations in a variety of genes. Thus, by testing for low resolution linkage to a candidate regulatory gene mutation, and then by sequencing the particular linked regulatory gene in affected and unaffected individuals, a particular regulatory gene mutation can be associated with a particular diabetic pedigree.
Human regulatory gene homologues are mapped to chromosome regions using standard methods. The regulatory gene regions are PCR amplified and compared between affected and unaffected DNA samples. Mutations detected in affected individuals are expected to (but need not) map to conserved domains of the regulatory genes. Because it is known that not all carriers of known diabetes-inducing mutations show metabolic defects, we expect that some non-diabetic non-glucose intolerant family members will carry the same regulatory gene mutation as affected family members. For this reason, a correlation of affected family members with a regulatory gene mutation is more important than a correlation of nonaffected with no mutation. Those skilled in the art will know that phenotypic classification of affected and unaffected individuals can greatly enhance the power of this genetic analysis. In addition, other mutations in the same regulatory gene are expected in some but not all diabetic pedigrees. For dominant diabetic inheritance, the affected individuals carry a regulatory gene mutation as well as a normal allele. For recessive diabetic inheritance, individuals carry two regulatory gene mutations that may be identical or two independent mutations in the same gene.
It is routine in the art of genetic counseling to determine risk factors given the presence of a closely linked molecular genetic marker in the genomic DNA of the individual and when combined with the additional understanding provided by the pedigree of the individual in the family. For example, a risk factor may be calculated for an individual in a regulatory gene chromosome family in a manner similar to those described for assessing the risk of other commonly known genetic diseases that are known to run in families, e.g., Huntington's disease and cystic fibrosis.
Once mutations in regulatory genes are associated with diabetes in a pedigree analysis, diagnostic PCR sequencing of these regulatory genes can be used to diagnose glucose intolerant, prediabetic, diabetic, obesity, and atherosclerotic conditions. Preferably, the regulatory gene regions are PCR amplified from patients and mutations detected in the regulatory genes using standard DNA sequencing or oligonucleotide hybridization techniques. The use of such gene sequences or specific antibody probes to the products of these sequences provide valuable diagnostics, particularly in view of the likelihood there exist two classes of type II diabetics: those with defects in the TGF-beta signaling genes, and those with defects in insulin signaling genes. Such genetic tests will influence whether drugs that affect regulatory gene or signals associated with regulatory proteins are prescribed.
To carry out the above analysis (as well as the other screening, diagnostic, and therapeutic methods described herein), mammalian homologs corresponding to the C. elegans regulatory genes are isolated as described above. Again, standard hybridization or PCR cloning strategies are employed, preferably utilizing conserved regulatory gene motifs for probe design followed by comparison of less conserved sequences flanking these motifs. Exemplary motifs for these genes are as follows;
In other embodiments, the invention includes any protein which possesses the requisite level of amino acid sequence identity (as defined herein) to regulatory gene sequence; such homologs include other substantially pure naturally-occurring mammalian regulatory proteins as well as allelic variants; natural mutants; induced mutants; proteins encoded by DNA that hybridizes to the regulatory gene DNA sequence or degenerate conserved domains of regulatory proteins (e.g., those described herein) under high stringency conditions; and proteins specifically bound by antisera directed to a regulatory protein.
The invention further includes analogs of any naturally-occurring regulatory proteins. Analogs can differ from the naturally-occurring protein by amino acid sequence differences which do not destroy function, by post-translational modifications, or by both. Modifications include in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation; such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs can also differ from the naturally-occurring regulatory protein by alterations in primary sequence. These include genetic variants, both natural and induced (for example, resulting from random mutagenesis by irradiation or exposure to ethanemethylsulfate or by site-specific mutagenesis. Also included are cyclized peptides, molecules, and analogs which contain residues other than L-amino acids, e.g., D-amino acids or non-naturally occurring or synthetic amino acids, e.g., .beta, or gamma, amino acids.
In addition to full-length polypeptides, the invention also includes fragments of a regulatory protein. As used herein, the term "fragment," means at least 20 contiguous amino acids, preferably at least 30 contiguous amino acids, more preferably at least 50 contiguous amino acids, and most preferably at least 60 to 80 or more contiguous amino acids. Fragments of such regulatory protein can be generated by methods known to those skilled in the art or may result from normal protein processing (e.g., removal of amino acids from the nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events).
For certain purposes, all or a portion of the regulatory protein sequence may be fused to another protein (for example, by recombinant means). In one example, the regulatory protein may be fused to the green fluorescent protein, GFP. Such a fusion protein is useful, for example, for monitoring the expression level of the regulatory protein in vivo (for example, by fluorescence microscopy) following treatment with candidate or known agonists or antagonists to the regulatory protein or gene expression.
The methods of the invention may be used to diagnose or treat any condition related to glucose metabolic syndrome or obesity in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is diagnosed or treated, the polypeptide, nucleic acid, or antibody employed is preferably specific for that species.
The methods of the invention may be used to diagnose or treat any condition related to glucose metabolic syndrome or obesity in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is diagnosed or treated, the regulatory protein, nucleic acid, or antibody employed is preferably specific for that species.
EXAMPLES
Example 1
Glycogen storage tests
Whole Caenorhabditis elegans nematodes can be assessed for glycogen storage by exposing live animals to iodine vapor or a diluted (1:10-1:20) Lugol's iodine solution (2% I2 in 4% KI). Both methods require 30-60s to fully react with the glycogen in the worm. The color of stained glycogen in the animal is usually dark red, but can be crimson or purple/black, depending upon the branching of the glycogen in the animal. A negative reaction has a yellow/brown color, which is the same color as a dilute iodine solution. Adult worms stained with iodine primarily store glycogen anterior to the posterior bulb of the pharynx, near the dorso-rectal ganglion, in the most proximal two oocytes of the gonad arm and in early embryos. Glycogen is also occasionally observed in the hypodermis and near the bend in the gonad. To identify RNAi phenotypes that were altered by hexosamine signaling, all of the '+' and '-' clones from the original screen were tested with N2 as well as oga-1 (for '+' phenotypes) or ogt-1 (for '-* phenotypes). For each RNAi strain, both N2 and either oga-1 or ogt- 1 were assayed simultaneously for rescue of the glycogen phenotype by iodine staining.
Example 2
Glucose challenge tests:
C. elegans were fed glucose by incubating the animals in a glucose solution, or by growing the animals on solid media seeded with bacteria and supplemented with glucose. Animals incubated for 48 hours in a 5% glucose solution gave a very strongly positive glycogen storage reaction, while those in a 0% glucose solution did not. Animals grown on glucose-supplemented plates have at least twice the level of internal free glucose when compared to animals grown on normal media.
Example 3
Glycogen storage mutants
87% of the genes in the C. elegans genome were screened by knockdown with RNAi technology for gene products that alter glycogen storage by assaying animals with the glycogen storage test described above. Those genes which displayed the same phenotype in 3 of 4 independent, blinded trials were considered for further analysis. The table below lists each of the genes tested by their assigned sequence code (CDS), as well as the phenotype for glycogen storage as determined by the screen.
The phenotypes fall into the following categories:
1. Less glycogen than normal (-), much less glycogen than normal (--).
2. More glycogen than normal (+), much more glycogen than normal (++).
3. Glycogen appears in the normal locations, but has an abnormal appearance (ab). If the glycogen appears outside the normal locations, the glycogen is not widely distributed. This phenotype can be accompanied by either more (ab+) or less (ab-) glycogen overall.
4. Glycogen appears widely distributed in the body of the worm (B). This probably indicates hypodermal or gut storage of glycogen. The phenotype is often accompanied by an overall increase in glycogen storage (B+). Less Glycogen than normal
D1014.3 F55A3.3 T28D9.10
B0491.5 F01G10.1 F55A3.7 VW02B 12L.1
B0495.4 F02E8.1 F56H1.4 VW02B 12L.1
C02F5.9 F10E7.7 F59C6.5 W02F12.5
C05C8.7 F11G1 1.10 H15N14.2 W09C5.8
C06H2.1 F14H8.2 H18N23.2 Y105E8A.9
C09G5.6 F20G4.1 H28O16.1 Y106G6H.3
C09H10.3 F23B12.5 H37A05.1 Y1 10A2AL.8
C15C7.5 F23H11.5 K02D10.5 Y116A8C.35
C16A3.5 F25B4.6 K03A1. I Y37D8A.14
C18E9.4 F25H5.5 K04G7.4 Y45G12B.1
C23H4.1 F26E4.6 K05C4.1 Y46G5A.31
C27A2.2 F26E4.9 K07A12.3 Y47D3B.7
C29E4.8 F26H9.6 K07D8.1 Y47G6A.23
C3OC1 1.2 F29C4.2 K08D12.1 Y48B6A.3
C33D3.1 F29G6.3 KO8E3.5 Y57E12AL.5
C34B2.8 F29G9.3 LLCl .3 Y57G11C.12
C34E10.6 F32A7.6 MOlFl .5 Y57G1 1C.24
C46G7.1 F32D1.2 RlOEl 1.2 Y71F9AL.17
C47B2.4 F33A8.1 R53.4 Y71F9B.4
C50D2.1 F36A2.7 T02H6.11 Y71H2B.10
C52E4.4 F40F4.6 T05D4.4 Y82E9BR.15
C53A5.1 F45H10.2 T10D4.3 Y82E9BR.3
C53A5.6 F46F11.5 T13C5.1 ZC328.3
C53B7.4 F49C12.12 T14B4.6 ZK328.5
C53D5.6 F49C12.13 T14B4.7 ZK430.8
C54G4.8 F54D7.2 T20H4.5
C56G2.6 F54F2.1 T23H2.5
CD4.6 F54H12.6 T26A5.3 F35H10.4 R12E2.3 F38A5.5 T01H3.1 F38E11.5 T14F9.1 F39H11.5 T14G10.5
Much less glycogen than F53G12.3 T20F5.2 normal F55A12.7 W09B6.1
AC7.1 F56C11.1 Y1 11B2A.14
C04F6.1 F57B9.10 Y25C1A.5
C23G10.4 F57B9.2 Y39B6A.12
C23H3.4 F59E10.3 Y49E10.1
C30B5.6 H19M22.2 Y55H10A.1
C36B1.4 K07D4.3 Y71D1 1A.5
C56C10.3 K08E5.3 ZK 1058.3
F23F1.8 K11D9.2 ZKl 80.4
F26D11.13 R03E1.2 ZK970.4
F27C1.7 RlOEl 1.1
More glycogen than normal F54D5.1 1 YU0A7A.8
F55A12.8 Y39G10AR.7
F55B11.2 Y39G10AR.8
B0047.4 K06A1.6 Y48G1A.4
B0393.1 K08E3.6 Y57G1 1C19
C05D2.1 R06F6.1 Y80D3A.1
C27H6.2 R74.1 Y87G2A.5
C34F11.3 T01G9.6 Y95B8A.10
C47D12.6 T02G5.9 ZKl 127.5
F22B5.2 T03F1.9
F22D6.3 T04A8.14 Much more glycogen than
F26D10.3 T1 1G6.1 normal
F39B2.4 T28F3.2 K04E7.2
F42A8.1 W07E6.4
Abnormal glycogen F54C9.1 Y1 10A7A.i l distribution F54E7.2 Y116A8C.42
B0336.2 F57B10.1 Y32F6A.3
C03D6.1 F58E2.9 Y41D4B.19
C03D6.3 K01G5.7 Y41D4B.19
C12C8.3 M7.1 Y48G1A.5
C14C10.4 R06A10.2 Y55F3AR.3
C16A3.4 R07E4.6 Y55F3AR.3
D 1054.15 R144.2 Y6B3A.1
F02D10.5 TO4A8.7 Y71F9AM.5
Fl 3D 12.7 T10B5.5 Y71G12B.i l
F26E4.8 T21B 10.7 Y71G12B.i l
F36F2.3 T28F12.2 ZK1151.2
F44A6.2 W03C9.4 ZK 1290.3
F48E8.5 W04A4.5 ZK652.1
F54A3.3 W06H3.3
Less glycogen - Abnormal distribution K10C2.4 More glycogen -- Widely distributed R05D11.3
C48E7.2
More glycogen ~ Abnormal distribution D2089.1
C37C3.6 F14B4.3
F38A6.1 F19F10.9
Y39B6A.33 F55F8.3
Y53C1OA.3 K06A5.4
ZC168.5 T23D8.3
T23D8.9
Normal glycogen levels - Widely distributed W07E6.1
C29A12.3 Y48G1A.4
C37H5.5 Y54E10A.15
F28B3.7
F32D1.10
F53F4.1 1
F56A3.3
F59A2.1
K07C5.4
T19B4.2
T23D8.4
T27B1.2
Y39B6A.14
Y9C9A.8
Example4
AMPdeaminase, and results obtained from that mutant/knockdown. Ten genotypes identified in the screen were given the glucosechallenge testdescribed above wherein worms arefed additional glucose on plates. Upon challenge, the level offree glucose in wild-type worms increased to 2.2 times the value inunchallenged worms. The level offree glucose in worms treated with RNAi againstAMP deaminase (CDS C34F11.3) only increased 1.7 times the wild-type value. In addition, these animals accumulated large quantities ofthe sugar alcohol xylitol. Xylitol is not found in wild-type animals treated with glucose or inAMPdeaminaseknockdown animals that arenot treated with glucose. Both loss offunction mutations in AMP deaminase and treatmentwith xylitol have previously been associated with improved glucosehomeostasis inhumans.
AMP deaminase, DNA coding sequence (SEQ ID NO: ) atgaaaaccgtcgacagtgaactattcgactcgggaccattcaagaaaaa ctttgcgttcggaaatgcagaccactcgacagcttcaccattcgaaatct caaccactccgattgaagttaacgaatctcgtgctcacaaaactattgag atctcgaaccgagcacgcctggaatctcaaaacgacggatgtctgtctcc atcatcactgaaatcggtgctcgacgagattcaaacggagccaagatgca agtcaccacagcatattgatctgcacactttcagagatgctgttgatgtg aactaccaacggatggctatcactggagaagaactcagtggagtacctct ggaggatctcaaaaccgcttccggacatctcatcgaggctcttcatctcc gctcgaagtacatggaacgtattggaaatcagttcccatcaacgactcgc aacttcctcagtggacattacccggcgaacttgccaaagcatcgtgtcaa gaatacggaaacaaccgtccagacatcattcaatccaccagatccgccaa aggatcattggggaaaaaatgatccgctgccaaagtatgagaaaatctat catttgagacgtaatcgtggagtgactgaaatttgcaatgacgatggctc aattgatcagcaattcaaaaatgttaatgtgacgaaggaggagttcttaa atgacactgaaaagctgacagcaatgattgttgatggtccacttaaatca ttctgcttccgtcgactttcctaccttgaaaacaagtttcaacttcatgt tcttctcaacgaacttcgtgagcttcatgagcagaagggggtgtcgcatc gagacttctataacatcagaaaggtagacactcacatccacgccgcatca tcaatgaatcagaaacatttgctccgtttcatcaagaagaagataaagac tgaagctgacacggttgttctgaataacaatggaacaaaggttacaatga aggaagtattcaagaagatgggaattgatgcctacgatttgtcagttgat atgcttgatgttcatgctgatcgtaatacattccatcgtttcgataagtt caacacaaagtataatccagttggagaatctactctccgcgagattttca tcaaaactgacaattatgtcggtggaaaatactttgccgatttgctcaag gaggtgttgtcggacctcgaggatagcaagtatcagcacgcggagccaag attgtcgatttacggaaggagcaagaacgaatgggacaaccttgcgaaat gggcgctcacacatgatgtatggagcccgaacgctagatggctcgttcag attcctcgactctacgacgtctatcgtgcaaagaatatggtaaagaattt tgacgatatgcttgataacctgttcaccccgttattcgaagtcaccaacg atccatcgtctcatccagagcttcatctcttccttcagcaaatttccgga attgattcagttgatgatgagagcaagcatgaatttgttaatttcgatcg ttcaacaccttgcccaccagagtacactgacttggagaatccaccataca actattatctcttctacatgtaccgcaacatttgcgccttgaatgcattc cgccgtgctcgtggactcaacacctttgcacttcgtccacattgtggaga ggctggccacgtttcgcatctgctcaccggatacctgaccagtgaaagta ttgctcacggaattcttctccgcaaggtgccagttcttcagtatttgtat tatttgacgcaaattggaatcgccatgtcaccactgtccaacaattcgtt gttcatcagttaccagcggaatcctttgccagaatatctgcaaaaaggac tgaatgtctctctgtccactgatgatccactccagttccactacaccaag gaagcattgatggaagaattctcgattgctgctcaagtttggaagctcag ctcatgtgatatgtgtgagctcgcgagaaatagtgtcatgcagagtggat ttgaagataaggtcaaaattcactggctcggaccaaattacaaagaagaa ggagttcttggcaacgatatccaccgtaccaatgttccagatattcgtgt cagcttccgtcacgaggctctggttgatgagctttacaacctcttccgtg tacaaaatactctcaaacagtag
AMPdeaminase protein sequence (SEQ ID NO: )
MKTVDSELFD SGPFKKNFAF GNADHSTASP FEISTTPlEV NESRAHKTIE ISNRARLESQ NDGCLSPSSL KSVLDEIQTE PRCKSPQHID LHTFRDAVDV NYQRMAITGE ELSGVPLEDL
KTASGHLiEA LHLRSKΎMER IGNQFPSTTR NFLSGHYPAN
LPKHRVKNTE TTVQTSFNPP DPPKDHWGKN DPLPKYEKIY
HLRRNRGVTE ICNDDGSIDQ QFKNVNVTKE EFLNDTEKLT
AMIVDGPLKS FCFRRLSYLE NKFQLHVLLN ELRELHEQKG
VSHRDFYNIR KVDTHIHAAS SMNQKHLLRF IKKKIKTEAD
TWLNNNGTK VTMKEVFKKM GIDAYDLSVD MLDVHADRNT
FHRFDKFNTK YNPVGESTLR EIFIKTDNYV GGKYFADLLK
EVLSDLEDSK YQHAEPRLSI YGRSKNEWDN LAKWALTHDV
WSPNARWLVQ IPRLYDVYRA KNMVKMFDDM LDNLFTPLFE
VTNDPSSHPE LHLFLQQISG IDSVDDESKH EFVNFDRSTP
CPPEYTDLEN PPYNYYLFYM YRNICALNAF RRARGLNTFA
LRPHCGEAGH VSHLLTGYLT SESIAHGILL RKVPVLQYLY
YLTQIGIAMS PLSNNSLFIS YQRNPLPEYL QKGLNVSLST
DDPLQFHYTK EALMEEFSIA AQVWKLSSCD MCELARNSVM
QSGFEDKVKI HWLGPNYKEE GVLGNDIHRT NVPDIRVSFR HEALVDELYN LFRVQNTLKQ The DNA sequence between the oligonucleotide probes is determined, and those sequences having the highest degree of homology are selected. Once isolated, these sequences are then tested in a C. elegans AMP deaminase mutant or mouse model as described above for the ability to functionally complement the mutation or ameliorate the glucose metabolic syndrome phenotype.
Example 5
Hexosamine signaling regulates glycogen storage and glucose uptake in C. elegans:
Glycogen storage in the nematode was altered by changing the nutrient supply. Nematodes placed in buffer for 24 hrs gradually lose their glycogen, while those placed in a 5% (w/v) glucose solution accumulate glycogen for at least 48 hrs. Nematode oga-1 and ogt- 1 mutant animals lack the ability to remove and add O-glcNAc modifications to proteins, respectively. When exposed to the same conditions, ogt-1 animals were found to be more capable than wild type or oga-1 nematodes to synthesize glycogen in the presence of glucose.
The o-glcNAc modifications of these mutants were assayed by immunofluorescence microscopy using an RL2 antibody, which binds primarily to O-glcNAc modified nuclear pore proteins. The results showed that oga-1 was more highly O-glcNAc modified in the presence of glucose, while ogt-1 did not have increased RL2 staining in glucose. Overall, these results show that glucose activates the hexosamine biosynthesis in the glycogen synthesis pathway, which is at least partially controlled by the activity of oga-1 and ogt-1. Changes in the level of O-glcNAc modification of proteins were verified by western blot.
In the presence of glucose, the luminal membrane of the intestine of oga-1 animals became very reactive to RL2 antibody, suggesting that the O-glcNAc modifications may alter glycogen synthesis by changing the uptake of glucose from the lumen. Under these conditions, ogt-1 mutants takes up an average of five-fold more radioactive glucose than wild-type in four hours, consistent with O-glcNAc modification affecting the uptake of glucose. These results show that the hexosamine signaling pathway acts to detect glucose in the environment and regulate glucose uptake and glycogen synthesis.
Example 6
Genes that modify both glycogen storage and the hexosamine signaling pathway: Some of the mutants identified in our RNAi screen that have altered glycogen likely have altered hexosamine signaling. To show this RNAi hits that had a (+/G) or (-) in wild- type backgrounds, were compared to the same RNAi in either an oga-1 (for +/G RNAi) or ogt'l (for - RNAi) background, i.e., RNAi glycogen phenotypes that were rescued through the presence of the additional mutation in oga-1 or ogt-1. Fourteen RNAi clones were found to be rescued in these mutants , eight from the oga-1 phenotypes, and six from the ogt-1 phenotypes (Table 1).
TWHt
mftHΛ iplUhi Tutor ]MPΪ1
YJiB-A. M OfTJ-J
Y»7«ΛΛ «τ-i
Sow øπmpbon
BMKJ nan cssctβ.i υmx-1
Ru Λ*Λ*-tn» ΛTF»ie
Among the hits are a number of genes implicated in the regulation of glucose uptake. For example:
• npp-9 (F59A2.1) is a homolog of RanBP2, deficiency of which results in defects in glucose catabolism in mammalian models;
• pod-2 (W09B6.1), which encodes acetyl-CoA carboxylase, is known to influence insulin secretion in rodents;
• rab-5 (F26H9.6) and nsf-1 (H15N14.2) have both been shown to control the cycling of glucose transporters to the cell surface in mammals;
• nsf-1 and VPS-32.1 (C56C1O.3) are also needed for glucose derepression in yeast, a sodium-proton exchanger, is induced in the kidney in response to insulin in mammals.
Another major class of targets from this screen was genes involved with ribosomal biogenesis and export. Six of the eight genes rescues by oga-1 are directly implicated in this process, strongly implying an interaction between ribosome biogenesis and glucose metabolism that may operate through hexosamine signaling, e.g., hsp-1, shuttles to the nucleus during environmental stress, and has glucose-regulated O-glcNAc lectin activity.

Claims

What is claimed is:
1. A method for identifying a therapeutic compound that restores normal glycogen accumulation, said method comprising: a) providing a nematode or an isolated nematode cell having impaired expression of a nematode gene; b) contacting said nematode or isolated nematode cell with a candidate compound; c) measuring glycogen distribution; and d) selecting for a compound that changes levels of glycogen accumulation.
2. The method of claim 1 , wherein the nematode gene is selected from the group consisting of B0491.5, B0495.4, C02F5.9, C05C8.7, C06H2.1, C09G5.6, CO9H1O.3, C15C7.5, C16A3.5, C18E9.4, C23H4.1, C27A2.2, C29E4.8, C30C11.2. C33D3.1, C34B2.8, C34E10.6, C46G7.1, C47B2.4, C50D2.1, C52E4.4, C53A5.1, C53A5.6, C53B7.4, C53D5.6, C54G4.8, C56G2.6, CD4.6, D1014.3, F01G10.1, FO2E8.1, F10E7.7, F11G11.10, F14H8.2, F20G4.1, F23B12.5, F23H11.5, F25B4.6, F25H5.5, F26E4.6, F26E4.9, F26H9.6, F29C4.2, F29G6.3, F29G9.3, F32A7.6, F32D1.2, F33A8.1, F36A2.7, F40F4.6, F45H10.2, F46F11.5, F49C12.12, F49C12.13, F54D7.2, F54F2.1, F54H12.6, F55A3.3, F55A3.7, F56H1.4, F59C6.5, H15N14.2, H18N23.2, H28O16.1, H37A05.1, K02D10.5, K03A1.1, K04G7.4, K05C4.1, K07A12.3, K07D8.1, K08D12.1, K08E3.5, LLC1.3, M01F1.5, R10E11.2, R53.4, T02H6.11, T05D4.4, T10D4.3, T13C5.1, T14B4.6, T14B4.7, T20H4.5, T23H2.5, T26A5.3, T28D9.10, VW02B12L.1, VW02B12L.1, W02F12.5, W09C5.8, Y105E8A.9, Y106G6H.3, Y110A2AL.8) Y116A8C.35, Y37D8A.14) Y45G12B.l, Y46G5A.31, Y47D3B.7, Y47G6A.23, Y48B6A.3, Y57EI2AL.5, Y57G11C.12, Y57G11C.24, Y71F9AL.17, Y71F9B.4, Y71H2B.10, Y82E9BR.15, Y82E9BR.3, ZC328.3, ZK328.5, ZK430.8, AC7.1, C04F6.1, C23G10.4, C23H3.4, C30B5.6, C36B1.4, C56C10.3, F23FI.8, F26D11.13, F27C1.7, F35H10.4, F38A5.5, F38E11.5, F39H11.5, F53G12.3, F55A12.7, F56C11.1, F57B9.1O, F57B9.2, F59E10.3, H19M22.2, K07D4.3, K08E5.3, K11D9.2, R03E1.2, RlOEl 1.1, R12E2.3, T01H3.1, T14F9.1, T14G10.5, T20F5.2, W09B6.1, YIl 1B2A.14, Y25C1A.5, Y39B6A.12, Y49E10.1, Y55H10A.1, Y71D11A.5, ZK1058.3, ZK180.4, and ZK970.4, KI0C2.4 and R05D11.3, and wherein the impaired expression of the nematode gene decreases glycogen levels.
3. The method of claim 1, wherein the nematode gene is selected from the group wherein the nematode gene is selected from the group consisting of B0047.4,B0393.1,C05D2.1, C27H6.2, C34F11.3, C47D12.6, F22B5.2, F22D6.3, F26D1O.3, F39B2.4, F42A8.1, F54D5.11, F55A12.8, F55B11.2, K06A1.6, K08E3.6, R06F6.1, R74.1, T01G9.6, T02G5.9, T03F1.9, T04A8.14, T11G6.1, T28F3.2, W07E6.4, Y110A7A.8, Y39G10AR.7, Y39G10AR.8, Y48G1A.4, Y57G11C.19, Y80D3A.1, Y87G2A.5, Y95B8A.10, ZK1127.5, K04E7.2C48E7.2, D2089.1, F14B4.3, F19F10.9, F55F8.3, K06A5.4, T23D8.3, T23D8.9, W07E6.1, Y48G1A.4, Y54E10A.15, C37C3.6, F38A6.1, Y39B6A.33, Y53C10A.3, and ZC168.5 and wherein the impaired expression of the nematode gene increases glycogen levels.
4. The method of claim 1 , wherein the nematode gene is selected from the group wherein the nematode gene is selected from the group consisting of B0336.2, C03D6.1, C03D6.3, C12C8.3, , C14C10.4, C16A3.4, D1054.15, F02D10.5, F13D12.7, F26E4.8, F36F2.3, F44A6.2, F48E8.5, F54A3.3, F54C9.1, F54E7.2, F57B10.1, F58E2.9, K01G5.7, M7.1, R06A10.2, R07E4.6, R144.2, T04A8.7, T1OB5.5, T21B10.7, T28F12.2, W03C9.4, W04A4.5, W06H3.3, Y110A7A.il, Y116A8C.42, Y32F6A.3, Y41D4B.19, Y41D4B.19, Y48G1A.5, Y55F3AR.3, Y55F3AR.3, Y6B3A.1, Y71F9AM.5, Y71G12B.il, Y71G12B.i l, ZK1151.2, ZK1290.3, ZK652.1, C29A12.3, C37H5.5, F28B3.7, F32D1.10, F53F4.11, F56A3.3, F59A2.1, K07C5.4, T19B4.2, T23D8.4, T27B1.2, Y39B6A.14, and Y9C9A.8. and wherein the impaired expression of the nematode gene causes abnormal glycogen distribution.
5. The method according to any of claims 1-4, wherein impaired expression of the nematode gene also changes O-glcNAc modification of proteins.
6. The method of claim 5, wherein the nematode gene is selected from the group wherein the nematode gene is selected from the group consisting of F26D10.3, F55F8.3, F59A2.1, W07E6.1, Yl 10A7A.8, Y39B6A.14, Y39B6A.33, Y87G2A.5, B0495.4, C56C10.3, F26H9.6, H15N14.2, H28)16.1, and W09B6.1.
7. The method of any of claims 1 to 6, further comprising the step of measuring the level of free glucose.
8. The method of claim 7, wherein the nematodes are subject to a glucose challenge.
9. The method of 7, wherein the nematode is C. elegans.
10. The method of claim 7, where in the compound is a candidate compound for treating glycogen storage disease or glucose metabolic syndrome in human patients.
11. The method of claim 10, wherein the disease is diabetes or obesity.
12. The method of claim 7, wherein the nematode gene expression is impaired by siRNA.
13. A method for detecting defects in glycogen synthesis or accumulation of glucose in the blood, comprising isolating cells of a subject, and measuring genetic expression of at least one human gene in the cells, wherein said human gene is a homolog of the nematode gene of any of claims 1-12.
14. The method of claim 13, wherein the human gene is identified by isolating DNA from die nematode gene, and contacting said DNA with isolated DNA from a human cell under hybridization conditions that provide detection of DNA sequences have about 70% or greater nucleic acid sequence identity to the nematodes gene.
15. The method of claim 13, wherein genetic expression of a multiplicity of human genes is measured.
16. The method of claim 13,wherein genetic expression is measured by changes in levels of mRNA
17. The method of claim 13, wherein the genetic expression is measured by a microarray.
18. The method of claim 13, wherein the genetic expression is a measure of the response of a subject to a therapeutic for treating a glucose metabolic syndrome.
19. The method of claim 13, wherein genetic expression of at least one human gene is measured by contacting protein of a sample from a subject with at least one antibody to measure expression levels of the human gene.
20. The method of claim 13, wherein the protein is measured by an ELISA.
PCT/US2010/039760 2009-06-25 2010-06-24 Methods for treating and diagnosing glucose metabolic syndrome Ceased WO2010151625A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US22038209P 2009-06-25 2009-06-25
US61/220,382 2009-06-25

Publications (1)

Publication Number Publication Date
WO2010151625A1 true WO2010151625A1 (en) 2010-12-29

Family

ID=43386880

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/039760 Ceased WO2010151625A1 (en) 2009-06-25 2010-06-24 Methods for treating and diagnosing glucose metabolic syndrome

Country Status (1)

Country Link
WO (1) WO2010151625A1 (en)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6627746B1 (en) * 1998-04-17 2003-09-30 Exelixis, Inc. Nucleic acids and proteins of C. elegans insulin-like genes and uses thereof
US20040158879A1 (en) * 2002-07-11 2004-08-12 Gary Ruvkun Polynucleotide and polypeptide fat metabolism regulators and uses thereof
US20040250299A1 (en) * 1999-04-15 2004-12-09 Devgen Nv Compound screening method
US6861256B2 (en) * 1997-05-15 2005-03-01 The General Hospital Corporation Therapeutic and diagnostic tools for impaired glucose tolerance conditions
US20050171027A1 (en) * 2003-12-29 2005-08-04 President And Fellows Of Harvard College Compositions for treating or preventing obesity and insulin resistance disorders
US20050229260A1 (en) * 2000-06-08 2005-10-13 Devgen Nv Compound screens relating to insulin deficiency or insulin resistance
US20050260652A1 (en) * 2004-04-15 2005-11-24 The General Hospital Corporation Compositions and methods that modulate RNA interference
US20060293325A1 (en) * 2005-06-23 2006-12-28 New York University Treatment for diabetes and obesity as well as method of screening compounds useful for such treatments

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6861256B2 (en) * 1997-05-15 2005-03-01 The General Hospital Corporation Therapeutic and diagnostic tools for impaired glucose tolerance conditions
US6627746B1 (en) * 1998-04-17 2003-09-30 Exelixis, Inc. Nucleic acids and proteins of C. elegans insulin-like genes and uses thereof
US20040250299A1 (en) * 1999-04-15 2004-12-09 Devgen Nv Compound screening method
US20050229260A1 (en) * 2000-06-08 2005-10-13 Devgen Nv Compound screens relating to insulin deficiency or insulin resistance
US20040158879A1 (en) * 2002-07-11 2004-08-12 Gary Ruvkun Polynucleotide and polypeptide fat metabolism regulators and uses thereof
US20050171027A1 (en) * 2003-12-29 2005-08-04 President And Fellows Of Harvard College Compositions for treating or preventing obesity and insulin resistance disorders
US20050260652A1 (en) * 2004-04-15 2005-11-24 The General Hospital Corporation Compositions and methods that modulate RNA interference
US20060293325A1 (en) * 2005-06-23 2006-12-28 New York University Treatment for diabetes and obesity as well as method of screening compounds useful for such treatments

Similar Documents

Publication Publication Date Title
Cheadle et al. Molecular genetic advances in tuberous sclerosis
DK2687223T3 (en) Detection and treatment of dementia
US20110207801A1 (en) Novel Genes, Compositions, and Methods for Modulating the Unfolded Protein Response
US8101380B2 (en) Schizophrenia-related isoform of KCNH2 and development of antipsychotic drugs
US20060003959A1 (en) Methods and agents for maintaining muscle mass and for preventing muscle atrophy and biomarkers for monitoring same
EP1254260B1 (en) Methods for diagnosing and treating heart disease
US8871443B2 (en) Schizophrenia-related isoform of KCNH2 and development of antipsychotic drugs
US20050031605A1 (en) Compositions and methods of treating diabetes
WO2008058399A1 (en) Methods for diagnosis, prognosis or treatment of migraine and related disorders
DK2037948T3 (en) Detection and treatment of dementia
CN111187834B (en) DEPDC5 as target point of gastrointestinal stromal tumor and application thereof in diagnosis and treatment
AU767718B2 (en) Novel mutations in the (FREAC3) gene for diagnosis and prognosis of glaucoma and anterior segment dysgenesis
WO2010151625A1 (en) Methods for treating and diagnosing glucose metabolic syndrome
US20060141462A1 (en) Human type II diabetes gene-slit-3 located on chromosome 5q35
JP7555094B2 (en) Agents for decomposing cAMP or cGMP and their uses
WO2002020848A2 (en) Gene and sequence variation associated with cancer
EP2807275A1 (en) Schizophrenia-related isoform of knch2 and development of antipsycotic drugs
Sampson David J Kwiatkowski, Mary Pat Reeve, Jeremy P Cheadle and
WO2013111064A1 (en) Mutations of the gpr179 gene in congenital stationary night blindness
EP1498493A1 (en) Method of examining allergic disease
Crabtree Modifier genes of familial adenomatous polyposis
MXPA00010172A (en) Novel mutations in the freac3
WO2004103316A2 (en) Orp9, a novel therapeutic target for increasing hdl levels
KR20100107385A (en) DJ-1 loss cell line for the acquisition of pathological markers applicable to the diagnosis of Parkinson's disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10792635

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10792635

Country of ref document: EP

Kind code of ref document: A1