WO2010149767A1

WO2010149767A1 - Method for determining the risk of occurence of liver fibrosis in an individual

Info

Publication number: WO2010149767A1
Application number: PCT/EP2010/059061
Authority: WO
Inventors: Bertrand Nalpas; Laurent Abel; Stanislas Pol; Christian Brechot; Fumihiko Matsuda; Thierry Poynard
Original assignee: Institut National De La Sante Et De La Recherche Medicale (Inserm)
Priority date: 2009-06-25
Filing date: 2010-06-25
Publication date: 2010-12-29

Abstract

The present invention relates to an in vitro method for determining that an individual with a chronic hepatitis C virus infection is at risk of developing liver fibrosis, which comprises: - determining whether the individual harbours at least one variant allele of the interferon-γ receptor 2 (IFNGR2) gene; - deducing that if the individual harbours at least one variant allele of the IFNGR2 gene then the individual is at risk of developing liver fibrosis.

Description

METHOD FOR DETERMINING THE RISK OF OCCURRENCE OF LIVER FIBROSIS IN AN INDIVIDUAL

Field of the invention The present invention relates to a method for determining that an individual is at risk of developing liver fibrosis and to a method for the prevention or treatment of liver fibrosis.

Technical background Hepatitis C virus (HCV) infection is a major public health concern worldwide with an estimated 170 million infected people. The natural history of patients with HCV chronic infection is characterized by a highly variable disease progression. Most subjects never develop cirrhosis during their lifetime while the remaining patients are considered "rapid fibrosers" and may develop severe liver fibrosis and ultimately cirrhosis in less than 20 years.

Liver fibrosis is the consequence of a generalized wound-healing response of hepatic tissue against repeated injury, which results in the formation of scar tissue instead of normal parenchyma. This process is characterized by an imbalance between matrix synthesis (Ae. fibrogenesis) and matrix degradation (Ae. fibrolysis), and leads to an accumulation of a large variety of matrix proteins, including collagens, proteoglycans and glycoproteins. Activated hepatic stellate cells, portal fibroblasts, and myofibroblasts of bone marrow origin are the major collagen- producing cells in the injured liver. A number of molecules and regulatory pathways are involved in this complex process of fibrogenesis/fibrolysis. The outcome of liver fibrosis progression is usually cirrhosis.

While viral factors such as HCV genotypes or viral load do not seem to influence progression, several host factors such as gender (male), age at infection (>40 years old), alcohol consumption (>50 g/day), obesity and its related metabolic disorders, co-infections (in particular by human immunodeficiency virus, HIV) are associated with the development of fibrosis.

However, these factors can account for only a minority of the variability in the rate of progression, and a number of studies have investigated the role of genetic host factors (Missiha et a/. (2008) Gastroenterology 134:1699-1714; Osterreicher et a/. (2007) Semin Liver Dis 27:28-43). Most of these studies have tested a single or a few candidate genes, and have not produced conclusive results as they were not clearly replicated (Osterreicher et al. (2007) Semin Liver Dis 27:28-43; Bataller et al. (2003) Hepatology 37:493-503). Thus, a recent study investigated a large number (>24,000) of putative functional single nucleotide polymorphisms (SNPs) and identified two variants possibly associated with severe fibrosis (Huang et al. (2006) Gastroenterology 130:1679- 1687). In a subsequent study which used the same SNPs and focused on Caucasian patients with well-characterized liver histology, a different panel of seven SNPs was found to predict the risk of developing cirrhosis (Huang et al. (2007) Hepatology 46:297-306). However, this panel needs to be validated in prospective studies. WO 02/29098 identified SNPs in the flanking interferon-gamma receptor chain-B (IFNGR2) gene associated with the outcome of infection with hepatitis virus. However, this association is described to be significant only in the case of an HBV infection and not in the case of an HCV infection. Besides, several association studies have investigated the role of a small number of polymorphisms within the gene encoding IFN-γ (IFNG) and progression to fibrosis in HCV infection, in particular a variant at position +874 which may influence IFN-γ expression, but no consistent and clearly replicated results have been reported (Osterreicher et al. (2007) Semin Liver Dis 27:28-43). A study also tested the role of variants within the interferon-γ receptor 1 gene (IFNGR1), there again without any significant results (Falleti et al. (2007) J Interferon Cytokine Res 27:239-246).

Accordingly, there is still a need for identifying alternative genetic markers of predisposition to liver fibrosis in individuals with a chronic HCV infection.

Description of the invention

The present invention arises from the identification, by the present inventors, of a cluster of four variants of the interferon^ receptor 2 (IFNGR2) gene strongly associated with fibrosis progression in chronic HCV infection, namely:

- an A for the G/A single nucleotide polymorphism (SNP) rs9976971 ; - an AA insertion for the --/AA insertion/deletion rs10600672;

- an A for the G/A SNP rs2284553;

- a T for the C/T SNP rs17882748. The present invention thus relates to a method, in particular an in vitro method, for determining that an individual with a chronic hepatitis C virus infection is at risk of developing liver fibrosis, which comprises:

- determining whether the individual harbours at least one variant allele of the interferon^ receptor 2 (IFNGR2) gene;

- deducing that if the individual harbours at least one variant allele of the IFNGR2 gene then the individual is at risk of developing liver fibrosis.

In a preferred embodiment, the above defined method comprises further determining whether the individual presents at least one other risk factor for liver fibrosis and deducing that the individual is at risk of developing liver fibrosis if said individual harbours at least one variant allele of the IFNGR2 gene and presents said at least one other risk factor.

As intended herein the above-defined individual is preferably a human.

As intended herein the expressions "individual with a chronic hepatitis C virus (HCV) infection" or "individual chronically infected with a hepatitis C virus (HCV)" are synonymous and notably relate to an individual in whom HCV RNA can be detected in particular in blood, serum or plasma samples. Numerous methods, and in particular commercial methods, are known in the art for detecting HCV RNA.

"Liver fibrosis" is well known to one of skill in the art and is characterized by the formation of scar tissue instead of normal parenchyma in the liver. Liver fibrosis is notably described in Lauer & Walker (2001 ) N Engl J Med 345: 41 -52; Marcellin et al.

(2002) Hepatology 36:S47-56, Missiha et al. (2008) Gastroenterology 134:1699-

1714; Poynard et al. (1997) Lancet 349: 825-832; and Poynard et al. (2001 ) J

Hepatol 34: 730-739. As intended herein, "liver fibrosis" notably encompasses severe liver fibrosis and cirrhosis.

As intended herein, the expression "the individual is at risk of developing liver fibrosis" notably means that the individual is predisposed to develop liver fibrosis or that the individual presents an increased risk of developing liver fibrosis with respect to a general population of individuals chronically infected with HCV or to a population of individuals chronically infected with HCV which do not harbour the above-defined at least one variant allele of the interferon^ receptor 2 (IFNGR2) gene.

The "interferon^ receptor 2 (IFNGR2) gene", also named interferon^ transducer 1 gene, encodes the non-ligand-binding β-chain of the interferon^ receptor, which is notably described by Bach et al. (1997) Annu. Rev. Immunol. 15:563. The IFNGR2 gene sensu stricto is localized on chromosome 21 in the cytogenetic band 21 q22.1 1 and in particular spans bases starting from position 33,697,072 bp from pter to position 33,731 ,698 bp from pter on the plus strand of chromosome 21. The man skilled in the art can readily define other positions for the IFNGR2 gene depending on the chosen count origin such as the centromere of the chromosome for instance. By way of example, the IFNGR2 coding sequence (mRNA) is represented by the NCBI Reference Sequence NM_005534.3 (SEQ ID NO: 1 ) and the β-chain of the interferon^ receptor (protein) is represented by the NCBI Reference Sequence NP_005525.2 (SEQ ID NO: 2). The expression "a variant allele of the interferon^ receptor 2 (IFNGR2) gene" refers to any allele which comprises sequence variations, such as substitutions (in particular single nucleotide polymorphisms (SNPs)), deletions (del) or insertions (ins), with respect to the consensus or ancestral sequence of the IFNGR2 gene. The consensus or ancestral sequence of the IFNGR2 gene can be generally defined as a hypothetical sequence which present for each position the A, T, C or G base which is the most frequent in the human population for this position. As intended herein the "variant allele of the interferon^ receptor 2 (IFNGR2) gene" also encompasses sequences directly upstream and downstream of the IFNGR2 gene sensu stricto, and in particular spans bases starting from position 33,689,000 bp from pter to position 33,732,000 bp from pter on the plus strand. Preferably, the sequence of the at least one variant allele of the of the interferon^ receptor 2 (IFNGR2) gene spans bases starting from position 33,689,000 bp from pter to position 33,732,000bp from pter on the plus strand of chromosome 21.

Preferably, the at least one variant allele as defined above comprises at least one variation selected from the group consisting of:

- an A for the G/A single nucleotide polymorphism (SNP) rs9976971 ;

- an AA insertion for the --/AA insertion/deletion rs10600672;

- an A for the G/A SNP rs2284553;

- a C for the T/C SNP rs17882748. More preferably, the at least one variant allele as defined above comprises an

A for the G/A SNP rs9976971.

The above-defined variations rs9976971 , rs10600672, rs2284553 and rs17882748 are well known to one of skill in the art and are notably described in the NCBI database dbSNP (www.ncbi.nlm.nih.gov/SNP/) In particular, the GZA SNP rs9976971 is located at position 33,689,967 bp from pter on the plus strand of chromosome 21 ; the rs10600672 --/AA insertion/deletion is located at position 33,691 ,495 bp from pter on the plus strand of chromosome 21 ; the G/A SNP rs2284553 is located at position 33,698,565 bp from pter on the plus strand of chromosome 21 ; and the TZC rs17882748 is located at position 33,697,591 bp from pter on the plus strand of chromosome 21 .

The sequences flanking the above-defined variations rs9976971 , rs10600672, rs2284553 and rs17882748 are notably represented by the following sequences wherein the variation is shown between square brackets: - rs9976971 :

CTGGGTCCAGTGAAGGTGTATAGCGG[GZA]AGGAGGCTCCCACAGAAGGTGGGGT (SEQ ID NO: 3)

- rs10600672: G AAT ATTAAAGCTTCGTAT ACTTAAA[-/AA]GTGTAGG AGTCTCCTGTTTTTCAAG (SEQ ID NO: 4)

- rs2284553:

GCAGGGCTCAGAACTGTCCGGGTCCC[GZA]TCAGTGTTGGGGCGGAAGAGGAAGA (SEQ ID NO : 5)

- rs17882748:

TCCCCTCCACCGGGACGCCCCGCTGC[TZC]GCTCGGGAAGAGGCGGGCCCTGCGC (SEQ ID NO: 6). As will be clear to one of skill in the art, the expression "GZA SNP" means that

G is the consensus base at the corresponding position and that A is the variant base, the expression "TZC SNP" means that T is the consensus base at the corresponding position and that C is the variant base; and the expression "--ZAA insertionZdeletion" means that the absence of AA at the corresponding position is the consensus and that AA insertion is the variation.

Preferably also, in the above-defined method, it is deduced that the individual is at risk of developing liver fibrosis if said individual is homozygous for the at least one variant allele or for the at least one variation. As intended herein the expression "homozygous" means that the at least one variant allele or the at least one variation is present on the two chromosomes 21 of the individual.

As intended herein, the expression "risk factor for liver fibrosis" relates to all characteristics of the individual chronically infected by HCV, in particular of a genetic, environmental, or physiological nature, which are known to be predictive of liver fibrosis. Numerous risk factors for liver fibrosis are known in the art for chronic HCV infected individuals, such as those described by Marcellin et al. (2002) Hepatology

36: S47-56; Missiha et al. (2008) Gastroenterology 134: 1699-1714; Ortiz et al. (2002) Am J Gastroenterol 97: 2408-2414; and Pol et al. (1998) J Hepatol 29: 12-19.

However, it preferred within the frame of the present invention that the at least one other risk factor for liver fibrosis selected from the group constituting of:

- the individual is a male;

- the age of the individual at infection is over forty; - alcohol consumption of the individual is over 50 g/day;

- the individual is obese;

- the individual is infected by HIV.

The present invention also relates to a modulator of the interferon^ receptor for use in the prevention or treatment of liver fibrosis in an individual chronically infected with hepatitis C virus. For example, the interferon^ receptor modulator can be bryostatine (notably described in Garcia et al. (2006) The Journal of Immunology,

177:2707-2716). Preferably, the interferon^ receptor modulator is bryostatine.

The present invention also relates to a method for preventing or treating liver fibrosis in an individual chronically infected with hepatitis C virus, comprising administering said individual with a prophylactically or therapeutically effective amount of a modulator of the interferon^ receptor.

In an embodiment, the present invention relates to the above-defined modulator of the interferon^ receptor or to the above-defined method of prevention or treatment, wherein the individual harbours at least one variant allele of the IFNGR2 gene. Preferably, the at least one variant allele comprises at least one variation selected from the group consisting of:

- an A for the G/A single nucleotide polymorphism (SNP) rs9976971 ;

- an AA insertion for the --/AA insertion/deletion rs10600672;

- an A for the G/A SNP rs2284553; - a C for the T/C SNP rs17882748.

More preferably, the at least one variant allele comprises an A for the G/A SNP rs9976971.

In another embodiment, the present invention relates to the above-defined modulator of the interferon^ receptor or to the above-defined method of prevention or treatment, wherein the individual is homozygous for the at least one variant allele or for the at least one variation.

Besides, the individual can also preferably present at least one other risk factor for liver fibrosis, which is more preferably selected from the group constituting of:

- the individual is a male;

- the age of the individual at infection is over forty;

- alcohol consumption of the individual is over 50 g/day;

- the individual is obese; - the individual is infected by HIV.

In another embodiment, the present invention relates to the above-defined modulator of the interferon^ receptor or to the above-defined method of prevention or treatment, wherein the modulator of the interferon^ receptor is selected from interferon^ or an interferon^ antagonist. Interferon^ antagonists are well known to one of skill in the art and notably encompass anti-interferon-γ receptor antibodies.

Brief description of the figures

Figure 1 represents the effect of SNP rs9976971 on fibrosis progression. Figure 1 in particular shows the variation with time of the proportion of fibrosis free patients according to genotypes at rs9976971 , AA (broken line) and GG/AG (plain line). The time of follow-up was estimated from the presumed year of infection to the year of either the first biopsy showing severe fibrosis (F3-4 patients) or the last biopsy showing no fibrosis without any treatment (for FO- 1 patients).

Figure 2 is schematic representation of the chromosome 21 region ranging from 33,689,800 to 33,702,200 bps, and including the 5'region, exon 1 and part of intron 1 of IFNGR2. Exon 1 is ranging from 33,697,072 to 33,697,792 bps with an untranslated and a translated part shown as a hatched and a solid box, respectively. Horizontal arrows indicate the regions covered by direct sequencing. Three segments could not be sequenced for technical reasons (33,694,486-33,696,000, 33,696,161 -33,696,390, and 33,699,1 14-33,700,075 bps). The four SNPs associated with severe fibrosis are indicated by vertical arrows with distance in bps provided from the position of rs9976971 which is located at 33,689,967 bps.

Example

Material and Methods Patients

Adult Caucasian patients were recruited (>18 years of age) with chronic HCV infection defined as the presence of circulating HCV RNA tested by reverse transcriptase polymerase chain reaction. The patients were collected in two steps. First, a prospective enrolment of patients was conducted from the hepatology units of Necker Hospital in Paris and St Joseph Hospital in Marseille (sample A). The inclusion criteria of patients were to have: 1 ) an available liver biopsy before any treatment, 2) a known presumed date of HCV acquisition (date of the first exposure to blood products, or of beginning of intravenous drug (IVD) use), 3) a low alcohol consumption (<3 or <2 standard drinks per day for males or females, respectively), 4) absence of co-infection with HIV or hepatitis B virus (HBV), 5) absence of any coexisting chronic liver disease or hepatocellular carcinoma. Clinical risk factors, history of HCV acquisition and of alcohol consumption (assessed using time-line follow back interview) were recorded through face-to-face interviews conducted by physicians trained in addiction problems. In a second step, additional patients were collected from an existing cohort from the hepatology unit of Pitie-Salpetriere Hospital in Paris (sample B). The inclusion criteria were the same as those for sample A except that the presumed date of infection was not known for all patients. The study was approved by the appropriate institutional review boards, and written informed consent was obtained from all patients. Most of the enrolled patients were already followed-up in the corresponding clinics since years and had a liver biopsy at the time of their first evaluation. The stage of fibrosis was assessed from liver biopsy samples using METAVIR units, and graded on a five-point scale from 0 to 4 (Bedossa et al. (1996) Hepatology 24:289- 293). For the present study, in order to optimize the phenotype definition, patients with grade 2 were excluded, and the only patients kept were patients with grades O or 1 (FO-1 patients) referred to as having no fibrosis, and patients with grades 3 or 4 (F3-4) referred to as having severe fibrosis. For patients with several biopsies, the biopsy used was either the first biopsy showing severe fibrosis (F3-4 patients) or the last biopsy showing no fibrosis without any treatment (for FO-1 patients). The duration of infection was estimated from the presumed year of HCV acquisition (e.g. first exposure to blood transfusion, or to IVD use) to the year of the relevant biopsy.

Genotvpinq and sequencing methods This study was focused on the role of polymorphisms located in a panel of genes encoding either enzymes involved in extracellular matrix turnover (matrix metalloproteinases and their inhibitors) or cytokines that are believed to have a pro- fibrogenic (TGF-β and related molecules) or an anti-fibrogenic (IFN-γ and its receptors) activity. A total of 36 genes were selected and are shown in Table 1. A selection of SNPs within each gene, totalling 384 SNPs (list in supplementary Table 1 ), was made using data from the first public release of HapMapll. For each gene, all HapMap SNPs in the region including the gene and the 10kb flanking regions were initially considered. SNPs with minor allele frequency < 5% or with low predicted quality for genotyping (calculated by lllumina®) were filtered out, and pairwise linkage disequilibrium (LD) was estimated (from the HapMap data) between all pairs of remaining SNPs within each gene. The 384 SNP panel was then selected such as no two SNPs in the same gene had an estimated r² > 0.8 or were < 60 bps apart.

All DNA samples were extracted from whole blood, and subjected to rigorous quality control to check for fragmentation and amplification. All SNPs were genotyped on an ultra-high throughput lllumina® platform. This platform uses the GoldenGate™ assay followed by a bead-based technology to resolve individual SNP genotypes (36). SNPs discovery within an IFNGR2 region of -12,3 kbs from 33,689,894 to 33,702,179 bps on chromosome 21 was performed by exhaustive sequencing (Fig. 2). The sample consisted of 32 French Caucasian subjects from the Epidemiological study on the Genetics and Environment of Asthma (Dizier et al. (2005) Genes lmmun 6:95-102). Subjects were both male and female individuals without any disease history. The minimal sample size of 32 allowed us to detect SNPs with a minor allele frequency (MAF) of at least 5% with a probability of 96%. Sequencing reactions were performed with the Dye Terminator method using an ABI PRISM^® 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Sequence alignment and SNP discovery were performed with Genalys^® software, developed by the Centre National de Genotypage (CNG) (Takahashi et al. (2003) J Bioinform Comput Biol 1 :253-265).

Statistical methods.

Association between severe fibrosis and the panel of SNPs was first tested in sample A by a classical case/control analysis using the genotypic test statistic (2 degrees of freedom): the cases are HCV infected patients with severe fibrosis and the controls are infected patients without severe fibrosis. Using a type I error of 0.02, our initial sample A had a power of 80% for detecting a polymorphism with an additive effect providing an odds ration (OR) for heterozygous of 2 and having a frequency > 0.09. For SNPs showing association at P <0.02, association by a survival analysis approach using Cox model was the tested: it was considered as starting points the estimated ages at infection, and as end points either the first biopsy showing severe fibrosis (failure time) or the last biopsy showing absence of severe fibrosis in the absence of any treatment (censored time). For all these analyses, the genetic model (dominant/additive/recessive) providing the best fit to the data was determined. SNPs showing the most interesting results (P <0.02 in the case/control study and P <0.05 in the survival analysis) were then tested for replication in sample B.

Heterogeneity of the association results were tested according to different criteria such as gender, mode of infection (blood transfusion/IVD use/others), viral genotypes (1 and 4 vs. others), age at infection (< 20 years vs. >20 years). Under the hypothesis of homogeneity of association, twice the difference between the likelihood of the whole sample and the summed likelihoods of the subsamples {e.g. the two subsamples of males and females) is asymptotically distributed as a χ² with one degree of freedom. All statistical analyses were performed using different procedures (FREQ, LOGISTIC, PHREG) implemented in SAS software v.8.2 (SAS Institute, Cary, North Carolina, USA). Pairwise LD between SNPs was assessed by determining the r² coefficient using the Haploview software (Barret et al. (2005) Bioinformatics 21 :263-265). Haplotype analysis was conducted using the THESIAS software (www.genecanvas.org) (Tregouet et al. (2007) Bioinformatics 23:1038- 1039).

Results Samples A and samples B consisted of a total of 267 (103 F3-4 patients with severe fibrosis and 164 F0-1 patients without severe fibrosis), and 126 (31 F3-4 and 95 F0-1 patients) patients with chronic HCV infection, respectively. The main features of the overall sample including 393 patients are shown in Table 2. While there was an overall excess of females (58.5% vs 41.5%, P =8x10^"4) that may be explained in part by the inclusion criterion of low alcoholic consumption, there was no significant difference (P =0.24) in the distribution of gender according to fibrosis status. In the 364 patients with reliable HCV acquisition data, the overall distribution of modes of infection was different (P =0.0004) according to the fibrosis status. The proportion of patients infected by blood transfusion was higher in patients with severe fibrosis (57.5%) than in F0-1 patients (41.3%), while the reverse was observed for IVD users (43% in F0-1 patients vs. 22% in F3-4 patients). F3-4 patients had a significantly older (P =0.004) age at infection (mean 29.9years (y), range 0.1 -73.2y) than F0-1 patients (25.6y, 0.1 -70.8y), and a longer (P =I O^"4) duration of HCV infection at time of biopsy (22.8y, 0.7-49.6y vs. 18.9y, 0.2-49.6y). Finally, the distribution of viral genotypes combined as usual in three main groups according to their sensitivity to anti-viral therapy (Hnatyszyn et al. (2005) Antivir Ther 10:1 -1 1 ) was not significantly different between F0-1 and F3-4 patients.

Out of the 384 SNPs, 16 SNPs could not be genotyped, and an additional five SNPs were excluded because either they showed deviations (P < 0.005) from Hardy- Weinberg equilibrium (three SNPs) or they had a minor allele frequency (MAF) <0.02 (two SNPs). The 363 remaining SNPs all showed a genotyping success >96%, and were used for association analysis. Association between severe fibrosis and the panel of 363 SNPs was first tested in sample A by a classical case/control analysis where cases were the HCV infected patients with severe fibrosis and controls were the infected patients without severe fibrosis. A total of nine SNPs, including two in IFNGR2 and three in MMP16, provided evidence for association with a P-value <0.02, and were investigated further. Out of these nine SNPs, four significantly influenced (P <0.05) the rate of progression towards severe fibrosis when performing a survival analysis (Tables 3 and 6). The effects of the two IFNGR2 SNPs, rs9976971 and rs2284553, that already yielded the lowest p-values in the case/control study (P =3x10^"4, and =8x10^"4, respectively), were even more significant (P =2x10^"5, and =8x10^"5, respectively) using the survival analysis. Conversely, the effects of the two other SNPs (one in MMP16, and one in TGFBR2) were slightly lower when accounting for time of progression. For both rs9976971 and rs2284553 (that are G/A SNPs), the risk allele was the minor allele A and the best fitting genetic model was recessive, i.e. subjects who are AA homozygous were predisposed to severe fibrosis as compared to AG and GG subjects. These two SNPs were in strong linkage disequilibrium (LD) (r²=0.79), and multivariate analysis confirmed that the results observed with rs9976971 and rs2284553 reflect a single signal.

The four SNPs providing evidence for association both in case/control (at P <0.02) and survival (at P <0.05) were tested in sample B (Table 3). Only the two IFNGR2 SNPs showed evidence for replication with the same risk allele. As in sample A, the survival analysis was more powerful than the case/control approach leading to a significant effect in sample B for rs9976971 (P =0.01 1 ). A similar trend, although not significant (P =0.13), was observed for rs2284553. When combining samples A and B (Table 4), the overall effect of rs9976971 in the case/control design was highly significant (P =8x10^"5), and the odds ratio (OR) of presenting severe fibrosis for AA subjects as compared to AG or GG subjects was 2.95 (1.70-5.11 ). This effect was much stronger (P =9x10^"7) in the survival analysis design, and the hazard ratio (HR) of progressing towards severe fibrosis for AA subjects as compared to AG or GG subjects was 2.62 (1.76-3.91 ) (Fig. 1). Consistent with this result taking into account the duration of infection, we observed that the effect of rs9976971 in the classical case/control design was much stronger (OR=4.46 (2.28- 8.72)) in the 57 F3-4 patients with rapid progression (< or = 20 years of infection) than in the 69 F3-4 patients with slow progression (>20 years of infection, OR=2.10 (1.04-4.25)). Even if the fact was considered that these results were obtained in a one- step strategy (without the use of a replication sample), and that we applied the classical and stringent Bonferroni correction for multiple testing (assuming the 363 SNPs were tested in the whole sample), the corrected p-values for rs9976971 remained significant and equal to 0.029 and 0.0003 in the case/control and the survival analysis, respectively. These results indicate that one SNP in IFNGR2, either rs9976971 or another variant in strong LD with it, strongly influences the rate of progression toward severe fibrosis in patients chronically infected by HCV. Next, other variants were searched in strong LD with rs9976971 along three lines. First, it was looked for long range LD (from 33,380,000 to 34,000,000 bps) using the European population of the HapMap database, NCBI build 36 (http://www.hapmap.org/). Substantial LD (r² ranging from 0.3 to 0.48) with rs9976971 was observed with three clusters of SNPs. One tag-SNP within each cluster was genotyped (rs2834208, rs13047599, and rs7279549), and no association with severe fibrosis (P >0.2) was observed with any of these tag-SNPs. No other SNPs showed r² >0.3 within this interval, and, in particular, all SNPs between 33,524,000 and 33,655,000 bps where the genes IFNAR1 and IFNAR2 encoding interferon α/β receptors are located, provided r² <0.1 1 with rs9976971. Second, the SeattleSNPs variation discovery resource database was explored as it contained results for IFNGR2 sequencing in 23 European subjects for a region of ~ 38 kbs (33,695,200 - 33,733,200) (http://pga.gs.washington.edu/data/ifngr2/). Finally, as rs9976971 is located in 5' of IFNGR2 (33,689,967), a sample of 32 French Caucasian subjects for a region of 12.3 kbs from 33,689,894 to 33,702,179 was also sequenced (Fig. 2). Based on these sequencing data from both the SeattleSNPs database and the results obtained, two additional variants were identified in strong LD with rs9976971 (Table 4). One is the T/C SNP rs17882748 (r²=0.83 with rs9976971 ) located in the untranslated region of exon 1 , and the other is an AA insertion/deletion denoted as rs10600672 (r²=0.98 with rs9976971 ) located in the 5' region of the gene at position 33,691 ,495.

Table 4 shows the results of both the case/control and the survival analysis with the four variants of interest over the combined samples A and B. Although all variants were strongly associated with development of severe fibrosis, the most significant results were observed with rs9976971 (P =9x10^"7) and the AA ins/del (P =4x10^"6) when using survival analysis. The AA insertion is in almost perfect LD with the A allele of rs9976971 (only three subjects had discordant genotypes) so that the HR of progressing towards severe fibrosis for AA/AA subjects as compared to --/AA or --/-- subjects was 2.47 (1.66-3.66), and the curve of progression towards fibrosis with age according to this ins/del variant was extremely similar to that shown in Fig. 1 for rs9976971. No significant heterogeneity was find of these associations according to gender, mode of infection (blood transfusion/IVD use/others), viral genotypes (1 and 4 vs. others), age at infection (<20 years vs. >20 years). An analysis was also conducted considering the different haplotypes that could be derived from these four variants using the method developed in the THESIAS program (Tregouet et al (op. cit.)). As expected by LD, two common haplotypes accounted for more than 90% of the estimated haplotypes (Table 5). The common haplotype carrying the risk alleles at the four IFNGR2 variants had a frequency of 0.338 and 0.447 in FO- 1 and F3-4 patients, respectively. Under a recessive model (Table 5), the effects of this at risk haplotype (using a case/control or a survival analysis) were slightly lower than those estimated from rs9976971 or rs10600672 alone. As expected by the r² value at 0.98, the two variant haplotypes consisting of rs9976971 and rs10600672 provided results almost identical to the analysis of any of these variants alone. However, none of the tested haplotypes consisting of three or four of these IFNGR2 variants provided stronger evidence for association than rs9976971 or rs10600672 when considered alone.

In this study, the inventors investigated whether the development of liver fibrosis in HCV chronically infected patients could be influenced by polymorphisms located in a panel of 36 genes involved in the fibrogenesis/fibrolysis process. To reduce the variability in assessing fibrosis stage by biopsy (Bedossa et al. (2003) J Interferon Cytokine Res 27:239-246), only F0-1 and F3-4 stages have been included to define phenotypes. The inventors found a single convincing signal of association in IFNGR2, which was the most significant in the primary sample and was exactly replicated (same allele at risk and same genetic model) in the second sample. The evidence for association was even higher (by one order of magnitude) when using the information obtained by the time of progression providing strong additional support to the findings of the inventors.

The IFNGR2 signal results from a cluster of four variants in strong LD. These variants are quite common with a frequency in the HapMap Caucasian population of 0.41 for the risk allele A of the most associated SNP rs9976971 , and a proportion of AA homozygous of 26% in our sample of F3-4 patients. Sequencing data coming either from existing databases or from the present analysis excluded the role of any other SNPs located within a region of ~ 43.5 kbs (33,689,894 - 33,733,200 bps) encompassing the IFNGR2 gene. Analysis of the HapMap database made also quite unlikely the hypothesis that this signal could be due to another SNP in long-range LD with this cluster of four IFNGR2 variants. Refined analysis showed that no haplotypes derived from this cluster of four variants provided stronger evidence for association than any of the four SNPs when analyzed alone. From a statistical point of view, the strongest evidence was obtained with rs9976971 and the AA ins/del (rs10600672), which are almost in perfect LD. Nevertheless, the roles of rs2284553 (in intron 1 ) and rs17882748 (in untranslated region of exon 1 ) could not be ruled out.

Table 1. List of the genes investigated in the association study

Gene name Abbreviation alpha-2-macroglobulin A2M angiotensinogen AGT interferon, gamma IFNG interferon gamma receptor 1 IFNGR1 interferon gamma receptor 2 IFNGR2 keratin 8 KRT8 latent transforming growth factor beta binding protein 1 LTBP1 latent transforming growth factor beta binding protein 2 LTBP2 latent transforming growth factor beta binding protein 3 LTBP3 latent transforming growth factor beta binding protein 4 LTBP4 matrix metalloproteinase 1 MMP1 matrix metalloproteinase 2 MMP2 matrix metalloproteinase 3 MMP3 matrix metalloproteinase 7 MMP7 matrix metalloproteinase 8 MMP8 matrix metalloproteinase 9 MMP9 matrix metalloproteinase 10 MMP10 matrix metalloproteinase 1 1 MMP1 1 matrix metalloproteinase 12 MMP12 matrix metalloproteinase 13 MMP13 matrix metalloproteinase 14 MMP14 matrix metalloproteinase 15 MMP15 matrix metalloproteinase 16 MMP16 matrix metalloproteinase 17 MMP17 matrix metalloproteinase 24 MMP24 matrix metalloproteinase 25 MMP25 transforming growth factor, beta 1 TGFB1 transforming growth factor, beta 2 TGFB2 transforming growth factor, beta 3 TGFB3 transforming growth factor, beta receptor I TGFBR1 transforming growth factor, beta receptor Il TGFBR2 transforming growth factor, beta receptor III TGFBR3 tissue inhibitor of metalloproteinase 1 TIMP1 tissue inhibitor of metalloproteinase 1 TIMP2 tissue inhibitor of metalloproteinase 1 TIMP3 tissue inhibitor of metalloproteinase 1 TIMP4 Table 2. Main features of the HCV chronically infected patients in the whole sample

Data for the 364 patients with known presumed dates of HCV acquisition f Mean (SD)

Table 3. Results in both samples for the four SNPs providing the strongest evidence for association with severe fibrosis in sample A (i.e. P <0.02 in case/control study and P <0.05 in the survival analysis)

Genetic model (recessive, additive, or dominant) for the risk allele f Odds ratio (with 95% confidence interval) under the corresponding genetic model

* Hazard ratio (with 95% confidence interval) under the corresponding genetic model estimated by Cox model analysis.

^§ Frequency estimated in sample A 1f P> 0.2 Table 4. Results in the whole sample for the four IFNGR2 variants providing the strongest evidence for association

Position in base pairs on chromosome 21

Table 5. Results of the analysis considering haplotypes derived from the cluster of the four IFNGR2 variants providing the strongest evidence for association.

* Results obtained with a recessive model for the common haplotype A/AA/C/A consisting of the risk alleles of the four IFNGR2 variants. Table 6. Distribution of genotypes for the four SNPs providing the strongest evidence for association with severe fibrosis in sample A (i.e. P<0.02 in case/control study and P<0.05 in the survival analysis), and shown in Table 3

Claims

1. An in vitro method for determining that an individual with a chronic hepatitis C virus infection is at risk of developing liver fibrosis, which comprises: - determining whether the individual harbours at least one variant allele of the interferon^ receptor 2 (IFNGR2) gene;

2. The method according to claim 1 , wherein the at least one variant allele comprises at least one variation selected from the group consisting of:

- an A for the G/A single nucleotide polymorphism (SNP) rs9976971 ;

- an AA insertion for the --/AA insertion/deletion rs10600672;

- an A for the G/A SNP rs2284553; - a C for the T/C SNP rs17882748.

3. The method according to claim 1 or 2, wherein the at least one variant allele comprises an A for the G/A SNP rs9976971.

4. The method according to any of claims 1 to 3, wherein it is deduced that the individual is at risk of developing liver fibrosis if said individual is homozygous for the at least one variant allele or for the at least one variation.

5. The method according to any of claims 1 to 4, which comprises further determining whether the individual presents at least one other risk factor for liver fibrosis and deducing that the individual is at risk of developing liver fibrosis if said individual harbours at least one variant allele of the IFNGR2 gene and presents said at least one other risk factor.

6. The method according to claim 5, wherein the at least one other risk factor for liver fibrosis selected from the group constituting of:

- the individual is a male;

- the age of the individual at infection is over forty;

- alcohol consumption of the individual is over 50 g/day; - the individual is obese;

- the individual is infected by HIV.

7. A modulator of the interferon^ receptor for use in the prevention or treatment of liver fibrosis in an individual chronically infected with hepatitis C virus.

8. The modulator of the interferon^ receptor according to claim 7, wherein the individual harbours at least one variant allele of the IFNGR2 gene.

9. The modulator of the interferon^ receptor according to claim 8, wherein the at least one variant allele comprises at least one variation selected from the group consisting of:

- an A for the G/A single nucleotide polymorphism (SNP) rs9976971 ;

- an AA insertion for the --/AA insertion/deletion rs10600672; - an A for the G/A SNP rs2284553;

- a C for the T/C SNP rs17882748.

10. The modulator of the interferon^ receptor according to claim 8 or 9, wherein the at least one variant allele comprises an A for the G/A SNP rs9976971.

11. The modulator of the interferon^ receptor according to any of claims 8 to 10, wherein the individual is homozygous for the at least one variant allele or for the at least one variation.

12. The modulator of the interferon^ receptor according to any of claims 7 to 11 , wherein the individual presents at least one other risk factor for liver fibrosis.

13. The modulator of the interferon^ receptor according to claim 12, wherein the at least one other risk factor is for liver fibrosis selected from the group constituting of: - the individual is a male;

- the age of the individual at infection is over forty;

- alcohol consumption of the individual is over 50 g/day;

- the individual is obese;

- the individual is infected by HIV.

14. The modulator of the interferon-γ receptor according to any of claims 7 to 13, selected from interferon^ or an interferon^ antagonist.