WO2004103316A2 - Orp9, a novel therapeutic target for increasing hdl levels - Google Patents

Abstract

Polynucleotide and polypeptide sequences for ORP9, as well as mutations associated with High HDL, and methods of utilizing these for the screening and identification of agents for the treatment of dyslipidemia and disorders of lipid metabolism, including small organic compounds, are disclosed along with methods of treating and/or ameliorating dyslipidernia and disorders of lipid metabolism, especially in human patients are disclosed. Diagnostic compounds, kits and methods using ORP9 are also described.

Description

ORP9, A NOVEL THERAPEUTIC TARGET FOR INCREASING HDL LEVELS

This application claims priority of U.S. Provisional Application 60/472,341, filed 21 May 2003, the disclosure of which is hereby incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention relates generally to the field of high-density lipoprotein (HDL) metabolism, to a novel gene associated therewith which was identified by its HDL associated human haplotype, and to methods of using this gene, including expression products thereof, for the screening of agents useful in the treatment of dyslipidemia and disorders of lipid metabolism and methods of treating such diseases.

BACKGROUND OF THE INVENTION

Epidemiological studies have consistently demonstrated that plasma high density lipoprotein cholesterol (HDL-C) concentration is inversely related to the incidence of vascular disease, particularly cardiovascular disease (CVD) and coronary artery disease (CAD). HDL-C levels are a strongly graded and independent cardiovascular risk factor. Protective effects of an elevated HDL-C persist until 80 years of age. A low HDL-C is associated with an increased CAD risk even with normal (<5.2 mmol/l) total plasma cholesterol levels. Even in the face of other dyslipidemias or secondary factors, HDL-C levels are important predictors of CAD. Low HDL cholesterol (in severe cases called hypoalphalipoproteinemia), is also implicated in cerebrovascular disease, coronary restenosis, and peripheral vascular disease. Conversely, high HDL cholesterol (also called hyperalphalipoproteinemia) is protective for these disorders.

Much of the therapeutic benefit of HDL is thought to be due to its role in promoting reverse cholesterol transport (RCT) from peripheral tissues to the liver.

Currently, there are no FDA approved therapeutic agents that modulate HDL levels in a direct, significant fashion. Current research strategies aimed towards modulating HDL involve increasing production of ApoA1 , the major lipoprotein in HDL, promoting the rate of reverse cholesterol transport (RCT) and decreasing catabolism of HDL. Catabolism of HDL is regulated by a number of enzymes, including CETP (Cholesteryl Ester Transfer Protein). Catabolism of HDL may also be regulated by HDL uptake into the liver (and other tissues) and by bile acid metabolism. Identification of additional genes which act to modulate HDL levels in humans would allow rational choice of which therapeutic approach to pursue in terms of drug development.

BRIEF SUMMARY OF THE INVENTION

The present invention relates to the discovery of a new target, ORP9, for therapeutic intervention in the treatment of dyslipidemias and disorders of lipid metabolism and the use of the target to screen for and identify therapeutic agents useful in treating the disorders, including increasing low HDL levels and thus treating the symptoms of attendant disorders, including but not limited to stroke, atherosclerosis and myocardial infarction. The discovery of a mutation in ORP9 that relates to clearly definable physiological outcomes in humans (namely highly elevated HDL levels, atheroprotection, reduced cardiovascular disease and other medical benefits illustrated by the NL-619 family), now allows the inventors to establish, for the first time, that the ORP9 is useful as a therapeutic target in humans for the treatment of dyslipidemia and disorders of lipid metabolism.

Compounds that modulate ORP9 activity are useful for treating or preventing coronary artery disease, regardless of the HDL status of the patient. For example, an individual with normal HDL levels who has a family history of coronary artery disease would still be advised to elevate HDL levels and reduce the individuals risk of coronary artery disease. Thus, the individual does not need to have a dyslipidemia in order to benefit from a therapeutic compound that modulates ORP9 activity.

In one embodiment, the present invention relates to a method for identifying an agent that modulates ORP-9 activity, comprising: a) contacting a test compound with a genetic construct comprising a reporter gene operably linked to a ORP-9 promoter under conditions supporting transcription of said reporter gene; b) determining a change in transcription of the reporter gene as a result of said contacting wherein a change in said transcription indicates that the test compound is an agent that modulates ORP-9 activity.

Such change in expression may be an increase or decrease in transcription or translation. In preferred embodiments, the promoter comprises the human promoter sequence in SEQ ID NO: 21 or the mouse promoter in SEQ ID NO: 22.

In another aspect, the present invention relates to a method for identifying an agent that modulates an ORP-9 activity, comprising: a) contacting a test compound with a polypeptide encoded by a polynucleotide corresponding to ORP-9 under conditions supporting an activity of said polypeptide; and b) determining a change in the activity of the polypeptide as a result of said contacting; wherein said change in activity identifies the test compound as an agent that modulates a ORP-9 activity.

In preferred embodiments, the determined change in activity in step (b) is a decrease in activity or is an increase in activity. In one embodiment, the activity is measured by measuring the activity of an enzyme.

The present invention also relates to a method for identifying an HDL- enhancing agent, comprising administering to an animal an effective amount of an agent found to have modulating activity using an assay of claim 1 or 16 and detecting an increase in plasma HDL activity in said animal due to said administering thereby identifying an agent useful in enhancing HDL activity.

In another aspect, the present invention relates to a method of determining risk of developing a disorder of lipid metabolism in a mammal, comprising determining the presence of a polymorphism in the amino acid sequence of an ORP-9 polypeptide in a mammal wherein said ORP-9 polymorphism indicates risk of developing a disorder of lipid metabolism, preferably wherein said mammal is a human being. In one embodiment, such polymorphism is determined in the gene encoding said ORP-9 polypeptide.

In preferred embodiments, the disorder of lipid metabolism is one of dyslipidemia, low HDL (hypoalphalipoproteinemia), vascular disease, such as cardiovascular disease, for example coronary artery disease (CAD), cerebrovascular disease, coronary restenosis, atherosclerosis and peripheral vascular disease, or is Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows a pedigree of a Dutch Family denoted as NL-619. Twelve individuals in this family have HDL levels above the 90^th percentile (corrected for age and sex) and were thus considered to have hyperalphalipoproteinemia for genetic analysis. The phenotype in the family used to define the linkage segregates a high HDL (hyperalphalipoproteinemia) trait in an autosomal dominant fashion with high penetrance. Other lipid parameters are normal in this family (including triglyceride (TG) and low density lipoprotein (LDL). There is strong evidence for the absence of cardiovascular disease and coronary artery disease in particular in this family.

Figures 2A shows a diagram for a 142 kb single gene haplotype wherein (C/--/T) defines ORP9 as a disease gene with the pedigree delineated in Figure 2B.

Figures 3A-3D show a diagram of splice variants of ORP9 showing which exons are included in each variant. Figures 3A to 3D follow in sequence to show the structure of the variants itemized at the left and exons 1 - 26 identified along the top. The diagram is not necessarily to scale.

Figures 4A - 4K follow in order and show a sequence alignment of coding nucleotides for variants of ORP9 with the variants identified at the right and nucleotide residue numbers at the top of each section. The variants are identified as v1 (SEQ ID NO: 3), v2 (SEQ ID NO: 5), v3 (SEQ ID NO: 7), v4 (SEQ ID NO: 9), v5 (SEQ ID NO: 11), v6 (SEQ ID NO: 13), and v7 (SEQ ID NO: 15).

Figure 5 shows a highly conserved stretch of nucleotide residues (with some encoded amino acid residues at the right) for the sequences of mouse and human in intron 8 of ORP9. Wild-type human intron 8 is shown in SEQ ID NO: 19. Figures 6A-6C shows a sequence alignment for Homologs of human (Homo sapiens) ORP9 gene were found in mouse (Mus musculus), fruit fly (Drosophila melanogaster) and Caenorhabditis elegans.

Figure 7 is a schematic of various protein domains of the amino acid sequence of ORP9 (SEQ ID NO: 24).

Figure 8 is a graphical representation of results presented in Table 6. All cells were treated with LXR/RXR agonists to stimulate ABCA1 expression and incubated with ApoAI to stimulate ABCA1 dependent cholesterol efflux.

Overexpression of ORP9S and ORP9L causes a statistically significant 25% decrease in cholesterol efflux from RAW cells.

DEFINITIONS

Unless expressly stated otherwise herein, the following terms have the indicated meanings.

"HDL" means High Density Lipoprotein

"LDL" means Low Density Lipoprotein

"TG" means triglyceride

"MT" means mutant "WT" means wild type

"Modulate" means to increase or to decrease.

The term "polynucleotide" is used interchangeably with "gene", "cDNA", "mRNA", "oligonucleotide", and "nucleic acid".

The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an analog or mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.

The term "expression system" includes, but is not limited to, a system that can be used to detect the expression of an ORP9 polynucleotide or polypeptide and may include whole cells, or cell extracts or other cell free expression systems. Such expression may include the transcription of a polynucleotide, such as an ORP9 polynucleotide or a reporter gene, to form an RNA transcript or the translation of an RNA to form a protein or polypeptide, such as an ORP9 polypeptide.

The term "agent" is used interchangeably with the term "compound" and likewise the term "test agent" is used interchangeably with the term "test compound".

The term "ORP9 gene" includes any of the variant forms of ORP9.

The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.

The term "mammal" refers to a member of the class Mammalia.

Examples of mammals include, without limitation, humans, primates, chimpanzees, mice, rats, rabbits, sheep, and cows.

A " test agent" or "candidate therapeutic agent" is able to inhibit ORP9 activity" if the agent can decrease one or more ORP9 activity The words "therapeutic target" are intended to mean that therapeutic intervention is achieved with therapeutic agents that modulate the activity of the gene or protein. "Modulate" means to increase, to decrease, or to otherwise change. Standard industrial processes are available to those skilled in the art to confirm the identity of the therapeutic agents which modulate the activity of the gene or protein, some of which are set out below.

The term "treat" or "treatment" encompasses therapeutic treatment, preventive treatment and protective treatment. Such protective treatment includes treatment of patients with low HDL levels who have not yet progressed to the state of actual cardiovascular disease.

"ORP9 activity" or "ORP9 biological activity" as used herein, especially relating to screening assays, is to be interpreted broadly and contemplates all directly or indirectly measurable and identifiable biological activities of the ORP9 gene, gene products and ORP9 polypeptides. Relating to the purified ORP9 polypeptide protein, ORP9 polypeptide activity includes, but is not limited to, all those biological processes, interactions, binding behavior, binding-activity relationships, pKa, pD, enzyme kinetics, stability, and functional assessments of the protein. Relating to ORP9 polypeptide activity in cell fractions, reconstituted cell fractions or whole cells, these activities include, but are not limited the rate at which ORP9 polypeptide performs any measurable biological characteristic and all measurable consequences of these effects, including cell growth, development or behavior and other direct or indirect effects of ORP9 polypeptide activity. Relating to ORP9 genes and transcription, ORP9 activity includes the rate, scale or scope of transcription of genomic DNA to generate RNA; the effect of regulatory proteins on such transcription, the effect of modulators of such regulatory proteins on such transcription; plus the stability and behavior of mRNA transcripts, post- transcription processing, mRNA amounts and turnover, all measurements of expression and translation of the mRNA into polypeptide sequences, and all measurements of protein expression levels or dynamics, including differential expression levels in different tissues. Relating to ORP9 activity in organisms, this includes but is not limited to biological activities which are identified by their presence, absence or deficiency in conditions or disorders made evident in organisms which have a mutation in ORP9. Some of the known or suggested biological activities are set out in the description of ORP9 provided in the instant specification, however those skilled in the art will be able to identify further measurable activities of ORP9 with routine techniques. Broadly speaking, ORP9 biological activity can be determined by all these and other means for analyzing biological properties of proteins and genes that are known in the art.

As used in this disclosure the phrase "dyslipidemia or a disorder of lipid metabolism" is therefore to be construed in its broadest context. This includes diseases where aberrant lipid metabolism directly causes the disease, or where lipid blood levels are disregulated causing disease, or where lipid disregulation is a consequence of another disease, or where diseases can be treated by modulating lipid levels, etc. More specifically, a disease of lipid metabolism according to this disclosure includes dyslipidemia, lipid deficiency disorders, other disorders of lipid metabolism and other disorders potentially related to lipid metabolism, and the like. Even more specifically dyslipidemia and disorders of lipid metabolism includes but is not limited to vascular disease, including cardiovascular, cerebrovascular and peripheral vascular disease, as well as coronary artery disease, deficiency of HDL, and/or activity of lipases and neurological disorders, including but not limited to Alzheimer's Disease.

As used herein, the term "percent identity" or "percent identical," when referring to a sequence, means that a sequence is compared to a claimed or described sequence after alignment of the sequence to be compared (the "Compared Sequence") with the described or claimed sequence (the "Reference Sequence"). The Percent Identity is then determined according to the following formula: Percent Identity = 100 [1-(C/R)]

wherein C is the number of differences between the Reference Sequence and the Compared Sequence over the length of alignment between the Reference Sequence and the Compared Sequence wherein (i) each base or amino acid in the Reference Sequence that does not have a corresponding aligned base or amino acid in the Compared Sequence and (ii) each gap in the Reference Sequence and (iii) each aligned base or amino acid in the Reference Sequence that is different from an aligned base or amino acid in the Compared Sequence, constitutes a difference; and R is the number of bases or amino acids in the Reference Sequence over the length of the alignment with the Compared Sequence with any gap created in the Reference Sequence also being counted as a base or amino acid.

If an alignment exists between the Compared Sequence and the

Reference Sequence for which the percent identity as calculated above is about equal to or greater than a specified minimum Percent Identity then the Compared Sequence has the specified minimum percent identity to the Reference Sequence even though alignments may exist in which the hereinabove calculated Percent Identity is less than the specified Percent Identity.

As used herein, the terms "portion," "segment," and "fragment," when used in relation to polypeptides or genes refer to a continuous sequence of nucleotide residues or amino acids, which sequence forms a subset of a larger sequence corresponding to a sequence claimed herein. Such terms include the products produced by treatment of polynucleotides with any of the common endonucleases, or any stretch of polynucleotides that could be synthetically synthesized. These may include exonic and intronic sequences of the corresponding genes. DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a gene and its corresponding protein related to dyslipidemia and disorders of lipid metabolism, referred to as ORP9. In this specification, ORP9 refers to both the gene and the protein gene product expressed therefrom, unless the context specifies otherwise.

In accordance with the present invention, it has been found that a mutation in the ORP9 gene results in highly elevated HDL levels in humans, and reduced risk of cardiovascular disease.

Identification of a causal mutation responsible for highly elevated HDL levels in a Dutch family.

The pedigree of family NL-619 is shown in Figure 1.

Twenty seven individuals from the main branch of family NL-619 were analyzed using 800 genetic markers evenly spaced throughout the genome. The maximum theoretical LOD score for this family was 4.05 for a genome scan with this marker density. Upon linkage analysis of the genome scan data, the maximum multipoint LOD score generated for was 3.5 for a 4cM (6Mb) interval on chromosome 1p32 bounded by markers D1S231 above and D1S2650 below.

Primer sequences:

D1S231 - Forward 5' TAACTGAGTGCTTACCTTATGC 3' (SEQ ID NO: 25) Reverse 5' CATGTGTTATATTTCAGGGG 3' (SEQ ID NO: 26)

D1 S2650 - Forward 5' GTGAACCAAACATAAGTGCC 3' (SEQ ID NO: 27) Reverse 5' GATCCAGAATCCATGTGAAG 3^* (SEQ ID NO: 28) Eighty three positional candidate genes were sequenced in two affected individuals with the high HDL phenotype. 135 SNPs were identified and deemed not causal due to lack of segregation in family NL-619 or because they were common in Dutch control individuals. As described in more detail below, a 2 bp deletion was identified in the pyrimidine tract of intron 8 of the gene ORP9 (also known as OSBPL9) (ENSG00000117859), 24 base pairs from the splice junction of exon 9 (ENSE00001030833). This mutation is genetically associated with high HDL in family NL-619. The ORP9 mutation is the single rare, segregating variant in 1p32 interval. The deletion was not observed in 1170 unrelated, normolipidemic Dutch control chromosomes. In addition, the 2 deleted bases are conserved in the mouse ortholog. We identified two SNPs flanking the mutation. The 5' (C/T) SNP (SEQ ID NO: 33) is in intron 3 of ORP9 and the 3' (T/A) SNP (SEQ ID NO: 32) is 3' to the ORP-9 reading frame. Using these SNPs, we demonstrated that haplotype (C-delCT-T) is a single gene haplotype of 142 Kb that is genetically associated with the high HDL phenotype in family NL-619. The combined evidence firmly establishes the association between ORP9 to elevated HDL levels in the family.

We predict that this mutation leads to aberrant splicing of the ORP9 transcript in physiologically relevant tissues, including the liver. Pyrimidine tract mutations are known to cause disease in humans, including thalassemia, ectodermal dysplasia and retinoblastoma (Beldjord et al., 1988; Monreal et al., 1999; Lefevre et al., 2002). This mutation could operate via aberrant splicing of mRNA, possibly in a tissue or developmentally specific manner.

Description of ORP9

The name ORP9 derives from OSBP-related protein 9. The HUGO

Gene Nomenclature Committee approved gene name is oxysterol binding protein-like 9, with gene symbol OSBPL9, and ID No. 16386. ORP9 aliases and additional descriptions include FLJ12492; OSBP4, FLJ14629, FLJ14801, FLJ32055, FLJ34384, MGC15035.

References to partial nucleotide and protein sequences can be found at OMIM 606737 (Online Mendelian Inheritance in Man, OMIM™. The NCBI Website and SWISS-PROT Entry name ORP9JHUMAN with the primary accession number Q96SU4. The ENSEMBL gene ID for OSBPL9 is ENSG00000117859 (Ensembl v.12.31.1 April 1, 2003). The NCBI Locus ID for OSBPL9 is 148738.

In one aspect, the invention relates to the nucleic acid sequence for ORP9. Seven variant expressed forms of ORP9 mRNA have been identified. SEQ ID NO: 23 is the genomic sequence around the ORP9 gene. All potentially expressed exons are given, along with numbering based on SEQ ID NO: 23, in Table 5. The invention includes the genomic sequence and all intron sequences, mRNA or cDNA, polymorphic, allelic, isoforms (adult, neonatal, etc.) and mutant forms thereof, and nucleic acid constructs of the gene, including vectors, plasmids and recombinant cells and transgenic organisms containing or corresponding to ORP9 (or knock-outs thereof). Such nucleic acid sequences are set forth in SEQ. ID NO: 3, 5, 7, 9, 11 , 13 and 15.

In another aspect, the invention relates to the gene product of ORP9, sometimes called herein ORP9 polypeptide, including the seven protein isoforms identified herein (translated from each of the variant nucleic acid sequences above). These sequences include ORP9 polypeptide, protein, and amino acid sequence, and the polymorphic, allelic, isoforms (adult, neo-natal, etc.) and mutant forms thereof, mRNA or other transcripts of ORP9, and recombinant cells and transgenic organisms wherein this polypeptide or a polypeptide corresponding thereto is expressed. Such amino acid sequences are set forth in SEQ. ID NOs:, 4, 6, 8, 10, 12, 14 and 16. Figure 3 illustrates alternative splice variants that are generated during transcription of the ORP9 gene. The alternative splice variants generated from the gene produce at least 7 transcripts. Each of the at least seven transcripts of the ORP9 gene may be translated into an ORP9 polypeptide. Variants 1 and 2 generate the same full length proteins of 558 amino acids, but are listed twice herein for clarity. Hence there are 6 full-length proteins of 558, 571 , 626, 723, 736, and 745, amino acids (a. a.) respectively.

The ORP9 expressed proteins can be grouped into two categories: the long form containing a pleckstrin homology (PH) domain (described further below) and an oxysterol binding domain (also described further below), and a short form which lacks the PH domain. These are sometimes describes as ORP9L and ORP9S. Differential expression of these transcripts could be due to alternate promoters, differential splicing, or tissue specific modulation of mRNA stability.

Affected individuals in the NL-619 family (i.e. those with high HDL) were determined to carry the following mutation in intron 8:

The above table shows genetic variation identified in ORP9. The mutation is found immediately adjacent to exon 9 in intron 8 (i.e. between exon 8 and exon 9) in the genomic nucleic acid sequence. indicates a deletion in the mutant form (MT) of the nucleotides marked in bold in the wild-type (WT).

Segregation of the indicated mutation in ORP9 has now been confirmed in all members of the NL-619 family having HDL levels in the top decile (i.e. above the 90^th percentile for HDL in the population controlled for age and sex). The mutation is also found in a single individual who is at the 88^th percentile for HDL, however this individual is a smoker and is overweight, which are environmental influences which would be expected to decrease HDL levels. Since this individual is not in the top decile, they were coded as phenotype unknown for genetic analysis. The variation is not found in 1170 control (unaffected) chromosomes from unrelated, normolipidemic, ethnically matched controls.

Figure 5 shows the high degree of conservation between the human and mouse ORP9 intron 8 sequence at the site of the mutation near the start of Exon 9. This provides further evidence of the physiological significance of the mutation found. The conserved pyrimidine tract TTTCT (SEQ ID NO: 31) is highlighted.

The entire intron 8 sequence (i.e. the sequence lying between exon 8 and exon 9) is provided at SEQ ID No. 19. The mutant form of this intron is provided at SEQ ID No. 20.

In another aspect, the invention relates to the promoter region of ORP9. The promoter region comprises nucleotides upstream of the transcription initiation site of ORP9. Optionally, it may include other promoter elements found in introns or exons on either side of the transcription start site.

Table 1 illustrates the promoter motifs identified from the human promoter region SEQ ID NO. 21.

Other promoter motifs can also be identified by those skilled in the art.

It should noted that, based on the promoter analysis, only some transcript variants (7,5,3,6) are under LXR regulation and these may have tissue specific and or uniquely regulated expression based on this difference. Analysis of the mouse promoter region SEQ ID No. 22 reveals numerous SREBP promoter sites in all variant forms of the expressed gene. Again, other promoter motifs may be found by those skilled in the art.

Genomic sequence: the full human genomic sequence illustrating the nucleic acid sequence around ORP9 is set forth at SEQ ID NO. 23. Exons are indicated in Table 5, the numbering is based on the numbering of SEQ ID NO:23.

Table 1. Promoter Motifs.

In accordance therewith, a gene useful in the methods of the invention comprises a polynucleotide corresponding to a polynucleotide having a nucleotide sequence of the ORP9 promoter selected from the group consisting of SEQ ID NO: 21 and SEQ ID No. 22. In another aspect, the present invention relates to a method for identifying an agent that modulates ORP9 activity, comprising:

(a) contacting a test compound with an expression system comprising a genetic construct comprising a reporter gene, preferably wherein the reporter gene is not ORP9, operably linked to an ORP9 promoter and under conditions supporting expression of the reporter gene; and

(b) determining a change in expression of the reporter gene as a result of said contacting, wherein said change in expression identifies the test compound as an agent that modulates ORP9 activity.

In preferred embodiment thereof, the modulation is a decrease or increase in transcription of said reporter gene and includes embodiments where the ORP9 promoter is a mammalian ORP9 promoter, preferably a mouse, rat or human ORP9 promoter. In a highly preferred embodiment, the promoter has a nucleotide sequence of SEQ ID NO: 21 or 22.

In one highly useful embodiment, the genetic construct is in a cell, preferably a mammalian cell, most preferably a recombinant cell, such as where the mammalian cell is a cell of the liver, kidney, intestine, endothelium, or is a neuronal cell.

Conservation of ORP9 in other organisms.

Homologs of human ORP9 gene were found in mouse (Mus musculus), Drosophila melanogaster and Caenorhabditis elegans. Figure 6 sets out a sequence comparison at the amino acid level of these sequences. The high degree of conservation of these sequences is shown in Table 2. ORP9 Polypeptide Function

This invention teaches the important discovery that ORP9 is a critical regulator of lipid metabolism. Exactly how^'.. it is involved in this process remains to be fully clarified.

Important information about the activity of this protein can be determined based on the analysis of protein domains.

Table 2*

*Each sequence is compared to every other sequence and three numbers are generated.

1: The number of residues that match exactly (identical residues) between the two sequences. 2: The number of residues whose juxtaposition yields a greater than zero score in the current scoring table (similar residues or conservative substitutions). 3: The number of residues lined up with a gap character.

Each number is expressed as a count and as percentage on different sides of the matrix diagonal. The diagonal shows how many locations have at least one residue for the single sequence, i.e., the sequence length. Protein Domain Analysis of OSBPL9

There are several annotated domains in ORP9 including a plextrin homology domain (PH), spectrin, and Oxysterol-binding protein domain (Figure 7).

Oxysterol-binding protein

The Oxysterol-binding protein motif is found in a number of eukaryotic proteins that seem to be involved with sterol synthesis and/or its regulation have been found to be evolutionary related. These include mammalian oxysterol-binding protein (OSBP), a protein of about 800 amino-acid residues that binds a variety of oxysterols (oxygenated derivatives of cholesterol); yeast OSH1, a protein of 859 residues that also plays a role in ergosterol synthesis; yeast proteins HES1 and KES1, highly related proteins of 434 residues that seem to play a role in ergosterol synthesis; and yeast hypothetical proteins YHR001w, YHR073w and YKR003w. The consensus pattern E-[KQ]-x-S-H-[HR]-P-P-x-[STACF]-A (SEQ ID NO: 1) is found in OSBPL9 as EQVSHHPPISA (SEQ ID NO: 2) starting at position 507 of the isoform f variant (SEQ ID NO: 24). The consensus pattern is found in, and only in, all known sequences in this class. This pattern is found within a larger, and more variant oxysterol binding domain signature. See Fortin N., Sheraton J., Brown J.L., Bussey H., Jiang B. A new family of yeast genes implicated in ergosterol synthesis is related to the human oxysterol binding protein. Yeast 10: 341- 353 (1994)

Pleckstrin-like domain

The 'pleckstrin homology' (PH) domain is a domain of about 100 residues that occurs in a wide range of proteins involved in intracellular signaling or as constituents of the cytoskeleton. The domain runs from amino acid 2 to 99 of SEQ ID NO: 24. Several potential functions of the domain are: a. binding to the beta/gamma subunit of heterotrimeric G proteins, b. binding to lipids, e.g. phosphatidylinositol-4,5-bisphosphate, c. binding to phosphorylated Ser/Thr residues, d. attachment to membranes by an unknown mechanism.

Sequence homology is very limited (10-30% identity at amino acid sequence level). There are no absolutely conserved positions; instead six blocks of sequence that show a conserved pattern of hydrophobic and hydrophilic residues are separated by stretches of amino acids which vary widely in length and sequence. The 3D structure of several PH domains has been determined [8]. The PH domain is defined at the structural level: all PH domains which have been solved so far have a very similar tertiary structure. Two antiparallel beta-sheets (four and three strands) lie at right angles to one another. A C-terminal alpha-helix is packed along the top of the "beta- sandwich". The more conserved positions correspond roughly to the alpha- helix and beta-strands. There are no totally invariant residues within the PH domain.

Proteins reported to contain one more PH domains belong to the following families:

Pleckstrin, the protein where this domain was first detected, is the major substrate of protein kinase C in platelets. Pleckstrin is one of the rare proteins to contain two PH domains.

Ser/Thr protein kinases such as the Akt/Rac family, the beta- adrenergic receptor kinases, the mu isoform of PKC and the trypanosomal NrkA family.

Tyrosine protein kinases belonging to the Btk/ltk/Tec subfamily. Insulin Receptor Substrate 1 (IRS-1).

Regulators of small G-proteins like guanine nucleotide releasing factor GNRP (Ras-GRF) (which contains 2 PH domains), guanine nucleotide exchange proteins like vav, dbl, SoS and yeast CDC24, GTPase activating proteins like rasGAP and BEM2/IPL2, and the human break point cluster protein bcr.

Cytoskeletal proteins such as dynamin (see IPR001401),

Caenorhabditis elegans kinesin-like protein unc-104 (see IPR001752), spectrin beta-chain, syntrophin (2 PH domains) and yeast nuclear migration protein NUM1.

Mammalian phosphatidylinositol-specific phospholipase C (PI-PLC)

(see IPR000909) isoforms gamma and delta. Isoform gamma contains two PH domains, the second one is split into two parts separated by about 400 residues.

Oxysterol binding proteins OSBP, yeast OSH1 and YHR073w.

Mouse protein citron, a putative rho/rac effector that binds to the GTP- bound forms of rho and rac. Several yeast proteins involved in cell cycle regulation and bud formation like BEM2, BEM3, BUD4 and the BEM1 -binding proteins BOI2 (BEB1) and BOM (BOB1).

Caenorhabditis elegans protein MIG-10.

Caenorhabditis elegans hypothetical proteins C04D8.1, K06H7.4 and ZK632.12.

Yeast hypothetical proteins YBR129c and YHR155w.

Spectrin repeat

A spectrin repeat is found in ORP9 (shown as a feature in SEQ ID

NO:24). Spectrin repeats are found in several proteins involved in cytoskeletal structure. These include spectrin, alpha-actinin and dystrophin. The spectrin repeat forms a three helix bundle. The second helix is interrupted by proline in some sequences. The repeat in SEQ ID NO: 24 is at residues 74-221 and such repeats are defined by a characteristic tryptophan (W) residue at position 17 in helix A (residue 90 of SEQ ID NO: 24) and a leucine (L) at 2 residues from the carboxyl end of helix C (residue 219 of SEQ ID NO: 24) (Yan Y., Branton D., Cronin T, Viel A., Winograd E., Harrison S.C. Crystal structure of the repetitive segments of spectrin. Science 262: 2027- 2030 (1993) )Standard prediction software also reveals numerous sites in ORP9 and its variants disclosed herein which are suitable for O-Glycosylation, N- Glycosylation and phosphorylation (data not shown).

Table 3 below shows expression levels of ORP9 in various human tissues:

Expression level was determined by semi-quantitative PCR amplification of a short 313 nt fragment spanning exons 11 to 13. This amplification was designed to quantitate total expression of ORP9, and does not distinguish between variant expressed forms.

Further aspects of ORP9 Polypeptide function at the biochemical level may be determined by those skilled in the art using standard techniques. It is clear from the instant invention that ORP9 Polypeptide is involved in regulation of HDL levels in humans.

Expression: The ORP9 gene appears to be expressed in many tissues. Based on publicly available ESTs, this gene is widely expressed in normal human tissues including brain, kidney, bone marrow, heart, liver, prostate, lung, thymus, pancreas (Unigene cluster Hs.21938).

In sum, the expression data identifies the major tissues of ORP9 expression as brain, muscle and small intestine, with significant amounts in Fetal liver, heart lung, ovary, prostate, testis, and uterus. Measurable amounts in liver are of particular interest, as the liver is a central organ of HDL metabolism. Those skilled in the art understand that tissue expression data provides helpful information for determining the role and biological function of the gene/protein in question.

While not wishing to be bound to any particular mechanism of action of how ORP9 mutation causes elevated HDL levels, ORP9 is consistent with an HDL related biological function, and it is possible to speculate on different roles the gene/protein of the invention may play in lipid metabolism.

Originally, the related Oxysterol Binding Protein (OSBP) was purified based on a tight binding affinity for 25-OH cholesterol, an oxysterol that functions as a repressor of cholesterol biosynthesis, in an effort to identify genes that modulate cellular cholesterol homeostasis. The OSBP protein contains an amino terminal pleckstrin homology (PH) domain and a carboxyl terminal ligand binding domain. Further assessment of the protein demonstrated that, upon treatment of cells with 25-OH cholesterol, OSBP shifts from a cytosolic subcellular localization to membranes of the Golgi apparatus This shift in subcellular localization is dependent on the PH domain of OSBP. Overexpression of OSBP resulted in an increase in cholesterol biosynthesis and a decrease in cholesterol esterification, further supporting the role of this gene in cholesterol metabolism. Taylor et al. tested 47 oxysterols as ligands for OSBP and showed that binding affinity was directly correlated with the potency of the respective oxysterols in suppressing HMG- CoA reductase activity, providing further evidence of a link between OSBP function and cholesterol synthesis and metabolism

Genomic approaches have allowed the identification of an additional 11 paralogous gene family members in humans, termed the ORPs (OSBP- related-proteins) or OSBPLs (OSBP-like), including ORP9 of the invention. The 12 family members can be subdivided into six subfamilies based on domain content and protein homology. Most ORPs have both a ligand binding domain and PH domain. ORP2, however, contains only a ligand binding domain and does not have a PH domain. A further subset, including ORP1 and ORP9, are expressed in two isoforms, a long form, that includes the PH domain, and a short form, which does not contain a PH domain. These isoforms may have differential tissue expression profiles and different functional roles (Johansson et al., 2003).

The subcellular targeting of ORPs has not been studied in great detail, however, the subcellular localization of ORP2 appears similar to that of OSBP (Xu et al, 1992; Laitinen et al., 2002). The two forms of ORP1 have been shown to have differing subcellular localization, with ORP1 L localized to the late endosomes and ORP1 S found in the cytosol and the nucleus. Ligand specificity has not been determined for many family members, although ORP1S and ORP2, which do not bind to 25-OH cholesterol, have been reported to bind to phosphatidic acid, PI(3)P and cardiolipin (Xu et al,

2001). Additional regulation of OSBP may occur post-translationally, as OSBP phosphorylation status changes based on cellular cholesterol content.

Overexpression of ORP2 in CHO cells increases cholesterol efflux to ApoAI 1.5 fold In addition, the long form of ORP1L has been shown to potentiate LXR signaling in COS and HEK293 cells (Johansson et al., 2003). The authors postulate that the potentiation effect observed for LXR signaling may be due to ORP1L binding and sequestering endogenous LXR antagonists in the cell, and therefore, overexpression of ORP1L relieves repression on LXR signaling.

In addition, overexpression of OSBP and ORP2 affect cholesterol synthesis, cholesterol ester synthesis and sphingomyelin synthesis ORP2 may regulate vesicle transport in the Golgi and/or Golgi and ER and exert an effect on cellular lipid metabolism in this fashion. An additional link to vesicle transport has been examined for ORP4, which binds vimentin intermediate filaments and modulates the esterification of LDL derived cholesterol in the cell. Several previous studies have demonstrated a link between vimentin intermediate filaments and intracellular cholesterol transport (Hall, 1997; Schweitzer et al., 1998)

A number of studies have examined ORP interacting proteins. ORPs bind a number of proteins involved in glucose/inositol metabolism, peroxisome biogenesis, RNA processing, vesicle trafficking and cell signaling (Table 2 in

Lehto et al, 2003). Published binding partners for human OSBP include

RACK1 (Protein Kinase C anchoring protein) and βγ-subunit of heterotrimeric

G proteins, implying diverse roles in cell signaling (Rodriguez et al, 1999; Touhara et al., 1994). In addition, using rabbit OSBP as a bait, human VAP-A was identified as an interactor. VAP-A is an ER associated protein which may play a role in vesicle transport, in line with data suggesting OSBP is also involved in this process (Wyles et al., 2002).

Current models in the suggest that ORPs, as a gene family, may integrate signaling of multiple lipid related pathways via differential ligand binding, antagonistic function and tissue specificity of gene and isoform expression, although the mechanisms by which this occurs is poorly understood. Different ORPs may act in an antagonistic fashion, based on genetic analysis of the paralogous OSH gene family in yeast (Beh et al., 2001).

Yeast studies also reveal increased OSH expression based on exposure of cells to Ca2+ and under anaerobic conditions. ORP9 may therefore find relevance in disease processes related to Ca2+ flux or hypoxic/necrotic disorders.

Overall the ORP9 effect on High HDL could be catabolic or synthetic. Synthetic would likely be due to increase in cholesterol efflux to ApoA-l. Catabolic could be related to reduced bile acid synthesis, as oxysterols are substrates for bile acids. A yeast OSH (i.e., ORP gene) has been associated with sterol influx, hence ORP9 could also be part of a sterol or HDL uptake pathway. This could explain why a loss of function mutation could lead to elevated HDL levels, i.e. by a decrease in uptake of HDL.

This invention establishes the first direct physiological evidence of the role that ORP9 plays in the human body, namely that ORP9 is an essential regulator of HDL levels in the human body, regardless of its exact mechanism of action. It is therefore a desirable drug target for treating dyslipidemia and disorders of lipid metabolism in animals, especially mammal. For example, because ORP9 is directly implicated in dyslipidemia according to this invention, the inventors recognize that dyslipidemia and other diseases where lipid metabolism is defective may be treatable by administering a compound that modulates ORP9 activity. The disease may not necessarily be related to aberrant ORP9 gene or protein activity. For example, a compound which modulates ORP9 activity may compensate for insufficiencies in other aspects of the lipid metabolism pathway. Or, a modulator of ORP9 may be used to treat a disease which is a consequence of dyslipidemia.

For example, there is some evidence to suggest that ORPs may modulate LDL cholesterol levels as well as HDL cholesterol levels. The compound LY295427 (3α,4 α,5 α)-4-(2-propenylcholesan-3-ol) enhances the ability of OSBP to bind 25-OH cholesterol, but does not appear to directly bind OSBP itself (Bowling et al., 1996). LY295427 has also been shown to reduce serum cholesterol in hypercholesterolemic hamsters and rabbits via upregulation of the LDL receptor (Bensch et al, 1999). Thus, OSBP could serve to integrate LDL and HDL metabolism, either by acting as a sensor of cellular cholesterol status, by binding and sequestering oxysterols and thus activating SREBP cleavage and LDL receptor transcription, or by other means.

In one aspect of the present invention, ORP9 is incorporated into a screening assay whereby compounds (potential therapeutic agents) are tested to determine if they modulate ORP9 gene expression activity, thereby identifying potential therapeutic agents.

Use of the ORP9 in Screening Assays for Identifying Therapeutic Agents and Classes of Potential Therapeutic Agents.

The present invention readily affords different means for identification of agents for treating dyslipidemia and disorders of lipid metabolism according to their ability to modulate the activity of ORP9. Exemplary assay methods useful for the identification of such agents are detailed herein, although those skilled in the art will be aware of alternative means. In one series of embodiments described in some detail below, assay methods involve testing libraries of chemical compounds, either one at a time or in combinations, in an assay format designed to measure a biological activity related to ORP9. Those library compounds that modulate the biological activity in the desired fashion are thereby identified as therapeutic agents of the invention. In effect, a wide variety of compounds are sequentially tested against the assay to determine whether they influence a measurable biological activity of the assay. Assays may be based one or more of the diverse measurable biological activities of a gene or polypeptide corresponding to ORP9.

In accordance with the foregoing, the present invention relates to a method for identifying an agent that modulates ORP9 activity, comprising: a) contacting a test compound with an expression system comprising an ORP9 polynucleotide and under conditions promoting expression of said

ORP9 polynucleotide, and b) determining a change in expression of said ORP9 polynucleotide as a result of said contacting, wherein said change in expression identifies the test compound as an agent that modulates ORP9 activity.

In a preferred embodiment of the screening methods of the invention, the change in expression is determined by determining a change in transcription of said gene, including where the modulation is an increase in transcription or a decrease in transcription.

In such another embodiment, the modulation is determined by determining a change in translation, where this change may be an increase in translation or a decrease in translation. In another preferred embodiment, the ORP9 gene is a mammalian ORP9 gene preferably where said mammal is a member selected from the group consisting of mouse, rat and human, most preferably a human.

The methods of the invention also contemplate embodiments where the gene is in a cell, such as a mammalian cell, preferably a cell of the liver cell, kidney cell, intestinal cell, endothelial cell or neuron. Also preferred is where the cell is a recombinant cell, such as where the cell has been engineered to express said gene, preferably by genetic engineering, and most preferably where the cell does not express said gene absent said engineering.

In one preferred embodiment, the gene comprises a polynucleotide corresponding to a polynucleotide having a nucleotide sequence selected from the group consisting of SEQ ID NO: 21 and 22.

In preferred embodiments, the agent or compound is useful in the treatment of dyslipidemia or a disorder of lipid metabolism and the ORP9 promoter is a mammalian ORP9 promoter, preferably where the mammal is a member selected from the group consisting of mouse, rat and human, most preferably a human.

In one such embodiment, the promoter has a nucleotide sequence of SEQ ID NO: 21 or 22.

In another specific embodiment, the genetic construct is in a cell, preferably a mammalian cell. Also preferred is where the cell is a recombinant cell engineered to express said reporter gene, such as where the engineering is genetic engineering. Most preferred is where the cell does not express said reporter gene absent said engineering. In another preferred embodiment, the mammalian cell is a macrophage, inflammatory cell, liver cell, hepatocyte, intestinal cell, hematopoietic cell, or a nervous system cell.

In another aspect, the present invention relates to a method for identifying an agent that modulates the biological activity of an ORP9- encoded polypeptide, comprising: a) contacting a test compound with an ORP9-encoded polypeptide and under conditions promoting a biological activity of the polypeptide; and b) detecting a change in the biological activity as a result of the contacting, wherein said change in biological activity identifies the test compound as an agent that modulates ORP9 polypeptide activity.

Preferably, the ORP9-encoded polypeptide is a mammalian ORP9 polypeptide, most preferably where the mammal is a member selected from the group consisting of mouse, rat and human.

In specific embodiments, the modulation is a decrease in said biological activity or where the modulation is an increase in said biological activity. Also preferred is where the polypeptide is in a cell, preferably a mammalian cell, such as where the cell has been engineered to contain said polypeptide, preferably by genetic engineering, especially where the cell does not express said polypeptide absent said engineering. In specific embodiments, such cell is a cell of the liver, kidney, intestine, endothelium, or is a neuronal cell.

In other preferred embodiments of this method, the polypeptide is encoded by a polynucleotide having the sequence of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, or 23, preferably where the polypeptide comprises an amino acid sequence selected from the sequence of SEQ ID NO: 4, 6, 8, 10, 12 ,14 and

16. The present invention further relates to a method for identifying a compound capable of modulating an ORP9 activity, comprising: (a) contacting a cell which expresses ORP9 with a test compound; and (b) assaying the ability of the test compound to modulate the transcription of an ORP9 nucleic acid or the activity of ORP9 Polypeptide, thereby identifying a compound capable of modulating an ORP9 activity. Preferably, the compound is an anti- ORP9 polypeptide antibody, or an antisense ORP9 nucleic acid molecule, or an ORP9 ribozyme.

Method of Treatment Using ORP9 as a Therapeutic Target.

The discovery that mutations in ORP9 relate to clearly definable physiological outcomes in humans (namely highly elevated HDL levels, atheroprotection, and other medical benefits illustrated by the NL-619 family), now allows the inventors to establish, for the first time, that the ORP9 is useful as a therapeutic target in humans for the treatment of dyslipidemia and disorders of lipid metabolism.

In accordance therewith, the present invention relates to a method for treating and/or preventing a lipid-related disorder in a mammal afflicted therewith comprising administering to said mammal a therapeutically effective amount of an ORP9 modulator, preferably where said ORP9 modulator exhibits modulating activity in a screening method of the invention, most preferably where the agent or compound was first identified as an ORP9 modulator using said method.

In a preferred embodiment of such method, the ORP9 modulator is a member selected from the group consisting of a selective ORP9 agonist, a selective ORP9 antagonist, pharmaceutically acceptable salts thereof, and combinations of these. Also preferred is where the disorder is a disease affecting lipid metabolism, such as dyslipidemia or a disorder of lipid metabolism.

The present invention further relates to a method to diagnose individuals affected by or at risk of dyslipidemia or a disorder of lipid metabolism comprising determining the nucleic acid sequence of the ORP9 gene in said individual wherein a mutation of said gene identifies said individual as an individual affected by or at risk of developing dyslipidemia or a disorder of lipid metabolism.

The present invention also relates to a method to diagnose individuals affected by or at risk of dyslipidemia or a disorder of lipid metabolism comprising determining the amino acid sequence of ORP9 polypeptide in said individual wherein a mutation of said gene identifies said individual as an individual affected by or at risk of developing dyslipidemia or a disorder of lipid metabolism.

In accordance with the foregoing, the present invention relates to a method of determining risk of developing a disorder of lipid metabolism in a mammal, comprising determining the presence of a polymorphism in the amino acid sequence of an ORP-9 polypeptide in a mammal wherein said ORP-9 polymorphism indicates risk of developing a disorder of lipid metabolism.

In one embodiment thereof, the mammal to be diagnosed is selected from the group consisting of mouse, rat and human, preferably a human being.

In a preferred embodiment, the polymorphism is in the amino acid sequence of SEQ ID NO: 24, or SEQ ID NO: 4, 6, 8, 10, 12, 14 or 16, and more than one polymorphism in said ORP-9 polypeptide may be determined.

The polymorphism may also be determined in the gene encoding an ORP-9 polypeptide, and said polymorphism may lie outside the coding region, such as in the promoter region, especially in the sequence of SEQ ID NO: 21 OR 22. In another embodiment, the polymorphism is the polymorphism of SEQ ID NO: 32 or 33.

In preferred embodiments of such methods, the disorder, such as the disorder of lipid metabolism, to be determined is a member of the group consisting of dyslipidemia and low HDL (hypoalphalipoproteinemia), or is a vascular disease, such as cardiovascular disease, or is Alzheimer's disease. In a highly preferred embodiment, the cardiovascular disease is one or more of coronary artery disease (CAD), cerebrovascular disease, coronary restenosis, atherosclerosis or peripheral vascular disease, especially coronary artery disease (CAD) or atherosclerosis. In one embodiment, the disorder is Alzheimer's disease.

The present invention also includes a composition for treating dyslipidemia or a disorder of lipid metabolism comprising a therapeutically effective amount of a polypeptide of the invention in a pharmaceutically acceptable carrier. Thus, the invention specifically contemplates a method for treating dyslipidemia or a disorder of lipid metabolism comprising administering to a patient in need thereof a therapeutically effective amount of such a composition in a pharmaceutically acceptable carrier. In referred embodiments, the disorder is one of lipid metabolism.

In accordance with the foregoing, the present invention relates to a method for treating a disorder comprising administering to a person in need of such treatment an effective amount of a selective ORP9 agonist or antagonist, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition containing either entity. In a further preferred embodiment, said administering is by oral or intravenous means.

It is also recognized that those skilled in the art may prefer to use forms of ORP9 corresponding to the sequences disclosed herein, although not necessarily the same. For example, while screening assays preferably employ ORP9 from human, mouse, rat or fugus (Takifugu rubripes), other assays may utilize ORP9 from a different organism, such as a vertebrate, including but not limited to a mammal. Thus the invention encompasses the use of, including but not limited to, sheep, dog, cow or horse ORP9, for the same purposes as set out more specifically herein for human ORP9. Depending on how the assay is developed, the actual amino acid or nucleic acid sequence of ORP9 from the alternate species needs not necessarily be known. For example, isolation of a protein activity from cow liver that identifies ORP9 may be sufficient for the assays of the invention. The shared technical features of these forms of ORP9, are that, when expressed, they have similar identifiable biological activity, and that they share functional similarity with ORP9, as the case may be, such as may be determined by those skilled in the art. The ORP9 gene and/or ORP9 polypeptide according to the invention may also be obtained from other mammalian species, other vertebrates, invertebrates and microorganisms based on the disclosure herein.

Thus, the polynucleotides for use in the screening assays of the invention that "correspond to" the polynucleotide encoding ORP9 (processed or unprocessed, including naturally occurring splice variants and alleles) are or at least 70%, or at least 80%, or at least 85%, most preferably at least 90%, or even at least 95%, or at least 98%, or identical to the polynucleotide of SEQ ID NO: 3, 5, 7, 9, 11, 13 or 15 or the complement thereof. Polynucleotides that "correspond to" the polynucleotide encoding ORP9 also include polynucleotides that would hybridize under stringent conditions, with the polynucleotide of SEQ ID NO: 3, 5, 7, 9, 11, 13 or 15 or the complement thereof. In addition, ORP9 protein sequences encoding the same polypeptides as any of the nucleic acid sequences corresponding to ORP9, regardless of the percent identity of such sequences, are also specifically contemplated by any of the methods of the present invention that rely on any or all of the sequences, regardless of how they are otherwise described or limited. Thus, any such sequences are available for use in carrying out any of the methods disclosed according to the invention. Such sequences also include any open reading frames, as defined herein, present within an ORP9 polynucleotide.

The present invention further relates to an isolated polypeptide comprising an amino acid sequence with at least 90 percent identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 4, 6, 8, 10, 12 ,14 and 16, preferably where the percent identity is at least 95 percent, even more preferably at least 98 percent, and most preferably where the amino acid sequence is selected from the group consisting of SEQ ID NO: 4, 6, 8, 10, 12, 14 and 16, wherein said polypeptide is useful in the methods of the invention.

Because of the processing that may take place in transforming the initial RNA transcript into the final mRNA, the sequences disclosed herein may represent less than the full genomic sequence. They may also represent sequences derived from alternate splicing of exons, which may include variants not disclosed in Figure 3. Consequently, the genes present in the cell (and representing the genomic sequences) and the sequences disclosed herein, which are mostly cDNA sequences, may be identical or may be such that the cDNAs contain less than the full complement of exons found in the genomic sequence. Such genes and cDNA sequences are still considered corresponding sequences because they both encode similar RNA sequences. Thus, by way of non-limiting example only, a gene that encodes an RNA transcript, which is then processed into a shorter mRNA, is deemed to encode both such RNAs and therefore encodes an RNA corresponding to an ORP9 sequence as disclosed herein. (Those skilled in the art understand that the word "encode" and its derivatives mean, in this field "can be transcribed into" or "can be translated into".) Thus, the sequences disclosed herein correspond to genes contained in the cells and are used to determine relative levels of transcription because they represent the same sequences or are complementary to RNAs encoded by these genes. Such genes also include different alleles and splice variants that may occur in the cells used in the processes of the invention.

Assay Procedures

The instant invention provides numerous assays which measure an activity of ORP9 and are useful for the testing of compounds to identify which ones affect such activity. In terms of formatting the assays, the assays may use whole cells, cell extracts or reconstituted cell extracts, or purified or semi- purified ORP9 protein, or they may be larger scale tissue or whole animal, such as mammal, assays. Common assays use measurements based on fluorescence, luminescence, radioactivity, or other measures of protein or gene transcript levels, amounts, or stability.

Assays include but are not limited to:

1. Competitive binding assay for compounds binding to the oxysterol domain. o The ligand (synthetic or endogenous) with high affinity for oxysterol domain is first identified by testing known classes of radiolabeled ligands (oxysterols, phospholipid, phosphatidic acid, PI(3)P cardiolipin, PUFAs, oxidized cholesterol-3-sulfate derivatives) o A high throughput competitive binding assay is used to identify compounds in a compound library that compete with binding to the labeled high affinity ligand o Compounds which demonstrate competitive binding are tested for agonist or antagonist properties in secondary assays (cholesterol efflux, LXR activation, ABCA1 expression, cholesterol synthesis, sphingomyelin synthesis, cholesterol ester synthesis) 2. Binding assay to disrupt subcellular localization via altering PH domain function o The PH domain is important in subcellular localization and may act via binding to inositol phosphates/phosphoinositides. o An assay is developed which measures targeting of ORP9 to specific membranes i.e., Golgi. The assay measures whether library test agents effect subcellular localization of ORP9. The assay may be based on differing concentrations of these molecules in different subcellular membranes. o An example is a FRET based assay similar to that disclosed by

Hamman et al, 2002. (Using a GFP-PH domain construct, homogeneous unilamellar vesicles were made that contained PIP(3) and octadecylrhodamine (OR), a lipophilic FRET acceptor for GFP.) It is possible to design an assay that enhances or reduces membrane targeting or affinity o Test agents or compounds that modulate ORP9 subcellular localization are tested for agonist or antagonist properties in secondary assays above

3. Splicing assay/Modulation of isoforms o Different isoforms of ORP9 may have different activities and have different consequences in the regulation of HDL. Assays can be tested in different cell types to identify agents which modulate expression of relevant isoforms in appropriate tissues to achieve therapeutic effect.

4. LXR potentiation assay o ORP9 activity may be most easily detected by using LXR activation as a surrogate assay o This is an LXR/RXR reporter assay done in HEK293 cells, with transfection of LXR, RXR, ORP9 constructs as well as addition of an LXR/RXR agonist. Increasing amounts of ORP9 could act to potentiate LXR signaling OR down-regulate LXR signaling depending on the physiological state of the cell.

In other embodiments, the polypeptide is part of an intact cell, preferably a mammalian cell, and which may be a recombinant cell. For ORP9, cells of greatest interest include a cell of the liver, kidney, intestine, endothelium, or is a neuronal cell although cells from other tissues may be employed. In one such embodiment, the cell has been engineered to comprise the polypeptide, including by genetic engineering, especially where the cell does not possess the polypeptide absent the engineering. Thus, the present invention specifically contemplates embodiments in which the cell is engineered by other than genetic engineering, such as where the activity of a polypeptide is to be enhanced and the cell has been engineered to contain, or have on its surface, the polypeptide but wherein the polypeptide is present due to physical insertion of the polypeptide into the membrane or cytoplasm of the cell and not through expression of a gene contained in the cell. Methods well known in the art, such as use of polyethylene glycol, viruses, and the like, are available to effect such insertions and the details of such procedures need not be further described herein.

In one embodiment of such method, the polypeptide is a polypeptide that reacts with an antibody that reacts with, or is specific for, a polypeptide having an amino acid sequence at least 95% identical to, more preferably at least 98% identical to, the sequence of SEQ ID NO: 4, 6, 8, 10, 12 ,14 and 16 and where any difference in amino acid sequence is due only to conservative amino acid substitutions. In an especially preferred embodiment, the polypeptide has the amino acid sequence of SEQ ID NO: 4, 6, 8, 10, 12 ,14 and 16.

The ORP9 polypeptide assays of the invention may employ agent screening technology such as (but not limited to) the ability of various dyes to change color in response to changes in assay conditions resulting from the activity of the polypeptides. Agent screening assays can also be based upon the ability of test agents to modulate the interaction of the target peptide (ORP9 polypeptide) and known or discovered interacting proteins. Such interacting proteins can be identified by a variety of methods known in the art, including, for example, radioimmunoprecipitation, co-immunoprecipitation, co- purification, and yeast two-hybrid screening. Such interactions can be further assayed by means including but not limited to fluorescence polarization or scintillation proximity methods.

Agents that have the effect of modulating the half-life of ORP9 polypeptide are also useful for treating dyslipidemia and disorders of lipid metabolism. By way of non-limiting example, an assay for this kind of agent comprises cells expressing a wild-type ORP9 polypeptide wherein such polypeptides are transiently metabolically labeled during translation, contacted with a candidate agent, and the half-life of the polypeptide is determined using standard techniques. Agents that modulate the half-life of the polypeptide are useful agents in the present invention.

In one such assay for which the polypeptides encoded by genes disclosed herein are useful, the purified or semi-purified ORP9 polypeptide (or a fragment thereof or an epitope-tagged form or fragment thereof) is bound to a suitable support (e.g., nitrocellulose or an antibody or a metal agarose column in the case of, for example, a his-tagged form of the polypeptide). Binding to the support is preferably done under conditions that allow proteins associated with the polypeptide to remain associated with it. Such conditions may include use of buffers that minimize interference with protein-protein interactions. If desired, other proteins (e.g., a cell lysate) are added, and allowed time to associate with the polypeptide. The immobilized polypeptide is then washed to remove proteins or other cell constituents that may be non- specifically associated with it the polypeptide or the support. The immobilized polypeptide can then be used for multiple purposes. In a compound screening embodiment, such as that provided by Neogenesis Pharmaceuticals, Inc. (Cambridge, MA) the bound ORP9 polypeptide will be employed in an automated ligand identification system, with low, medium or high-throughput capacity. In this case a pool of test agents are exposed to ORP9 under conditions (i.e. buffers, temperatures, etc.) which promote specific binding of the test agents to the protein. Agents with non-specific binding are separated from the mixture. ORP9/ligand complexes are then collected, and bound ligands are released and measured by mass spectrometer. A data analysis system correlates mass data with the list of compound masses included in the original test agent mixture. In an alternative embodiment, compounds or agents can be tested for their ability to interfere with interactions between ORP9 polypeptide and other bound molecules (which are presumably ORP9 polypeptide interacting proteins). Compounds which can successfully displace interacting proteins are thereby identified as ORP9 polypeptide modulating agents of the invention. Other well known protein binding assays, which use purified or semi-purified target protein, can also be employed to identify test compounds with specific binding affinity for the protein.

In an alternative embodiment designed to identify ORP9 polypeptide interacting proteins, the immobilized polypeptide is dissociated from its support, and proteins bound to it are released (for example, by heating), or, alternatively, associated proteins are released from the polypeptide without releasing the latter polypeptide from the support. The released proteins and other cell constituents can be analyzed, for example, by SDS-PAGE gel electrophoresis, Western blotting and detection with specific antibodies, phospho-amino acid analysis, protease digestion, protein sequencing, or isoelectric focusing. Normal and mutant forms of such polypeptide can be employed in these assays to gain additional information about which part of the polypeptide a given factor is binding to. In addition, when incompletely purified polypeptide is employed, comparison of the normal and mutant forms of the protein can be used to help distinguish true binding proteins. Such an assay can be performed using a purified or semipurified protein or other molecule that is known to interact with a polypeptide encoded by an ORP9 polynucleotide.

This assay may include the following steps. 1. Harvest the encoded polypeptide and couple a suitable fluorescent label to it;

2. Label an interacting protein (or other molecule) with a second, different fluorescent label. Use dyes that will produce different quenching patterns when they are in close proximity to each other versus when they are physically separate (i.e., dyes that quench each other when they are close together but fluoresce when they are not in close proximity);

3. Expose the interacting molecule to the immobilized polypeptide in the presence or absence of a compound being tested for its ability to interfere with an interaction between the two; and 4. Collect fluorescent readout data.

An alternative assay for such protein interaction is the Fluorescent Resonance Energy Transfer (FRET) assay. This assay can be performed as follows. 1. Provide the encoded protein or a suitable polypeptide fragment thereof and couple a suitable FRET donor (e.g.,. nitro-benzoxadiazole (NBD)) to it;

2. Label an interacting protein (or other molecule) with a FRET acceptor (e.g., rhodamine); 3. Expose the acceptor-labeled interacting molecule to the donor- labeled polypeptide in the presence or absence of a compound being tested for its ability to interfere with an interaction between the two; and

4. Measure fluorescence resonance energy transfer.

Quenching and FRET assays are related. Either one can be applied in a given case, depending on which pair of fluorophores is used in the assay. The description of the ORP9 provided herein teaches a wide variety of biological activities of ORP9 that may be useful for the development of low, medium or high-throughput screening assays.

One useful biological activity that works for a variety of assays is ligand binding (i.e. assays which either inhibit or enhance ORP9 binding with a ligand). A variety of oxysterols, lipids and related compounds may be preferred ligands of ORP9. Oxysterols, phospholipids, phosphatidic acid, PI(3)P cardiolipin, Polyunsaturated fatty acids and oxidized cholesterol-3- sulfate derivatives are strongly suggested. Those skilled in the art can identify these and other ligands. Assays based on whole cells, cell extracts or purified proteins may be developed which measure the capacity of a test compound to inhibit or enhance ORP9 binding with a specific ligand.

Cell function assays can be designed. In these assays, a measurable cell function which is dependent on ORP9 activity can be measured to determine inhibition or enhancement by test compounds. Studies of the yeast paralog OSH may be helpful in this regard (Beh et al., 2001). The capacity of test compounds to influence the identified cell function can be used to identify modulators of ORP9. Cell function may be complex such as if ORP9 acts as a receptor, intracellular signal molecule or secreted protein in a multicellular communication system. OSBPs may influence the cell cycle as expression changes for human ORPs have been tentatively linked to pancreatic cancer and CML (chronic myelogenous leukemia). This may form the basis of a useful cell function assay.

Using whole cells or cell extracts, assays can be developed for compounds which increase or decrease GPI cleavage or secretion of ORP9 or for compounds which increase or decrease N-glycosylation, O- glycosylation or phosphorylation of ORP9. Assays that measure compounds which modulate post-translational modifiers of ORP9 can be used to identify potential therapeutic agents. In addition it is to be noted that ORP9 may interact with other known proteins of the HDL metabolic pathway: Likely interactors are proteins and macromolecules involved in catabolic or synthetic aspects of HDL. Synthetic would likely be due to increase in cholesterol efflux to ApoA-l. Catabolic could be related to reduced bile acid synthesis, as oxysterols are substrates for bile acids. Defects in catabolism of HDL could also be related to modulation of lipases and transfer proteins that modulate HDL in the plasma. This interaction with proteins in the HDL catabolic or synthetic pathways is a useful activity which may be used as the basis for a screening assay. ORP9 may also be involved in the catabolic or synthetic aspect of LDL. Catabolism of LDL could be related to ORP regulation of the SREBP and LDL receptor pathways or an effect of modulation of lipases and transfer proteins that modulate LDL in the plasma. Synthetic effects on LDL could be based on modulation of absorption of cholesterol, synthesis of ApoB.

One preferred assay relies on LXR potentiation for ORP9 (such as been shown for ORP1L). This is an LXR/RXR reporter assay done in HEK293 cells, with transfection of LXR, RXR, ORP9 constructs as well as addition of an LXR/RXR agonist. Increasing amounts of ORP9 could act to potentiate LXR signaling down-regulate LXR signaling depending on protein variant, interaction with other ORP variants, tissue specificity of the above and the physiological state of the tissue and/or organism.

Additionally, drug screening assays can also be based upon polypeptide functions deduced upon antisense interference with the gene function. Intracellular localization of ORP9, or effects which occur upon a change in intracellular localization of such proteins, can also be used as an assay for drug screening.

In accordance with the foregoing, the present invention provides the amino acid sequence of a protein, designated ORP9, that is found in tissues of the human body (for example, SEQ ID NO: 4, 6, 8, 10, 12 ,14 and 16 from humans) and which is associated with hereditary transmission of elevated HDL. Thus, proteins and macromolecules that interact with ORP9 represent candidate compounds for evaluation as therapeutic agents of the invention.

In accordance with the disclosure herein, upstream untranslated regions and promoter regions of ORP9 Gene are readily obtained from SEQ ID No. 23 and other publicly retrievable sequence databases. Such genomic or untranslated regions may be included in plasmids comprising the identified gene, such as in assays to identify compounds which modulate transcription thereof. In one such assay, the upstream genomic region is ligated to a reporter gene, and incorporated into a transcription plasmid. The plasmid is transfected into a cell, and the recombinant cell is exposed to test compound(s). Those compounds which increase or decrease the expression of the reporter gene are identified as modulators of ORP9 activity.

The invention also includes recombinant cells engineered to express a polynucleotide or polypeptide as disclosed herein. The gene disclosed herein as being involved in ORP9 in a mammal can be used, or a fragment thereof can be used, as a tool to express a protein, where such genes encode a protein, in an appropriate cell in vitro, or can be cloned into expression vectors which can be used to produce large enough amounts of protein to use in in vitro assays for drug screening. Alternatively, the expression construct may employ the genomic promoter region of ORP9 and link it to a gene, such as a reporter gene, whose expression level is easily measured. Expression systems which may be employed include baculovirus, herpes virus, adenovirus, adeno-associated virus, bacterial systems, and eucaryotic systems such as CHO cells. Naked DNA and DNA-liposome complexes can also be used. The invention thus claims recombinant cell lines containing a heterologous ORP9 gene. Such recombinant cells may be used in transcription assays for analyzing the levels of transcription of ORP9 gene or a suitable reporter gene after contacting the cells with test compounds that may modulate ORP9 activity. The levels of gene transcription can be quantified by Northern blot analysis or RT-PCR, or, alternatively, by measuring the amount of protein produced, by one of a number of methods known in the art, or by measuring the levels of biological activity of polypeptides encoded thereby or other genes. In this way, the gene transcription can serve as a marker, indicative of the physiological response of the cells to the agent. Accordingly, this response state may be determined before, and at various points during, treatment of the individual with the agent.

Recombinant cell lines are also useful for the preparation of purified protein. Those skilled in the art are capable of producing recombinant cell lines and extracting protein fractions containing highly purified proteins. These samples can be used in a variety of binding assays to identify compounds which interact with the proteins.

Target selectivity is an important aspect of the development of therapeutic agents. The present invention specifically contemplates the identification of target compounds, especially small organic molecules, that agonize or antagonize the transcription of ORP9 Gene, as defined herein, or the activity of the ORP9 polypeptide (such as SEQ ID NO: 4, 6, 8, 10, 12, 14 and 16) encoded thereby, with high specificity and that have little or no effect on other genes and/or polypeptides.

Thus, in one such embodiment, the methods disclosed herein for identifying a compound that modulates expression of a polynucleotide corresponding to ORP9, including those having the sequence of SEQ ID NO: 3, 5, 7, 9, 11 , 13, 15, and 23, or on the activity of a polypeptide encoded thereby, comprises first identifying such a compound and then testing the compound for effects on expression or activity of at least one other gene or polypeptide, preferably a gene or polypeptide with important physiological consequences that are preferably not disturbed by therapeutic intervention, and demonstrating little or no effect.

In another aspect, the invention provides a method for computationally identifying a compound of the invention. The method involves (a) determining the crystal structure of an active site of an ORP9 polypeptide protein (i.e. through x-ray crystallography or other techniques); and (b) through computational modeling, identifying a compound which interacts with the active site, thereby identifying a compound, or its analog, as a compound which is useful for modulating the activity of such a polypeptide. This process is sometimes referred to as in silico screening. Sophisticated software for testing the probability of test compounds to interact with the target protein, which can test tens of millions of computer generated compounds, is available to those skilled in the art.

Potential therapeutic compounds are usually tested in animal model systems to confirm the putative efficacy. These compounds are herein referred to as compounds that modulate ORP9 activity.

Those skilled in the art are aware that typical measurements of lipid metabolism that may be modulated in animal models (i.e., as a result of treatment with a candidate therapeutic agent) include triglycerides, HDL, LDL, total cholesterol, mass and/or activity of lipases and transfer proteins including, but not limited to LCAT, CETP, PLTP, EL, HL and LPL, fractional catabolic rate of various lipoproteins including ApoAI and ApoB. Specialized mouse models for study include ApoE and LDLR knock out models, ABCA1 knock out and transgenic models, including BAC transgenics, humanized transgenic ApoAI and CETP models, ORP conditional knock outs (when generated), and others. Additional organisms for study of ORP9 function as it relates to lipid metabolism include C. elegans, D. melanogaster, D rerio and others.

In animal models, biopsy samples can be taken to show a decrease in gene transcription, such as by measuring levels of protein, mRNA, or genomic DNA post-administration samples and comparing the level of expression or activity of the protein, mRNA, or genomic DNA in the pre- administration sample with that of the corresponding post administration sample or samples, thereby showing the effects of drug administration on one or more of the genes disclosed herein and concomitant reduction in problems with lipid metabolism.

The invention also includes antibodies and immu no-reactive substances which target, interact with or bind to ORP9 polypeptide or epitopes thereof. Polypeptides encoded by the polynucleotides disclosed herein can be used as an antigen to raise antibodies, including monoclonal antibodies. Such antibodies will be useful for a wide variety of purposes, including but not limited to, functional studies, drug screening assays, therapeutic and/or diagnostic agents. Monitoring the influence of agents (e.g., small organic compounds) on the expression or biological activity of the ORP9 polypeptides identified according to the invention can be applied not only in basic drug screening, but also in clinical trials. For example, the effectiveness of an agent determined by a screening assay as described herein to increase or decrease gene transcription, protein levels, or biological activity can be monitored in clinical trails of subjects exhibiting symptoms of dyslipidemia and disorders of lipid metabolism. Alternatively, the effectiveness of an agent determined by a screening assay to modulate transcription of ORP9 Gene, as well as structurally and functionally related genes, including genes with high homology thereto, and including protein levels, or biological activity can be monitored in clinical trials of subjects exhibiting dyslipidemia or a disorder of lipid metabolism. In such clinical trials, the transcription or activity of the genes or polypeptides disclosed herein and, preferably, other genes that have been implicated in, for example, lipid metabolism, can be used to ascertain the effectiveness of a particular drug.

Purified or semi-purified ORP9 protein, or fragments thereof, or proteins corresponding to ORP9, and any biochemically modified versions thereof, are themselves therapeutic agents of the invention. Such agents may be desirable as systemic or local agents to adsorb, remove or "mop up" excess ligands which are contributing to disease or risk thereof. Recombinant or non-recombinant forms of these proteins or fragments can be administered to persons in need thereof for the treatment of disorders, such as dyslipidemia and disorders of lipid metabolism. Those skilled in the art are familiar with techniques for generating such agents, and for determining conditions of administration.

Specific compounds which may modulate the gene expression or gene transcript levels in a cell of ORP9 include, but are not limited to, antisense nucleic acids, RNAi, ribozymes and other nucleic acid compositions which specifically hybridize with ORP9 (including exons or introns of such genes, promoters, 3'-tails, and the like). These specific compounds are compounds of the invention, and are useful for treating the diseases discussed previously. Design and manufacturing of such compounds are well known to those skilled in the art.

Specific compounds which may modulate the activity of ORP9 in vivo include antibodies (polyclonal or monoclonal) and modified antibodies or fragments of antibodies which specifically bind to an epitope of the polypeptide. These specific compounds are compounds of the invention, and are useful for treating the diseases previously discussed. Design and manufacturing of such compounds are well known to those skilled in the art. In particular, humanized antibodies tend to be preferred, such as those generated using techniques provided by Abgenix, Inc. (Freemont, CA), Medarex, Inc. (Princeton, NJ), Protein Design Labs, Inc. (Freemont, CA), Genentech (South San Francisco, CA), and others.

Specific compounds which modulate the activity of ORP9 in the body include gene therapy vectors comprising all or a part of the ORP9 gene sequence or mutant ORP9 sequence. As is well known to those skilled in the art, gene therapy allows the delivery of ORP9 in an organism to cells where it is taken up and expressed, thus changing the level or amount of ORP9 polypeptide in such cell. Such gene therapy vectors can be identified by the methods of the present invention.

Specific compounds which modulate the activity of ORP9 include small organic molecules. Such compounds may be naturally occurring, or they may be synthetic. Collections and combinatorial libraries of such compounds are widely available from commercial sources. As know to those skilled in the art, a screening assay, such as the assays disclosed in the instant specification, can be easily adapted to identify therapeutic agents which have the desired ORP9 modulating ability. Agonists, antagonists, or mimetics found to be effective at reducing disorders of lipid metabolism may be confirmed as useful in animal models (for example, mice, chimpanzees, etc.). In other embodiments, treatment with a compound of the invention may be combined with other therapeutic agents to achieve a combined, even synergistic, effect.

Test compounds may be purified (or substantially purified) molecules or may be one component of a mixture of compounds (e.g., an extract or supernatant obtained from cells). In a mixed compound assay, gene expression is tested against progressively smaller subsets of the candidate compound pool (e.g., produced by standard purification techniques, such as HPLC or FPLC) until a single compound or minimal compound mixture is demonstrated to modulate gene or protein activity or expression in a manner having therapeutic effects. In general, novel drugs having therapeutic properties are identified from libraries, possibly large libraries, of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art. Those skilled in the field or drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the screening procedure(s) of the invention. Accordingly, virtually any number of chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds. Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, Wl). Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, FL), and PharmaMar, U.S.A. (Cambridge, MA). In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.

Methods well known in the art for making formulations are found in, for example, Remington: The Science and Practice of Pharmacy. (19th ed.) ed. A.R. Gennaro AR., 1995, Mack Publishing Company, Easton, PA. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for agonists of the invention include ethylenevinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, or example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.

Combination therapies are also contemplated by the inventors. An therapeutic agent identified by one of the screening methods disclosed herein may be administered along with another agent intended to treat a coincident conditions, such as where therapeutic and antitumor agents are given together or contemporaneously.

It should also be noted that the agents identified according to the processes of the invention are also useful for treating or preventing coronary artery disease, regardless of the HDL status of the patient. For example, a patient with normal HDL levels who has a family history of coronary artery disease would still be advised to take a therapeutic agent according to the invention in order to elevate HDL levels and further reduce the risk of coronary artery disease. Thus, the patient does not need to have a dyslipidemia in order to be eligible for treatment according to the invention.

The present invention also relates to a process that comprises a method for producing test data, such as by generating test data to facilitate identification of a product, comprising identifying an agent according to one of the disclosed processes for identifying such an agent (i.e., the therapeutic agents identified according to the assay procedures disclosed herein) wherein said product is the data collected with respect to said agent as a result of said identification process, or assay, and wherein said data is sufficient to convey the chemical character and/or structure and/or properties of said agent. For example, the present invention specifically contemplates a situation whereby a user of an assay of the invention may use the assay to screen for compounds having the desired enzyme modulating activity and, having identified the compound, then conveys that information (i.e., information as to structure, dosage, etc) to another user who then utilizes the information to reproduce the agent and administer it for therapeutic or research purposes according to the invention. For example, the user of the assay (user 1) may screen a number of test compounds without knowing the structure or identity of the compounds (such as where a number of code numbers are used the first user is simply given samples labeled with said code numbers) and, after performing the screening process, using one or more assay processes of the present invention, then imparts to a second user (user 2), verbally or in writing or some equivalent fashion, sufficient information to identify the compounds having a particular modulating activity (for example, the code number with the corresponding results). This transmission of information from user 1 to user 2 is specifically contemplated by the present invention.

In accordance with the foregoing, the present invention encompasses a method for producing test data with respect to the modulating activity of a test compound comprising:

(a) contacting a test compound with a genetic construct comprising a reporter gene operably linked to a ORP-9 promoter under conditions supporting transcription of said reporter gene; b) determining a change in transcription of the reporter gene as a result of said contacting wherein a change in said transcription indicates that the test compound is an agent that modulates ORP-9 activity, and

(c) producing test data with respect to the modulating activity of said test compound based on a change in the transcription of the determined reporter gene wherein said change shows modulating activity.

The present invention also contemplates a method for producing test data with respect to the modulating activity of a test compound comprising: (a) contacting a test compound with a polypeptide encoded by a polynucleotide corresponding to ORP-9 gene and under conditions supporting an activity of said polypeptide; and b) determining a change in the activity of the polypeptide as a result of said contacting, wherein a change in said activity indicates that the test compound is an agent that modulates an ORP-9 activity, and

(c) producing test data with respect to the modulating activity of said test compound based on a change in the activity of the determined polypeptide wherein said change shows modulating activity.

Diagnostics and Pharmacogenomics

In a further embodiment, the invention relates to diagnostic and pharmacogenomic compounds, kits and methods. This aspect relates to analysis ORP9 gene (ORP9) for the diagnosis of a patient, or in the selection of a therapeutic agent for a patient (i.e. pharmacogenomics). It also relates to the use of ORP9 diagnosis to classify patients having or at risk of having a disease of lipid metabolism.

For example, nucleic acid analysis can be used to identify the ORP9 mutations disclosed herein, thus confirming the probable cause of elevated HDL.

Using the nucleic acid sequences disclosed in this invention, both the wild-type (non-disease associated) sequences (SEQ ID No. 3, 5, 7, 9, 11, 13, 15, and 23) and the disease associated (mutated) sequence (shown in SEQ ID No. 18), those skilled in the art are capable of developing numerous different types of nucleic acid diagnostic methods, compounds and kits. Techniques include DNA sequencing, hybridization probing, single stranded conformational analysis, PCR based techniques such as mismatch amplification, and myriad other well known methods. All such analysis can be performed on a small sample of blood, saliva, urine or other tissue provided by the patient. They may be performed alone, or in multiplex with other diagnostic tests.

Example 1

DNA extracted from the blood of test subjects was amplified using Herculase enzyme (Stratagene Corp., La Jolla, CA) using P18G5E6 primers where the forward primer was tagged with 5' FAM dye. The PCR products were run on an ABI 3700 and analyzed using Genemapper software. The amplification produces a 253 bp fragment corresponding to the wild-type allele or a 251 bp fragment corresponding to the mutant allele.

Forward Primer P18G5E6-F: 5'-CCTTCCCAACTTGCTTGTA-3' (SEQ ID NO: 29)

Reverse Primer P18G5E6-R: 5'-CTGTCATCAATAGTGGCAGCTT-3'

(SEQ ID NO: 30)

Alternatively, using the protein sequences disclosed in this invention

(SEQ ID No. 4, 6, 8, 10, 12 ,14 and 16) protein based analyses such as antibody based assays (Elisa, Radioimmunoassay and the like) can be employed to identify the expression, amount or presence or absence of a normal or mutant ORP9 protein (ORP9 Polypeptide), such as those mutant polypeptides that result from the mutations disclosed herein.

Gene transcription, both comparable and absolute, as well as biological activity, and mutational analysis can each serve as a diagnostic tool for a disease of lipid metabolism; thus determination of the amount of ORP9 mRNA can be used to diagnose the presence or absence of a mutation correlated with such a disease. Based on the instant invention, those skilled in the art will also be able to develop other biochemical, chemical and diagnostic assays of ORP9 mutation which are suitable for use with animal tissue samples.

In another aspect, the present invention relates to diagnostic and pharmacogenomic compositions, kits and methods which identify the presence or absence in a patient of one or more mutations in a polynucleotide or a polypeptide corresponding to SEQ ID NOs: 3-16 and 23 including those specific mutations identified at SEQ ID NO. 18. This embodiment is most useful in diagnosing the presence or absence, or risk, of dyslipidemia or a disorder of lipid metabolism, including any of those mentioned herein.

A valuable embodiment of the invention will be to use the diagnostic assays to classify patients having or at risk of having a disease of lipid metabolism. There are many risk factors for dyslipidemia and disorders of lipid metabolism. Not all of these risk factors lead to the development of a disease of lipid metabolism. Using the teaching of the invention, it is now possible to take patients at risk of having a disease of lipid metabolism based on a known risk factor and further assessing them for mutations in ORP9, wherein a mutation in ORP9 (in one or both copies of the gene) indicates a statistically lower chance of developing the disease of lipid metabolism.

This invention therefore discloses a method of classifying a patient at risk of developing a disease of lipid metabolism, comprising

a) performing a first assessment for a disease of lipid metabolism, and

b) performing a diagnostic assay on ORP9,

wherein a finding of mutation in ORP9 classifies said patient as having a statistically lower risk of developing said disease.

Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons (Eichelbaum, M., Clin. Exp. Pharmacol. Physiol., 23:983- 985, 1996; Linder, M. W., Clin. Chem., 43:254-266, 1997). In general, two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drugs act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drugs (altered drug metabolism). Altered drug action may occur in a patient having a polymorphism (e.g., an single nucleotide polymorphism or SNP) in promoter, intronic, or exonic sequences of ORP9 Gene. Thus by determining the presence and prevalence of polymorphisms allow for prediction of a patient's response to a particular therapeutic agent.

This pharmacogenomic analysis can lead to the tailoring of drug treatments according to patient genotype, including prediction of side effects upon administration of therapeutic agents, particularly therapeutic agents for treating disorders disclosed in this specification. Pharmacogenomics allows for the selection of agents (e.g., drugs) for therapeutic or prophylactic treatment of an individual based on the genotype of the individual (e.g., the genotype of the individual is examined to determine the ability of the individual to respond to a particular agent).

Diagnostics employing a gene or protein corresponding to ORP9 Gene (ORP9) can also be useful in selecting patients for clinical trials of a potential therapeutic agent. Patients can be stratified according to the DNA or protein sequence of ORP9 Gene and their response to drug treatment can be evaluated. Such stratification can greatly reduce the number of patients required to establish efficacy for a potential therapeutic agent.

The invention thus comprises compounds, reagents and kits which are designed to identify the presence or absence of mutations in the ORP9 gene.

The identity of the sequences disclosed herein are set out in Table 4. Example 2

ORP9 - A Functional Role in Cellular Cholesterol Efflux

The role of the ORP gene family in lipid metabolism, and their role in cardiovascular disease and HDL metabolism is currently unknown. ORPs, as a gene family, may integrate signaling of multiple lipid related pathways via differential ligand binding, antagonistic function and/or tissue specificity of gene and isoform expression. Two ORPs have been demonstrated to be involved in pathways relevant to HDL metabolism.

Overexpression of ORP2 increases cholesterol efflux to ApoAI 1.5 Fold in CHO cells, and thus may play a role in modulating HDL levels (Laitinen et al. 2002. Journal of Lipid Research 43:245-254). In addition, overexpression of ORP1L potentiates LXR/RXR Activation in HEK293 cells (Johansson et al. 2003. Mol Biol Cell 14:903-915). Since LXR/RXR activation is known to increase ABCA1 function, the effect of LXR/RXR potentiation by ORP1L may lead to increased ABCA1 dependent cholesterol efflux and increased HDL levels in humans. In addition, overexpression of OSBP and ORP2 effect cholesterol synthesis, cholesterol ester synthesis and sphingomyelin synthesis (Lagace et al. 1997. Biochem J 326:205-213, Laitinen et al. 2002. Journal of Lipid Research 43:245-254).

RATIONALE

We have shown that a mutation in the ORP9 gene causes high HDL in humans. The mechanism of this effect is unknown, but it may be due to increased cellular cholesterol efflux via ABCA1 , resulting in high plasma HDL levels. The mutation in Intron 8 of the ORP9 gene is likely to be a loss of function mutation based on tissue specific exon skipping. Since this loss of function mutation has been shown to cause high HDL we would predict that the transient overexpression (i.e. Analogous to a gain of function mutation) of ORP9 in the RAW cell line would lead to decreased cholesterol efflux. Cell transfection experiments were performed to test whether overexpression of ORP9L or ORP9S increase ApoAI dependent cholesterol efflux in RAW cells. ORP9L corresponds to the full length ORP9 protein (isoform f), whereas ORP9S corresponds to the shorter form that does not include the PH domain (isoform a). Cells transfected with GFP alone are used as a baseline for ApoAI dependent efflux.

METHODS

Subcloning: ORP9L and ORP9S cDNAs were amplified using RT-PCR from commercially obtained human brain cDNA using the following primers:

for ORP9L:

Forward: 5'-CACCATGGCGTCCATCATGGA-3' (SEQ ID NO: 34)

Reverse: 5'-GAAACGTCTTGGTGCTGCCAAGCAT-3' (SEQ ID NO: 35)

for ORP9S:

Forward: 5'-CACCATGGTAGAATCAATTAAACACT-3' (SEQ ID NO: 36) Reverse: 5'-TTGGTGCTGCCAAGCAT-3' (SEQ ID NO: 37)

PCR products were subcloned into pcDNA3.1/V5/His/TOPO

(Invitrogen) according to the manufacturer's instructions. Clones that contained the PCR product by restriction digest were sequenced to ensure no sequence errors.

Transfection and Cholesterol Efflux:

RAW cells were transiently transfected with the ORP9 constructs and placed under selection for 2 weeks to enrich for cells carrying the constructs. Cells were scraped from 10cM dishes and plated into 96-well flat-bottom plates at a density of 80,000 cells/well in a volume of 0.2ml of growth medium. The next day, growth medium is removed and labeling medium containing DMEM, FBS, L-glut, Pen/Strep, 20μg/ml cholesterol and 2μCi/mL 3H- cholesterol. The next day, the labeling medium is removed and equilibration medium containing DMEM, L-glut, Pen/Strep and 0.2% defatted BSA, 0.01 mM 9-cis retinoic acid and 0.01 M 22-R-OH-cholesterol. The next day, equilibration medium is removed and efflux medium containing 20μg/ml ApoAI in equilibration medium (including 9-cis retinoic acid and 22-R-OH-cholesterol) is added. After 24 hours, the medium is removed for scintillation counting. 0.2 ml of 0.1 M NaOH is added to each well to solubilize cells for 15-20 min. The solubilized cell solution is then counted in 300ul scintillant.

Statistics:

Cholesterol efflux was calculated as the proportion of cholesterol in the media in percentage

Efflux = (media / (media + cells)) * 100

The SAS system for windows vδ.O was used for the statistics. The means and 95% confidence interval of the mean were calculated. Student t-tests p-values are shown.

RESULTS

Table 6. Mean fold increase in cholesterol efflux of treated 2c6 and RAW cells with 95% confidence interval of the mean. Results of Student t-tests of ORP9 constructs against GFP constructs by treatment and cell type are shown.

Cell Treatment Condition n Mean C p-value

RAW LXR/RXR+ApoAI GFP 8 4.8101 0.8643

RAW LXR/RXR+ApoAI ORP9S 8 3.6859 0.3760 0.0136

RAW LXR/RXR+ApoAI ORP9L 8 3.5379 0.7534 0.0200 CONCLUSION:

Baseline cholesterol efflux in RAW cells is constant across the different constructs (data not shown). A significant decrease of ApoAI mediated cholesterol efflux was found in RAW cells treated with LXR/RXR+ApoAI for the ORP9S and ORP9L transfected cells. This data shows that ORP9 is functionally important in cellular cholesterol efflux. This data is consistent with the hypothesis that loss-of-function mutations in ORP9 in vivo could cause elevated cellular cholesterol efflux, and, by extension, elevated HDL. Results are shown schematically in Figure 8.

Table 4. Sequence Descriptions (other than primers)

Table 5. All 26 Identified Exons of ORP-9 (see Figures 3A - 3D).

Exon cDNA Nucleotide ni 3ring BP in Genomic Number (NOT Translatabk only Sequence potential Exons)

1 1-130 (2001-2130)

2 131-181 (36900-36950)

3 182-260 (54343-54421)

4 261-337 (98912-98988)

5 338-611 (114760-115033)

6 612-680 (125052-125120)

7 681-776 (130445-130540)

8 777-824 (131619-131666)

9 825-854 (133278-133307)

10 855-905 (135054-135104)

11 906-944 (141229-141267)

12 945-1035 (145599-145689)

13 1036-1140 (146776-146880)

14 1141-1300 (150731-150890)

15 1301-1413 (156979-157091)

16 1414-1532 (157514-157632)

17 1533-1618 (161742-161827)

18 1619-1790 (166073-166244)

19 1791-1875 (167468-167552)

20 1876-1986 (168824-168934)

21 1987-2050 (169173-169240)

22 2051-2191 (169351-169491)

23 2192-2270 (170717-170795)

24 2271-2362 (171435-171526)

25 2363-2498 (172262-172397)

26 2499-3253 (172624-173378)

In Table 5, location of the Exon of Column 1 is provided in column 2 and the corresponding location in the genomic sequence (SEQ ID NO: 23) is provided in column 3. The genomic sequence was taken from public NCBI. It is equivalent to the following (both are identical):

NC_000001 51450682-51626059 Human Chromosome 1

NT_032977.6 13643835-13819212 Contig within Human Chromosome 1

Claims

WHAT IS CLAIMED IS:

1. A method for identifying an agent that modulates ORP-9 activity, comprising: a) contacting a test compound with a genetic construct comprising a reporter gene operably linked to a ORP-9 promoter under conditions supporting transcription of said reporter gene; b) determining a change in transcription of the reporter gene as a result of said contacting wherein a change in said transcription indicates that the test compound is an agent that modulates ORP-9 activity.

2. The method of claim 1 wherein the determined change in transcription of step (b) is a decrease in transcription.

3. The method of claim 1 wherein the determined change in transcription of step (b) is an increase in transcription.

4. The method of claim 1 wherein transcription is determined by measuring the amount of an expression product encoded by said reporter gene.

5. The method of claim 4 wherein the expression product is an RNA.

6. The method of claim 4 wherein the expression product is a polypeptide.

7. The method of claim 1 wherein the agent is useful in the treatment of dyslipidemia or a disorder of lipid metabolism.

8. The method of claim 1 wherein the reporter gene is in a cell.

9. The method of claim 8 wherein the intact cell is a mammalian cell.

10. The method of claim 9 wherein the mammalian cell is a macrophage, inflammatory cell, liver cell, hepatocyte, intestinal cell, hematopoietic cell, or a nervous system cell.

11. The method of claim 8 wherein the cell is a recombinant cell that has been genetically engineered to express said polypeptide.

12. The process of claim 11 wherein the cell does not express said polypeptide absent said engineering.

13. The method of claim 1 wherein the promoter is a mammalian ORP-9 promoter.

14. The method of claim 13 wherein the mammal is selected from mouse, rat and human.

15. The method of claim 1 wherein the promoter comprises the promoter sequence in SEQ ID NO: 21 or SEQ ID NO: 22.

16. The method of claim 1 wherein the reporter gene is not ORP-9.

17. A method for identifying an agent that modulates an ORP-9 activity, comprising: a) contacting a test compound with a polypeptide encoded by a polynucleotide corresponding to ORP-9 gene and under conditions supporting an activity of said polypeptide; and b) determining a change in the activity of the polypeptide as a result of said contacting; wherein a change in said activity indicates that the test compound is an agent that modulates an ORP-9 activity.

18. The method of claim 17 wherein the determined change in activity in step (b) is a decrease in activity.

19. The method of claim 17 wherein the determined change in activity in step (b) is an increase in activity.

20. The method of claim 17 wherein the activity is measured by measuring the activity of an enzyme.

21. The method of claim 17 wherein the polypeptide is present in a cell.

22. The method of claim 21 wherein the cell is a cell that has been engineered to comprise said polypeptide.

23. The method of claim 21 wherein the cell is a recombinant cell that has been genetically engineered to express said polypeptide.

24. The process of claim 23 wherein the cell does not express said polypeptide absent said engineering.

25. The process of claim 21 wherein said cell is a mammalian cell.

26. The method of claim 25 wherein the mammalian cell is a macrophage, inflammatory cell, liver cell, hepatocyte, intestinal cell, hematopoietic cell, or a nervous system cell.

27. The method of claim 17 wherein the polypeptide is a mammalian ORP9 polypeptide.

28. The method of claim 27 wherein the polypeptide is encoded by a nucleotide having a sequence selected from the group consisting of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15 and 23.

29. The method of claim 27 wherein the polypeptide comprises an amino acid selected from the group consisting of SEQ ID NO: 4, 6, 8, 10, 12, 14 and 16.

30. A method for identifying an HDL-enhancing agent, comprising administering to an animal an effective amount of an agent found to have modulating activity using an assay of claim 1 or 17 and detecting an increase in plasma HDL activity in said animal due to said administering thereby identifying an agent useful in enhancing HDL activity.

31. A method of determining risk of developing a disorder of lipid metabolism in a mammal, comprising determining the presence of a polymorphism in the amino acid sequence of an ORP-9 polypeptide in a mammal wherein said ORP-9 polymorphism indicates risk of developing a disorder of lipid metabolism.

32. The method of claim 31 wherein said mammal is selected from the group consisting of mouse, rat and human.

33. The method of claim 32, wherein said member is a human being.

34. The method of claim 33, wherein said polymorphism is in the amino acid sequence of SEQ ID NO: 24.

35. The method of claim 33, wherein more than one polymorphism in said ORP-9 polypeptide is determined.

36. The method of claim 33, wherein said polymorphism is determined in the gene encoding said ORP-9 polypeptide.

37. The method of claim 36 wherein said polymorphism is the polymorphism of SEQ ID NO: 32 or 33.

38. The method of claim 31, wherein said disorder of lipid metabolism is a member of the group consisting of dyslipidemia and low HDL (hypoalphalipoproteinemia).

39. The method of claim 31 , wherein said disorder of lipid metabolism is a vascular disease.

40. The method of claim 31 , wherein said disorder of lipid metabolism is a member of the group consisting of cardiovascular disease and Alzheimer's disease.

41. The method of claim 40, wherein said cardiovascular disease is a member of the group consisting of coronary artery disease (CAD), cerebrovascular disease, coronary restenosis, atherosclerosis and peripheral vascular disease.

42. The method of claim 41, wherein said member is coronary artery disease (CAD).

43. The method of claim 41 , wherein said member is atherosclerosis.

44. The method of claim 40, wherein said member is Alzheimer's disease.

45. A method for producing test data with respect to the modulating activity of a test compound comprising:

(a) contacting a test compound with a genetic construct comprising a reporter gene operably linked to a ORP-9 promoter under conditions supporting transcription of said reporter gene; b) determining a change in transcription of the reporter gene as a result of said contacting wherein a change in said transcription indicates that the test compound is an agent that modulates ORP-9 activity, and (c) producing test data with respect to the modulating activity of said test compound based on a change in the transcription of the determined reporter gene wherein said change shows modulating activity.

45. A method for producing test data with respect to the modulating activity of a test compound comprising:

(a) contacting a test compound with a polypeptide encoded by a polynucleotide corresponding to ORP-9 gene and under conditions supporting an activity of said polypeptide; and b) determining a change in the activity of the polypeptide as a result of said contacting, wherein a change in said activity indicates that the test compound is an agent that modulates an ORP-9 activity, and

(c) producing test data with respect to the modulating activity of said test compound based on a change in the activity of the determined polypeptide wherein said change shows modulating activity.