WO2010141924A2 - Enhanced engineered native promoters and uses thereof - Google Patents
Enhanced engineered native promoters and uses thereof Download PDFInfo
- Publication number
- WO2010141924A2 WO2010141924A2 PCT/US2010/037551 US2010037551W WO2010141924A2 WO 2010141924 A2 WO2010141924 A2 WO 2010141924A2 US 2010037551 W US2010037551 W US 2010037551W WO 2010141924 A2 WO2010141924 A2 WO 2010141924A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- promoter
- gene
- dna construct
- tfre
- engineered
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
Definitions
- Another method is to assimilate appropriate regulatory elements to retain innate responsiveness of the engineered genes. Since transcription is a fundamental mechanism for controlling gene expression, incorporating naturally occurring regulatory elements can be useful in increasing fidelity and safety of engineered genes. For most eukaryotic genes, the majority of the information necessary for recapitulating developmental and spatial expression resides in the proximal promoter which can be a few hundred base-pairs (bp) long. However, endogenous transcriptional activity is difficult to achieve in engineered vectors with promoter fragments lacking their genomic context and distal elements.
- genes linked to the ⁇ -globin promoter can achieve levels comparable to the endogenous promotor but requires inclusion of the ⁇ -globin locus control region, an extended enhancer located at an ectopic chromatin site (7, 8).
- Other promoters rely on similar compact distal enhancers (9) but locus control regions are unique and gene specific.
- highly inducible promoters have been constructed from a minimal TATA box by fusing multiple binding sites for hypoxia- inducible factor (HIF) binding sites with optimal spacing of orientation to achieve hypoxia responsiveness (18) or 7 T-cell factor / lymphoid enhancer-binding factor (TCF/LEF) binding sites to achieve a ⁇ -catenin responsiveness (19).
- HIF hypoxia- inducible factor
- TCF/LEF T-cell factor / lymphoid enhancer-binding factor
- the disclosure relates to methods and DNA constructs for engineered promoters for enhancing gene expression.
- the invention is based on the surprising finding that one can significantly enhance native promoter function by arranging several transcription factor response elements in tandem with a specific spacing between them to form segments of transcription factor elements. Moreover, the transcription can be further enhanced by including at least two of such segments in the promoter region of the gene.
- Use of the presently described engineered promoters allows one to avoid using viral promoters and yet results in enhanced expression of the genes thus providing a significant improvement for any mammalian gene expression system either in vivo or in vitro.
- the present disclosure provides an engineered
- DNA construct for increasing gene expression from a transcription factor (TF) dependent promoter comprising at least one transcription factor response element (TFRE) segment, wherein the segment comprises between four and 16 consecutive TFREs, wherein each of the TFRE is separated by about 9 to 15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) for one transcription factor (TF).
- TF transcription factor
- bp base-pairs
- the disclosure herein provides a modified promoter comprising at least one transcription factor response element (TFER) segment, wherein the TFRE segment comprises 4-16 TFREs, wherein all of the TFREs are response elements (REs) of one transcription factor (TF) native to a promoter, wherein each of the 4-16 TFREs are separated by 9-15 base pairs (bp).
- TFER transcription factor response element
- a method of enhancing expression of a gene comprising operably linking the gene to an engineered promoter forming a gene expression construct, wherein the engineered promoter comprises at least one transcription factor response element (TFER) segment, wherein the TFRE segment comprises four to 16 TFREs; wherein all of the TFREs are response elements (REs) of one transcription factor (TF), and wherein each of the TFRE is in forward orientation, and wherein each of the four to 16 TFREs are separated by 9- 15 base pairs, and wherein the at least one TFER segment is inserted upstream (5') of the ATG start codon of the gene.
- TFER transcription factor response element
- a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) operably linking the engineered DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (c) transducing a host cell with the gene expression construct.
- TFRE transcription factor response element
- the disclosure herein provides a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) engineering a second DNA construct to further comprise at least two TFRE segments of step (a), wherein the TFRE segments are separated by 200-700 base pairs; (c) operably linking the engineered second DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (d) transducing a host cell with the gene expression construct.
- TFRE transcription factor response element
- a method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences, wherein each of the TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; and (c) operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
- TFRE transcription factor response element
- a method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences, wherein each of the
- TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; (c) engineering a second DNA construct to further comprise at least two TFRE segments, wherein the TFRE segments are separated by 200-700 base pairs; and (d) operably linking the engineered second
- the promoters can be mammalian or non-mammalian promoters.
- human promoters are the human U6, Hl and tRNA promoters.
- the promoters can be a synthetically made promoter made of parts from many non-related sources, much like a chimeric promoter.
- the TFREs are in forward configuration, forward direction or forward orientation. In some embodiments, the TFREs are in reverse configuration, reverse direction or reverse orientation. In other embodiments, the TFREs in a segment have a mixed forward and reverse orientation.
- the genes do no express proteins but rather express RNA that are utilized by the cell, e. g. for pre-microRNA, ribosomal and transfer RNA.
- the engineered DNA construct, modified promoter or engineered promoter described herein is a gene expression construct.
- engineered DNA construct, modified promoter or engineered promoter described herein the gene expression construct is further transduced into a host cell.
- the host cell is selected from a group consisting of hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells.
- the host cells can be a stem cell.
- adult stem cells embryonic stem cells, induced pluripotent stem cells, etc.
- the host cells can be any cell within the body of an organism, e.g. when a gene therapy vector or construct is used.
- the host cells can be the type of cells used for the bioprocess production of commercial therapeutic biologies, e. g. therapeutic antibodies, proteins and peptides.
- commercial therapeutic biologies e. g. therapeutic antibodies, proteins and peptides.
- CHO Chinese hamster ovary
- mouse myeloma cells e.g., Chinese hamster ovary (CHO) cells and mouse myeloma cells.
- the host cell is a cell selected from Tables 1-4.
- the expression of the gene is in vivo.
- the expression of the gene is in vitro.
- the engineered DNA construct described herein is operably linked upstream (5') of an ATG start codon of a gene that is operably linked to a TF dependent promoter.
- the engineered DNA construct, modified promoter or engineered promoter described herein comprises at least two TFRE segments, wherein the two
- TFRE segments are separated by 200-700 bp.
- At least one TFRE of the TFRE segment is the native to the promoter of the gene
- the engineered promoter or modified promoter is derived from a native promoter of the gene.
- the gene is a mammalian gene.
- the mammalian promoter is selected from a group consisting human, mouse, rat, non-human primate (e.g. monkey, baboon, ape, and chimpanzee), dog, and hamster.
- the mammalian promoter is a non-human promoter, e. g. mouse, rat, non-human primate (e. g. monkey, baboon, ape, and chimpanzee), dog, and hamster.
- the mammalian promoter is a human promoter.
- the engineered DNA construct, modified promoter or engineered promoter described herein, the TFRE is for a TF selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic helix-loop-helix
- bHLH basic-leucine zipper type
- bZIP basic-leucine zipper type
- winged helix type zinc binding type
- heat-shock type TFs heat-shock type
- the TF is a homeo-domain type TF.
- the homeo-domain type TF is a hepatocyte nuclear factor 1 alpha (HNFlA) or (HNFl ⁇ ) TF.
- the TF is a nuclear hormone receptor type TF.
- the nuclear hormone receptor type TF is a hepatocyte nuclear factor 4 alpha
- a vector comprising an engineered DNA construct, engineered promoter or modified promoter construct described herein.
- the vector is a gene therapy vector or a vector adapted for gene therapy.
- a cell comprising a vector of any one embodiments of the engineered DNA construct, engineered promoter or modified promoter construct described herein. Definitions
- the term “native” as in “native promoter” refers to a promoter that is naturally and/or originally present in a cell and it is typically designated for the expression of a particular gene.
- “native promoter” is encoded in the natural original genome of the cell.
- no extra ordinary measures have been taken by another organism to insert the promoter artificially into the cell.
- a non-native promoter would be a promoter is not originally present in a cell and it has been inserted artificially into the cell.
- a non-native promoter of a gene is one that that is not naturally associated with the gene.
- the mouse hepatocyte nuclear factor l ⁇ Dup4xH4RE (Hnfl a Du P 4xH4RE ⁇ p romoter was O p e rably linked with a human hepatocyte nuclear factor 1 alpha (HNFl alpha) cDNA.
- the Hnfl cP up4xl ⁇ 4RE is a non-native promoter.
- the native response element (RE) or the “native promoter
- RE refers to the RE that is naturally present in the promoter DNA sequence.
- the human apolipoprotein C3 (ApoC3) gene is expressed from a HNF4 alpha (HNF4A) transcription factor dependent Apo C3 promoter which has two REs for HNF4A.
- the two REs for HNF4A (H4RE) are the native RE of the ApoC3 promoter.
- the hepatocyte nuclear factor 1 alpha (HNFlA) transcription factor dependent human HNF4A P2 promoter has one RE for HNFlalpha (HIRE).
- the HIRE in the native RE of the human HNF4A P2 promoter.
- fragment as in "promoter fragment” refers a part or portion of the promoter sequence that is in the genome.
- the term "forward direction”, “forward orientation” or “forward configuration” with respect to a response element DNA sequence in a promoter refers to the orientation of the DNA sequence. It is typically the most common orientation of that family/class of RE with respect to the transcription start site on the sense strand of DNA of the gene or with respect to the direction of transcription of the associated gene. For example, the most common orientation and therefore the consensus binding site sequence for the TATA- binding protein (TBP) is TATAAAA. This is in forward direction. TTTTATA is the reverse or backward direction. Regardless of the orientation of the transcription factor response element (TFRE), transcription factors generally still bind to their respective TFRE and are able to activate and stimulate gene expression.
- TTP TATA- binding protein
- the term "chimeric" with reference to the mini gene cassettes or promoters described herein refers to being composed of DNA sequences from different origins.
- the Hnfl ctr Dup4XH4RE /HNF4cc3 HA mini gene is composed of the HNF4 ⁇ 3 gene (cDNA) translationally fused a DNA sequence encoding the HA-tag at the C-terminus of HNF4oc3.
- the promoter DNA sequence for transcribing the chimeric gene HNF4 ⁇ 3HA is composed of mouse Hnfl or promoter sequence and eight H4REs of different genes, e. g.
- chimeric minigene cassette refers to a expression gene being composed of DNA sequences from different origins, the DNA sequences each having different functions within the gene (e. g. transcriptional regulatory, ribosome binding, promoter sequences etc), and the chimeric minigene cassette has all the necessary sequences to expresse the gene within, and it expresses a single gene product, e. g. a protein.
- the Hnfl ⁇ r Dup4XH4RE /HNF4cc3 HA minigene cassette the HNF4oc3 HA protein is expressed.
- the different DNA sequences are operably linked to the gene.
- upstream is used in reference to a DNA sequence with respect to a specific site on a DNA sequence. It indicates that the DNA sequence to the left side of the specified site wherein the DNA sequence is oriented in a 5' to 3' direction.
- An example of a specific site of reference is the ATG start codon in a gene.
- the specific site is numbered as "one" and upstream location of the DNA sequence with respect to the specific site is numbered in the negative, e. g. -213 nt or bp of the specific site.
- Another example of a specific site of reference is the transcription start site of the gene.
- the specific site is numbered as zero and upstream location of the DNA sequence with respect to the specific site is numbered in the negative, e. g. -213 nt or bp of the transcription start site of the gene.
- the RE of the human G6Pase gene is located on Chromosome 17 at -236/-218 and -78/-60 from RefSeq: NM_000151.
- the RefSeq provides the transcribed sequence from the gene and represents the putative transcriptional start site of the human G6Pase gene on the chromosome.
- This putative transcriptional start site is numbered as "one" or +1. Therefore, the RE of the human G6Pase gene is located -236/-218 and -78/-60 from this +1 start site on the chromosome.
- nucleotide is abbreviated "nt”.
- base-pair is abbreviated "bp”.
- engineered DNA constructs, engineered promoter and modified promoters comprise double
- DNA sequences and the nucleotides on one strand are base paired with those on the corresponding strand in the standard Watson and Crick base pairing.
- TFRE single-stranded DNA sequences
- the TFRE would be separated by 9-15 nt or 200-700nt.
- the term "consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
- gene or "coding sequence” means the nucleic acid sequence which is transcribed (DNA) and translated (mRNA) into a polypeptide in vitro or in vivo when operably linked to appropriate regulatory sequences, e. g. transcription factor response elements (TFRE).
- TFRE transcription factor response elements
- the gene may or may not include regions preceding and following the coding region, e.g. 5' untranslated (5'UTR) or “leader” sequences and 3' UTR or “trailer” sequences, as well as intervening sequences (introns) between individual coding segments (exons).
- a gene refers to a complementary DNA (cDNA) that is derived from a messenger
- RNA (mRNA) of the gene RNA (mRNA) of the gene.
- identity means the percentage of identical nucleotide at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A. M., Oxford University Press, New York, 1988. Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs such as BLASTP.
- nucleic acid sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection.
- sequences are then said to be “substantially identical.”
- This term also refers to, or can be applied to, the complement of a DNA sequence or a messenger RNA (mRNA).
- mRNA messenger RNA
- sequences that have deletions and/or additions, as well as those that have substitutions are then said to be “substantially identical.”
- DNA sequence refers to any nucleic acid molecule, preferably a polymeric molecule, incorporating units of deoxyribonucleic acid.
- the nucleic acid can be either single-stranded or double- stranded.
- DNA sequence polynucleotide molecule
- nucleic acid are use interchangeably.
- operably linked means generally that the regulatory elements and promoter in a DNA sequence or nucleic acid construct are in-frame with a nucleic acid coding sequence for a protein or peptide. Accordingly, the term typically refers to an arrangement wherein the first polynucleotide molecule is connected with the second transcribable polynucleotide molecule, such as a gene of interest, where the polynucleotide molecules are so arranged that the first polynucleotide molecule affects the function of the second polynucleotide molecule.
- the two polynucleotide molecules are part of a single contiguous polynucleotide molecule and more preferably are adjacent.
- a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the gene of interest in a cell.
- transcribable polynucleotide molecule refers to any polynucleotide molecule capable of being transcribed into a RNA molecule.
- Methods are known for introducing constructs into a cell in such a manner that the transcribable polynucleotide molecule is transcribed into a functional mRNA molecule that is translated and therefore expressed as a protein product.
- Constructs may also be constructed to be capable of expressing antisense RNA molecules, in order to inhibit translation of a specific RNA molecule of interest.
- conventional compositions and methods for preparing and using constructs and host cells are well known to one skilled in the art.
- promoter refers to a polynucleotide molecule that in its native state (i. e. as is naturally in the genome of an organism) is located upstream or 5' to a translational start codon of an open reading frame (or protein-coding region) or the transcription start site and that is involved in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription.
- a promoter is used as a 5' regulatory element for modulating expression of a particular gene or genes operably associated or linked thereto.
- a promoter When operably linked to a transcribable polynucleotide molecule, a promoter typically causes the transcribable polynucleotide molecule to be transcribed in a manner that is similar to that of which the promoter is normally associated.
- a "core basic promoter” is one that will transcribe any transcribable polynucleotide molecule that is operably linked to it. Transcription takes place as long as the transcription machinery (ribosome etc) and raw materials for transcription (RNAs) are available. In one embodiment, the transcription for a "core basic promoter" is on all the time or constitutive.
- the "core basic promoter” can comprise addition transcription factor (TF) response elements (TFRE) and/or enhancer elements (collectively known as regulatory elements) that allow the transcription of the transcribable polynucleotide molecule to be regulated.
- the regulation is by the presence or absence of transcription factors or enhancers binding to the elements comprising the promoter.
- transcription only occurs in the presence of the factor or transcription is further increased in the presence of the enhancer.
- Promoter databases and computer softwares are available for predicting the location of promoter sequences of genes in the genome of an organism, e. g. at Wormbase, the Cold Spring Harbor Laboratory, Molbio-Tools, Weizmann Institute of Science and Wellcome Trust Sanger Institute.
- One of ordinary skill in the art would be able to identify and/or locate promoter sequences of genes of interest using these and other methods/tools known in the art.
- a transcription factor (sometimes called a sequence- specific DNA binding factor) is a protein that binds to specific DNA sequences and thereby controls the transfer (or transcription) of genetic information from DNA to mRNA. TFs perform this function alone or with other proteins in a complex, by promoting (as an activator), or blocking (as a repressor) the recruitment of RNA polymerase (the enzyme that performs the transcription of genetic information from DNA to RNA) to specific genes.
- the specific DNA sequences to which a TF binds is known as a response element (RE) or regulatory element.
- RE response element
- Other names include cis- element and cis-acting transcriptional regulatory element.
- Transcription factors are classified based on many aspects. For example, the secondary, tertiary and quaternary structures of the protein structures DNA-binding sequence and properties, the interaction with the double helix of the DNA, and the metal and other binding characteristics. TFs are grouped into superclasses which are then divided into classes which are further divided into families and subfamilies. Databases of TFs are available at the World Wide Web at several websites, e. g. BIOBASE Gene Regulation (TRANSFAC® 7.0 Public 2005), the Ohio State University AtTFDB - Arabidopsis transcription factor database, TFSEARCH, and the RIKEN Genomic Sciences Center (GSC) in Japan.
- BIOBASE Gene Regulation TRANSFAC® 7.0 Public 2005
- TFSEARCH the Ohio State University AtTFDB - Arabidopsis transcription factor database
- GSC RIKEN Genomic Sciences Center
- the major superclass basic domains, zinc-coordinating DNA-binding domains, helix-turn-helix, beta-Scaffold Factors with minor groove contacts, and other transcription factors.
- the major classes are leucine zipper factors (bZIP), helix-loop-helix factors (bHLH), Helix-loop-helix / leucine zipper factors (bHLH-ZIP), NF-I, RF-X, bHSH, Cys4 zinc finger of nuclear receptor type, Cys4 zinc finger of nuclear receptor type, Cys2His2 zinc finger domain, Cys6 cysteine-zinc cluster, Homeo domain, Paired box, Fork head / winged helix, heat shock factors, tryptophan clusters, Ets-type, RHR (ReI homology region), STAT, p53, MADS box, beta-Barrel alpha-helix transcription factors, TATA-binding proteins, HMG, Heteromeric CCAAT factors, Grainyhead, Cold- shock domain factors,
- RE response element
- a RE binds transcription factors, trans-acting protein factors that regulate transcription. Some REs bind more than one transcription factor, and transcription factors may interact with different affinities with more than one RE.
- the modified promoters of the present invention desirably contain REs that can enhance gene expression.
- REs can be identified by a number of techniques known in the art, including deletion analysis, i.e., deleting one or more nucleotides from the 5' end or internal to a promoter; DNA binding protein analysis using DNase I footprinting, methylation interference, electrophoresis mobility- shift assays, in vivo genomic footprinting by ligation-mediated PCR, and other conventional assays; or by DNA sequence similarity analysis with known cis-element motifs by conventional DNA sequence comparison methods.
- the RE sequences are palindromes. Generally, RE sequences are orientated in the forward or the reverse direction, and the respective transcription factors will bind their respective RE regardless of the orientation.
- Examples of some native REs for use with the methods, engineered DNA constructs, engineered promoters, modified promoters are show in Tables 1-6 which provide the native genes and their respective RE, the gene reference (RefSeq) number in the public GENB ANKTM, the location of the native RE on the native promoter/gene, the sequence of the REs, and the cells for expressing the respective genes using the methods, engineered DNA constructs, engineered promoters, modified promoters described herein.
- the RefSeq provides the transcribed sequence from the gene and represents the putative transcriptional start site of the respective gene on the respective chromosome. This putative transcriptional start site is numbered as "one" or +1.
- the negative numbering of the RE means that the RE is on the left side or upstream of the +1 of the gene's putative transcriptional start site location on the chromosome.
- Transcription factors interact with their binding sites or RE using a combination of electrostatic (of which hydrogen bonds are a special case) and Van der Waals forces. Due to the nature of these chemical interactions, most transcription factors bind DNA in a sequence specific manner. However, not all bases in the transcription factor-binding site may actually interact with the transcription factor. In addition, some of these interactions may be weaker than others. Thus, transcription factors do not bind just one sequence but are capable of binding a subset of closely related sequences, each with a different strength of interaction. The closely related sequences have a core RE binding motif.
- TBP TATA-binding protein
- TBP TATAAAA
- TBP transcription factor can also bind similar sequences such as TATATAT or TATATAA.
- the core RE binding motif is "TATA”.
- FOXLl is a winged helix-turn-helix / forkhead type TF. It has a core RE binding motif of "ATA” and a consensus sequence of nnnnATA.
- the human TF GATA2 and GATA3 are zinc-binding type TFs and they have a core RE binding motif of "GAT".
- the consensus sequence for GAT A2 is n(G/C)ATn and the consensus sequence for GATA3 is (A/T)GAT(A/T)n.
- the rat, mouse and human TF CREBl is a basic leucine zipper type TF. It has a core RE binding motif of "TGACGT” and the consensus sequence is (TZGZC)(GZC)A(CZG)(GZA)(TZC)(CZAZT)(AZT).
- the "n” can be any one of the four standard nucleotide bases A, T, C, G that make up a DNA sequence.
- the JASPAR database and TRANSFAC are two web-based transcription factor database on transcription factors, their experimentally-proven binding sites, and regulated genes. Its broad compilation of binding sites allows the derivation of positional weight matrices. Web based research engines for transcription factor binding sites are also available, e. g. Matlnspector, SIB-HTPSELEX Database and TRANSFAC. One can also search for putative TFRE sites in the upstream promoter region of a gene or even within the gene using search tool such as TFSEARCH, Matlnspector, Transcription Element Search
- TESS Software from the University of Pennsylvania, and jPREdictor which predicts cis- regulatory elements from Bielefeld University, Germany and other tools known in the art.
- the term "responsive" or “stimulated” when used with HNF4 ⁇ 3 or HNFl ⁇ and HNF4 ⁇ 3- or HNFl ⁇ regulated or dependent gene refers to the increased gene transcription from a promoter that is regulated by these respective transcription factors when the these respective transcription factors are present or provided. The increase is above that seen in the absence of the transcription factors.
- enhancing expression of a gene refers to increasing the level of transcription of the gene; the increase is above the level that is normally seen for transcription from the native promoter of the gene.
- transcription factor response element (TFRE) segment refers to a DNA sequence that comprises TFRE within.
- the segment can also comprise other DNA sequences that are not used for transcription of a gene if the gene is operably linked to the segment.
- the term "construct” refers to any recombinant polynucleotide molecule such as a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, or linear or circular single- stranded or double- stranded DNA polynucleotide molecule, derived from any source comprising a polynucleotide molecule where one or more polynucleotide molecule has been linked in a functionally operative manner.
- a "DNA construct” would be a recombinant DNA polynucleotide molecule.
- an “engineered DNA construct” refers to a recombinant DNA polynucleotide molecule that does not exist naturally but is constructed artificially by molecular techniques.
- an “engineered DNA construct” comprises DNA sequences of various origins, much like a chimeric DNA polynucleotide molecule.
- An “engineered promoter” refers to an “engineered DNA construct” that can function as a promoter in transcription initiation of a gene that is operably linked to the
- a "modified promoter” refers to a native promoter in which some changes have been artificially incorporated within.
- the changes can include deletion and addition of sequences to the promoter.
- the changes are designed to alter the transcription activity of the promoter and thereby affect the expression of the gene that is operably linked to it.
- a “modified promoter” can be considered an "engineered promoter”.
- the term "vector”, as used herein, refers to a nucleic acid construct designed for transfer between different host cells.
- a "vector” is referred broadly to any plasmid, phagemid or virus encoding an exogenous nucleic acid.
- the term is also be construed to include non-plasmid, non-phagemid and non-viral compounds which facilitate the transfer of nucleic acid into virions or cells, such as, for example, poly-lysine compounds and the like.
- the vector may be a viral vector that is suitable as a delivery vehicle for delivery of the nucleic acid, or mutant thereof, to a cell, or the vector may be a non-viral vector which is suitable for the same purpose.
- an "expression vector” or expression construct” refers to a vector that has the ability to incorporate and express exogenous DNA fragments in a foreign cell.
- a cloning or expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification.
- the term vector may also be used to describe a recombinant virus, e.g., a virus modified to contain the coding sequence for a therapeutic compound or factor.
- a vector may be of viral or non-viral origin.
- viral and non- viral vectors for delivery of DNA to cells and tissues are well known in the art and are described, for example, in Ma et al. (1997, Proc. Natl. Acad. Sci. U. S. A. 94: 12744-12746).
- viral vectors include, but are not limited to, a recombinant Vaccinia virus, a recombinant adenovirus, a recombinant retrovirus, a recombinant adeno-associated virus, a recombinant avian pox virus, and the like (Cranage et al., 1986, EMBO J. 5: 3057-3063; International Patent Application No. W094/17810, 1994; International Patent Application No.
- a "gene therapy vector” refers to an expression vector that is engineered to incorporate and express DNA sequences or gene products (e. g. mRNA or siRNA) in a host cell for the purpose of correcting a defect or deficiency in that cell.
- a “gene therapy vector” is an expression vector adapted for transfer and expression of DNA sequences into a host cell for the purpose of correcting a defect or deficiency in that cell or the organism having the host cell.
- the product from the expressed DNA sequences functions to correct the defect or deficiency or they cam be used for t he treatment of diseases and disorders.
- a gene therapy vector is engineered with the correct gene and is inserted into the cell of the tissue having the defect. Expression from the correct gene in the gene therapy vector will produce functional enzyme, replacing the missing enzyme in the cells and tissue.
- gene therapy vectors for use with animal model experiments that utilize the cytomegalovirus immediate early CMV-IE promoter (e.g. pCI-neo cloning vector CVU47120, nts 1-750).
- This promoter contains numerous response elements to a variety of ubiquitously expressed TFs (e.g. SPl, AP-I, CREBP, SRF, etc.).
- the "CAG” promoter composed of the core chicken beta-actin promoter fused the CMV enhancer, a variation that has been used to express TFs (e.g. Klf4, Oct3/4, c-myc, Sox2) capable of reprogramming somatic cells into "induced pluripotent stem cells” (iPS cells).
- TFs e.g. Klf4, Oct3/4, c-myc, Sox2
- target gene in a gene that one wants to enhance gene expression is a host cell when an expression vector or a gene therapy vector is transduced, transfected or inserted into the host cell.
- a host cell is any cell that is transfected with a vector.
- the host cell is selected from a group consisting of hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells.
- the host cells are any stem cells, of any species, mammalian or non- mammalian.
- the host cell is a human cell.
- the host cells are any cell within the body of an organism, e.g. when a gene therapy vector or construct is used.
- the organism can be of any species, mammalian or non-mammalian, including human.
- the host cells are the type of cells used for the bioprocess production of commercial therapeutic biologies, e. g. therapeutic antibodies, proteins and peptides.
- commercial therapeutic biologies e. g. therapeutic antibodies, proteins and peptides.
- CHO Chinese hamster ovary
- mouse myeloma cells e.g., mouse myeloma cells.
- the host cell is a cell selected from Tables 1-4.
- Figure IA shows a schematic of the modification of the native mHnfl or promoter and 5-prime UTR (692 bp upstream of the ATG start codon) by inserting additional H4REs in increments of three immediately downstream of the native H4RE.
- the arrow indicates the transcription start site (not to scale).
- Figure IB shows the effect of increasing the number of adjacent H4REs on mHnfl or promoter activity in the reporter plasmid pGL3 transfected into HEK-293 cells.
- Figure 2A shows the schematic of duplicating the Stul/Nhel fragment containing the 4xH4RE motif to generate mHnfl ⁇ P uP4xH4RE Tj 16 transcription start site (arrow) corresponds to its position in the human promoter.
- Figure 2A shows the effect of duplicating the 370-bp mHnfl ctr 4xH4RE promoter fragment containing the 4xH4RE on promoter activity in the reporter plasmid pGL3 transfected into HEK-293 cells.
- Figure 3 shows the schematic of modifying the native ApoC3 promoter by inverting the proximal H4RE (ApoC? DuplxH4RE/061 ), converting both to 4xH4RE motifs retaining the 607-bp spacing (ApoC3 Dup4xH4RE/061 ), and then bringing the motifs closer by deleting an intervening 312-bp Sad fragment (ApoC? Dup4xH4RE/030 ). Motif spacing was increased to 2.06 kb by inserting a 1.77-kb human HNFl ⁇ cDNA fragment into the Sad site and then sequentially reduced by deleting indicated restriction fragments.
- Figure 4A shows the schematic of modifying native 1.0-kb human HNF4A P2 promoter.
- Figure 4C shows the effects of modifications to the human HNF4A P2 promoter in the reporter plasmid pGL3 transfected into HEK-293 cells. Data are presented as fold stimulation vs. pGL3-Basic.
- Figure 5A shows the schematic diagram of the coding sequence of human
- HNFl ⁇ fused to the augmented mHnfl a promoter to form the mHnfl cP apAxmKE IHNFl a minigene cassette (upper) and the protein expression from the augmented promoter (lower).
- Figure 5B shows the schematic diagram of the coding sequence of rat HNF4 ⁇ 3 that is HA-tagged at the C-terminus and then fused to the augmented P2 promoter to form the fflVF4 ⁇ -P2 Dup4xH4RE /HNF4 ⁇ 3 HA minigene cassette (upper) and the protein expression from the augmented promoter (lower).
- Figure 6 A shows the effect of H4RE copy number in the mHnfl or promoter in rat
- Figure 6D shows the effect of HIRE copy number and/or duplicating the
- Figure 7A shows the sequence of the mouse Hnfl O0.7ATG promoter comprising the 692 nucleotide (nt) upstream of the ATG start codon are shown (SEQ. ID. NO: 1).
- NM_009327 / mouse Hnfla gene shown is Mus musculus Chromosome 5: 115,420,851 -
- Figure 7B shows the DNA sequences of the synthetic oligonucleotides (SEQ. ID.
- H4REs 3xH4RE
- Underlined sequences are H4REs derived from the human G6Pase gene (2 elements on Chl7: -236/-218 & -78/-60 from RefSeq NM_000151) flanking the human HNFlB element (TCF2; -214/-196 from RefSeq: NM_000458).
- Figure 7C shows the sequence of the mouse Hnfl ⁇ 7ATG4xH4RE promoter with the
- Figure 7D shows the sequence of the mHnfl ⁇ mmL promoter with the
- Figure 7E shows the effects of StuUNhel duplication on the HNF4 ⁇ 3 stimulated activity of the native mHnfl or promoter.
- Figure 7F shows the position of the putative Nkx-2.2 element (double underlined) on the native mHnfl or promoter sequence with respect to the H4RE (boxed) (SEQ.
- Nkx-2.2 site (bold underline; wild type sequence) in mouse Hnfla promoter (the region shown is Ch 5: 115,421,112 - 115,421,260, reverse orientation; the Nkx-2.2 site is located from 115,421,159 - 115,421,165 (also reverse orientation). Flanking Stul and BIpI sites are underlined and the native H4RE is boxed.
- Figure 7G and the mutation of the putative Nkx-2.2 element in the mutated sequence (SEQ. ID. NO: 7).
- the Nkx-2.2 site was mutated by changing all 7 nucleotides (bold underline).
- Figure 7H shows the effects of a mutation of the putative Nkx-2.2 site on the
- HNF4oc3 stimulated activity of the native mHnfl or promoter.
- Figure 8 A shows the DNA sequence of the human ApoC3 promoter (SEQ. ID.
- Sequence -706/-8 with respect to NM_000040 (Chrll:116,700,624-116,703,787), containing 5' GGTACC Kpnl site and 3' AGATCT Bglll site introduced during PCR cloning, distal H4RE at -702/-690 (box and bold), Ndel site (GCTAGC) introduced at -88A83, and reversed H4RE at -82/-70 (box and bold).
- Figure 8B shows the DNA sequence of the ApoC3 Oup4xl ⁇ 4RE061 and the PCT sequences having the 3XH4RE used to construct the modified the human ApoC3 promoter with duplicated 4xH4REs (SEQ. ID. NO: 9, 10, 11 in accordance to appearance). The REs are boxed and bold.
- Figure 8C shows the DNA sequence of the ApoC3 Dup4xH4RE03 . (SEQ. ID. NO:
- the REs are boxed and bold.
- Figure 9 A shows the DNA sequence of the human HNF4A P2 promoter with Ix
- HIRE SEQ. ID. NO: 13
- Figure 9B shows the DNA sequence of the human HNF4A P2 promoter with a duplicated Ix HIRE (SEQ. ID. NO: 14, 15, 16 in the order of appearance) and the sequences of the PCR primers for duplication the HIRE.
- Figure 9C shows the DNA sequence of the human HNF4A P2 promoter with the duplicated 4X HIRE and the 0.84 bp spacing (SEQ. ID. NO: 17, 18, 19 in the order of appearance) and the sequences of the PCR primers for duplication the HlREs.
- Figure 9D shows the DNA sequence of the human HNF4A P2 promoter with the duplicated 4X HIRE and the 0.23 bp spacing (SEQ. ID. NO: 20) and the sequences of the PCR primers for duplication the HlREs.
- the present invention relates to methods, engineered DNA constructs, engineered promoters, modified promoters and DNA sequences to enhance the transcriptional activity of a promoter fragment in mammalian expression vectors while retaining the natural transcription factor dependence or regulation control of the native mammalian promoter or promoter fragment for transcription.
- the described engineered promoter enhancement constructs and methods provide safe, normally regulated promoters capable of expressing therapeutic proteins for, for example, new gene transfer and/or gene therapy vectors as well as currently available gene transfer and/or gene therapy vectors and techniques.
- the methods and DNA sequences described herein provide ways to generate safe, normally regulated promoters capable of expressing therapeutic proteins from gene expression vectors.
- the promoters can be native promoters.
- DNA DNA, and encompass multiple discrete binding sites for transcription factors that in combination dictates specificity of gene transcription.
- the extensive enhancer/locus control regions form the regulatory elements of a gene.
- HNF4A P2 promoter The HNFlA (TCFl) and HNF4A genes are mutated in maturity onset diabetes of the young M0DY3 (24) and MODYl (25), respectively, and have been proposed to constitute a bi-stable transcriptional couple in pancreatic ⁇ cells (26, 27).
- the prototype mammalian promoters and the transcription response elements used by the inventors are examples only, and the same strategy can be applied to any mammalian promoter construct. Therefore, the invention is not limited to the specific exemplary constructs prepared thus far, e.g., HNF4 ⁇ -dependent and HlRE-dependent promoters. These exemplary promoters are used as examples and for proof-of-concept demonstrations only.
- H4REs HNF4 REs
- the inventors were able to significantly enhance the HNF4 ⁇ - stimulated activity.
- the inventors also added another manipulation duplicating a several hundred nucleotide fragment containing the 4xH4RE to generate non-adjacent 4xH4RE motifs or segments. This duplication step further increased the HNF4 ⁇ induction to a thousand-fold (See Fig. 2B).
- HNF4 ⁇ -stimulated activity was observed by converting the two non-adjacent H4REs in the ApoC3 promoter (28) to 4xH4RE motifs, which resulted in similar enhanced HNF4 ⁇ -stimulated activity.
- HNF4A P2 promoter was demonstrated by introducing non-adjacent 4xHlRE motifs (HNFl REs) in the HNF4A P2 promoter.
- HNF4oc is nuclear protein receptor type TF and the HNFl ⁇ is a homeodomain type TF.
- the demonstration of this method in three different mammalian promoters which are respectively dependent on different types of TF shows that this method is not limited to homeodomain type TF or nuclear protein receptor type TF promoters but rather that the method is applicable to any other TF dependent mammalian promoter.
- the present disclosure provides a method of enhancing expression of a gene comprising operably linking the gene to an engineered promoter forming a gene expression construct, wherein the engineered promoter comprises at least one transcription factor response element (TFRE) segment, wherein the TFRE segment comprises four to 16 TFREs; wherein all of the TFREs are response elements (REs) of one transcription factor (TF), and wherein each of the TFRE is in forward orientation, and wherein each of the four to 16 TFREs are separated by 9-15 base pairs, and wherein the at least one TFRE segment is inserted upstream (5') of the ATG start codon of the mammalian gene.
- TFRE transcription factor response element
- a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) operably linking the engineered DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (c) transducing a cell with the gene expression construct.
- TFRE transcription factor response element
- the disclosure herein provides a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) engineering a second DNA construct to further comprise at least two TFRE segments of step (a), wherein the TFRE segments are separated by 200-700 base pairs; (c) operably linking the engineered second DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (d) transducing a cell with the gene expression construct.
- TFRE transcription factor response element
- a method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences in forward orientation, wherein each of the TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; and (c) operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
- TFRE transcription factor response element
- a method for modifying a promoter to enhance gene expression from a transcription factor dependent mammalian promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences in forward orientation, wherein each of the TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; (c) engineering a second DNA construct to further comprise at least two TFRE segments, wherein the TFRE segments are separated by 200-700 base pairs; and (d) operably linking the engineered second DNA construct upstream (5') of the ATG start
- a modified promoter comprising at least one transcription factor response element (TFER) segment, wherein the TFRE segment comprises 4-16 TFREs, wherein all of the TFREs are response elements (REs) of one transcription factor (TF) native to a promoter, wherein the TFREs are in forward configuration, wherein each of the 4-16 TFREs are separated by 9-15 base pairs (bp).
- TFER transcription factor response element
- the disclosure herein provides an engineered DNA construct for increasing gene expression from a transcription factor (TF) dependent promoter comprising at least one transcription factor response element (TFRE) segment, wherein the segment comprises between four and 16 consecutive TFREs in forward direction, wherein each of the TFRE is separated by about 9 to 15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) for one transcription factor (TF).
- TF transcription factor
- TFRE transcription factor response element
- the promoters are mammalian promoters. In other embodiments, the promoters are non-mammalian promoters. In other embodiments, the promoters are synthetically made promoter made of parts from many non-related sources, much like a chimeric promoter described in the examples.
- the TFREs are in forward configuration, forward direction or forward orientation. In some embodiments, the TFREs are in reverse configuration, reverse direction or reverse orientation. In one embodiment, all the TFREs in a segment are in the same direction. In other embodiments, the TFREs in a segment have a mixed forward and reverse orientation.
- the TFRE segment of the engineered DNA construct, modified promoter or engineered promoter comprise four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, or 16 TFREs.
- the multiples of TFRE have to be for the same and one TF but they need not be the native TF, nor do they have to be the same sequence.
- the TFRE segment can be made by reproducing the native promoter RE, adding consensus REs, or building the multi-copy RE by combining several REs from other highly responsive promoters.
- One skilled in the art would be able to selected, mix and match TFREs to form the segment as the inventors demonstrated.
- the ranges of TFRE in a segment is between 4-5, 4-6, 4-7,
- the TFREs in a segment is two REs.
- the ranges of TFRE in a segment is between 2-16, e. g. 2-4, 2-6, 2-8, 2-10, 2-12, 2-14, and 2-16.
- the inventors have shown that having more REs do not necessary result in a further increased in the TF stimulated activity (Fig. IB).
- the maximum number of H4RE appears to be ten before there is some negative effects on the stimulated activity.
- the multiple TFREs in a TFRE segment resulted in increase the TF stimulated activity (Fig. 2B, 4B, 4C, 6D, and 7E).
- the multiple TFREs in a TFRE segment are separated by about 9, 10, 11, 12, 13, 14, or 15 bps.
- the 9-15 bps are used to space the TFRE apart in a segment.
- the sequences of the 9-15 bps is not important and can be any of the A, T, C, G nucleotide in a DNA sequence. This range of spacing is approximately that of a single helical DNA turn of 10-11 bp. Such a spacing of 9-15 bp between the multiple REs will have the DNA binding sites on one and the same side of the helix DNA.
- the engineered DNA construct, modified promoter and/or engineered promoter described herein are used to form gene expression constructs.
- the engineered DNA construct, modified promoter or engineered promoter described herein is a gene expression construct.
- the engineered DNA construct, modified promoter or engineered promoter described herein are operably linked to a gene to form a mini gene cassette.
- the engineered DNA construct, modified promoter or engineered promoter described herein is a mini gene cassette. The inventors show two such mini gene cassettes, see Fig. 5A in the example.
- engineered DNA construct, modified promoter or engineered promoter described herein the gene expression construct is further transduced into a host cell.
- engineered DNA construct, modified promoter or engineered promoter described herein the mini gene cassette is further transduced into a host cell.
- the host cell is selected from a group consisting of hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells.
- the host cell expresses the respective TF that binds the TFREs in the segment and thereby regulate the expression of the operably linked gene.
- the host cells are stem cells. For example, adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.
- engineered DNA construct, modified promoter or engineered promoter described herein are used to enhance to expression of differentiating or programming factors in the stem cell.
- the host cells are any cell within the body of an organism, e.g. when a gene therapy vector or construct is used.
- the methods, engineered DNA construct, modified promoter or engineered promoter described herein are used to correct a defect or deficiency in a cell or tissue comprising the cell or for treating a disease or disorder.
- the methods, engineered DNA construct, modified promoter or engineered promoter described herein are used for enhancing commercial production of therapeutic biologies.
- the host cells are any of the type of cells used for the bioprocess production of commercial therapeutic biologies, e. g. therapeutic antibodies, proteins and peptides. Such cells are well known in the art and one skilled in the art would be able to select an appropriate host cell.
- CHO Chinese hamster ovary
- mouse myeloma cells are the typical cells used for commercial production of therapeutic biologies.
- the methods and constructs are used to enhance gene expression for the commercial production of therapeutic biologies, then one should select from the CHO or mouse myeloma derived cell lines.
- the host cell is a cell selected from Tables 1-4.
- the expression of the gene is in vivo.
- the genes are expressed in the host cells (e. g. the hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, muscle cells and stem cells such as adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc. within a mammal, e. g. a mouse or a human.
- the expression of the gene is in vitro.
- the genes are expressed in the cells (e. g. hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells) that are extracted or isolated from a mammal.
- the cells are cultured ex vivo in tissue culture conditions.
- the engineered DNA construct described herein is operably linked upstream (5') of an ATG start codon of a gene that is operably linked to a TF dependent promoter. In one embodiment, the modified promoter or engineered promoter described herein is operably linked upstream (5') of an ATG start codon of a gene. [0135] In one embodiment, the engineered DNA construct described herein is operably linked upstream (5') of a transcriptional start site of a gene that is operably linked to a TF dependent promoter. In one embodiment, the modified promoter or engineered promoter described herein is operably linked upstream (5') of a transcriptional start site of a gene.
- the gene product of the gene is a protein. In another embodiment, the gene product of the gene is not a protein, e. g. an RNA such as a microRNA.
- the engineered DNA construct, modified promoter or engineered promoter described herein comprises at least two TFRE segments, wherein the two TFRE segments are separated by 200-700 bp. In another embodiment, the engineered DNA construct, modified promoter or engineered promoter described herein comprises up to four TFRE segments, wherein the TFRE segments are separated by 200-700 bp. In one embodiment, the engineered DNA construct, modified promoter or engineered promoter described herein comprises two, three or four TFRE segments. In another embodiment, all the TFRE segments have TFRE that are for the same and one TF.
- the multiple TFRE segments are separated by about 200,
- the 200-700 bps are used to space the TFRE segment apart in a engineered DNA construct, modified promoter or engineered promoter. In some embodiments, the separation is between 200-300, 200-400, 200-500, 200-600, 300-400, 300-500, 300-600, 300-700, 400-500, 400-600, 400-700, 500-600, 500-700, or 600-700 bp.
- the sequences of the200-700 bps is not important and can be any of the A, T, C, G nucleotide in a DNA sequence.
- the ideal range is between 200-700 bps and it varies with the gene.
- the inventors show that a reduction in the size from 0.84-0.23 kilo bp increased the TF stimulated activity for the HNF4A promoter (Fig. 4B) while a reduction in the size from 0.61-0. 30 kilo bp decreased the TF stimulated activity for the ApoC3 promoter (Fig. 3B).
- Fig. 4B the a reduction in the size from 0.61-0. 30 kilo bp decreased the TF stimulated activity for the ApoC3 promoter
- Fig. 3B One skilled in the art would be able to experiment to determine the optimum segment spacing for the gene of interest using the methods described in the examples and other methods known in the art.
- at least one TFRE of the TFRE segment is the native to the promoter of the gene, otherwise known as the native promoter TFRE.
- the native RE is duplicated in the TFRE segment.
- the segment comprises identical TFREs.
- the segment comprises all native promoter REs.
- none of the TFRE of the TFRE segment is native to the promoter of the gene.
- the TFREs of a segment are made up of TFRE from other genes and they are all REs for the same and one TF.
- the segment comprises one native TFRE of the mouse Hnfl alpha gene, two REs of the human G6Pase gene and one RE from the human HNFlB (TCF2) gene.
- At least one TFRE of the engineered DNA construct, modified promoter or engineered promoter described herein is the native promoter TFRE.
- all the TFREs are identical.
- the engineered DNA construct, modified promoter or engineered promoter described herein comprises all native promoter REs.
- none of the TFRE of the of the engineered DNA construct, modified promoter or engineered promoter described herein is native to the promoter of the gene.
- the TFREs of engineered DNA construct, modified promoter or engineered promoter described herein are made up of TFRE from other genes and they are all REs for the same and one TF.
- the TFRE segment is repeated at least twice and up to four times. In one embodiment, the TFRE segment is duplicated in tandem in the engineered DNA construct, modified promoter or engineered promoter described herein. In another embodiment, the TFRE segment is triplicated in tandem in the engineered DNA construct, modified promoter or engineered promoter described herein. In one embodiment, the TFRE segment is repeated in tandem four times in the engineered DNA construct, modified promoter or engineered promoter described herein.
- the engineered promoter or modified promoter is derived from a native promoter of the gene.
- the gene is a mammalian gene.
- the engineered promoter or modified promoter is derived from a mammalian promoter.
- the mammalian gene is a non-human mammalian gene, e. g. mouse, rat, non-human primate (e. g. monkey, baboon, ape, and chimpanzee), dog, and hamster gene.
- the mouse hepatocyte nuclear factor 1 alpha mHNFl alpha
- the mammalian gene is a human gene.
- the mammalian promoter is selected from a group consisting human, mouse, rat, non-human primate (monkey, baboon, ape, and chimpanzee), dog, and hamster.
- the mammalian promoter is a non-human promoter, e. g. mouse, rat, non-human primate (monkey, baboon, ape, and chimpanzee), dog, and hamster.
- the mammalian promoter is a human promoter. Examples include but are limited to the human U6, Hl, tRNA, beta-actin, alpha-actin and EFl alpha promoters.
- the engineered DNA construct, modified promoter or engineered promoter described herein, the TFRE is for a TF selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic helix-loop-helix (bHLH), basic-leucine zipper type (bZIP), winged helix type, and heat-shock type TFs.
- the TF is a homeo-domain type TF.
- the homeo-domain type TF is a hepatocyte nuclear factor 1 alpha (HNFl ⁇ ) TF.
- the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a gene selected from the group consisting of hepatocyte nuclear factor 4 alpha (HNF4A), sodium-glucose cotransporter (SLC5A1) and albumin (ALB).
- HNF4A hepatocyte nuclear factor 4 alpha
- SLC5A1 sodium-glucose cotransporter
- ALB albumin
- the TF is a HNFl ⁇ and the gene expression construct or mini gene cassette is transduced into a host cell
- the cell is selected from a group consisting of stem cells (e. g. adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.), hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells and renal proximal tubule cells.
- stem cells e. g. adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.
- pancreatic beta cells intestinal mucos
- the TF is a nuclear hormone receptor type TF.
- the nuclear hormone receptor type TF is a hepatocyte nuclear factor 4 alpha (HNF4 ⁇ ).
- the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a gene selected from the group consisting of Coagulation Factor VIII (procoagulant component), Acyl CoA dehydrogenase, UDP-glucuronosyl-transferase 1, ATP-binding cassette, sub-family C (ABCC), Apolipoprotein C3 and hepatocyte nuclear factor 1 alpha (HNFlA).
- the TF is a HNF4 ⁇ and the gene expression construct or mini gene cassette is transduced into a host cell
- the cell is selected from a group consisting of stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.), hepatocytes, hematopoietic cells, epidermal cells, and endothelial cells.
- the TF is a bHLH type TF.
- the bHLH type TF is a MyoD.
- the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a gene selected from the group consisting of actin, alpha 1, skeletal muscle (ACTAl), myocyte enhander factor 2A (MEF2A) and Catenin beta (CTNNBl).
- the TF is a bHLH and the gene expression construct or mini gene cassette is transduced into a host cell
- the cell is selected from a group consisting of stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.), pre-myocytes, myocytes, and muscle cells.
- the TF is a bHLH type TF.
- the bHLH type TF is a neurogenin-3 (Ngn-3).
- the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a OVO homologue-like 1 (OVOhLl) gene.
- the cell is a pancreatic beta cell or stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.).
- the TF is a bZIP type TF.
- the bZIP type is a bZIP type TF.
- TF is cyclic AMP (cAMP) RE (CRE).
- the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is pyruvate carbolylase.
- the TF is a bZIP type TF and the gene expression construct or mini gene cassette is transduced into a host cell, the cell is a hepatocyte or stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.).
- a vector comprising an engineered DNA construct, engineered promoter or modified promoter construct described herein.
- the vector is a gene therapy vector.
- a cell comprising a vector of any one embodiments of the engineered DNA construct, engineered promoter or modified promoter construct described herein.
- the engineered DNA construct or modified mammalian promoter is mHnfl ⁇ r 4XH4RE or a nucleic acid sequence that is at least 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 4 which is the DNA sequence depicted in Figure 1C.
- the construct was made by the combination of 254 nts upstream of NM_009327 (Chr5: 115,398,989- 115,421,071) and the 1st 219 nts of with the synthetic 3xH4RE segment (Fig. 7B; italicized portion) inserted 50 nts upstream of NM_009327.
- the engineered DNA construct or modified mammalian promoter is mHnfl a Du ⁇ xmRE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 5 which is the DNA sequence depicted in Figure 7D which is equivalent to the sequence in Fig. 7C except for duplication of the italicized portion 339 nts]
- the engineered DNA construct or modified mammalian promoter is human ApoC3 DuP1XH4RE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 8 which is the sequence shown in Fig.
- the engineered DNA construct or modified mammalian promoter is human ApoC3 Ou ⁇ xmRE/06 or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 9 which is the sequence shown in Fig. 8B which made by the synthetic 69-bp 3xH4RE segment inserted between Kpnl site and promoter at nt -706 and synthetic 85-bp 3xH4RE segment inserted into promoter created Nhel site at nt -88 from NM_000040 (see Fig. 8B).
- the two GAGCTC Sad sites are bold.
- the engineered DNA construct or modified mammalian promoter is human ApoC3 Du ⁇ xmRE/029or ° 3 or 80% identical to SEQ. ID. NO: 12 which is the sequence shown in Fig. 8C.
- the ApoC? Dup4xH4RE/029 and ApoC? Dup4xH4RE/03 are used interchangeably.
- the engineered DNA construct or modified mammalian promoter is human HNF4A P2 1XH1RE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 13 which is the sequence shown in Fig.
- the engineered DNA construct or modified mammalian promoter is human HNF4A P2 DUP1XH1RE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 14 which is the sequence shown in Fig. 9B.
- a 20-bp fragment containing a putative HIRE located -8.41 kb upstream from NM_175194 was inserted between the Kpnl & Sad sites with the forward PCR primer (HIRE boxed).
- the downstream reverse primer introduced an N del site immediately upstream of the proximal HIRE.
- the engineered DNA construct or modified mammalian promoter is human HNF4A p2 Ou ⁇ xmRE/0 84kb or 80% identical to SEQ. ID. NO: 17 which is the sequence in Fig. 9C. Modified to the sequence is by inserting a 3xHlRE segment adjacent to each HIRE with the primers shown in Fig. 9C.
- the three HlREs inserted immediately downstream of the upstream HIRE were derived from the human ⁇ l -antitrypsin, ⁇ -fibrinogen, and albumin genes, respectively.
- the human albumin HIRE was derived from nts -322/-310 with respect to
- NM_000477 (Chr4:74,268,972-74,287,627)
- human ⁇ l-antitrysin HIRE was derived from nts +139/+151 with respect to NM_000295 (Chrl4:94,843,085-94,855,153)
- the ⁇ - fibrinogen HIRE was derived from nts -58A46 with respect to NM_005141 (Chr4: 155,484,132- 155,493,915).
- the engineered DNA construct or modified mammalian promoter is human HNF4A P2Dup4xHl RE/0.23kb or 80% identical to SEQ. ID. NO:20 which is the sequence shown in Fig. 9D The 609 bp of DNA was deleted between the BsrGI and PflMI sites.
- the RE of different genes can be from different organisms, e. g. RE from the nematode worm, the fruit fly, and from human.
- Transcription factors are proteins that bind to the enhancer or promoter regions and interact such that transcription occurs from only a small group of promoters in any cell. Most transcription factors can bind to specific DNA sequences, and these trans-regulatory proteins or transcription factors (TFs) can be grouped together in families based on similarities in structure.
- proteins share a common framework structure in their respective DNA-binding sites, and slight differences in the amino acids at the binding site can alter the sequence of the DNA to which it binds.
- TFs contain a domain involved in activating the transcription of the gene whose promoter or enhancer it has bound. Usually, this trans-activating domain enables that TF to interact with proteins involved in binding RNA polymerase. This interaction often enhances the efficiency with which the basal transcriptional complex can be built and bind RNA polymerase II.
- transcription factors There are several families of transcription factors, and those discussed here are just some of the main types.
- Homeo domains are conserved DNA-binding domains found in the transcription factors of a wide variety of organisms. There are also known to play an important role in embryogenesis. Homeodomains are about 60 amino acid residues long, and structurally, they consist of three alpha-helices and one flexible N-terminal arm. Homeodomains all bind to DNA at a TAAT core motif. The in vitro the common consensus DNA site that contains the motif (C/G)TAATTG.
- An example of homeo domain TF is Msx-1 which is encoded by a subfamily of homeobox genes. In a developing embryo, these genes are expressed in craniofacial structures, the neural tube, and in the limbs.
- Msx-1 specifically interacts with DNA at the sequence (C/G)TAATTG. Biologically, Msx-1 acts as a transcriptional repressor.
- Msx-1 acts as a transcriptional repressor.
- Another example is the heterodimers between the Pbx/Exd and Hox/HOM-C classes of homeodomain proteins. They are bind regulatory elements in tissue- specific and developmentally regulated genes. The Pbx- Hox heterodimers bind a prototypic element of TGATTAAT.
- Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both Basic helix-loop-helix and leucine zipper motifs.
- An example is Microphthalmia-associated transcription factor.
- Another example is the sterol regulatory element binding protein (SREBP)
- Basic Helix-Loop-Helix (bHLH) Transcription Factors are proteins bind to DNA through a region of basic amino acids (typically 10 to 13 residues) that precedes the first ⁇ - helix.
- the helices contain hydrophobic amino acids at every third or fourth position, so that the helix presents a surface of hydrophobic residues to the environment. This enables the protein to pair by hydrophobic interaction with the same protein or with a related protein that displays such a surface.
- the muscle-specific transcription factors MyoD and myogenin are examples of TF having this structural motif bHLH.
- the MyoD family of proteins is active in promoting myo genesis when complexed to either the E12 or E47 proteins-two ubiquitous bHLH proteins).
- the Id protein contains the HLH motif, but lacks the basic region that binds to the DNA. Dimerization of Id with MyoD, E12, or E47 interferes with the ability of these proteins to bind DNA, and the expression of Id in cells prevents the activity of the MyoD proteins.
- the Id protein is made while the muscle cell precursors are still dividing, and they disappear when the myoblasts leave the cell cycle to begin differentiating into myotubes. If Id is overexpressed in cultured myoblasts, they will not differentiate into myotubes.
- the structure of basic leucine zipper (bZip) transcription factors is very similar to that of the bHLH proteins.
- the bZip proteins are dimers, each of whose subunits contains a basic DNA-binding domain at the carboxyl end, followed closely by an a helix containing several leucine residues. These leucines are placed in the helix such that they interact with similarly spaced leucine residues on other bZip proteins to form a "leucine zipper" between them, causing dimers to form.
- This domain is followed by a regulatory domain that can interact with the promoter to stimulate or repress transcription
- the C/EBP, API, and yeast GCN4 transcription factors are members of the bZip family.
- CCAAT enhancer-binding protein C/EBP
- C/EBP plays a role in adipogenesis similar to that of the myogenic bHLH proteins in myo genesis.
- Zinc finger transcription factors have zinc finger motifs for their DNA-binding domain.
- Zinc finger proteins include WT-I (a important transcription factor critical in the formation of the kidney and gonads); the ubiquitous transcription factor SpI; Xenopus 5S rRNA transcription factor TFIIIA; Krox 20 (a protein that regulates gene expression in the developing hindbrain); Egr-1 (which commits white blood cell development to the macrophage lineage); Kruppel (a protein that specifes abdominal cells in Drosophila); and numerous steroid-binding transcription factors.
- WT-I a important transcription factor critical in the formation of the kidney and gonads
- the ubiquitous transcription factor SpI Xenopus 5S rRNA transcription factor TFIIIA
- Krox 20 a protein that regulates gene expression in the developing hindbrain
- Egr-1 which commits white blood cell development to the macrophage lineage
- Kruppel a protein that specifes abdominal cells in Drosophila
- the WT-I protein contains four zinc finger regions, and it is usually expressed in the fetal kidney and gonads. People with one mutant WTl allele (usually a deletion of the gene or of a zinc finger region) have urogenital malformations and develop WiIm' s tumor of the kidney. In mice, both WTl genes can be deleted by gene targeting, and the resulting mice die in utero, having neither kidneys nor gonads.
- the WTl factor binds to the regulatory regions of several genes that are active during kidney development and also is thought to inhibit the expression of certain growth factors.
- Nuclear hormone receptors and their hormone -responsive elements Specific steroid hormones are known to increase the transcription of specific sets of genes. Once the hormone has entered the cell, it binds to its specific receptor protein, converting that receptor into a conformation that is able to enter the nucleus and bind particular DNA sequences.
- the family of steroid hormone receptors includes proteins that recognize estrogen, progesterone, testosterone, and cortisone as well as nonsteroid lipids such as retinoic acid, thyroxine, and vitamin D.
- the DNA sequences capable of binding nuclear hormone receptors are called hormone-responsive elements, and they can be in either enhancers or promoters.
- One set of steroids includes the glucocorticoid hormones (cortisone, hydrocortisone, and the synthetic hormone dexamethasone). These bind to the glucocorticoid hormone receptors and enable the bound receptors to bind to the glucocorticoid-responsive elements in the chromosomes.
- the steroid-hormone-responsive elements are extremely similar to one another and are recognized by closely related proteins. These steroid receptor proteins are similar to chimeric protein molecules.
- a hormone-binding domain In general, they each contain three functional domains: (1) a hormone-binding domain, (2) a DNA-binding domain that recognizes the hormone-responsive element, and (3) a trans-activation domain, which is involved in mediating the signal to initiate transcription. These functions can overlap, and all domains appear to have some role in activating transcription.
- Some steroid receptor proteins have their DNA binding domain as inverted palindromes. For transcriptional activation to occur, the receptor has to enter the nucleus and dimerize with a similar hormone-binding protein. The binding of hormone to the hormone-binding domain appears necessary for dimerization, translocation into the nucleus, and the ability of the DNA- binding region to recognize the hormone-responsive element.
- the consensus sequence of the glucocorticoid-response element is AGAACANNNTGTTCT (where N can be any base) (SEQ. ID. NO: 21). Changing as few as two amino acids will change the specificity of the binding protein.
- the (palindromic) sequence GGTCACTGTGACC (SEQ. ID. NO: 22) is a strong estrogen-responsive enhancer element that will bind the estrogen-containing receptor protein. Two symmetrical mutations in this sequence, making it GGACACTGTGTCC (SEQ. ID. NO: 23), convert this DNA into a glucocorticoid-responsive enhancer.
- TF transcription factor
- bp base-pairs
- [M] The engineered DNA construct of any of the paragraphs [A]-[L], wherein the TF is a selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic-leucine zipper type (bZIP), winged helix type, and heat-shock type TF.
- TF is a selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic-leucine zipper type (bZIP), winged helix type, and heat-shock type TF.
- a modified promoter comprising an engineered DNA construct of any one of paragraphs [A]-[T].
- [Z] A cell comprising a vector of any one of the paragraphs [U], [V], [X], and [Y].
- a method of enhancing expression of a target gene comprising operably linking the gene to an engineered DNA construct of any one of paragraphs [A]- [T] or a modified promoter of paragraph [W] to form a gene expression construct.
- [BB] A method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising:(a) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences, wherein each of the TFRE is separated by 9-15 base-pairs
- step (a) wherein the TFRE segments are separated by 200-700 base pairs; and (c) operably linking the engineered second DNA construct upstream (5') of an
- ATG start codon of a target gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct.
- a method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a target gene that is operably linked to the transcription factor dependent promoter; (b) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences, wherein each of the
- TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; (c) engineering a second DNA construct to further comprise at least two TFRE segments, wherein the
- TFRE segments are separated by 200-700 base pairs; and (d) operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the target gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
- the host cell is selected from a group consisting of stem cells, adult stem cells, embryonic stem cells, induced pluripotent stem cells, hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre- myocytes, myocytes, and muscle cells.
- HNF hepatocyte nuclear factor
- M0DY3 hepatocyte nuclear factor 4 ⁇ -dependent Hnfl a
- HNF4 ⁇ stimulation increased from 5-fold to 90-fold by inserting 3 additional HNF4 ⁇ REs (H4REs).
- Constructing a promoter with two 4xH4REs 0.25 kb apart by duplicating the 4xH4RE fragment increased stimulation to > 1000-fold.
- HNF4 ⁇ -induced protein expression by the duplicate 4xH4RE Hnfl or promoter was comparable to a viral promoter. Converting the two Apolipoprotein C3 (ApoC3) H4REs spaced 0.61 kb apart to 4xH4REs achieved a similar result. Increasing spacing to 2.1 kb with non-promoter DNA abolished the augmentation. Converting the HNF l ⁇ RE of the HNF4A (MODYl) P2 promoter to 4xHlRE and adding a second 4xHlRE 0.84 kb upstream increased HNFl ⁇ stimulation from 26-fold to >200-fold. Deleting intervening DNA to produce 0.23-kb spacing increased stimulation to >500-fold. Materials and Methods
- HEK-293 cells were provided by Thomas J. Gardella and were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 units of penicillin and 50 units of streptomycin.
- DMEM Dulbecco's modified Eagle's medium
- Rat INS-I insulinoma cells were grown as recommended (29).
- Hnfl a Because the transcription start site of the mouse Hnfl a gene has not been definitively established (See Figure 7A), the region 692 bp upstream of the ATG codon was incorporated to ensure inclusion of any functional mouse promoter elements (referred to as mHnfl ⁇ 7ATG ).
- Figure 7A Sequence of the mouse Hnfl ⁇ O.7ATG promoter: The 692 nt upstream of the ATG start codon are shown.
- Relevant features include (with respect to the ATG): restriction sites for Stul (aggcct; -310), BIpI (gctnagc; -267), and Nhel (gctagc; -43); H4RE (boxed; -279); and putative transcription start sites for mouse Hnfl ⁇ ("a”; -218; RefSeq: NM_009327), Bach, L, et al.,1990, Genomics, 8:155-164) and human Hra/i ⁇ r("c"; -23; RefSeq: NM_000545), Kuo, C.J., et al., 1990, Proc. Natl. Acad. Sci. U. S.
- FIG. 7B shows the DNA sequences of the oligonucleotides (SEQ. ID. NO: 2 and 3) used to insert 3 additional H4REs (3xH4RE).
- the 3-nt BIpI overhang (TnA) allows for directional insertion of DNA fragments.
- the two complimentary 70-mers were synthesized with unique overhangs to match the Hnfl ⁇ promoter site. Potentially useful restriction sites were also incorporated into the sequence. Nucleotides adjacent to the overhangs were chosen to reconstitute the upstream BIpI site while destroying the downstream site following insertion. This design permits sequential insertion of additional fragments to generate 7xH4RE, 10xH4RE, etc.
- the mHnfl ⁇ 7ATG promoter was modified in two ways. First, additional sets of three H4RE sequences, derived from the two elements found in the human G6Pase gene flanking the element from the human HNFlB gene (TCF2), separated by 9-15 bp (3xH4RE), were sequentially inserted into the BIpI site 8 bp downstream of the native H4RE. The 3-nt BIpI overhang permitted directional insertion of the 3xH4RE duplex and the oligonucleotides were designed to preserve only the BIpI site adjacent to the native H4RE.
- Figure 7C shown the sequence of the mHnfl ⁇ 07ATG4xH4RE promoter with 4 H4REs.
- ApoC3 promoter Several modifications were made to the human ApoC3 promoter (-890/+24), which has two conserved H4REs separated by 607 bp, -70 and -690 from the transcription start site with the proximal H4RE in reverse orientation (31). The proximal element was converted to the forward direction (a). The H4REs were converted to 4xH4RE motifs or segments. The PCR product was digested with Acc65I/NheI and ligated with the proximal element in converted, forward orientation promoter in step (a).
- H4REs were converted to forward 4xH4RE motifs.
- the H4RE is bold and italicized and the restriction enzyme sites are in bold.
- ⁇ IApoc3IAcc65 ⁇ J ⁇ forward primer inserts Kpnl site immediately upstream of the distal H4RE: gagcctggtaccgggaggggcaaaggcc (SEQ. ID. NO: 24 )
- R/Apoc3/BglIUNheIfR reverse primer inserts BgIII site at 3' terminus, converts proximal H4RE from reverse to forward orientation, and creates adjacent Nhel site: aaatttAGATCTAGGAGGGTTCTGACCTGTTTTATATCATCTCCAGGGCAGCAGGCACTGAGGA
- A/7oc3/4xH4RE/Acc651/&iWl/F forward primer converts distal H4RE to a 4xH4RE motif with flanking Kpnl and BsfWI sites: aaattTggtac c AAGC AG ⁇ CCAAAGA ⁇ CATGAATTCAC AATGCCAaAGrTAaCGTACGGC T GAG rCCAAAGTrCAGGTCGAgggaggggcaaaggcctc (SEQ. ID. NO: 10)
- Apoc3/3xH4-RE/NheI/SpeIfR reverse primer inserts three H4REs to create a proximal 4xH4RE motif by ligating into duplicate lxH4RE promoter Nhel site
- PspOMI site and the proximal BpulOI site (codons 35-530).
- HNF4A P2 promoter The native 1.0-kb HNF4A P2 promoter, with one conserved HIRE at -0.15 kb, was initially modified by inserting the HIRE found at -8.41 kb in the HNF4A gene at the 5-prime end to generate a promoter with two HlREs separated by 840 bp
- HNF4A- p2 Dup4xHi/ o 84 ⁇ ⁇ his promoter was further modified in several ways.
- 0.61 kb of DNA adjacent to the distal motif was deleted to create a 226-bp spacer (HNF44-P2 Dup4xH1/023 ).
- the distal 4xHlRE was deleted from this promoter, followed by sequential removal of proximal
- HNF4A-P2 Dup2xm/021 promoter was constructed from HNF4A-P2 Du ⁇ xm/0 84 by deleting two HlREs and adjacent DNA from each motif.
- a human HNF4A P2 promoter fragment (- 1013/- 11 ) was cloned by PCR and ligated into pGL3-Basic using incorporated Sad and Xhol sites (native 1.0-kb promoter).
- Putative HIRE located at -8,410 bp was incorporated into the 5 -prime end of the native promoter, creating a promoter with duplicate IxHlRE separated by an 840-bp spacer.
- HlREs were converted to forward 4xHlRE motifs to create a duplicate 4xHlRE promoter with the same spacing.
- the 4xHlRE motifs were brought closer by removal of the 610-bp
- Upstream 4xHlRE distal HIRE - human ⁇ l-AT - human ⁇ -fibrinogen - human albumin
- Downstream 4x ⁇ lRE human albumin - human ⁇ l-AT - human ⁇ -fibrinogen - proximal HIRE
- HNF4a-V2 Promoter KpnVSacI to Xhol fragment is shown in Fig. 9A (SEQ.
- fflVF4 ⁇ -P2 Dup4xH1RE Promoter Sequence Restriction endonuclease deletions are as follows. Deletion of Dup4xHlRE between BsrGl (tgtaca; -0.99, & PfMl (ccannnntgg; -
- Nhel (gctagc; -0.19) gives Dup2xHlRE with 0.27 -kb spacing.
- HNF4a-P2 Dup4xmRE Promoter Sequences are shown in Fig. 9C and 9D (SEQ. ID.
- CMV promoter The CMV-IE (immediate early) promoter was excised from pcDNA3.1 (Invitrogen) and inserted into pGL3-Basic to assess its activity in comparison to modified native promoters.
- CMV expression plasmids Plasmid pcDNA3.1 (INVITROGENTM) was used for all expression plasmids. Vectors for HNF4 ⁇ variants were described previously (30, 32). HA- tagged rat HNF4 ⁇ 3 (rHNF4oc3 HA ) was constructed by fusing two hemagglutinin epitopes to the C-terminus of the rat HNF4 ⁇ 3 sequence.
- HA-tagged rat HNF4a3 (rHNF4a3 H ⁇ ): Two copies of the HA epitope
- YPYDVPDYA (SEQ. ID. NO: 26)
- the reverse primer contained this coding sequence between an Xbal site and the C-terminus of HNF4 ⁇ 9.
- Amplification with this primer and an exon 7 forward primer generated a product from which an EcoNI (exon 8) / Xbal fragment could be used to HA-tag any exon 8 + variant.
- EcoNI I Xbal fragment was used to convert the HNF4 ⁇ l coding sequence in pcDNA3.1 (Huang, J., et al., 2008, Diabetes Metab. Res.
- Augmented promoter expression plasmids The human HNFloc coding sequence was excised from pcDNA3.1 with Pmel and Xbal and inserted between the Ncol (blunt-ended) and Xbal sites of the pGL3 plasmid, replacing the Luciferase gene (mHnfl ⁇ P ⁇ /hHNFl ⁇ ). Similarly, the rHNF4 ⁇ 3 HA coding sequence was excised from pcDNA3.1 with HincHII and Xbal and fused to the HNF4A-P2 Ou ⁇ xm/023 promoter.
- Human HNFIa Fusion of the human HNFl ⁇ cDNA to the mHnfl «D UP4XH4RE promoter: The cDNA was excised from the pcDNA3.1 vector using Pmel (blunt-end) and Xbal and inserted into pGL3-mHnfl ⁇ P uP4XH4RE m place of the Luciferase gene between the blunt- ended Ncol site and Xbal. Note that the pGL3 ATG start codon is reconstituted but that this codon is in frame with the ATG start codon of the inserted HNFl ⁇ cDNA. ATG are in bold in the sequences below.
- GTTTAAACTTAAGCTT pcDNA PmeVHindlll (SEQ. ID. NO: 31) This is the pcDNA3.1+ multiple cloning site nts 901-916; Pmel blunt cuts between "T” & "A” of "GTTTAAAC.”
- ATG/Pmd/Hmdlll/cDNA (SEQ. ID. NO: 33). This is the he 1st 5 nts are from pGL3-Basic, nts 86-90 of U57024, part of a "CCATGG" Ncol site containing the ATG start codon for the Luciferase gene. When the 5' overhang of the digested Ncol site is filled in with Klenow, the CCATG is fused to AAAC.... of pcDNA3.1+ nts 905 and following that was created by Pmel digestion.
- REAGENT® INVITROGENTM, Carlsbad, CA
- DUAL-LUCIFERASE® Promega
- 24-well clusters to measure protein expression by immunoblotting (see below).
- reporter assays a total of 400 ng DNA was added with 200 ng each reporter plasmid (e. g.
- Anti-HA mouse monoclonal clone 7, specific for human influenza virus hemagglutinin; H3663; Sigma, St. Louis, MO
- Anti- HNFl ⁇ (C-19) sc-6547; Santa Cruz Biotechnology, Inc., Santa Cruz, CA
- Secondary antibodies were goat anti-mouse IgG-HRP (Santa Cruz) and donkey anti-goat IgG-HRP (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA).
- SUPERSIGNAL West Pico Pierce, Rockford, IL
- ATG start codon (30) was modified by inserting up to five sets of three contiguous H4REs into the BIpI site 20 bp downstream of the native H4RE (Fig. IA; Fig. 7B).
- the H4RE sequences were derived from the two human G ⁇ Pase gene elements (-236/-218 and -78/-60 from RefSeq No.: NM_000151) flanking the human HNFlB element (TCF2; -214/-196 from RefSeq NM_000458).
- H4Res were inserted were separated by 9-15 bp which is the nucleotide spacing close to a single helical DNA turn of 10-11 bp (34,35). Promoter activities were assessed by transient transfection in HEK-293 cells with the indicated mHnfl or promoter reporters (200 ng) alone or in combination with the pcDNA-HNF4 ⁇ 3 expression vector (200 ng).
- the native i 07ATG promoter was stimulated 11-fold over baseline but the mHnfl ⁇ xH4RE promoter was stimulated further to 72-fold. Incorporating additional H4RE motifs into a segment containing several H4Res enhanced some promoters but did not guarantee further increase in every promoter activity.
- the mHnfl ⁇ 0xH4RE promoter was enhanced -70% more than mHnfl ⁇ xH4RE (124-fold)
- the mHnfl c ⁇ xl ⁇ 4RE and mHnfl ⁇ 3xH4RE promoters had lower activity (only ⁇ 40-fold) and the mHnfl ⁇ 6xH4RE promoter was less active than the native promoter (7 -fold).
- the useful number of transcription factor repeats is 4-16, in some cases 4-10, in some cases 4, 5, 6 7, 8, 9, 10, 11, 12, 13, 14 or 15 repeats are useful. In some cases the 4-7 repeats provides the best enhancement. In some cases 4-6 and in some cases 4-5 repeats.
- mHnfl cP u ⁇ xmRE promoter was stimulated by >1100-fold, substantially more than for mHnfl ⁇ 1K ⁇ G ( ⁇ 5-fold) or mHnfl ⁇ f xH4RE ( ⁇ 88-fold; Fig. 2B).
- FIG. 7E shows the effects of Stul/Nhel duplication in the native mHnfl a promoter:
- the Stul/Nhel fragment was duplicated in the native promoter to generate mHnfl ⁇ P uPlxH4RE Tj 16 activity of this promoter was compared to the native promoter and 4xH4RE promoters in HEK-293 cells using Dual Lucif erase.
- HNF4a-dependent ApoC3 promoter Activity of the HNF4a-dependent ApoC3 promoter is enhanced by insertion of non-adjacent 4xH4RE motifs
- HEK-293 cells were transiently transfected with the indicated AproC3 promoter reporters (200 ng) alone or in combination with the pcDNA-HNF4a3 expression vector (200 ng).
- HNF4a3 stimulated the native promoter by ⁇ 56-fold and ApoC? Dup4xH4RE/061 by >1400-fold in HEK-293 cells (Fig. 3B).
- the distal P2 promoter of the human HNF4A gene was modified.
- the P2 promoter which is -45 kb upstream of the proximal Pl promoter (36-38) and controls preferential expression of several HNF4 ⁇ variants in the pancreas (39), is HNFl -dependent with a well-characterized HIRE at -0.17 kb (40).
- a 1.0-kb fragment (-1,013/-1I) was cloned into pGL3-Basic.
- both HlREs were converted to 4xHlRE motifs (Hnf4a- p2 Dup4xHi/ o 84 ⁇ ⁇ his promoter was ffurr modified in several ways.
- 0.61 kb of DNA adjacent to the distal motif was deleted to create a 226-bp spacer (Hnf4a-P2 Du ⁇ xm/023 ).
- This promoter was further modified by deleting the distal 4xHlRE, followed by sequential removal of HlREs from the downstream motif.
- Hnf4a-P2 Dup2xm ' 027 promoter was constructed from Hnf4a-P2 Oa ⁇ xm/0 84 by deleting two HlREs and adjacent DNA from each motif.
- B Promoter activities: HEK-293 cells were transiently transfected with the indicated mHnfl or promoter reporters (200 ng) alone or in combination with the pcDNA-HNF4a3 expression vector (200 ng).
- HNFl ⁇ stimulated the P2 DUP4XH1RE/0 84 promoter ⁇ 180-fold, about 7 times more than the native promoter (26-fold; -3% vs. CMV), and the P2 DUP4XH1RE/023 promoter by almost 500-fold (Fig. 4B; -8% vs. CMV).
- transcription factor response elements are 9-15 bp apart, and wherein the segments are about 200-700 base pairs apart.
- the transcription factor elements are organized in forward orientation with respect to the transcription start site.
- HNF4A P2 promoters In contrast to the HNF4 ⁇ -responsive promoters, most modified HNF4A P2 promoters exhibited modest constitutive activity in HEK-293 cells, i.e. independent of co- expressed HNFl ⁇ . This constitutive activity was 4-fold for the native promoter and ranged from 1.5-fold for the single 4xHlRE promoter to a high of ⁇ 30-fold for the duplicate 2xHlRE promoter. Nevertheless, the consistently high induction ratios with HNFl ⁇ (9.5 to >40) indicate that responsiveness to this factor was retained.
- Augmented promoters generate detectable amounts of functional transcription factors [0230] To test whether augmented promoters are sufficiently active to generate detectable protein levels with measurable activities, each promoters was fused to coding sequences of their cognate transcription factors: human HNFl ⁇ to mHnfl ⁇ P uP4xH4RE an d HA- tagged rat HNF4a3 (HNF4a3 HA ) to fflVF44-P2 Dup4xH1RE (Fig. 5A & 5B, upper).
- HEK-293 cells were transiently transfected with the mHnfl cP up4xmRE /HNFl a plasmid with or without the pcDNA-rHNF4a3 expression vector.
- Whole cell protein was extracted 48 h later to assess HNFIa expression by immunoblotting (pcDNA-HNFla, positive control).
- HNF4A- P2 Du ⁇ xmRE /HNF4a3 HA gene cassette the coding sequence of rat HNF4a3 was fused to the augmented P2 promoter.
- HEK-293 or INS-I cells were transiently transfected with the HNF4A- P2 Dup4xmRE /HNF4a3 HA plasmid and, where indicated, the pcDNA-HNFla expression vector.
- Whole cell protein was extracted 48 h later to assess HNF4a3HA expression by immunoblotting for the HA tag (pcDNA-HNF4a3 HA , positive control). The numbers above the histogram indicate/? values between activities.
- the HA tag enabled detection of ectopic HNF4a3 in the presence of endogenous or transiently expressed HNF4 ⁇ 3.
- the HNF4cc3 HA minigene exhibited HNFl ⁇ -dependent HNF4 ⁇ 3 HA expression in HEK-293 cells (using its HA epitope tag; Fig. 5B, lower; arrow).
- the augmented P2 promoter is constitutively active in INS-I cells (see below) and, consequently, the HNF4 ⁇ 3 HA minigene produced protein without exogenous HNFl ⁇ expression Fig. 5B, lower; arrows).
- HNFl ⁇ and HNF4 ⁇ 3HA are functional, their abilities to activate reporters for their target promoters in HEK-293 cells were examined.
- the mHnfl ⁇ Dup4xH4RE reporter was markedly stimulated by HNF4 ⁇ 3 (Fig. 5C).
- HNFl ⁇ produced a modest but insignificant stimulation while the HNF4A- p2 Dup4xHiRE /HNF4a3 HA gene cassette had no effect
- the mHnfl ⁇ Dup4xH4RE promoter was significantly stimulated by the combination of HNFl ⁇ and the HNF4A- P2 Dup4xH1RE /HNF4a3 HA gene cassette.
- Enhanced promoter activities are also observed in rat INS-I ⁇ cells
- the augmented promoters were developed based on their activities in heterologous HEK-293 cells. Thus, it was important to assess how modified promoters behaved in a ⁇ cell line that normally expresses HNFl ⁇ and HNF4 ⁇ .
- Rat INS-I ⁇ cells were chosen because they exhibit glucose-dependent insulin secretion (29) and can offer a model for enhancing this property using augmented promoters to express ⁇ -cell transcription factors.
- HNFl ⁇ and HNF4 ⁇ the promoters were tested in rat INS-I ⁇ cells.
- Reporter plasmids were transiently transfected into INS-I cells with or without co-transfected pcDNA-HNF4a3 expression vector. Normalized luciferase activities are expressed relative to that of blank pGL3- Basic.
- mHnfl or promoter is not constitutively active in INS-I cells, but is but is responsive to ectopically increased expression of HNF4 ⁇ (30).
- HNF4A P2 promoters were constitutively active in INS-I cells
- FIG. 6D These constitutive activities cells were similar to HNF4 ⁇ -induced activities in HEK- 293 cells (Fig. 4B) except for the low activity of the HNF4A-P2 Oup2xmRE/027 promoter. Co- expression of HNF4 ⁇ modestly increased promoter activities from 10% to 3-fold except for fflVF44-P2 Dup4xH1RE/0 84 , which was inhibited by 50%. Discussion
- the inventors have developed a strategy to substantially exponentially enhance native promoter activity by amplifying responsiveness to a crucial transcription factor and particularly by using spacers of about 200-700 bp between groups of multi-copy REs.
- tandem RE arrays have been used, under the premise that adjacent elements cooperate in activating transcription (41), their ability to increase promoter activity may be inherently limited.
- REs is very effective in boosting native promoter activity. Specifically, HNF4 ⁇ induction was increased >200-fold over the native mouse Hnfl ⁇ promoter by engineering a 4xH4RE motif, then duplicating the fragment containing this motif to obtain duplicate motifs 0.25 kb apart (See Fig. 2B).
- the enhanced promoter could drive inducible readily detectable protein expression following transient transfection (See Fig. 5).
- Hnfl ⁇ and HNF4A P2 promoter both drove readily detectable expression of cognate proteins, of which HNFl ⁇ was capable of activating target promoters. Accordingly, the same strategy can be applied to many native gene promoters could be modified for use in gene therapy.
- H4REs were inserted into the native Hnfl or promoter to activate it beyond the generally observed range of 10- to 50-fold.
- enhancement reached an apparent plateau with the 10xH4RE promoter and additional elements were ultimately counterproductive.
- separating two 4xH4RE motifs by several hundred base pairs, preferably not exceeding 700 bp led to synergistic activation.
- the ineffectiveness of duplicating the native lxH4RE fragment to create duplicate lxH4REs separated by the same DNA demonstrated that a repeat of H4Res, namely, 4xH4RE motif was important to the enhancement. This conclusion was further supported by exclusion of the nearby Nkx-2.2 site as the active component in the duplication.
- the data indicate that the introduction of a DNA spacer between two multi-copy motifs or segments was the major factor in augmenting promoter activity and was distinctly superior to introducing additional RE copies alone, based on number of fold increase in reporter gene expression.
- HNF hepatocyte nuclear factor
- LFB1/HNF1 acts as a repressor of its own transcription. Nucleic Acids Res., 22:4284- 4290.
- Hepatocyte nuclear factor Ia a key mediator of the effect of bile acids on gene expression. Hepatology, 37:622-631.
- HNF hepatocyte nuclear factor
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
We describe methods and DNA constructs / engineered mammalian promoters to enhance native promoter activity while retaining inherent regulation by inserting multi-copy response elements (REs) into non-adjacent locations. Multiple copies of REs are clustered in a group forming a transcription factor response element segment. The segment is at least duplicated in tandem upstream of the ATG start codon. Spacers of 0.2-0.7 kilo base pairs are introduced between the two segments and smaller spacers of about between 9-15 bp are introduced between the copies of REs within a segment.
Description
ENHANCED ENGINEERED NATIVE PROMOTERS AND USES THEREOF
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims benefit under 35 U.S.C. § 119(e) of the U.S. provisional application No. 61/184,475 filed June 5, 2009, the contents of which are incorporated herein by reference in its entirety.
BACKGROUND OF INVENTION
[0002] Expressing genes of interest in cells or tissues for therapeutic purposes often entails driving transcription with strong viral or constitutive promoters. However, such methods can lead to some undesired consequences. For example, tumorigenic transformation can occur in the transfected target cells from unregulated expression of potentially oncogenic cell conversion factors (1) or insertional mutagenesis by retroviral vectors (2, 3).
[0003] One solution is to incorporate some synthetic regulatory elements into the therapeutic constructs and this method has confers some control (4). However, this method also increases the system complexity and may require pharmaceutical agents to modulate promoter activity.
[0004] Another method is to assimilate appropriate regulatory elements to retain innate responsiveness of the engineered genes. Since transcription is a fundamental mechanism for controlling gene expression, incorporating naturally occurring regulatory elements can be useful in increasing fidelity and safety of engineered genes. For most eukaryotic genes, the majority of the information necessary for recapitulating developmental and spatial expression resides in the proximal promoter which can be a few hundred base-pairs (bp) long. However, endogenous transcriptional activity is difficult to achieve in engineered vectors with promoter fragments lacking their genomic context and distal elements. For instance, expression of genes linked to the β-globin promoter can achieve levels comparable to the endogenous promotor but requires inclusion of the β-globin locus control region, an extended enhancer located at an ectopic chromatin site (7, 8). Other promoters rely on similar compact distal enhancers (9) but locus control regions are unique and gene specific.
[0005] Several other strategies have been employed to enhance transcriptional activities of native promoters while retaining (or engineering) innate regulation: use of larger promoters (10), duplicating positive response elements (RE) (11) or more complex promoter fragments (12,13), fusing distal (14) or ectopic enhancers (15), and binary amplification systems (16). Appropriate targeting and responsiveness is theoretically possible by combining cis elements into "designer promoters" (17). For single response elements, highly inducible promoters have
been constructed from a minimal TATA box by fusing multiple binding sites for hypoxia- inducible factor (HIF) binding sites with optimal spacing of orientation to achieve hypoxia responsiveness (18) or 7 T-cell factor / lymphoid enhancer-binding factor (TCF/LEF) binding sites to achieve a β-catenin responsiveness (19).
[0006] However, attempts to achieve endogenous transcriptional activities from native mammalian promoters have not been as successful. New or significantly improved approaches are necessary to make native or synthetic promoters widely useful for genetic engineering in humans and other mammals.
SUMMARY OF THE INVENTION
[0007] The disclosure relates to methods and DNA constructs for engineered promoters for enhancing gene expression.
[0008] The invention is based on the surprising finding that one can significantly enhance native promoter function by arranging several transcription factor response elements in tandem with a specific spacing between them to form segments of transcription factor elements. Moreover, the transcription can be further enhanced by including at least two of such segments in the promoter region of the gene. Use of the presently described engineered promoters allows one to avoid using viral promoters and yet results in enhanced expression of the genes thus providing a significant improvement for any mammalian gene expression system either in vivo or in vitro.
[0009] Specifically, in one embodiment, the present disclosure provides an engineered
DNA construct for increasing gene expression from a transcription factor (TF) dependent promoter comprising at least one transcription factor response element (TFRE) segment, wherein the segment comprises between four and 16 consecutive TFREs, wherein each of the TFRE is separated by about 9 to 15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) for one transcription factor (TF).
[0010] In one embodiment, the disclosure herein provides a modified promoter comprising at least one transcription factor response element (TFER) segment, wherein the TFRE segment comprises 4-16 TFREs, wherein all of the TFREs are response elements (REs) of one transcription factor (TF) native to a promoter, , wherein each of the 4-16 TFREs are separated by 9-15 base pairs (bp).
[0011] In one embodiment, provided herein is a method of enhancing expression of a gene comprising operably linking the gene to an engineered promoter forming a gene expression construct, wherein the engineered promoter comprises at least one transcription factor response element (TFER) segment, wherein the TFRE segment comprises four to 16 TFREs; wherein all
of the TFREs are response elements (REs) of one transcription factor (TF), and wherein each of the TFRE is in forward orientation, and wherein each of the four to 16 TFREs are separated by 9- 15 base pairs, and wherein the at least one TFER segment is inserted upstream (5') of the ATG start codon of the gene.
[0012] In one embodiment, provided herein is a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) operably linking the engineered DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (c) transducing a host cell with the gene expression construct.
[0013] In one embodiment, the disclosure herein provides a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) engineering a second DNA construct to further comprise at least two TFRE segments of step (a), wherein the TFRE segments are separated by 200-700 base pairs; (c) operably linking the engineered second DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (d) transducing a host cell with the gene expression construct.
[0014] In one embodiment, provided herein is a method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences, wherein each of the TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; and (c) operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the gene regulated by
transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
[0015] In one embodiment, provided herein is a method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences, wherein each of the
TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; (c) engineering a second DNA construct to further comprise at least two TFRE segments, wherein the TFRE segments are separated by 200-700 base pairs; and (d) operably linking the engineered second
DNA construct upstream (5') of the ATG start codon of the gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
[0016] In some embodiments, the promoters can be mammalian or non-mammalian promoters. Examples of human promoters are the human U6, Hl and tRNA promoters. In other embodiments, the promoters can be a synthetically made promoter made of parts from many non-related sources, much like a chimeric promoter.
[0017] In some embodiments, the TFREs are in forward configuration, forward direction or forward orientation. In some embodiments, the TFREs are in reverse configuration, reverse direction or reverse orientation. In other embodiments, the TFREs in a segment have a mixed forward and reverse orientation.
[0018] In some embodiments, the genes do no express proteins but rather express RNA that are utilized by the cell, e. g. for pre-microRNA, ribosomal and transfer RNA.
[0019] In some embodiments, the engineered DNA construct, modified promoter or engineered promoter described herein is a gene expression construct.
[0020] In one embodiment of the methods, engineered DNA construct, modified promoter or engineered promoter described herein, the gene expression construct is further transduced into a host cell.
[0021] In one embodiment, the host cell is selected from a group consisting of hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes,
myocytes, and muscle cells. In some embodiments, the host cells can be a stem cell. For example, adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc. In other embodiments, the host cells can be any cell within the body of an organism, e.g. when a gene therapy vector or construct is used. In other embodiments, the host cells can be the type of cells used for the bioprocess production of commercial therapeutic biologies, e. g. therapeutic antibodies, proteins and peptides. For example, Chinese hamster ovary (CHO) cells and mouse myeloma cells. In other embodiments, the host cell is a cell selected from Tables 1-4.
[0022] In one embodiment, the expression of the gene is in vivo.
[0023] In one embodiment, the expression of the gene is in vitro.
[0024] In one embodiment, the engineered DNA construct described herein is operably linked upstream (5') of an ATG start codon of a gene that is operably linked to a TF dependent promoter.
[0025] In one embodiment, the engineered DNA construct, modified promoter or engineered promoter described herein comprises at least two TFRE segments, wherein the two
TFRE segments are separated by 200-700 bp.
[0026] In one embodiment, at least one TFRE of the TFRE segment is the native to the promoter of the gene
[0027] In one embodiment, the engineered promoter or modified promoter is derived from a native promoter of the gene. In one embodiment, the gene is a mammalian gene.
[0028] In one embodiment, the mammalian promoter is selected from a group consisting human, mouse, rat, non-human primate (e.g. monkey, baboon, ape, and chimpanzee), dog, and hamster. In one embodiment, the mammalian promoter is a non-human promoter, e. g. mouse, rat, non-human primate (e. g. monkey, baboon, ape, and chimpanzee), dog, and hamster. In one embodiment, the mammalian promoter is a human promoter.
[0029] In one embodiment of the methods, the engineered DNA construct, modified promoter or engineered promoter described herein, the TFRE is for a TF selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic helix-loop-helix
(bHLH), basic-leucine zipper type (bZIP), winged helix type, zinc binding type, and heat-shock type TFs.
[0030] In one embodiment, the TF is a homeo-domain type TF. In one embodiment, the homeo-domain type TF is a hepatocyte nuclear factor 1 alpha (HNFlA) or (HNFlα) TF.
[0031] In one embodiment, the TF is a nuclear hormone receptor type TF. In one embodiment, the nuclear hormone receptor type TF is a hepatocyte nuclear factor 4 alpha
(HNF4A) or (HNF4α).
[0032] In one embodiment, provided herein is a vector comprising an engineered DNA construct, engineered promoter or modified promoter construct described herein. In one embodiment, the vector is a gene therapy vector or a vector adapted for gene therapy. [0033] In one embodiment, provided herein is a cell comprising a vector of any one embodiments of the engineered DNA construct, engineered promoter or modified promoter construct described herein. Definitions
[0034] As used herein, the term "native" as in "native promoter" refers to a promoter that is naturally and/or originally present in a cell and it is typically designated for the expression of a particular gene. In one embodiment, "native promoter" is encoded in the natural original genome of the cell. In one embodiment, no extra ordinary measures have been taken by another organism to insert the promoter artificially into the cell. A non-native promoter would be a promoter is not originally present in a cell and it has been inserted artificially into the cell. In one embodiment, a non-native promoter of a gene is one that that is not naturally associated with the gene. For example, the mouse hepatocyte nuclear factor lα Dup4xH4RE (Hnfl a Du P 4xH4RE^ promoter was Operably linked with a human hepatocyte nuclear factor 1 alpha (HNFl alpha) cDNA. The Hnfl cPup4xlϊ4RE is a non-native promoter.
[0035] As used herein, "the native response element (RE)" or the "native promoter
(RE)" refers to the RE that is naturally present in the promoter DNA sequence. For example, the human apolipoprotein C3 (ApoC3) gene is expressed from a HNF4 alpha (HNF4A) transcription factor dependent Apo C3 promoter which has two REs for HNF4A. The two REs for HNF4A (H4RE) are the native RE of the ApoC3 promoter. Likewise, the hepatocyte nuclear factor 1 alpha (HNFlA) transcription factor dependent human HNF4A P2 promoter has one RE for HNFlalpha (HIRE). The HIRE in the native RE of the human HNF4A P2 promoter. [0036] As used herein, the term "fragment" as in "promoter fragment" refers a part or portion of the promoter sequence that is in the genome.
[0037] As used herein, the term "forward direction", "forward orientation" or "forward configuration" with respect to a response element DNA sequence in a promoter refers to the orientation of the DNA sequence. It is typically the most common orientation of that family/class of RE with respect to the transcription start site on the sense strand of DNA of the gene or with respect to the direction of transcription of the associated gene. For example, the most common orientation and therefore the consensus binding site sequence for the TATA- binding protein (TBP) is TATAAAA. This is in forward direction. TTTTATA is the reverse or backward direction. Regardless of the orientation of the transcription factor response element
(TFRE), transcription factors generally still bind to their respective TFRE and are able to activate and stimulate gene expression.
[0038] As used herein, the term "chimeric" with reference to the mini gene cassettes or promoters described herein refers to being composed of DNA sequences from different origins. For example, the Hnfl ctrDup4XH4RE/HNF4cc3HA mini gene is composed of the HNF4α3 gene (cDNA) translationally fused a DNA sequence encoding the HA-tag at the C-terminus of HNF4oc3. The promoter DNA sequence for transcribing the chimeric gene HNF4α3HA is composed of mouse Hnfl or promoter sequence and eight H4REs of different genes, e. g. from mouse Hnfl a, human G6Pase (located on Chromosome 17 at -236/-218 and -78/-60 from RefSeq: NM_000151) and human HNFlB (TCF2) genes (located on Chromosome 17 (Chl7)at- 214/-196 from RefSeq: NM_000458; the negative numbering is with respect to the first nucleotide in the RefSeq and is to the left of that first nucleotide on the chromosome . The RefSeq provides the transcribed sequence from the gene and represents the putative transcriptional start site on the chromosome).
[0039] As used herein, the term "chimeric minigene cassette" with reference to the mini genes described herein refers to a expression gene being composed of DNA sequences from different origins, the DNA sequences each having different functions within the gene (e. g. transcriptional regulatory, ribosome binding, promoter sequences etc), and the chimeric minigene cassette has all the necessary sequences to expresse the gene within, and it expresses a single gene product, e. g. a protein. For the Hnfl αrDup4XH4RE/HNF4cc3HA minigene cassette, the HNF4oc3HA protein is expressed. The different DNA sequences are operably linked to the gene. [0040] As used herein, the term "upstream" is used in reference to a DNA sequence with respect to a specific site on a DNA sequence. It indicates that the DNA sequence to the left side of the specified site wherein the DNA sequence is oriented in a 5' to 3' direction. An example of a specific site of reference is the ATG start codon in a gene. Typically, the specific site is numbered as "one" and upstream location of the DNA sequence with respect to the specific site is numbered in the negative, e. g. -213 nt or bp of the specific site. Another example of a specific site of reference is the transcription start site of the gene. Typically, the specific site is numbered as zero and upstream location of the DNA sequence with respect to the specific site is numbered in the negative, e. g. -213 nt or bp of the transcription start site of the gene. For example, the RE of the human G6Pase gene is located on Chromosome 17 at -236/-218 and -78/-60 from RefSeq: NM_000151. The RefSeq provides the transcribed sequence from the gene and represents the putative transcriptional start site of the human G6Pase gene on the chromosome. This putative
transcriptional start site is numbered as "one" or +1. Therefore, the RE of the human G6Pase gene is located -236/-218 and -78/-60 from this +1 start site on the chromosome.
[0041] As used herein, the term "nucleotide" is abbreviated "nt".
[0042] As used herein, the term "base-pair" is abbreviated "bp".
[0043] In the context of the engineered DNA constructs, engineered promoter and modified promoters wherein the transcription factor response element (TFRE) are separated by
9-15 bp, or when the TFRE segments are separated by 200-700 bp, it is understood that the engineered DNA constructs, engineered promoter and modified promoters comprise double
DNA sequences and the nucleotides on one strand are base paired with those on the corresponding strand in the standard Watson and Crick base pairing. In the occasion when single-stranded DNA sequences are used, e. g. in PCR primers, one skilled in the art would recognize then that the TFRE would be separated by 9-15 nt or 200-700nt.
[0044] As used herein the term "comprising" or "comprises" is used in reference to DNA sequence and methods, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.
[0045] As used herein the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
[0046] The term "consisting of" refers to DNA sequence and methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0047] The term "gene" or "coding sequence" means the nucleic acid sequence which is transcribed (DNA) and translated (mRNA) into a polypeptide in vitro or in vivo when operably linked to appropriate regulatory sequences, e. g. transcription factor response elements (TFRE).
The gene may or may not include regions preceding and following the coding region, e.g. 5' untranslated (5'UTR) or "leader" sequences and 3' UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons). In one embodiment, a gene refers to a complementary DNA (cDNA) that is derived from a messenger
RNA (mRNA) of the gene.
[0048] As used herein, "identity" means the percentage of identical nucleotide at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in Computational
Molecular Biology, Lesk, A. M., Oxford University Press, New York, 1988. Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs such as BLASTP.
[0049] The terms "identical" or percent "identity", in the context of two or more nucleic acid sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection. Such sequences are then said to be "substantially identical." This term also refers to, or can be applied to, the complement of a DNA sequence or a messenger RNA (mRNA). The term also includes sequences that have deletions and/or additions, as well as those that have substitutions.
[0050] As used herein, the term "DNA sequence" refers to any nucleic acid molecule, preferably a polymeric molecule, incorporating units of deoxyribonucleic acid. The nucleic acid can be either single-stranded or double- stranded. "DNA sequence", "polynucleotide molecule" and "nucleic acid" are use interchangeably.
[0051] The term "operably linked" means generally that the regulatory elements and promoter in a DNA sequence or nucleic acid construct are in-frame with a nucleic acid coding sequence for a protein or peptide. Accordingly, the term typically refers to an arrangement wherein the first polynucleotide molecule is connected with the second transcribable polynucleotide molecule, such as a gene of interest, where the polynucleotide molecules are so arranged that the first polynucleotide molecule affects the function of the second polynucleotide molecule. Preferably, the two polynucleotide molecules are part of a single contiguous polynucleotide molecule and more preferably are adjacent. For example, a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the gene of interest in a cell.
[0052] As used herein, the phrase "transcribable polynucleotide molecule" refers to any polynucleotide molecule capable of being transcribed into a RNA molecule. Methods are known for introducing constructs into a cell in such a manner that the transcribable polynucleotide molecule is transcribed into a functional mRNA molecule that is translated and therefore expressed as a protein product. Constructs may also be constructed to be capable of expressing
antisense RNA molecules, in order to inhibit translation of a specific RNA molecule of interest. For the practice of the present invention, conventional compositions and methods for preparing and using constructs and host cells are well known to one skilled in the art. [0053] As used herein, the term "promoter" refers to a polynucleotide molecule that in its native state (i. e. as is naturally in the genome of an organism) is located upstream or 5' to a translational start codon of an open reading frame (or protein-coding region) or the transcription start site and that is involved in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription. Generally, a promoter is used as a 5' regulatory element for modulating expression of a particular gene or genes operably associated or linked thereto. When operably linked to a transcribable polynucleotide molecule, a promoter typically causes the transcribable polynucleotide molecule to be transcribed in a manner that is similar to that of which the promoter is normally associated. A "core basic promoter" is one that will transcribe any transcribable polynucleotide molecule that is operably linked to it. Transcription takes place as long as the transcription machinery (ribosome etc) and raw materials for transcription (RNAs) are available. In one embodiment, the transcription for a "core basic promoter" is on all the time or constitutive. In some embodiments, the "core basic promoter" can comprise addition transcription factor (TF) response elements (TFRE) and/or enhancer elements (collectively known as regulatory elements) that allow the transcription of the transcribable polynucleotide molecule to be regulated. The regulation is by the presence or absence of transcription factors or enhancers binding to the elements comprising the promoter. For examples, transcription only occurs in the presence of the factor or transcription is further increased in the presence of the enhancer. Promoter databases and computer softwares are available for predicting the location of promoter sequences of genes in the genome of an organism, e. g. at Wormbase, the Cold Spring Harbor Laboratory, Molbio-Tools, Weizmann Institute of Science and Wellcome Trust Sanger Institute. One of ordinary skill in the art would be able to identify and/or locate promoter sequences of genes of interest using these and other methods/tools known in the art.
[0054] A transcription factor (TF) (sometimes called a sequence- specific DNA binding factor) is a protein that binds to specific DNA sequences and thereby controls the transfer (or transcription) of genetic information from DNA to mRNA. TFs perform this function alone or with other proteins in a complex, by promoting (as an activator), or blocking (as a repressor) the recruitment of RNA polymerase (the enzyme that performs the transcription of genetic information from DNA to RNA) to specific genes. The specific DNA sequences to which a TF
binds is known as a response element (RE) or regulatory element. Other names include cis- element and cis-acting transcriptional regulatory element.
[0055] Transcription factors (TFs) are classified based on many aspects. For example, the secondary, tertiary and quaternary structures of the protein structures DNA-binding sequence and properties, the interaction with the double helix of the DNA, and the metal and other binding characteristics. TFs are grouped into superclasses which are then divided into classes which are further divided into families and subfamilies. Databases of TFs are available at the World Wide Web at several websites, e. g. BIOBASE Gene Regulation (TRANSFAC® 7.0 Public 2005), the Ohio State University AtTFDB - Arabidopsis transcription factor database, TFSEARCH, and the RIKEN Genomic Sciences Center (GSC) in Japan. The major superclass: basic domains, zinc-coordinating DNA-binding domains, helix-turn-helix, beta-Scaffold Factors with minor groove contacts, and other transcription factors. The major classes are leucine zipper factors (bZIP), helix-loop-helix factors (bHLH), Helix-loop-helix / leucine zipper factors (bHLH-ZIP), NF-I, RF-X, bHSH, Cys4 zinc finger of nuclear receptor type, Cys4 zinc finger of nuclear receptor type, Cys2His2 zinc finger domain, Cys6 cysteine-zinc cluster, Homeo domain, Paired box, Fork head / winged helix, heat shock factors, tryptophan clusters, Ets-type, RHR (ReI homology region), STAT, p53, MADS box, beta-Barrel alpha-helix transcription factors, TATA-binding proteins, HMG, Heteromeric CCAAT factors, Grainyhead, Cold- shock domain factors, Copper fist proteins, HMG (high mobility group), Pocket domain, ElA-like factors, AP2/EREBP-related factors, EREBP and AP2/B3.
[0056] As used herein, the term "response element" (RE) refers to the DNA sequence to which a transcription factor binds to and confers an aspect of control of gene expression. A RE binds transcription factors, trans-acting protein factors that regulate transcription. Some REs bind more than one transcription factor, and transcription factors may interact with different affinities with more than one RE. The modified promoters of the present invention desirably contain REs that can enhance gene expression. REs can be identified by a number of techniques known in the art, including deletion analysis, i.e., deleting one or more nucleotides from the 5' end or internal to a promoter; DNA binding protein analysis using DNase I footprinting, methylation interference, electrophoresis mobility- shift assays, in vivo genomic footprinting by ligation-mediated PCR, and other conventional assays; or by DNA sequence similarity analysis with known cis-element motifs by conventional DNA sequence comparison methods. In some embodiments, the RE sequences are palindromes. Generally, RE sequences are orientated in the forward or the reverse direction, and the respective transcription factors will bind their respective RE regardless of the orientation. Examples of some native REs for use with the
methods, engineered DNA constructs, engineered promoters, modified promoters are show in Tables 1-6 which provide the native genes and their respective RE, the gene reference (RefSeq) number in the public GENB ANK™, the location of the native RE on the native promoter/gene, the sequence of the REs, and the cells for expressing the respective genes using the methods, engineered DNA constructs, engineered promoters, modified promoters described herein. In the tables 1-4 and 6, and described herein, the RefSeq provides the transcribed sequence from the gene and represents the putative transcriptional start site of the respective gene on the respective chromosome. This putative transcriptional start site is numbered as "one" or +1. The negative numbering of the RE means that the RE is on the left side or upstream of the +1 of the gene's putative transcriptional start site location on the chromosome.
[0057] Transcription factors interact with their binding sites or RE using a combination of electrostatic (of which hydrogen bonds are a special case) and Van der Waals forces. Due to the nature of these chemical interactions, most transcription factors bind DNA in a sequence specific manner. However, not all bases in the transcription factor-binding site may actually interact with the transcription factor. In addition, some of these interactions may be weaker than others. Thus, transcription factors do not bind just one sequence but are capable of binding a subset of closely related sequences, each with a different strength of interaction. The closely related sequences have a core RE binding motif. For example, although the consensus binding site for the TATA-binding protein (TBP) is TATAAAA, the TBP transcription factor can also bind similar sequences such as TATATAT or TATATAA. The core RE binding motif is "TATA". For example, the human transcription factor FOXLl is a winged helix-turn-helix / forkhead type TF. It has a core RE binding motif of "ATA" and a consensus sequence of nnnnnATA. The human TF GATA2 and GATA3 are zinc-binding type TFs and they have a core RE binding motif of "GAT". The consensus sequence for GAT A2 is n(G/C)ATn and the consensus sequence for GATA3 is (A/T)GAT(A/T)n. The rat, mouse and human TF CREBl is a basic leucine zipper type TF. It has a core RE binding motif of "TGACGT" and the consensus sequence is (TZGZC)(GZC)A(CZG)(GZA)(TZC)(CZAZT)(AZT). The "n" can be any one of the four standard nucleotide bases A, T, C, G that make up a DNA sequence.
[0058] The JASPAR database and TRANSFAC (TRANSFAC® 7.0 Public 2005) are two web-based transcription factor database on transcription factors, their experimentally-proven binding sites, and regulated genes. Its broad compilation of binding sites allows the derivation of positional weight matrices. Web based research engines for transcription factor binding sites are also available, e. g. Matlnspector, SIB-HTPSELEX Database and TRANSFAC. One can also search for putative TFRE sites in the upstream promoter region of a gene or even within the
gene using search tool such as TFSEARCH, Matlnspector, Transcription Element Search
Software (TESS) from the University of Pennsylvania, and jPREdictor which predicts cis- regulatory elements from Bielefeld University, Germany and other tools known in the art.
[0059] As used herein, the term "responsive" or "stimulated" when used with HNF4α3 or HNFlα and HNF4α3- or HNFlα regulated or dependent gene refers to the increased gene transcription from a promoter that is regulated by these respective transcription factors when the these respective transcription factors are present or provided. The increase is above that seen in the absence of the transcription factors.
[0060] As used herein, the term "enhancing expression of a gene" refers to increasing the level of transcription of the gene; the increase is above the level that is normally seen for transcription from the native promoter of the gene.
[0061] As used herein, the term "transcription factor response element (TFRE) segment" refers to a DNA sequence that comprises TFRE within. In one embodiment, the segment can also comprise other DNA sequences that are not used for transcription of a gene if the gene is operably linked to the segment.
[0062] As used herein, the term "construct" refers to any recombinant polynucleotide molecule such as a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage, or linear or circular single- stranded or double- stranded DNA polynucleotide molecule, derived from any source comprising a polynucleotide molecule where one or more polynucleotide molecule has been linked in a functionally operative manner.
[0063] A "DNA construct" would be a recombinant DNA polynucleotide molecule.
[0064] An "engineered DNA construct" refers to a recombinant DNA polynucleotide molecule that does not exist naturally but is constructed artificially by molecular techniques. In one embodiment, an "engineered DNA construct" comprises DNA sequences of various origins, much like a chimeric DNA polynucleotide molecule.
[0065] An "engineered promoter" refers to an "engineered DNA construct" that can function as a promoter in transcription initiation of a gene that is operably linked to the
"engineered promoter". An example of such is vaHnfl ££DUP4XH4RE described herein (SEQ. ID.
NO: 5).
[0066] A "modified promoter" refers to a native promoter in which some changes have been artificially incorporated within. The changes can include deletion and addition of sequences to the promoter. In some embodiments, the changes are designed to alter the transcription activity of the promoter and thereby affect the expression of the gene that is
operably linked to it. In some aspects, a "modified promoter" can be considered an "engineered promoter".
[0067] The term "vector", as used herein, refers to a nucleic acid construct designed for transfer between different host cells. In one embodiment, a "vector" is referred broadly to any plasmid, phagemid or virus encoding an exogenous nucleic acid. In another embodiment, the term is also be construed to include non-plasmid, non-phagemid and non-viral compounds which facilitate the transfer of nucleic acid into virions or cells, such as, for example, poly-lysine compounds and the like. The vector may be a viral vector that is suitable as a delivery vehicle for delivery of the nucleic acid, or mutant thereof, to a cell, or the vector may be a non-viral vector which is suitable for the same purpose.
[0068] An "expression vector" or expression construct" refers to a vector that has the ability to incorporate and express exogenous DNA fragments in a foreign cell. A cloning or expression vector may comprise additional elements, for example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in human cells for expression and in a prokaryotic host for cloning and amplification. The term vector may also be used to describe a recombinant virus, e.g., a virus modified to contain the coding sequence for a therapeutic compound or factor. As used herein, a vector may be of viral or non-viral origin. Examples of viral and non- viral vectors for delivery of DNA to cells and tissues are well known in the art and are described, for example, in Ma et al. (1997, Proc. Natl. Acad. Sci. U. S. A. 94: 12744-12746). Examples of viral vectors include, but are not limited to, a recombinant Vaccinia virus, a recombinant adenovirus, a recombinant retrovirus, a recombinant adeno-associated virus, a recombinant avian pox virus, and the like (Cranage et al., 1986, EMBO J. 5: 3057-3063; International Patent Application No. W094/17810, 1994; International Patent Application No. W094/23744, 1994). Examples of non-viral vectors include, but are not limited to, liposomes, polyamine derivatives of DNA, and the like. [0069] A "gene therapy vector" refers to an expression vector that is engineered to incorporate and express DNA sequences or gene products (e. g. mRNA or siRNA) in a host cell for the purpose of correcting a defect or deficiency in that cell. In other words, a "gene therapy vector" is an expression vector adapted for transfer and expression of DNA sequences into a host cell for the purpose of correcting a defect or deficiency in that cell or the organism having the host cell. The product from the expressed DNA sequences functions to correct the defect or deficiency or they cam be used for t he treatment of diseases and disorders. For example, there is a deficiency in expression of a particular enzyme in a cell or tissue due to a nonsense mutation in the native gene in the cell. A gene therapy vector is engineered with the correct gene and is
inserted into the cell of the tissue having the defect. Expression from the correct gene in the gene therapy vector will produce functional enzyme, replacing the missing enzyme in the cells and tissue. There are gene therapy vectors for use with animal model experiments that utilize the cytomegalovirus immediate early CMV-IE promoter (e.g. pCI-neo cloning vector CVU47120, nts 1-750). This promoter contains numerous response elements to a variety of ubiquitously expressed TFs (e.g. SPl, AP-I, CREBP, SRF, etc.). The "CAG" promoter, composed of the core chicken beta-actin promoter fused the CMV enhancer, a variation that has been used to express TFs (e.g. Klf4, Oct3/4, c-myc, Sox2) capable of reprogramming somatic cells into "induced pluripotent stem cells" (iPS cells). There are limited studies on identifying the REs responsible for activities of these promoters.
[0070] As used herein, the term "target gene" in a gene that one wants to enhance gene expression is a host cell when an expression vector or a gene therapy vector is transduced, transfected or inserted into the host cell.
[0071] As used herein, a host cell is any cell that is transfected with a vector. In one embodiment, the host cell is selected from a group consisting of hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells. In some embodiments, the host cells are any stem cells, of any species, mammalian or non- mammalian. In one embodiment, the host cell is a human cell. In other embodiments, the host cells are any cell within the body of an organism, e.g. when a gene therapy vector or construct is used. The organism can be of any species, mammalian or non-mammalian, including human. In other embodiments, the host cells are the type of cells used for the bioprocess production of commercial therapeutic biologies, e. g. therapeutic antibodies, proteins and peptides. For example, Chinese hamster ovary (CHO) cells and mouse myeloma cells. In other embodiments, the host cell is a cell selected from Tables 1-4.
BRIEF DESCRIPTION OF THE DRAWINGS
[0072] Figure IA shows a schematic of the modification of the native mHnfl or promoter and 5-prime UTR (692 bp upstream of the ATG start codon) by inserting additional H4REs in increments of three immediately downstream of the native H4RE. The arrow indicates the transcription start site (not to scale).
[0073] Figure IB shows the effect of increasing the number of adjacent H4REs on mHnfl or promoter activity in the reporter plasmid pGL3 transfected into HEK-293 cells.
[0074] Figure 2A shows the schematic of duplicating the Stul/Nhel fragment containing the 4xH4RE motif to generate mHnfl βPuP4xH4RE Tj16 transcription start site (arrow) corresponds to its position in the human promoter.
[0075] Figure 2A shows the effect of duplicating the 370-bp mHnfl ctr4xH4RE promoter fragment containing the 4xH4RE on promoter activity in the reporter plasmid pGL3 transfected into HEK-293 cells.
[0076] Figure 3 shows the schematic of modifying the native ApoC3 promoter by inverting the proximal H4RE (ApoC?DuplxH4RE/061), converting both to 4xH4RE motifs retaining the 607-bp spacing (ApoC3Dup4xH4RE/061), and then bringing the motifs closer by deleting an intervening 312-bp Sad fragment (ApoC?Dup4xH4RE/030). Motif spacing was increased to 2.06 kb by inserting a 1.77-kb human HNFl α cDNA fragment into the Sad site and then sequentially reduced by deleting indicated restriction fragments.
[0077] Figure 3B shows the effect of introducing 4xH4RE motifs into the ApoC3 promoter in the reporter plasmid pGL3 transfected into HEK-293 cells. Data also show the effects of the size of the spacting between the duplicates of the4XH4REs. Data are presented as fold stimulation vs. pGL3-Basic (n=5-6). Numbers above the histograms indicate p values between activities.
[0078] Figure 4A shows the schematic of modifying native 1.0-kb human HNF4A P2 promoter.
[0079] Figure 4B shows the effects of modifications to the human HNF4A P2 promoter in the reporter plasmid pGL3 transfected into HEK-293 cells. Data are presented as fold stimulation vs. pGL3-Basic (n=5-6).
[0080] Figure 4C shows the effects of modifications to the human HNF4A P2 promoter in the reporter plasmid pGL3 transfected into HEK-293 cells. Data are presented as fold stimulation vs. pGL3-Basic.
[0081] Figure 5A shows the schematic diagram of the coding sequence of human
HNFl α fused to the augmented mHnfl a promoter to form the mHnfl cPapAxmKE IHNFl a minigene cassette (upper) and the protein expression from the augmented promoter (lower).
[0082] Figure 5B shows the schematic diagram of the coding sequence of rat HNF4α3 that is HA-tagged at the C-terminus and then fused to the augmented P2 promoter to form the fflVF4Λ-P2Dup4xH4RE/HNF4α3HA minigene cassette (upper) and the protein expression from the augmented promoter (lower).
[0083] Figure 5C shows the reporter assay data of HEK-293 cells that were transiently transfected with the indicated combinations of reporter plasmid (200 ng), expression plasmid
(100 ng), and cognate mini gene cassette (100 ng). Data are presented as fold stimulation vs. pGL3-Basic (n=3; NS, not significantly different from reporter plasmid alone; *, p < 0.005 vs. reporter plasmid either alone or with the HNFl α minigene inducer). This experiment was repeated with nearly equivalent results.
[0084] Figure 6 A shows the effect of H4RE copy number in the mHnfl or promoter in rat
INS-I β cells upon HNF4α3 stimulation (n=3).
[0085] Figure 6B shows the effect of duplicating the 4xH4RE in the mHnfl or promoter in rat INS-I β cells upon HNF4α3 stimulation (n=6).
[0086] Figure 6C shows the effect of duplicating the 4xH4RE in the ApoC3 promoter in rat INS-I β cells and the effects of the size of the spacting between the duplicates of the4XH4REs upon HNF4α3 stimulation (n=3).
[0087] Figure 6D shows the effect of HIRE copy number and/or duplicating the
4xHlRE in the HNF4A P2 promoter in rat INS-I β cells upon HNFl stimulation (n=6).
[0088] Figure 7A shows the sequence of the mouse Hnfl O0.7ATG promoter comprising the 692 nucleotide (nt) upstream of the ATG start codon are shown (SEQ. ID. NO: 1).
(NM_009327 / mouse Hnfla gene; shown is Mus musculus Chromosome 5: 115,420,851 -
115,421,545, reverse orientation, with "GAGCT" added to 5-prime end to create Sad site. The native H4RE is boxed and in bold.
[0089] Figure 7B shows the DNA sequences of the synthetic oligonucleotides (SEQ. ID.
NO: 2 and 3 in the order of appearance) used to insert 3 additional H4REs (3xH4RE) at the BIpI site on Chromosome 5: 115,420,800 of Fig. 7A. Underlined sequences are H4REs derived from the human G6Pase gene (2 elements on Chl7: -236/-218 & -78/-60 from RefSeq NM_000151) flanking the human HNFlB element (TCF2; -214/-196 from RefSeq: NM_000458).
[0090] Figure 7C shows the sequence of the mouse Hnfl ά 7ATG4xH4RE promoter with the
3 additional H4REs (boxed) inserted downstream of the original native H4RE (boxed and bold)
(SEQ. ID. NO: 4). This is a combination of mouse genomic sequence of Fig. 7A (Ch 5:
115,420,851 - 115,421,259, reverse orientation, plus the inserted synthetic sequence of Fig. 7B.
[0091] Figure 7D shows the sequence of the mHnfl ^^mmL promoter with the
4xH4RE duplicated in tandem and separated by 252 base-pairs (bp) (SEQ. ID. NO: 5). The 338 base pairs (in italic) were duplicated and inserted immediately downstream of the Nhel site
("GCTAGC") ending with the 2nd Nhel site that is closer to the ATG start codon.
[0092] Figure 7E shows the effects of StuUNhel duplication on the HNF4α3 stimulated activity of the native mHnfl or promoter.
[0093] Figure 7F shows the position of the putative Nkx-2.2 element (double underlined) on the native mHnfl or promoter sequence with respect to the H4RE (boxed) (SEQ.
ID. NO: 6) Nkx-2.2 site (bold underline; wild type sequence) in mouse Hnfla promoter (the region shown is Ch 5: 115,421,112 - 115,421,260, reverse orientation; the Nkx-2.2 site is located from 115,421,159 - 115,421,165 (also reverse orientation). Flanking Stul and BIpI sites are underlined and the native H4RE is boxed.
[0094] Figure 7G and the mutation of the putative Nkx-2.2 element in the mutated sequence (SEQ. ID. NO: 7). The Nkx-2.2 site was mutated by changing all 7 nucleotides (bold underline).
[0095] Figure 7H shows the effects of a mutation of the putative Nkx-2.2 site on the
HNF4oc3 stimulated activity of the native mHnfl or promoter.
[0096] Figure 8 A shows the DNA sequence of the human ApoC3 promoter (SEQ. ID.
NO: 8). Sequence -706/-8 with respect to NM_000040 (Chrll:116,700,624-116,703,787), containing 5' GGTACC Kpnl site and 3' AGATCT Bglll site introduced during PCR cloning, distal H4RE at -702/-690 (box and bold), Ndel site (GCTAGC) introduced at -88A83, and reversed H4RE at -82/-70 (box and bold).
[0097] Figure 8B shows the DNA sequence of the ApoC3Oup4xlϊ4RE061 and the PCT sequences having the 3XH4RE used to construct the modified the human ApoC3 promoter with duplicated 4xH4REs (SEQ. ID. NO: 9, 10, 11 in accordance to appearance). The REs are boxed and bold.
[0098] Figure 8C shows the DNA sequence of the ApoC3Dup4xH4RE03. (SEQ. ID. NO:
12). The REs are boxed and bold.
[0099] Figure 9 A shows the DNA sequence of the human HNF4A P2 promoter with Ix
HIRE (SEQ. ID. NO: 13).
[0100] Figure 9B shows the DNA sequence of the human HNF4A P2 promoter with a duplicated Ix HIRE (SEQ. ID. NO: 14, 15, 16 in the order of appearance) and the sequences of the PCR primers for duplication the HIRE.
[0101] Figure 9C shows the DNA sequence of the human HNF4A P2 promoter with the duplicated 4X HIRE and the 0.84 bp spacing (SEQ. ID. NO: 17, 18, 19 in the order of appearance) and the sequences of the PCR primers for duplication the HlREs.
[0102] Figure 9D shows shows the DNA sequence of the human HNF4A P2 promoter with the duplicated 4X HIRE and the 0.23 bp spacing (SEQ. ID. NO: 20) and the sequences of the PCR primers for duplication the HlREs.
DETAILED DESCRIPTION OF THE INVENTION
[0103] The present invention relates to methods, engineered DNA constructs, engineered promoters, modified promoters and DNA sequences to enhance the transcriptional activity of a promoter fragment in mammalian expression vectors while retaining the natural transcription factor dependence or regulation control of the native mammalian promoter or promoter fragment for transcription.
[0104] The described engineered promoter enhancement constructs and methods provide safe, normally regulated promoters capable of expressing therapeutic proteins for, for example, new gene transfer and/or gene therapy vectors as well as currently available gene transfer and/or gene therapy vectors and techniques.
[0105] In some embodiments, the methods and DNA sequences described herein provide ways to generate safe, normally regulated promoters capable of expressing therapeutic proteins from gene expression vectors. The promoters can be native promoters.
[0106] To achieve effective control of gene expression in vivo, higher eukaryotes generally utilize extensive promoter/enhancer/locus control regions spanning many kilobases of
DNA, and encompass multiple discrete binding sites for transcription factors that in combination dictates specificity of gene transcription. The extensive enhancer/locus control regions form the regulatory elements of a gene.
[0107] The inventors tested several strategies to enhance activity of the hepatocyte nuclear factor HNF4α-dependent Hnfl or promoter (20-23), which was chosen as a prototype due to the key role of the HNF lα transcription factor (TF) in β-cell differentiation and function in the pancreas. The inventors also tested the method with a HlRE-depenedent promoter, the
HNF4A P2 promoter. The HNFlA (TCFl) and HNF4A genes are mutated in maturity onset diabetes of the young M0DY3 (24) and MODYl (25), respectively, and have been proposed to constitute a bi-stable transcriptional couple in pancreatic β cells (26, 27).
[0108] The prototype mammalian promoters and the transcription response elements used by the inventors are examples only, and the same strategy can be applied to any mammalian promoter construct. Therefore, the invention is not limited to the specific exemplary constructs prepared thus far, e.g., HNF4α-dependent and HlRE-dependent promoters. These exemplary promoters are used as examples and for proof-of-concept demonstrations only.
[0109] By introducing three more HNF4 REs (H4REs) into the Hnfl or promoter in addition to its existing H4RE to create a 4xH4RE motif or segment, the inventors were able to significantly enhance the HNF4α- stimulated activity. The inventors also added another manipulation duplicating a several hundred nucleotide fragment containing the 4xH4RE to
generate non-adjacent 4xH4RE motifs or segments. This duplication step further increased the HNF4α induction to a thousand-fold (See Fig. 2B).
[0110] A similar enhancement in HNF4α-stimulated activity was observed by converting the two non-adjacent H4REs in the ApoC3 promoter (28) to 4xH4RE motifs, which resulted in similar enhanced HNF4α-stimulated activity.
[0111] Also, comparable enhanced HNFlα-stimulated activity of the HNFl -dependent
HNF4A P2 promoter was demonstrated by introducing non-adjacent 4xHlRE motifs (HNFl REs) in the HNF4A P2 promoter.
[0112] HNF4oc is nuclear protein receptor type TF and the HNFl α is a homeodomain type TF. The demonstration of this method in three different mammalian promoters which are respectively dependent on different types of TF shows that this method is not limited to homeodomain type TF or nuclear protein receptor type TF promoters but rather that the method is applicable to any other TF dependent mammalian promoter.
[0113] Accordingly, the present disclosure provides a method of enhancing expression of a gene comprising operably linking the gene to an engineered promoter forming a gene expression construct, wherein the engineered promoter comprises at least one transcription factor response element (TFRE) segment, wherein the TFRE segment comprises four to 16 TFREs; wherein all of the TFREs are response elements (REs) of one transcription factor (TF), and wherein each of the TFRE is in forward orientation, and wherein each of the four to 16 TFREs are separated by 9-15 base pairs, and wherein the at least one TFRE segment is inserted upstream (5') of the ATG start codon of the mammalian gene.
[0114] In one embodiment, provided herein is a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) operably linking the engineered DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (c) transducing a cell with the gene expression construct.
[0115] In one embodiment, the disclosure herein provides a method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: (a) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences in a forward orientation, wherein
each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); (b) engineering a second DNA construct to further comprise at least two TFRE segments of step (a), wherein the TFRE segments are separated by 200-700 base pairs; (c) operably linking the engineered second DNA construct upstream (5') of an ATG start codon of a gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct; and (d) transducing a cell with the gene expression construct.
[0116] In one embodiment, provided herein is a method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences in forward orientation, wherein each of the TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; and (c) operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
[0117] In one embodiment, provided herein is a method for modifying a promoter to enhance gene expression from a transcription factor dependent mammalian promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a gene that is operably linked to the transcription factor dependent promoter; (b) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences in forward orientation, wherein each of the TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; (c) engineering a second DNA construct to further comprise at least two TFRE segments, wherein the TFRE segments are separated by 200-700 base pairs; and (d) operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
[0118] In one embodiment, provided herein is a modified promoter comprising at least one transcription factor response element (TFER) segment, wherein the TFRE segment comprises 4-16 TFREs, wherein all of the TFREs are response elements (REs) of one transcription factor (TF) native to a promoter, wherein the TFREs are in forward configuration, wherein each of the 4-16 TFREs are separated by 9-15 base pairs (bp).
[0119] In one embodiment, the disclosure herein provides an engineered DNA construct for increasing gene expression from a transcription factor (TF) dependent promoter comprising at least one transcription factor response element (TFRE) segment, wherein the segment comprises between four and 16 consecutive TFREs in forward direction, wherein each of the TFRE is separated by about 9 to 15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) for one transcription factor (TF).
[0120] In some embodiments, the promoters are mammalian promoters. In other embodiments, the promoters are non-mammalian promoters. In other embodiments, the promoters are synthetically made promoter made of parts from many non-related sources, much like a chimeric promoter described in the examples.
[0121] In some embodiments, the TFREs are in forward configuration, forward direction or forward orientation. In some embodiments, the TFREs are in reverse configuration, reverse direction or reverse orientation. In one embodiment, all the TFREs in a segment are in the same direction. In other embodiments, the TFREs in a segment have a mixed forward and reverse orientation.
[0122] In some embodiments, the TFRE segment of the engineered DNA construct, modified promoter or engineered promoter comprise four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, or 16 TFREs. The multiples of TFRE have to be for the same and one TF but they need not be the native TF, nor do they have to be the same sequence. The TFRE segment can be made by reproducing the native promoter RE, adding consensus REs, or building the multi-copy RE by combining several REs from other highly responsive promoters. One skilled in the art would be able to selected, mix and match TFREs to form the segment as the inventors demonstrated.
[0123] In some embodiments, the ranges of TFRE in a segment is between 4-5, 4-6, 4-7,
4-8, 4-9, 4-10, 4-12, 4-14 or 4-16. The inventors have shown that simply having two REs can increase the TF stimulated activity (Fig. 4B and 4C). Accordingly, in one embodiment, the TFREs in a segment is two REs. In another embodiment, the ranges of TFRE in a segment is between 2-16, e. g. 2-4, 2-6, 2-8, 2-10, 2-12, 2-14, and 2-16. The inventors have shown that having more REs do not necessary result in a further increased in the TF stimulated activity (Fig.
IB). For the Hnfla promoter shown in the example, the maximum number of H4RE appears to be ten before there is some negative effects on the stimulated activity.
[0124] In addition, the inventors that duplicating the native RE and also duplicating the
TFRE segment resulted in increase the TF stimulated activity (Fig. 2B, 4B, 4C, 6D, and 7E). [0125] In one embodiment, the multiple TFREs in a TFRE segment are separated by about 9, 10, 11, 12, 13, 14, or 15 bps. The 9-15 bps are used to space the TFRE apart in a segment. The sequences of the 9-15 bps is not important and can be any of the A, T, C, G nucleotide in a DNA sequence. This range of spacing is approximately that of a single helical DNA turn of 10-11 bp. Such a spacing of 9-15 bp between the multiple REs will have the DNA binding sites on one and the same side of the helix DNA. There are evidences that in stituations where multiple TFs are binding on the same side of a DNA helix, they (i. e. the TFs) tend to work cooperatively better to enhance gene expression. Therefore, the 9-15 bp spacing is crucial to the arrangement of the TFREs in the segments described herein.
[0126] In some embodiments, the engineered DNA construct, modified promoter and/or engineered promoter described herein are used to form gene expression constructs. In some embodiments, the engineered DNA construct, modified promoter or engineered promoter described herein is a gene expression construct. In some embodiments, the engineered DNA construct, modified promoter or engineered promoter described herein are operably linked to a gene to form a mini gene cassette. In some embodiments, the engineered DNA construct, modified promoter or engineered promoter described herein is a mini gene cassette. The inventors show two such mini gene cassettes, see Fig. 5A in the example. [0127] In one embodiment of the methods, engineered DNA construct, modified promoter or engineered promoter described herein, the gene expression construct is further transduced into a host cell. In another embodiment of the methods, engineered DNA construct, modified promoter or engineered promoter described herein, the mini gene cassette is further transduced into a host cell.
[0128] In one embodiment, the host cell is selected from a group consisting of hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells. In one embodiment, the host cell expresses the respective TF that binds the TFREs in the segment and thereby regulate the expression of the operably linked gene. [0129] In some embodiments, the host cells are stem cells. For example, adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc. In one embodiment, engineered DNA
construct, modified promoter or engineered promoter described herein are used to enhance to expression of differentiating or programming factors in the stem cell.
[0130] In other embodiments, the host cells are any cell within the body of an organism, e.g. when a gene therapy vector or construct is used. In some embodiments, the methods, engineered DNA construct, modified promoter or engineered promoter described herein are used to correct a defect or deficiency in a cell or tissue comprising the cell or for treating a disease or disorder.
[0131] In some embodiments, the methods, engineered DNA construct, modified promoter or engineered promoter described herein are used for enhancing commercial production of therapeutic biologies. In other embodiments, the host cells are any of the type of cells used for the bioprocess production of commercial therapeutic biologies, e. g. therapeutic antibodies, proteins and peptides. Such cells are well known in the art and one skilled in the art would be able to select an appropriate host cell. For example, Chinese hamster ovary (CHO) cells and mouse myeloma cells are the typical cells used for commercial production of therapeutic biologies. When the methods and constructs are used to enhance gene expression for the commercial production of therapeutic biologies, then one should select from the CHO or mouse myeloma derived cell lines. In other embodiments, the host cell is a cell selected from Tables 1-4.
[0132] In one embodiment, the expression of the gene is in vivo. For example, the genes are expressed in the host cells (e. g. the hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, muscle cells and stem cells such as adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc. within a mammal, e. g. a mouse or a human.
[0133] In one embodiment, the expression of the gene is in vitro. For example, the genes are expressed in the cells (e. g. hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells) that are extracted or isolated from a mammal. The cells are cultured ex vivo in tissue culture conditions.
[0134] In one embodiment, the engineered DNA construct described herein is operably linked upstream (5') of an ATG start codon of a gene that is operably linked to a TF dependent promoter. In one embodiment, the modified promoter or engineered promoter described herein is operably linked upstream (5') of an ATG start codon of a gene.
[0135] In one embodiment, the engineered DNA construct described herein is operably linked upstream (5') of a transcriptional start site of a gene that is operably linked to a TF dependent promoter. In one embodiment, the modified promoter or engineered promoter described herein is operably linked upstream (5') of a transcriptional start site of a gene. [0136] In one embodiment, the gene product of the gene is a protein. In another embodiment, the gene product of the gene is not a protein, e. g. an RNA such as a microRNA. [0137] In one embodiment, the engineered DNA construct, modified promoter or engineered promoter described herein comprises at least two TFRE segments, wherein the two TFRE segments are separated by 200-700 bp. In another embodiment, the engineered DNA construct, modified promoter or engineered promoter described herein comprises up to four TFRE segments, wherein the TFRE segments are separated by 200-700 bp. In one embodiment, the engineered DNA construct, modified promoter or engineered promoter described herein comprises two, three or four TFRE segments. In another embodiment, all the TFRE segments have TFRE that are for the same and one TF.
[0138] In one embodiment, the multiple TFRE segments are separated by about 200,
250, 300, 350, 400, 450, 500, 550, 600, 650, or 700 bps, including all the whole integer number of bp between 200 and 700. The 200-700 bps are used to space the TFRE segment apart in a engineered DNA construct, modified promoter or engineered promoter. In some embodiments, the separation is between 200-300, 200-400, 200-500, 200-600, 300-400, 300-500, 300-600, 300-700, 400-500, 400-600, 400-700, 500-600, 500-700, or 600-700 bp. The sequences of the200-700 bps is not important and can be any of the A, T, C, G nucleotide in a DNA sequence. The ideal range is between 200-700 bps and it varies with the gene. In the example, the inventors show that a reduction in the size from 0.84-0.23 kilo bp increased the TF stimulated activity for the HNF4A promoter (Fig. 4B) while a reduction in the size from 0.61-0. 30 kilo bp decreased the TF stimulated activity for the ApoC3 promoter (Fig. 3B). One skilled in the art would be able to experiment to determine the optimum segment spacing for the gene of interest using the methods described in the examples and other methods known in the art. [0139] In one embodiment, at least one TFRE of the TFRE segment is the native to the promoter of the gene, otherwise known as the native promoter TFRE. In another embodiment, the native RE is duplicated in the TFRE segment. In one embodiment, the segment comprises identical TFREs. In another embodiment, the segment comprises all native promoter REs. In other embodiments, none of the TFRE of the TFRE segment is native to the promoter of the gene. In some embodiments, the TFREs of a segment are made up of TFRE from other genes and they are all REs for the same and one TF. In the Example, the segment comprises one native
TFRE of the mouse Hnfl alpha gene, two REs of the human G6Pase gene and one RE from the human HNFlB (TCF2) gene.
[0140] In one embodiment, at least one TFRE of the engineered DNA construct, modified promoter or engineered promoter described herein is the native promoter TFRE. In one embodiment of the engineered DNA construct, modified promoter or engineered promoter described herein, all the TFREs are identical. In another embodiment, the engineered DNA construct, modified promoter or engineered promoter described herein comprises all native promoter REs. In other embodiments, none of the TFRE of the of the engineered DNA construct, modified promoter or engineered promoter described herein is native to the promoter of the gene. In some embodiments, the TFREs of engineered DNA construct, modified promoter or engineered promoter described herein are made up of TFRE from other genes and they are all REs for the same and one TF.
[0141] In one embodiment of the engineered DNA construct, modified promoter or engineered promoter described herein, the TFRE segment is repeated at least twice and up to four times. In one embodiment, the TFRE segment is duplicated in tandem in the engineered DNA construct, modified promoter or engineered promoter described herein. In another embodiment, the TFRE segment is triplicated in tandem in the engineered DNA construct, modified promoter or engineered promoter described herein. In one embodiment, the TFRE segment is repeated in tandem four times in the engineered DNA construct, modified promoter or engineered promoter described herein.
[0142] In one embodiment, the engineered promoter or modified promoter is derived from a native promoter of the gene. In one embodiment, the gene is a mammalian gene. In one embodiment, the engineered promoter or modified promoter is derived from a mammalian promoter. In one embodiment, the mammalian gene is a non-human mammalian gene, e. g. mouse, rat, non-human primate (e. g. monkey, baboon, ape, and chimpanzee), dog, and hamster gene. For example, the mouse hepatocyte nuclear factor 1 alpha (mHNFl alpha). In another embodiment, the mammalian gene is a human gene. For example, the human apolipoprotein C3 (ApoC3), human hepatocyte nuclear factor 4 alpha (HNF4a\pha) and human elongation factor 1 alpha (EFl alpha).
[0143] In one embodiment, the mammalian promoter is selected from a group consisting human, mouse, rat, non-human primate (monkey, baboon, ape, and chimpanzee), dog, and hamster. In one embodiment, the mammalian promoter is a non-human promoter, e. g. mouse, rat, non-human primate (monkey, baboon, ape, and chimpanzee), dog, and hamster. In one
embodiment, the mammalian promoter is a human promoter. Examples include but are limited to the human U6, Hl, tRNA, beta-actin, alpha-actin and EFl alpha promoters. [0144] In one embodiment of the methods, the engineered DNA construct, modified promoter or engineered promoter described herein, the TFRE is for a TF selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic helix-loop-helix (bHLH), basic-leucine zipper type (bZIP), winged helix type, and heat-shock type TFs. [0145] In one embodiment, the TF is a homeo-domain type TF. In one embodiment, the homeo-domain type TF is a hepatocyte nuclear factor 1 alpha (HNFl α) TF. In one embodiment wherein the TF is a HNF lα, the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a gene selected from the group consisting of hepatocyte nuclear factor 4 alpha (HNF4A), sodium-glucose cotransporter (SLC5A1) and albumin (ALB). In one embodiment wherein the TF is a HNFlα and the gene expression construct or mini gene cassette is transduced into a host cell, the cell is selected from a group consisting of stem cells (e. g. adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.), hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells and renal proximal tubule cells.
[0146] In one embodiment, the TF is a nuclear hormone receptor type TF. In one embodiment, the nuclear hormone receptor type TF is a hepatocyte nuclear factor 4 alpha (HNF4α). In one embodiment, wherein the TF is HNF4α, the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a gene selected from the group consisting of Coagulation Factor VIII (procoagulant component), Acyl CoA dehydrogenase, UDP-glucuronosyl-transferase 1, ATP-binding cassette, sub-family C (ABCC), Apolipoprotein C3 and hepatocyte nuclear factor 1 alpha (HNFlA). In one embodiment wherein the TF is a HNF4α and the gene expression construct or mini gene cassette is transduced into a host cell, the cell is selected from a group consisting of stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.), hepatocytes, hematopoietic cells, epidermal cells, and endothelial cells.
[0147] In one embodiment, the TF is a bHLH type TF. In one embodiment, the bHLH type TF is a MyoD. In one embodiment, wherein the TF is MyoD, the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a gene selected from the group consisting of actin, alpha 1, skeletal muscle (ACTAl), myocyte enhander factor 2A (MEF2A) and Catenin beta (CTNNBl). In one embodiment wherein the TF is a bHLH and the gene expression construct or mini gene cassette is transduced into a host cell, the cell is
selected from a group consisting of stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.), pre-myocytes, myocytes, and muscle cells. [0148] In one embodiment, the TF is a bHLH type TF. In one embodiment, the bHLH type TF is a neurogenin-3 (Ngn-3). In one embodiment, wherein the TF is Ngn-3, the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is a OVO homologue-like 1 (OVOhLl) gene. In one embodiment wherein the TF is a bHLH and the gene expression construct or mini gene cassette is transduced into a host cell, the cell is a pancreatic beta cell or stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.).
[0149] In one embodiment, the TF is a bZIP type TF. In one embodiment, the bZIP type
TF is cyclic AMP (cAMP) RE (CRE). In one embodiment, wherein the TF is CRE, the gene operably linked to the engineered DNA construct, engineered promoter or modified promoter is pyruvate carbolylase. In one embodiment wherein the TF is a bZIP type TF and the gene expression construct or mini gene cassette is transduced into a host cell, the cell is a hepatocyte or stem cells (adult stem cells, embryonic stem cells, induced pluripotent stem cells, etc.). [0150] In one embodiment, provided herein is a vector comprising an engineered DNA construct, engineered promoter or modified promoter construct described herein. In one embodiment, the vector is a gene therapy vector.
[0151] In one embodiment, provided herein is a cell comprising a vector of any one embodiments of the engineered DNA construct, engineered promoter or modified promoter construct described herein.
[0152] In one embodiment, the engineered DNA construct or modified mammalian promoter is mHnfl αr4XH4RE or a nucleic acid sequence that is at least 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 4 which is the DNA sequence depicted in Figure 1C. The construct was made by the combination of 254 nts upstream of NM_009327 (Chr5: 115,398,989- 115,421,071) and the 1st 219 nts of with the synthetic 3xH4RE segment (Fig. 7B; italicized portion) inserted 50 nts upstream of NM_009327.
[0153] In one embodiment, the engineered DNA construct or modified mammalian promoter is mHnfl aDu≠xmRE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 5 which is the DNA sequence depicted in Figure 7D which is equivalent to the sequence in Fig. 7C except for duplication of the italicized portion 339 nts] [0154] In one embodiment, the engineered DNA construct or modified mammalian promoter is human ApoC3 DuP1XH4RE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 8 which is the sequence shown in Fig. 8A comprising composite
of the nts -706/-8 from human ApoC3 gene [NM_000040 (Chrll:116,700,624-116,703,787), flanked by incorporated Kpnl (GGTACC) and BgHl (AGATCT) sites, converting nts -88Λ83 (AGCAGG) to an Nhel site (GCTAGC), and reversing the proximal H4RE at -82/-70 with regard to NM_000040] .
[0155] In one embodiment, the engineered DNA construct or modified mammalian promoter is human ApoC3 Ou≠xmRE/06 or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 9 which is the sequence shown in Fig. 8B which made by the synthetic 69-bp 3xH4RE segment inserted between Kpnl site and promoter at nt -706 and synthetic 85-bp 3xH4RE segment inserted into promoter created Nhel site at nt -88 from NM_000040 (see Fig. 8B). The two GAGCTC Sad sites are bold.
[0156] In one embodiment, the engineered DNA construct or modified mammalian promoter is human ApoC3Du≠xmRE/029or ° 3 or 80% identical to SEQ. ID. NO: 12 which is the sequence shown in Fig. 8C. The 312 bp between the two Sad sites deleted by restriction enzyme digestion. The ApoC?Dup4xH4RE/029 and ApoC?Dup4xH4RE/03 are used interchangeably. [0157] In one embodiment, the engineered DNA construct or modified mammalian promoter is human HNF4A P2 1XH1RE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 13 which is the sequence shown in Fig. 9A, where nts -1013/-11 with respect to NM_175194 (Chr20:42,982,441-43,058,311) with KpnVSacI and Xhol sites incorporated at 5' and 3' ends, respectively, via PCR primers.
[0158] In one embodiment, the engineered DNA construct or modified mammalian promoter is human HNF4A P2DUP1XH1RE or a nucleic acid sequence that is 80%, 85%, 90%, 95% or 99% identical to SEQ. ID. NO: 14 which is the sequence shown in Fig. 9B. A 20-bp fragment containing a putative HIRE located -8.41 kb upstream from NM_175194 was inserted between the Kpnl & Sad sites with the forward PCR primer (HIRE boxed). The downstream reverse primer introduced an N del site immediately upstream of the proximal HIRE. [0159] In one embodiment, the engineered DNA construct or modified mammalian promoter is human HNF4A p2Ou≠xmRE/0 84kb or 80% identical to SEQ. ID. NO: 17 which is the sequence in Fig. 9C. Modified to the sequence is by inserting a 3xHlRE segment adjacent to each HIRE with the primers shown in Fig. 9C. The three HlREs inserted immediately downstream of the upstream HIRE were derived from the human αl -antitrypsin, β-fibrinogen, and albumin genes, respectively.
[0160] The human albumin HIRE was derived from nts -322/-310 with respect to
NM_000477 (Chr4:74,268,972-74,287,627), the human αl-antitrysin HIRE was derived from nts +139/+151 with respect to NM_000295 (Chrl4:94,843,085-94,855,153), and the β-
fibrinogen HIRE was derived from nts -58A46 with respect to NM_005141 (Chr4: 155,484,132- 155,493,915).
[0161] In one embodiment, the engineered DNA construct or modified mammalian promoter is human HNF4A P2Dup4xHl RE/0.23kb or 80% identical to SEQ. ID. NO:20 which is the sequence shown in Fig. 9D The 609 bp of DNA was deleted between the BsrGI and PflMI sites.
[0162] In practicing the methods and DNA constructs described herein, one would first decide on a gene to which one wishes to increased expression, perhaps in the native cell (e. g. a mammalian cell) of the gene or in a cell used for commercial production of therapeutic biologies. After identifying the native RE of the promoter of the gene (e.g. using genomic data and predicting software known in the art and those described herein), one can construct a DNA construct or modify the native promoter with TFRE segments as described herein. Then, one would operably link the DNA constructs or modified promoter with TFRE segments to the gene of interest, and transduce the resulting construct into a host cell, e. g. the native cell. [0163] In another embodiment, one can choose to make a synthetic DNA construct comprising several REs from different genes, preferably those sequences that have relatively high binding affinity for the chosen TF. The RE of different genes can be from different organisms, e. g. RE from the nematode worm, the fruit fly, and from human. [0164] Transcription factors are proteins that bind to the enhancer or promoter regions and interact such that transcription occurs from only a small group of promoters in any cell. Most transcription factors can bind to specific DNA sequences, and these trans-regulatory proteins or transcription factors (TFs) can be grouped together in families based on similarities in structure. Within such a family, proteins share a common framework structure in their respective DNA-binding sites, and slight differences in the amino acids at the binding site can alter the sequence of the DNA to which it binds. In addition to having this sequence-specific DNA-binding domain, TFs contain a domain involved in activating the transcription of the gene whose promoter or enhancer it has bound. Usually, this trans-activating domain enables that TF to interact with proteins involved in binding RNA polymerase. This interaction often enhances the efficiency with which the basal transcriptional complex can be built and bind RNA polymerase II. There are several families of transcription factors, and those discussed here are just some of the main types.
[0165] Homeo domains are conserved DNA-binding domains found in the transcription factors of a wide variety of organisms. There are also known to play an important role in embryogenesis. Homeodomains are about 60 amino acid residues long, and structurally, they
consist of three alpha-helices and one flexible N-terminal arm. Homeodomains all bind to DNA at a TAAT core motif. The in vitro the common consensus DNA site that contains the motif (C/G)TAATTG. An example of homeo domain TF is Msx-1 which is encoded by a subfamily of homeobox genes. In a developing embryo, these genes are expressed in craniofacial structures, the neural tube, and in the limbs. Msx-1 specifically interacts with DNA at the sequence (C/G)TAATTG. Biologically, Msx-1 acts as a transcriptional repressor. Another example is the heterodimers between the Pbx/Exd and Hox/HOM-C classes of homeodomain proteins. They are bind regulatory elements in tissue- specific and developmentally regulated genes. The Pbx- Hox heterodimers bind a prototypic element of TGATTAAT.
[0166] Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both Basic helix-loop-helix and leucine zipper motifs. An example is Microphthalmia-associated transcription factor. Another example is the sterol regulatory element binding protein (SREBP)
[0167] Basic Helix-Loop-Helix (bHLH) Transcription Factors are proteins bind to DNA through a region of basic amino acids (typically 10 to 13 residues) that precedes the first α- helix. The helices contain hydrophobic amino acids at every third or fourth position, so that the helix presents a surface of hydrophobic residues to the environment. This enables the protein to pair by hydrophobic interaction with the same protein or with a related protein that displays such a surface. The muscle-specific transcription factors MyoD and myogenin are examples of TF having this structural motif bHLH. The MyoD family of proteins is active in promoting myo genesis when complexed to either the E12 or E47 proteins-two ubiquitous bHLH proteins). Muscle development is inhibited, though, when the MyoD, E12, or E47 proteins are bound to the Id (inhibitor of differentiation) protein. The Id protein contains the HLH motif, but lacks the basic region that binds to the DNA. Dimerization of Id with MyoD, E12, or E47 interferes with the ability of these proteins to bind DNA, and the expression of Id in cells prevents the activity of the MyoD proteins. The Id protein is made while the muscle cell precursors are still dividing, and they disappear when the myoblasts leave the cell cycle to begin differentiating into myotubes. If Id is overexpressed in cultured myoblasts, they will not differentiate into myotubes. [0168] The structure of basic leucine zipper (bZip) transcription factors is very similar to that of the bHLH proteins. The bZip proteins are dimers, each of whose subunits contains a basic DNA-binding domain at the carboxyl end, followed closely by an a helix containing several leucine residues. These leucines are placed in the helix such that they interact with similarly spaced leucine residues on other bZip proteins to form a "leucine zipper" between them, causing dimers to form. This domain is followed by a regulatory domain that can interact
with the promoter to stimulate or repress transcription The C/EBP, API, and yeast GCN4 transcription factors are members of the bZip family. Genetic and X-ray crystallographic methods have converged on a model of DNA binding where two alpha helices containing the DNA-binding region are inserted into the major groove of the DNA, each helix finding an identical DNA sequence. The resulting binding looks like that of a scissors or hemostat. Several bZIP proteins bind to the sequence CCAAT; one of the most important is called the CCAAT enhancer-binding protein (C/EBP). C/EBP plays a role in adipogenesis similar to that of the myogenic bHLH proteins in myo genesis.
[0169] Zinc finger transcription factors have zinc finger motifs for their DNA-binding domain. Zinc finger proteins include WT-I (a important transcription factor critical in the formation of the kidney and gonads); the ubiquitous transcription factor SpI; Xenopus 5S rRNA transcription factor TFIIIA; Krox 20 (a protein that regulates gene expression in the developing hindbrain); Egr-1 (which commits white blood cell development to the macrophage lineage); Kruppel (a protein that specifes abdominal cells in Drosophila); and numerous steroid-binding transcription factors. Each of these proteins has two or more "DNA-binding fingers," a-helical domains whose central amino acids tend to be basic. These domains are linked together in tandem and are each stabilized by a centrally located zinc ion coordinated by two cysteines (at the base of the helix) and two internal histidines. The crystal structure shows that the zinc fingers bind in the major groove of the DNA. The WT-I protein contains four zinc finger regions, and it is usually expressed in the fetal kidney and gonads. People with one mutant WTl allele (usually a deletion of the gene or of a zinc finger region) have urogenital malformations and develop WiIm' s tumor of the kidney. In mice, both WTl genes can be deleted by gene targeting, and the resulting mice die in utero, having neither kidneys nor gonads. The WTl factor binds to the regulatory regions of several genes that are active during kidney development and also is thought to inhibit the expression of certain growth factors. [0170] Nuclear hormone receptors and their hormone -responsive elements. Specific steroid hormones are known to increase the transcription of specific sets of genes. Once the hormone has entered the cell, it binds to its specific receptor protein, converting that receptor into a conformation that is able to enter the nucleus and bind particular DNA sequences. The family of steroid hormone receptors includes proteins that recognize estrogen, progesterone, testosterone, and cortisone as well as nonsteroid lipids such as retinoic acid, thyroxine, and vitamin D. The DNA sequences capable of binding nuclear hormone receptors are called hormone-responsive elements, and they can be in either enhancers or promoters. One set of steroids includes the glucocorticoid hormones (cortisone, hydrocortisone, and the synthetic
hormone dexamethasone). These bind to the glucocorticoid hormone receptors and enable the bound receptors to bind to the glucocorticoid-responsive elements in the chromosomes. The steroid-hormone-responsive elements are extremely similar to one another and are recognized by closely related proteins. These steroid receptor proteins are similar to chimeric protein molecules. In general, they each contain three functional domains: (1) a hormone-binding domain, (2) a DNA-binding domain that recognizes the hormone-responsive element, and (3) a trans-activation domain, which is involved in mediating the signal to initiate transcription. These functions can overlap, and all domains appear to have some role in activating transcription. Some steroid receptor proteins have their DNA binding domain as inverted palindromes. For transcriptional activation to occur, the receptor has to enter the nucleus and dimerize with a similar hormone-binding protein. The binding of hormone to the hormone-binding domain appears necessary for dimerization, translocation into the nucleus, and the ability of the DNA- binding region to recognize the hormone-responsive element.
[0171] There are similarities among hormone receptor proteins and the similarities among hormone-responsive elements. The consensus sequence of the glucocorticoid-response element is AGAACANNNTGTTCT (where N can be any base) (SEQ. ID. NO: 21). Changing as few as two amino acids will change the specificity of the binding protein. The (palindromic) sequence GGTCACTGTGACC (SEQ. ID. NO: 22) is a strong estrogen-responsive enhancer element that will bind the estrogen-containing receptor protein. Two symmetrical mutations in this sequence, making it GGACACTGTGTCC (SEQ. ID. NO: 23), convert this DNA into a glucocorticoid-responsive enhancer.
[0172] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology, gene regulation, promoters and transcription factors can be found in Benjamin Le win, Genes IX, published by Jones & Bartlett Publishing, 2007 (ISBN-13: 9780763740634); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632- 02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0173] Unless otherwise stated, the present invention was performed using standard procedures known to one skilled in the art, for example, in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA
(1982); Sambrook et al., Molecular Cloning: A Laboratory Manual (2 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (1989); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1986); Current Protocols in Molecular Biology (CPMB) (Fred M. Ausubel, et al. ed., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998), Methods in Molecular biology, Vol. 180, Transgenesis Techniques by Alan R. Clark editor, second edition, 2002, Humana Press, and Methods in Meolcular Biology, Vo. 203, 2003, which are all herein incorporated by reference in their entireties.
[0174] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. [0175] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about."
[0176] All patents and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0177] The present invention can be defined in any of the following alphabetized paragraphs:
[A] An engineered DNA construct for increasing gene expression from a transcription factor (TF) dependent promoter comprising at least one transcription factor response element (TFRE) segment, wherein the segment comprises between four and 16 consecutive TFREs, wherein each of the TFRE is separated by about 9 to 15 base-pairs
(bp), and wherein all of the TFREs are response elements (REs) for one transcription factor (TF).
[B] The engineered DNA construct of paragraph [A], wherein the engineered DNA construct is operably linked upstream (5') of an ATG start codon of a target gene that is operably linked to a TF dependent promoter.
[C] The engineered DNA construct of paragraph [A] or [B], wherein the TFRE is in forward direction.
[D] The engineered DNA construct of any one of paragraphs [A]-[C], wherein the promoter is a mammalian promoter.
[E] The engineered DNA construct of any one of paragraphs [A]-[C], wherein the promoter is a non-human mammalian promoter.
[F] The engineered DNA construct of any one of paragraphs [A]-[C], wherein the promoter is a non-mammalian promoter.
[G] The engineered DNA construct of any one of paragraphs [A]-[F], wherein the engineered DNA construct comprising at least two TFRE segments, wherein the two segments are separated by 200 -700 base-pairs.
[H] The engineered DNA construct of any of paragraphs [A]-[G], wherein at least one TFRE is native to the promoter of the gene.
[I] The engineered DNA construct of paragraph [D], wherein the mammalian promoter is selected from a group consisting human, non-primate mammal, rat, dog, and hamster.
[J] The engineered DNA construct of any one of claims [A]-[I], wherein the gene is a mammalian gene.
[K] The engineered DNA construct of paragraph [J], wherein the mammalian gene is a non-human mammalian gene.
[L] The engineered DNA construct of paragraph [J], wherein the mammalian gene is a human gene.
[M] The engineered DNA construct of any of the paragraphs [A]-[L], wherein the TF is a selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic-leucine zipper type (bZIP), winged helix type, and heat-shock type TF.
[N] The engineered DNA construct of paragraph [M], wherein the TF is a homeo- domain type TF.
[O] The engineered DNA construct of paragraph [N], wherein the homeo-domain type TF is a hepatocyte nuclear factor 1 alpha (HNFl α) TF.
[P] The engineered DNA construct of paragraph [M], wherein the TF is a nuclear hormone receptor type TF.
[Q] The engineered DNA construct of paragraph [P], wherein the nuclear hormone receptor type TF is a hepatocyte nuclear factor 4 alpha (HNF4α).
[R] The engineered DNA construct of paragraph [O], wherein the gene is a gene selected from the group consisting of nuclear factor 4 alpha (HNF4A), sodium-glucose cotransporter (SLC5A1) and albumin (ALB).
[S] The engineered DNA construct of paragraph [Q], wherein the gene is a gene selected from the group consisting of Coagulation Factor VIII (procoagulant component), Acyl CoA dehydrogenase, UDP-glucuronosyl-transferase 1, ATP-binding cassette, sub-family C (ABCC), Apolipoprotein C3 and hepatocyte nuclear factor 1 alpha
(HNFlA).
[T] The engineered DNA construct of any of the paragraphs [A]-[S], wherein the engineered DNA construct is a gene expression construct.
[U] A vector comprising the engineered DNA construct of any one of paragraphs
[A]-[T].
[V] The vector of paragraph [U], wherein the vector is an expression vector adapted for gene therapy or gene transfer.
[W] A modified promoter comprising an engineered DNA construct of any one of paragraphs [A]-[T].
[X] A vector comprising the modified promoter of paragraph [W].
[Y] The vector of paragraph [X], wherein the vector is an expression vector adapted for gene therapy or gene transfer.
[Z] A cell comprising a vector of any one of the paragraphs [U], [V], [X], and [Y].
[AA] A method of enhancing expression of a target gene comprising operably linking the gene to an engineered DNA construct of any one of paragraphs [A]- [T] or a modified promoter of paragraph [W] to form a gene expression construct.
[BB] A method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising:(a) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences, wherein each of the TFRE is separated by 9-15 base-pairs
(bp), and wherein all of the TFREs are response elements (REs) of one transcription
factor (TF); (b) engineering a second DNA construct to further comprise at least two
TFRE segments of step (a), wherein the TFRE segments are separated by 200-700 base pairs; and (c) operably linking the engineered second DNA construct upstream (5') of an
ATG start codon of a target gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct.
[CC] A method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: (a) identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a target gene that is operably linked to the transcription factor dependent promoter; (b) engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences, wherein each of the
TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; (c) engineering a second DNA construct to further comprise at least two TFRE segments, wherein the
TFRE segments are separated by 200-700 base pairs; and (d) operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the target gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
[DD] The method of paragraph [BB] or [CC], wherein the TFRE is in forward direction.
[EE] The method of any of paragraphs [BB], [CC] or [DD], wherein the promoter is a mammalian promoter.
[FF] The method of any of paragraphs [AA]-[EE], wherein the gene expression construct is further transduced into a host cell.
[GG] The method of paragraph [FF], wherein the host cell is selected from a group consisting of stem cells, adult stem cells, embryonic stem cells, induced pluripotent stem cells, hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre- myocytes, myocytes, and muscle cells.
[HH] The method of paragraph [FF], wherein the expression is in vivo.
[II] The method of paragraph [FF], wherein the expression is in vitro.
[0178] This invention is further illustrated by the following example which should not be construed as limiting. The contents of all references cited throughout this application, as well as the figures and table are incorporated herein by reference.
EXAMPLE
[0179] Effective gene therapy requires regulated gene expression and vector safety. Our goal was to generate safe, normally regulated promoters capable of expressing therapeutic proteins. We developed a method to essentially exponentially increase native promoter activity while retaining inherent regulation by inserting multi-copy response elements (REs) into non- adjacent locations. For the hepatocyte nuclear factor (HNF) 4α-dependent Hnfl a (M0DY3) gene, HNF4α stimulation increased from 5-fold to 90-fold by inserting 3 additional HNF4α REs (H4REs). Constructing a promoter with two 4xH4REs 0.25 kb apart by duplicating the 4xH4RE fragment increased stimulation to > 1000-fold. HNF4α-induced protein expression by the duplicate 4xH4RE Hnfl or promoter was comparable to a viral promoter. Converting the two Apolipoprotein C3 (ApoC3) H4REs spaced 0.61 kb apart to 4xH4REs achieved a similar result. Increasing spacing to 2.1 kb with non-promoter DNA abolished the augmentation. Converting the HNF lα RE of the HNF4A (MODYl) P2 promoter to 4xHlRE and adding a second 4xHlRE 0.84 kb upstream increased HNFl α stimulation from 26-fold to >200-fold. Deleting intervening DNA to produce 0.23-kb spacing increased stimulation to >500-fold. Materials and Methods
[0180] Cell lines: HEK-293 cells were provided by Thomas J. Gardella and were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 units of penicillin and 50 units of streptomycin. Rat INS-I insulinoma cells were grown as recommended (29).
[0181] Plasmids and DNA constructs: Promoters were inserted in pGL3-Basic
(Promega, Madison, WI) for manipulation and analysis.
[0182] Hnfl a. Because the transcription start site of the mouse Hnfl a gene has not been definitively established (See Figure 7A), the region 692 bp upstream of the ATG codon was incorporated to ensure inclusion of any functional mouse promoter elements (referred to as mHnfl ά 7ATG). Figure 7A Sequence of the mouse HnflαO.7ATG promoter: The 692 nt upstream of the ATG start codon are shown. Relevant features include (with respect to the ATG): restriction sites for Stul (aggcct; -310), BIpI (gctnagc; -267), and Nhel (gctagc; -43); H4RE (boxed; -279); and putative transcription start sites for mouse Hnflα ("a"; -218; RefSeq: NM_009327), Bach, L, et al.,1990, Genomics, 8:155-164) and human Hra/i αr("c"; -23; RefSeq: NM_000545), Kuo, C.J., et al., 1990, Proc. Natl. Acad. Sci. U. S. A., 87:9838-9842).
[0183] This promoter has comparable activity to the previously studied mHnfl a497 promoter that comprised 510 bp ending 182 bp upstream of the ATG (30). Figure 7B shows the DNA sequences of the oligonucleotides (SEQ. ID. NO: 2 and 3) used to insert 3 additional H4REs (3xH4RE). The 3-nt BIpI overhang (TnA) allows for directional insertion of DNA fragments. The two complimentary 70-mers were synthesized with unique overhangs to match the Hnflα promoter site. Potentially useful restriction sites were also incorporated into the sequence. Nucleotides adjacent to the overhangs were chosen to reconstitute the upstream BIpI site while destroying the downstream site following insertion. This design permits sequential insertion of additional fragments to generate 7xH4RE, 10xH4RE, etc.
[0184] The mHnfl ά 7ATG promoter was modified in two ways. First, additional sets of three H4RE sequences, derived from the two elements found in the human G6Pase gene flanking the element from the human HNFlB gene (TCF2), separated by 9-15 bp (3xH4RE), were sequentially inserted into the BIpI site 8 bp downstream of the native H4RE. The 3-nt BIpI overhang permitted directional insertion of the 3xH4RE duplex and the oligonucleotides were designed to preserve only the BIpI site adjacent to the native H4RE. Figure 7C shown the sequence of the mHnfl α07ATG4xH4RE promoter with 4 H4REs.
[0185] Second, the 0.34-kb fragment containing the 4xH4RE was duplicated between the Stul site 20 bp upstream of the native H4RE and the Nhel site 43 bp upstream of the ATG start codon; creating two 4xH4RE motifs separated by -250 bp. Figure 7D shows the sequence of the mHnfl αDup4xH4RE promoter. The mHnfl α4XH4RE promoter was digested with Nhel, blunt- ended with Klenow, and further digested with Ncol to obtain a promoter with the proximal 43 bp removed. A StuIINcoI fragment from the mHnfl α4XH4RE promoter was ligated into this vector, creating two 4xH4RE motifs or segments separated by 252 bp. Only the Nhel site is reconstituted at the Stul/Nhel junction (bold).
[0186] ApoC3 promoter: Several modifications were made to the human ApoC3 promoter (-890/+24), which has two conserved H4REs separated by 607 bp, -70 and -690 from the transcription start site with the proximal H4RE in reverse orientation (31). The proximal element was converted to the forward direction (a). The H4REs were converted to 4xH4RE motifs or segments. The PCR product was digested with Acc65I/NheI and ligated with the proximal element in converted, forward orientation promoter in step (a). Spacing between the 4xH4RE motifs was adjusted by restriction endonuclease digestion (c), insertion of a cDNA, and removal of various lengths of the cDNA.
[0187] A shorter -706/- 8 promoter fragment was generated by PCR in which both
H4REs were converted to forward 4xH4RE motifs. The H4RE is bold and italicized and the restriction enzyme sites are in bold.
[0188] The PCR primers used to construct the duplicate lxH4RE ApoC3 promoter:
ΗIApoc3IAcc65\J¥ (forward primer inserts Kpnl site immediately upstream of the distal H4RE): gagcctggtaccgggaggggcaaaggcc (SEQ. ID. NO: 24 )
R/Apoc3/BglIUNheIfR (reverse primer inserts BgIII site at 3' terminus, converts proximal H4RE from reverse to forward orientation, and creates adjacent Nhel site): aaatttAGATCTAGGAGGGTTCTGACCTGTTTTATATCATCTCCAGGGCAGCAGGCACTGAGGA
CCCAGGGCGCrGACCrrTGCCCAgctagcGACCAGTGGAGATGAGG (SEQ. ID. NO: 25)
[0189] The PCR primers used to construct the duplicate 4xH4RE ApoC3 promoter:
A/7oc3/4xH4RE/Acc651/&iWl/F (forward primer converts distal H4RE to a 4xH4RE motif with flanking Kpnl and BsfWI sites): aaattTggtac c AAGC AGΓCCAAAGAΓCATGAATTCAC AATGCCAaAGrTAaCGTACGGC T GAG rCCAAAGTrCAGGTCGAgggaggggcaaaggcctc (SEQ. ID. NO: 10)
Apoc3/3xH4-RE/NheI/SpeIfR (reverse primer inserts three H4REs to create a proximal 4xH4RE motif by ligating into duplicate lxH4RE promoter Nhel site):
AAATTTGCTAGCGTCGACTGATCTTTGGACTCACATATGCCΓGAACTΓΓGGACTTGTACTAGTA rrAACrrrGGCATGACCAGTGGAGATGAGGgcc (SEQ. ID. NO: 11)
[0190] Second, the distance between the two motifs was reduced to -0.30 kb by deleting
312 bp between the two Sad sites (-522 and -210). Third, a 1.77 kb HNFl a cON A Sad fragment, encompassing codons 12-600, was inserted into the promoter Sad site in the forward orientation to create a 2.06-kb spacer between the 4xH4RE motifs. Finally, various fragments of the HNFl a cDN A were removed by restriction endonuclease digestion to generate a series of promoters with shorter spacing between the two 4xH4RE motifs: (i) a 757-bp fragment was deleted with Mscl (codons 282-533); (ii) a 1,022-bp fragment was deleted with PspOMI (codons
35-375); (iii) a 1,323-bp fragment was removed between the distal SpαlOI site and the proximal
Msd site (codons 93-533) ; and (iv) a 1,484-bp fragment was removed between the distal
PspOMI site and the proximal BpulOI site (codons 35-530).
[0191] HNF4A P2 promoter: The native 1.0-kb HNF4A P2 promoter, with one conserved HIRE at -0.15 kb, was initially modified by inserting the HIRE found at -8.41 kb in the HNF4A gene at the 5-prime end to generate a promoter with two HlREs separated by 840 bp
(fflVF44-P2DuplxH1/0 84). Subsequently, both HlREs were converted to 4xHlRE motifs (HNF4A- p2 Dup4xHi/o 84^ χhis promoter was further modified in several ways. First, 0.61 kb of DNA
adjacent to the distal motif was deleted to create a 226-bp spacer (HNF44-P2Dup4xH1/023). The distal 4xHlRE was deleted from this promoter, followed by sequential removal of proximal
HlREs. Finally, an HNF4A-P2Dup2xm/021 promoter was constructed from HNF4A-P2Du≠xm/0 84 by deleting two HlREs and adjacent DNA from each motif.
[0192] A human HNF4A P2 promoter fragment (- 1013/- 11 ) was cloned by PCR and ligated into pGL3-Basic using incorporated Sad and Xhol sites (native 1.0-kb promoter).
Putative HIRE located at -8,410 bp was incorporated into the 5 -prime end of the native promoter, creating a promoter with duplicate IxHlRE separated by an 840-bp spacer. Both
HlREs were converted to forward 4xHlRE motifs to create a duplicate 4xHlRE promoter with the same spacing. The 4xHlRE motifs were brought closer by removal of the 610-bp
BsrGl/PflMl fragment, leaving a 230-bp spacer. Removing the distal 4xHlRE motif from the full-length duplicate 4xHlRE promoter with KpnVPβMI produced a promoter with a single
4xHlRE motif and 226 bp upstream DNA. From this promoter, one HIRE was removed by
BsiWUAvrH to create a 3xHlRE motif and two HlREs were removed by BsfWl/Nhel to create a
2xHlRE motif.
[0193] Upstream 4xHlRE: distal HIRE - human αl-AT - human β-fibrinogen - human albumin
[0194] Sites: Kpnl I Distal / Sad I αl-AT / AfM / β-fib / BssHll / Alb / BsrGl
[0195] Downstream 4xΗlRE: human albumin - human αl-AT - human β-fibrinogen - proximal HIRE
[0196] Sites: BsWl I Alb / Avrll I αl-AT / Nhel I β-fib / Ndel I Prox
[0197] HNF4a-V2 Promoter: KpnVSacI to Xhol fragment is shown in Fig. 9A (SEQ.
ID. NO: 13).
[0198] fflVF4α-P2Dup4xH1RE Promoter Sequence: Restriction endonuclease deletions are as follows. Deletion of Dup4xHlRE between BsrGl (tgtaca; -0.99, & PfMl (ccannnnntgg; -
0.38) gives 0.23-kb spacing. Deletion between Kpnl (ggtacc; 5-prime end) & PfMl
(ccannnnntgg; -0.38) gives 0.38-kb promoter with single 4xHlRE motif. Deletion of 4xHlRE promoter between BsϊWl (cgtacg; -0.19) & Avrll (cctagg; -0.19) gives 0.38-kb promoter with single 3xHlRE motif. Deletion of 3xHlRE promoter between BsϊWl (cgtacg; -0.19) & Nhel
(gctagc; -0.19) gives 0.38-kb promoter with single 2xHlRE motif. Deletion of Dup4xHlRE between Mlul (acgcgt; -0.99) & Stul (aggcct; -0.64) and between PfMl (ccannnnntgg; -0.38) &
Nhel (gctagc; -0.19) gives Dup2xHlRE with 0.27 -kb spacing.
[0199] HNF4a-P2Dup4xmRE Promoter Sequences are shown in Fig. 9C and 9D (SEQ. ID.
NO: 17 and 20)
[0200] CMV promoter: The CMV-IE (immediate early) promoter was excised from pcDNA3.1 (Invitrogen) and inserted into pGL3-Basic to assess its activity in comparison to modified native promoters.
[0201] CMV expression plasmids: Plasmid pcDNA3.1 (INVITROGEN™) was used for all expression plasmids. Vectors for HNF4α variants were described previously (30, 32). HA- tagged rat HNF4α3 (rHNF4oc3HA) was constructed by fusing two hemagglutinin epitopes to the C-terminus of the rat HNF4α3 sequence.
[0202] HA-tagged rat HNF4a3 (rHNF4a3HΛ): Two copies of the HA epitope
(YPYDVPDYA (SEQ. ID. NO: 26)) were inserted separated by 2 Gs (YPYD VPD YA-GG- YPYDVPDYA (SEQ. ID. NO: 27)). The reverse primer contained this coding sequence between an Xbal site and the C-terminus of HNF4α9. Amplification with this primer and an exon 7 forward primer generated a product from which an EcoNI (exon 8) / Xbal fragment could be used to HA-tag any exon 8+ variant. Similarly, the EcoNI I Xbal fragment was used to convert the HNF4αl coding sequence in pcDNA3.1 (Huang, J., et al., 2008, Diabetes Metab. Res. Rev., 24:533-543) to rHNF4a3HA. To construct the augmented P2 promoter HNF4a3 expression plasmid, the rHNF4a3HA cDNA was excised with HindIII I Xbal and inserted into pGL3/fflVF44-P2Dup4xH1RE in place of the Luciferase gene (fflVF4αr-P2Dup4xH1RE/rHNF4a3HA). Restriction sites ale single underlined in the sequences below. [0203] Human/h4α9-HA2/XMI/R (anti-sense):
TTAATCTAGATTAAGCATAGTCCGGGACGTCATAGGGATATCCGCCCGCATAGTCAGGAACATC GTATGGGTAAGCAACTTGCCCAAAGC (SEQ. ID. NO: 28)
[0204] (This is a synthetic polynucleotide containing antisense sequence for the Xbal restriction enzyme site, 2 copies of the HA hemagglutinin epitope separated by 2 glycine residues, and 17 nucleotides complementary to 3' terminus of the cDNA coding frame (to fuse the HA epitope codons to the C-terminal end). The HA epitope codons translate to the Tyr-Pro- Tyr-Asp-Val-Pro-Asp-Tyr-Ala (SEQ. ID. NO: 29) sequence found in HA but the particular combinations used do not occur in any extant influenza virus genome sequenced to date.) [0205] DNA sequence (sense): GCTTTGGGCAAGTTGCT TAC CCA TAC GAT GTT
CCT GAC TAT GCG GGC GGA TAT CCC TAT GAC GTC CCG GAC TAT GCT TAA TCTAGATTAA(SEQ. ID. NO: 30) This is the DNA sequence that is synthesized by PCR. The triplet codons are separated for easier comprehension. "GGC" and "GGA" both encode glycine to form a spacer between the 2 HA epitopes for improved antibody binding. [0206] Augmented promoter expression plasmids: The human HNFloc coding sequence was excised from pcDNA3.1 with Pmel and Xbal and inserted between the Ncol (blunt-ended)
and Xbal sites of the pGL3 plasmid, replacing the Luciferase gene (mHnfl αP^^^/hHNFlα). Similarly, the rHNF4α3HA coding sequence was excised from pcDNA3.1 with HincHII and Xbal and fused to the HNF4A-P2Ou≠xm/023 promoter.
[0207] Human HNFIa: Fusion of the human HNFlα cDNA to the mHnfl «DUP4XH4RE promoter: The cDNA was excised from the pcDNA3.1 vector using Pmel (blunt-end) and Xbal and inserted into pGL3-mHnfl βPuP4XH4RE m place of the Luciferase gene between the blunt- ended Ncol site and Xbal. Note that the pGL3 ATG start codon is reconstituted but that this codon is in frame with the ATG start codon of the inserted HNFlα cDNA. ATG are in bold in the sequences below.
[0208] GTTTAAACTTAAGCTT (pcDNA PmeVHindlll) (SEQ. ID. NO: 31) This is the pcDNA3.1+ multiple cloning site nts 901-916; Pmel blunt cuts between "T" & "A" of "GTTTAAAC."
[0209] AAGCTTGGCGGTAGAGGAGCCATGG (HNFlα HindlUj 'ATG) (SEQ. ID. NO: 32)
This is the rat HNFlα cDNA NM_012669 nts 136-154 with 5' "AAGCTT" HindIII site for cloning. The ATG at NM_012669 nts 151-153 is the HNFlα start codon. [0210] CCATGAAACTTAAGCTTGGCGGTAGAGGAGCCATGG (Chimeric
ATG/Pmd/Hmdlll/cDNA) (SEQ. ID. NO: 33). This is the he 1st 5 nts are from pGL3-Basic, nts 86-90 of U57024, part of a "CCATGG" Ncol site containing the ATG start codon for the Luciferase gene. When the 5' overhang of the digested Ncol site is filled in with Klenow, the CCATG is fused to AAAC.... of pcDNA3.1+ nts 905 and following that was created by Pmel digestion.
[0211] CC ATG AAA CTT AAG CTT GGC GGT AGA GGA GCC ATG G
(Repeated with codon breaks) (SEQ. ID. NO: 34) This is the pGL3-Basic U57024 nts 86-90, pcDNA3.1+ nts 905-916, and rat ΗNFlα cDNA NM_012669 nts 136-154. Transfection analyses
[0212] Transient transfections were performed with LIPOFECTAMINE 2000
REAGENT® (INVITROGEN™, Carlsbad, CA) in either 48-well clusters to assess promoter activities by DUAL-LUCIFERASE® (Promega) as previously described (33) or 24-well clusters to measure protein expression by immunoblotting (see below). For reporter assays, a total of 400 ng DNA was added with 200 ng each reporter plasmid (e. g. pGL3-Basic, pGL3-Basic-Hra/4αr- p2 Dup4xΗi/023 ; pGL3_Basic-mH«/i αr4xΗ4RE' pGL3-Basic-mH«/i«Dup4xH4RE, pGL3-Basic-ApoC? Dup4xH4RE/061) and expression vector (e.g. pcDNA-HNF4a3 expression vector) (or empty pcDNA3.1). Reporter assays were performed in triplicate at least twice (n=6-9).
Immunoblot analyses
[0213] Western blotting was performed to assess protein expression from augmented promoter expression plasmids. Plasmids were transiently transfected into HEK-293 cells or INS- 1 cells with or without co-transfected pcDNA-HNF4α3 expression plasmid. Extracts were prepared 48 h later with IP buffer (50 ml Tris-HCl, pH 8.0, 100 mM NaF, 30 mM Na- pyrophosphate, 2 mM Na2MoO4, 1 mM Na3VO4, 5 mM EDTA plus protease inhibitors). Immunoblotting was performed with 40 μg total protein as described (33) or any method known to one skilled in the art. Primary antibodies used were Anti-HA (mouse monoclonal clone 7, specific for human influenza virus hemagglutinin; H3663; Sigma, St. Louis, MO) and Anti- HNFlα(C-19) (sc-6547; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Secondary antibodies were goat anti-mouse IgG-HRP (Santa Cruz) and donkey anti-goat IgG-HRP (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). SUPERSIGNAL West Pico (Pierce, Rockford, IL) was also used for detection. Statistical analyses
[0214] Data are presented as means + SD. Promoter activities were compared by two- tailed paired t tests, with /><0.05 taken as significant. When the number of observations differed, a two-tailed t test assuming unequal variances was substituted. Results
Impact ofH4RE copy number on Hnfl ocpromoter activity
[0215] The mHnfl ά 7ATG promoter, with a conserved H4RE 278 bp upstream of the
ATG start codon (30), was modified by inserting up to five sets of three contiguous H4REs into the BIpI site 20 bp downstream of the native H4RE (Fig. IA; Fig. 7B). The H4RE sequences were derived from the two human GόPase gene elements (-236/-218 and -78/-60 from RefSeq No.: NM_000151) flanking the human HNFlB element (TCF2; -214/-196 from RefSeq NM_000458).
[0216] The multiple H4Res were inserted were separated by 9-15 bp which is the nucleotide spacing close to a single helical DNA turn of 10-11 bp (34,35). Promoter activities were assessed by transient transfection in HEK-293 cells with the indicated mHnfl or promoter reporters (200 ng) alone or in combination with the pcDNA-HNF4α3 expression vector (200 ng).
[0217] Activities were measured by DUAL LUCIFERASE®. Data are presented as fold stimulation over the promoter-less pGL3-Basic plasmid (f , p < 0.01 vs. Basic; *, p < 0.05 vs. lxH4RE; **, p < 0.01 vs. lxH4RE; NS, not significantly different from lxH4RE (n=3; this experiment was repeated with nearly equivalent results). Each promoter had low basal activity,
comparable to the blank pGL3-Basic. However, co-expression of HNF4α3 stimulated each promoter to a different degree (Fig. IB). The native i07ATG promoter was stimulated 11-fold over baseline but the mHnfl ά xH4RE promoter was stimulated further to 72-fold. Incorporating additional H4RE motifs into a segment containing several H4Res enhanced some promoters but did not guarantee further increase in every promoter activity. For example, while the mHnfl ^0xH4RE promoter was enhanced -70% more than mHnfl ά xH4RE (124-fold), the mHnfl c^xlϊ4RE and mHnfl ^3xH4RE promoters had lower activity (only ~40-fold) and the mHnfl ^6xH4RE promoter was less active than the native promoter (7 -fold). These data indicate that promoter activity is not linearly dependent on the number of adjacent H4REs and indicate that boosting Hnfl or promoter activity with additional H4REs (spaced -10 bp) has a limit. Thus we believe that the useful number of transcription factor repeats is 4-16, in some cases 4-10, in some cases 4, 5, 6 7, 8, 9, 10, 11, 12, 13, 14 or 15 repeats are useful. In some cases the 4-7 repeats provides the best enhancement. In some cases 4-6 and in some cases 4-5 repeats.
Insertion of non-adjacent 4xH4RE motifs considerably enhanced Hnfl a promoter activity [0218] It is possible that the close assemblage of many similar cis elements could cause steric interference or otherwise obstruct the transcriptional machinery. To assess the effect of introducing additional H4REs into non-adjacent locations, the 370-bp Stul/Nhel promoter fragment that contained the 4xH4RE motif (mHnfl flPuP4xH4RE ; Fig. 2A) was duplicated. This "duplicated" mHnfl cPu≠xmRE promoter was stimulated by >1100-fold, substantially more than for mHnfl ά1KΪG (~5-fold) or mHnfl αfxH4RE (~88-fold; Fig. 2B). HEK-293 cells were transiently transfected with the indicated mHnfl or promoter reporters (200 ng) alone or in combination with the pcDNA-HNF4a3 expression vector (200 ng). Data are presented as fold stimulation vs. pGL3-Basic (n=3; this experiment was repeated with nearly equivalent results). The numbers above the histograms indicate/? values between activities. Constitutive activity of pGL3 containing the CMV immediate early promoter (200 ng) vs. pGL3-Basic is shown for comparison (gray bar; *, without pcDNA-HNF4a3). Stimulated mHnfl CPUP4XΪ14RE promoter activity is -20% that of the CMV promoter (Fig. 2B). Thus, separating two 4xH4RE motifs led to synergistic interaction rather an additive effect.
[0219] Two alternatives for the strong enhancement exhibited by mHnfl βPuP4xH4RE were considered. First, the StuVNheI fragment was tested for whether it contained elements other than the 4xH4RE that caused the enhancement. However, duplicating this fragment in the native mHnfl ά 7ATG promoter {mHnfl QPUP1XH4RE) did not detectably alter promoter activity. Fig. 7E
shows the effects of Stul/Nhel duplication in the native mHnfl a promoter: The Stul/Nhel fragment was duplicated in the native promoter to generate mHnfl βPuPlxH4RE Tj16 activity of this promoter was compared to the native promoter and 4xH4RE promoters in HEK-293 cells using Dual Lucif erase.
[0220] Second, a putative Nkx-2.2 element (GCAAGTG, reverse orientation; -82A88 with respect to NM_009327) 8 bp upstream of the H4RE was tested for whether its duplication contributed to the strong enhancement. A putative Nkx-2.2 site (consensus = GCAAGTG) is found in reverse orientation immediately upstream of the H4RE (box in Fig. 7F). This site in the mHnfl ά xH4RE promoter and both sites in the mHnfl βPuP4xH4RE promoter were mutated (reverse = TACCTAA). The activities of these promoters were compared to the native and wild- type 4xH4RE promoters in HEK-293 cells using Dual Luciferase. However, mutation of this Nkx-2.2 element in mHnfl α4xH4RE or both elements in mHnfl ODUP4XH4RE (to TACCTAA) more than doubled HNF4α3-stimulated promoter activities in HEK-293 cells (Fig. 7G). The removal of the Nkx-2.2 element did not abolished the enhance activity form the duplicated promoter. These results indicate that it is the 4xH4RE motif is the crucial feature in enhancing activity of the duplicated promoter.
Activity of the HNF4a-dependent ApoC3 promoter is enhanced by insertion of non-adjacent 4xH4RE motifs
[0221] To test whether non-adjacent 4xH4RE motifs could enhance another HNF4α- dependent promoter, the human ApoC3 promoter was examined, which has two H4REs (31) (reverse element at -70 bp and forward element at -690). The proximal response element was first inverted, and then both elements were converted to 4xH4RE motifs (ApoC?Dup4xH4RE/061), and deleted an internal 312-bp Sad fragment to reduce spacing by one-half (ApoC?Dup4xH4RE/030; Fig. 3A). HEK-293 cells were transiently transfected with the indicated AproC3 promoter reporters (200 ng) alone or in combination with the pcDNA-HNF4a3 expression vector (200 ng). HNF4a3 stimulated the native promoter by ~56-fold and ApoC?Dup4xH4RE/061 by >1400-fold in HEK-293 cells (Fig. 3B). Stimulation of the ApoC?Dup4xH4RE/030 promoter, with the 4xH4REs in closer proximity, was lower but still substantial (~480-fold). These stimulated activities are -24% and -8% of CMV, respectively.
Increased spacing between 4xH4RE motifs reduced ApoC3 promoter activity [0222] If favorable spacing between two 4xH4RE motifs is necessary to boost promoter activity, then altering the spacing should affect activity. To test this supposition, an unrelated, "non-functional" DNA (1,767-bp Sad fragment from human HNFl α cDNA NM_000545) was inserted between the 4xH4RE motifs to expand the spacing to 2.06 kb (Fig. 3A). This DNA
fragment does not contain an H4RE and, as a cDNA, has lost the genomic context that may confer chromatin-like behavior. A series of promoters with lesser spacing were generated by deleting internal cDNA fragments and their activities were compared to the ApoC3 promoters with only native intervening DNA (Fig. 3B). Stimulation by HNF4α3 was significantly reduced by increasing the spacing to 2.06 kb (150-fold) or 1.31 kb (118-fold). Further reduction of spacing to 1.04 kb led to slightly higher stimulation (220-fold) and to 0.73 kb or 0.57 kb produced stimulations indistinguishable from the "uninserted" ApoC3Dup4xH4RE/061 promoter. Activity of the HNF 1 -dependent HNF4A P2 promoter is enhanced by insertion of non-adjacent multi-copy HIRE motifs (HNFl response elements)
[0223] To determine whether incorporating non-adjacent multi-copy motifs of a different response element could enhance native promoter activity, the distal P2 promoter of the human HNF4A gene was modified. The P2 promoter, which is -45 kb upstream of the proximal Pl promoter (36-38) and controls preferential expression of several HNF4α variants in the pancreas (39), is HNFl -dependent with a well-characterized HIRE at -0.17 kb (40). First, a 1.0-kb fragment (-1,013/-1I) was cloned into pGL3-Basic. Then, a putative HIRE (-8.41 kb) was inserted at its 5-prime end to generate 840-bp spacing between the two HlREs (Hnf4a- p2 DupixHi/o 84 pig 4A)_ Adding the second H1RE to P2 increased HNFl-responsiveness by about
30%.
[0224] Subsequently, both HlREs were converted to 4xHlRE motifs (Hnf4a- p2 Dup4xHi/o 84^ τhis promoter was furmer modified in several ways. First, 0.61 kb of DNA adjacent to the distal motif was deleted to create a 226-bp spacer (Hnf4a-P2Du≠xm/023). This promoter was further modified by deleting the distal 4xHlRE, followed by sequential removal of HlREs from the downstream motif. Finally, an Hnf4a-P2Dup2xm'027 promoter was constructed from Hnf4a-P2Oa≠xm/0 84 by deleting two HlREs and adjacent DNA from each motif. (B) Promoter activities: HEK-293 cells were transiently transfected with the indicated mHnfl or promoter reporters (200 ng) alone or in combination with the pcDNA-HNF4a3 expression vector (200 ng).
[0225] In the first set of modifications, both HlREs were converted to 4xHlRE motifs
(fflVF44-P2Dup4xH1RE/0 84) and then the spacing between them was reduced to 0.23 kb by deleting 0.61 kb DNA downstream of the distal 4xHlRE (fflVF44-P2Dup4xH1RE/023). HNFlα stimulated the P2DUP4XH1RE/0 84 promoter ~ 180-fold, about 7 times more than the native promoter (26-fold; -3% vs. CMV), and the P2DUP4XH1RE/023 promoter by almost 500-fold (Fig. 4B; -8% vs. CMV). [0226] This result is consistent with the notion that activity increases when spacing is reduced to -700 bp or less, as observed with the ApoC3 promoter.
[0227] In the second set of modifications, the impact of HIRE number and spacing on activity were explored. Deletion of the distal 4xHlRE motif essentially abolished the enhanced activity (to 38-fold stimulation). However, reduction of the remaining 4xHlRE motif to either 3x or 2x motifs re-activated this promoter to stimulations of -180- and ~140-fold, respectively. On the other hand, construction of a promoter with two 2xHlRE motifs spaced 0.27 kb apart also produced remarkably high stimulation (~270-fold).
[0228] Accordingly, one can create enhanced promoters by multiplying segments of at least 2 transcription factor response elements, wherein the transcription factor response elements are 9-15 bp apart, and wherein the segments are about 200-700 base pairs apart. Based on our experiments, to obtain the optimal enhancement, the transcription factor elements are organized in forward orientation with respect to the transcription start site.
[0229] In contrast to the HNF4α-responsive promoters, most modified HNF4A P2 promoters exhibited modest constitutive activity in HEK-293 cells, i.e. independent of co- expressed HNFlα. This constitutive activity was 4-fold for the native promoter and ranged from 1.5-fold for the single 4xHlRE promoter to a high of ~30-fold for the duplicate 2xHlRE promoter. Nevertheless, the consistently high induction ratios with HNFlα (9.5 to >40) indicate that responsiveness to this factor was retained.
Augmented promoters generate detectable amounts of functional transcription factors [0230] To test whether augmented promoters are sufficiently active to generate detectable protein levels with measurable activities, each promoters was fused to coding sequences of their cognate transcription factors: human HNFlα to mHnfl βPuP4xH4RE and HA- tagged rat HNF4a3 (HNF4a3HA) to fflVF44-P2Dup4xH1RE (Fig. 5A & 5B, upper). HEK-293 cells were transiently transfected with the mHnfl cPup4xmRE/HNFl a plasmid with or without the pcDNA-rHNF4a3 expression vector. Whole cell protein was extracted 48 h later to assess HNFIa expression by immunoblotting (pcDNA-HNFla, positive control). For HNF4A- P2Du≠xmRE/HNF4a3HA gene cassette, the coding sequence of rat HNF4a3 was fused to the augmented P2 promoter. HEK-293 or INS-I cells were transiently transfected with the HNF4A- P2Dup4xmRE/HNF4a3HA plasmid and, where indicated, the pcDNA-HNFla expression vector. Whole cell protein was extracted 48 h later to assess HNF4a3HA expression by immunoblotting for the HA tag (pcDNA-HNF4a3HA, positive control). The numbers above the histogram indicate/? values between activities.
[0231] The HA tag enabled detection of ectopic HNF4a3 in the presence of endogenous or transiently expressed HNF4α3. Transient introduction of the HNFlα minigene into HEK-293 cells led to HNF4α-dependent production of the HNFlα protein (Fig. 5A, lower). Similarly, the
HNF4cc3HA minigene exhibited HNFlα-dependent HNF4α3HA expression in HEK-293 cells (using its HA epitope tag; Fig. 5B, lower; arrow). The augmented P2 promoter is constitutively active in INS-I cells (see below) and, consequently, the HNF4α3HA minigene produced protein without exogenous HNFl α expression Fig. 5B, lower; arrows).
[0232] To test whether functional levels of HNFl α and HNF4a3HA are expressed, the activation of reporters was examined (Fig. 5C). HEK-293 cells were transiently transfected with the indicated combinations of reporter plasmid (150 ng), expression plasmid (100 ng), and cognate gene cassette (150 ng). Data are presented as fold stimulation vs. pGL3-Basic (n=3; this experiment was repeated with nearly equivalent results). Brackets indicate p values between activities.
[0233] To test whether the expressed HNFlα and HNF4α3HA are functional, their abilities to activate reporters for their target promoters in HEK-293 cells were examined. As previously shown, the mHnflαDup4xH4RE reporter was markedly stimulated by HNF4α3 (Fig. 5C). In contrast, HNFlα produced a modest but insignificant stimulation while the HNF4A- p2 Dup4xHiRE /HNF4a3 HA gene cassette had no effect However, the mHnflαDup4xH4RE promoter was significantly stimulated by the combination of HNFlα and the HNF4A- P2Dup4xH1RE/HNF4a3HA gene cassette. Similarly, this combination also significantly stimulated the ApoC3Dup4xH4RE/061 promoter (Fig. 5C). On the other hand, the combination of HNF4α3 and the mHnflαDup4xH4RE/HNFla gene cassette did not appreciably stimulate the HNF4A- p2 Du P 4xHiRE promoter (not shown) but the possibility that HNF4α3 inhibited this promoter was not explicitly ruled out.
Enhanced promoter activities are also observed in rat INS-I β cells [0234] The augmented promoters were developed based on their activities in heterologous HEK-293 cells. Thus, it was important to assess how modified promoters behaved in a β cell line that normally expresses HNFlα and HNF4α. Rat INS-I β cells were chosen because they exhibit glucose-dependent insulin secretion (29) and can offer a model for enhancing this property using augmented promoters to express β-cell transcription factors. [0235] To assess activities of modified promoters in a β cell line that normally expresses
HNFlα and HNF4α, the promoters were tested in rat INS-I β cells. Reporter plasmids were transiently transfected into INS-I cells with or without co-transfected pcDNA-HNF4a3 expression vector. Normalized luciferase activities are expressed relative to that of blank pGL3- Basic. Previously, it was found that the mHnfl or promoter is not constitutively active in INS-I cells, but is but is responsive to ectopically increased expression of HNF4α (30). Likewise, none
of the modified mHnfl a promoters exhibited constitutive activity in these cells (activity comparable to blank pGL3-Basic) but each was stimulated by increased HNF4α3 expression. [0236] However, increasing the number of H4REs in the mHnfl or promoter (Fig. 6A) produced results similar to those observed in HEK-293 cells (Fig. IB), although promoters with the highest H4RE copy number were relatively less active in INS-I cells than in the heterologous HEK-293 cells. Moreover, duplicating the 4xH4RE motif somewhat diminished promoter activity in INS-I cells (Fig. 6B) unlike the effect in HEK-293 cells (Fig. 2B). [0237] The behavior of the ApoC3 promoters (Fig. 6C) mirrored that in HEK-293 cells
(Fig. 3B) with the exception that the ApoC?Dup4xH4RE/030 promoter was more active than
A π oDup4xH4RE/0 61
[0238] In contrast, the HNF4A P2 promoters were constitutively active in INS-I cells
(Fig. 6D). These constitutive activities cells were similar to HNF4α-induced activities in HEK- 293 cells (Fig. 4B) except for the low activity of the HNF4A-P2Oup2xmRE/027 promoter. Co- expression of HNF4α modestly increased promoter activities from 10% to 3-fold except for fflVF44-P2Dup4xH1RE/0 84, which was inhibited by 50%. Discussion
[0239] The inventors have developed a strategy to substantially exponentially enhance native promoter activity by amplifying responsiveness to a crucial transcription factor and particularly by using spacers of about 200-700 bp between groups of multi-copy REs. [0240] While tandem RE arrays have been used, under the premise that adjacent elements cooperate in activating transcription (41), their ability to increase promoter activity may be inherently limited.
[0241] The inventors showed that providing a spacer DNA between groups of multiple
REs is very effective in boosting native promoter activity. Specifically, HNF4α induction was increased >200-fold over the native mouse Hnflα promoter by engineering a 4xH4RE motif, then duplicating the fragment containing this motif to obtain duplicate motifs 0.25 kb apart (See Fig. 2B).
[0242] Moreover, the enhanced promoter could drive inducible readily detectable protein expression following transient transfection (See Fig. 5).
[0243] When the strategy was applied to the HNF4α-dependent ApoC3 promoter, taking advantage of its two H4REs spaced 0.61 kb apart, activity was also substantially boosted. [0244] In addition, extension of the "spacer strategy" to the HNFlα-dependent HNF4A
P2 promoter also provided similar results, indicating the applicability to a wide range of genes and REs.
[0245] Moreover, the enhanced Hnflα and HNF4A P2 promoters both drove readily detectable expression of cognate proteins, of which HNFl α was capable of activating target promoters. Accordingly, the same strategy can be applied to many native gene promoters could be modified for use in gene therapy.
[0246] Multiple copies of response elements have been incorporated into promoters to create more sensitive reporters and expression vectors. For instance, the 100-fold inducibility of the β-catenin reporter pSuperTopFlash (19) makes it an excellent reporter but only β-catenin phosphorylation mutants enable the -1000-fold inducibility necessary to achieve physiological levels. Thus, even with this highly potent non-native promoter, the normal enhancement level is still far short of that necessary for effective gene therapy.
[0247] The inventors tested whether a sufficient number of H4REs could be inserted into the native Hnfl or promoter to activate it beyond the generally observed range of 10- to 50-fold. However, at least for closely-arrayed H4REs in the context of the Hnfl or promoter, enhancement reached an apparent plateau with the 10xH4RE promoter and additional elements were ultimately counterproductive. In contrast, separating two 4xH4RE motifs by several hundred base pairs, preferably not exceeding 700 bp led to synergistic activation. The ineffectiveness of duplicating the native lxH4RE fragment to create duplicate lxH4REs separated by the same DNA demonstrated that a repeat of H4Res, namely, 4xH4RE motif was important to the enhancement. This conclusion was further supported by exclusion of the nearby Nkx-2.2 site as the active component in the duplication.
[0248] Accordingly, the data indicate that the introduction of a DNA spacer between two multi-copy motifs or segments was the major factor in augmenting promoter activity and was distinctly superior to introducing additional RE copies alone, based on number of fold increase in reporter gene expression.
[0249] This is the first report to describe enhancement of native promoter activity to the order of 1000-fold over baseline (i.e. activity of the blank reporter or augmented promoter without stimulation) as well to reveal the exceptional ability of spacer DNA to amplify response element multimers.
[0250] The results with the ApoC3 and HNF4A P2 promoters support our conclusion that spacing of several hundred bp, but preferably not exceeding 700 bp between multi-copy motifs is optimum. For ApoC3, spacing of 0.61 kb with native promoter DNA led to the highest activity while deleting half the spacer reduced activity to about one-third. In the other direction, separating the 4xH4RE motifs by >2.0 kb markedly diminished the spacer-dependent stimulation. Much of the lost activity was regained when ~0.6-kb spacing was restored. For
HNF4A P2, activity increased markedly when the native 0.84-kb spacer was reduced to 0.23 kb. The similar result obtained with the three different promoters is compelling evidence for a major role of multi-copy RE motif spacing in boosting promoter activities. [0251] Different HIRE motif configurations produced large changes in HNF4A P2 promoter activity. Two or three HlREs in a single motif conferred greater activity than either 4xHlRE or IxHlRE. In fact, 4xHlRE promoter activity was as low as the IxHlRE promoter. However, when four HlREs were arranged as duplicate 2xHlRE motifs with 0.27-kb spacing, promoter activity was significantly higher than the single, contiguous 4xHlRE arrangement. [0252] The activities of modified promoters in INS-I cells provide further insights. With only few exceptions, relative promoter activities were largely the same in this β cell line as in HEK-293 cells co-transfected with HNF4α3. mHnfl a promoter constructs with more than the four adjacent elements as in the 4xH4RE promoter were weaker than the native promoter. In addition, the mHw/i ctDup4xH4RE promoter with its 8 H4REs was also less active than the single- motif 4xH4RE promoter. These results may reflect the presence of negative regulatory factors in INS-I cells that keep the modified promoters in check to some degree. Also, the active mHnfl α promoter constructs remained dependent on co-transfected HNF4α3 in INS-I cells. This result indicates that promoter behavior was amplified by the modifications and not otherwise altered noticeably. For ApoC3, the ApoC?Dup4xH4RE/061 promoter with its native spacing was about half as potent in INS-I cells as in HEK-293 cells while the ApoC3Dup4xH4RE/030 promoter was markedly more potent. These differences could reflect an ApoC3 promoter element inhibitory in INS-I cells because ApoC3 expression is normally restricted to liver. Finally, it was found that the modified HNF4A P2 constructs had robust basal activities in INS-I cells. This result is also consistent with the amplification of native promoter activity.
[0253] The mHnfl cPup4xmRE and fflVF44-P2Dup4xH1RE promoters in the luciferase reporter plasmid exhibited inducible activity -20% and -8% obtainable with the strong, constitutive CMV promoter, respectively. Moreover, active HNFIa and HNF4a3HA proteins were expressed from these promoters and this demonstrated that both gene cassettes can function effectively in gene expression. Furthermore, production of readily-detectible HNF4a3HA in INS-I cells relying on constitutive HNF44-P2Dup4xH1RE promoter activity indicates that gene expression modules can be designed with native promoters for a variety of cell types. [0254] The references cited herein and throughout the specification are incorporated herein by reference. References
1. Okita, K., Ichisaka, T. and Yamanaka, S. (2007) Generation of germline-competent induced pluripotent stem cells. Nature, 448:313-317.
2. Yamada, K., Tsukahara, T., Yoshino, K., Kojima, K., Agawa, H., Yamashita, Y., Amano, Y., Hatta, M., Matsuzaki, Y., Kurotori, N. et al. (2009) Identification of a high incidence region for retroviral vector integration near exon 1 of the LM02 locus. Retro virology, 6:79.
3. Nam, CH. and Rabbitts, T.H. (2006) The role of LM02 in development and in T cell leukemia after chromosomal translocation or retroviral insertion. MoI. Ther., 13:15-25.
4. Gossen, M. and Bujard, H. (2002) Studying gene function in eukaryotes by conditional gene inactivation. Annu. Rev. Genet., 36:153-173.
5. Jackson, D. A. (2003) The principles of nuclear structure. Chromosome Res., 11:387-401.
6. West, A. G. and Fraser, P. (2005) Remote control of gene transcription. Hum. MoI. Genet., 14 (Spec No l):R101-lll.
7. Grosveld, F., van Assendelft, G.B., Greaves, D.R. and Kollias, G. (1987) Position- independent, high-level expression of the human beta-globin gene in transgenic mice. Cell, 51:975-985.
8. Fraser, P. and Grosveld, F. (1998) Locus control regions, chromatin activation and transcription. Curr. Opin. Cell Biol., 10:361-365.
9. Li, Q., Peterson, K.R., Fang, X. and Stamatoyannopoulos, G. (2002) Locus control regions. Blood, 100:3077-3086.
10. Wang, Y., Yu, L. and Geller, A.I. (1999) Diverse stabilities of expression in the rat brain from different cellular promoters in a helper virus-free herpes simplex virus type 1 vector system. Hum. Gene Ther., 10:1763-1771.
11. Hwang, D.Y., Carlezon, W.A., Jr., Isacson, O. and Kim, K.S. (2001) A high-efficiency synthetic promoter that drives transgene expression selectively in noradrenergic neurons. Hum. Gene Ther., 12:1731-1740.
12. German, M.S., Moss, L.G., Wang, J. and Rutter, WJ. (1992) The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical beta-cell nuclear complexes. MoI. Cell Biol., 12:1777-1788.
13. Sander, M., Griffen, S.C., Huang, J. and German, M.S. (1998) A novel glucose- responsive element in the human insulin gene functions uniquely in primary cultured islets. Proc. Natl. Acad. Sci. U. S. A., 95:11572-11577.
14. Zaret, K.S., DiPersio, CM., Jackson, D.A., Montigny, WJ. and Weinstat, D.L. (1988) Conditional enhancement of liver- specific gene transcription. Proc. Natl. Acad. Sci. U. S. A., 85: 9076-9080.
15. Wang, X., Kong, L., Zhang, G.R., Sun, M. and Geller, A.I. (2004) A preproenkephalin- neurofilament chimeric promoter in a helper virus-free herpes simplex virus vector enhances long-term expression in the rat striatum. Neurobiol. Dis., 16:596-603.
16. Shaw, K.L., Pais, E., Ge, S., Hardee, C, Skelton, D., Hollis, R.P., Crooks, G.M. and Kohn, D.B. (2009) Lentiviral vectors with amplified b cell-specific gene expression. Gene Ther. 16:998-1008.
17. Venter, M. and Warnich, L. (2009) In silico promoters: modelling of cis-regulatory context facilitates target predictio. J. Cell MoI. Med., 13:270-278.
18. Kaluz, S., Kaluzova, M. and Stanbridge, EJ. (2008) Rational design of minimal hypoxia-inducible enhancers. Biochem. Biophys. Res. Commun., 370:613-618.
19. Veeman, M.T., Slusarski, D.C., Kaykas, A., Louie, S.H. and Moon, R.T. (2003) Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr. Biol., 13:680-685.
20. Miura, N. and Tanaka, K. (1993) Analysis of the rat hepatocyte nuclear factor (HNF) 1 gene promoter: synergistic activation by HNF4 and HNFl proteins. Nucleic Acids Res., 21:3731-3736.
21. Piaggio, G., Tomei, L., Toniatti, C, De Francesco, R., Gerstner, J. and Cortese, R. (1994) LFB1/HNF1 acts as a repressor of its own transcription. Nucleic Acids Res., 22:4284- 4290.
22. Gragnoli, C, Lindner, T., Cockburn, B.N., Kaisaki, PJ., Gragnoli, F., Marozzi, G. and Bell, G.I. (1997) Maturity-onset diabetes of the young due to a mutation in the hepatocyte nuclear factor-4a binding site in the promoter of the hepatocyte nuclear factor- Ia gene. Diabetes, 46:1648-1651.
23. Jung, D. and Kullak-Ublick, G.A. (2003) Hepatocyte nuclear factor Ia: a key mediator of the effect of bile acids on gene expression. Hepatology, 37:622-631.
24. Yamagata, K., Oda, N., Kaisaki, PJ., Menzel, S., Furuta, H., Vaxillaire, M., Southam, L., Cox, R.D., Lathrop, G.M., Boriraj, V.V. et al. (1996) Mutations in the hepatocyte nuclear factor-la gene in maturity-onset diabetes of the young (M0DY3). Nature, 384:455-458.
25. Yamagata, K., Furuta, H., Oda, N., Kaisaki, PJ., Menzel, S., Cox, NJ., Fajans, S. S., Signorini, S., Stoffel, M. and Bell, G.I. (1996) Mutations in the hepatocyte nuclear factor-4a gene in maturity-onset diabetes of the young (MODYl). Nature, 384:458-460.
26. Servitja, J.M. and Ferrer, J. (2004) Transcriptional networks controlling pancreatic development and b cell function. Diabetologia, 47:597-613.
27. Ferrer, J. (2002) A genetic switch in pancreatic b-cells: implications for differentiation and haploinsufficiency. Diabetes, 51:2355-2362.
28. Ladias, J.A., Hadzopoulou-Cladaras, M., Kardassis, D., Cardot, P., Cheng, J., Zannis, V. and Cladaras, C. (1992) Transcriptional regulation of human apolipoprotein genes ApoB, ApoCIII, and ApoAII by members of the steroid hormone receptor superfamily HNF-4, ARP-I, EAR-2, and EAR-3. J. Biol. Chem., 267:15849-15860.
29. Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P.A. and Wollheim, CB. (1992) Establishment of 2-mercaptoethanol-dependent differentiated insulin- secreting cell lines. Endocrinology, 130:167-178.
30. Huang, J., Karakucuk, V., Levitsky, L.L. and Rhoads, D.B. (2008) Expression of HNF4a variants in pancreatic islets and Ins-1 b cells. Diabetes Metab. Res. Rev., 24:533-543.
31. Ogami, K., Hadzopoulou-Cladaras, M., Cladaras, C. and Zannis, V.I. (1990) Promoter elements and factors required for hepatic and intestinal transcription of the human ApoCIII gene. J. Biol. Chem., 265:9808-9815.
32. Huang, J., Levitsky, L.L. and Rhoads, D.B. (2009) Novel P2 promoter-derived HNF4a isoforms with different N-terminus generated by alternate exon insertion. Exp. Cell Res., 315:1200-1211.
33. Yang, F., Agulian, T., Sudati, J.E., Rhoads, D.B. and Levitsky, L.L. (2004) Developmental regulation of galactokinase in suckling mouse liver by the Egr-1 transcription factor. Pediatr. Res., 55:822-829.
34. Wang, J.C. (1979) Helical repeat of DNA in solution. Proc. Natl. Acad. Sci. U. S. A., 76: 200-203.
35. Larsson, E., Lindahl, P. and Mostad, P. (2007) HeliCis: a DNA motif discovery tool for colocalized motif pairs with periodic spacing. BMC Bioinformatics, 8:418.
36. Nakhei, H., Lingott, A., Lemm, I. and Ryffel, G. U. (1998) An alternative splice variant of the tissue specific transcription factor HNF4a predominates in undifferentiated murine cell types. Nucleic Acids Res., 26:497-504.
37. Thomas, H., Jaschkowitz, K., Bulman, M., Frayling, T.M., Mitchell, S. M., Roosen, S., Lingott-Frieg, A., Tack, CJ. , Ellard, S., Ryffel, G.U. et al. (2001) A distant upstream promoter of the HNF-4a gene connects the transcription factors involved in maturity-onset diabetes of the young. Hum. MoI. Genet., 10:2089-2097.
38. Torres-Padilla, M. E. and Weiss, M. C. (2003) Effects of interactions of hepatocyte nuclear factor 4a isoforms with coactivators and corepressors are promoter- specific. FEBS Lett., 539:19-23.
39. Boj, S.F., Parrizas, M., Maestro, M.A. and Ferrer, J. (2001) A transcription factor regulatory circuit in differentiated pancreatic cells. Proc. Natl. Acad. Sci. U. S. A., 98:14481- 14486.
40. Briancon, N., Bailly, A., Clotman, F., Jacquemin, P., Lemaigre, F.P. and Weiss, M. C. (2004) Expression of the a7 isoform of hepatocyte nuclear factor (HNF) 4 is activated by HNF6/OC-2 and HNFl and repressed by HNF4al in the liver. J. Biol. Chem., 279:33398-33408.
41. Ptashne, M. (1988) How eukaryotic transcriptional activators work. Nature, 335:683- 689.
42. Jensen, P. R. and Hammer, K. (1998) The sequence of spacers between the consensus sequences modulates the strength of prokaryotic promoters. Appl. Environ. Microbiol., 64, 82- 87.
43. Solem, C. and Jensen, P.R. (2002) Modulation of gene expression made easy. Appl. Environ. Microbiol., 68, 2397-2403.
44. Gupta, S., Dennis, J., Thurman, R.E., Kingston, R., Stamatoyannopoulos, J. A. and Noble, W.S. (2008) Predicting human nucleosome occupancy from primary sequence. PLoS Comput. Biol., 4:el000134.
45. Kuhn, R.M., Karolchik, D., Zweig, A.S., Wang, T., Smith, K.E., Rosenbloom, K.R., Rhead, B., Raney, BJ. , Pohl, A., Pheasant, M. et al. (2009) The UCSC Genome Browser Database: update 2009. Nucleic Acids Res., 37:D755-761.
> m
ω c
OD ω
m ω x m m
70 c ι— m
K) CD
> m
K)
ω c ro ω
m ω x m m
70 c m
TE
>
U)
ω
X m m
70 m
>
ω c
OD ω
m ω x m σ m o>
70 c ι— m
K) CD
TABLE 5
> m
ω c
OD ω
m ω x m m
70 c ι— m
Claims
1. An engineered DNA construct for increasing gene expression from a transcription factor (TF) dependent promoter comprising at least one transcription factor response element (TFRE) segment, wherein the segment comprises between four and 16 consecutive TFREs, wherein each of the TFRE is separated by about 9 to 15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) for one transcription factor (TF).
2. The engineered DNA construct of claim 1, wherein the engineered DNA construct is operably linked upstream (5') of an ATG start codon of a target gene that is operably linked to a TF dependent promoter.
3. The engineered DNA construct of claim 1 or 2, wherein the TFRE is in forward direction.
4. The engineered DNA construct of any one of claims 1-3, wherein the promoter is a mammalian promoter.
5. The engineered DNA construct of any one of claims 1-3, wherein the promoter is a non- human mammalian promoter.
6. The engineered DNA construct of any one of claims 1-3, wherein the promoter is a non- mammalian promoter.
7. The engineered DNA construct of any one of claims 1-6, wherein the engineered DNA construct comprising at least two TFRE segments, wherein the two segments are separated by 200 -700 base-pairs.
8. The engineered DNA construct of any of claims 1-7, wherein at least one TFRE is native to the promoter of the gene.
9. The engineered DNA construct of claim 4, wherein the mammalian promoter is selected from a group consisting human, non-primate mammal, rat, dog, and hamster.
10. The engineered DNA construct of any one of claims 1-9, wherein the gene is a mammalian gene.
11. The engineered DNA construct of claim 10, wherein the mammalian gene is a non- human mammalian gene.
12. The engineered DNA construct of claim 10, wherein the mammalian gene is a human gene.
13. The engineered DNA construct of any of the claims 1-12, wherein the TF is a selected from a group of consisting of homeo-domain type, nuclear hormone receptor type, basic- leucine zipper type (bZIP), winged helix type, and heat-shock type TF.
14. The engineered DNA construct of claim 13, wherein the TF is a homeo-domain type TF.
15. The engineered DNA construct of claim 14, wherein the homeo-domain type TF is a hepatocyte nuclear factor 1 alpha (HNFl α) TF.
16. The engineered DNA construct of claim 13, wherein the TF is a nuclear hormone receptor type TF.
17. The engineered DNA construct of claim 16, wherein the nuclear hormone receptor type TF is a hepatocyte nuclear factor 4 alpha (HNF4α).
18. The engineered DNA construct of claim 15, wherein the gene is a gene selected from the group consisting of nuclear factor 4 alpha (HNF4A), sodium-glucose cotransporter (SLC5A1) and albumin (ALB).
19. The engineered DNA construct of claim 17, wherein the gene is a gene selected from the group consisting of Coagulation Factor VIII (procoagulant component), Acyl CoA dehydrogenase, C-4 to C-12 straight chain, UDP-glucuronosyl-transferase 1, ATP- binding cassette, sub-family C (ABCC), Apolipoprotein C3 and hepatocyte nuclear factor 1 alpha (HNFlA).
20. The engineered DNA construct of any of the claims 1-19, wherein the engineered DNA construct is a gene expression construct.
21. A vector comprising the engineered DNA construct of any one of claims 1-20.
22. The vector of claim 21, wherein the vector is an expression vector adapted for gene therapy or gene transfer.
23. A modified promoter comprising an engineered DNA construct of any one of claims 1- 20.
24. A vector comprising the modified promoter of claim 23.
25. The vector of claim 24, wherein the vector is an expression vector adapted for gene therapy or gene transfer.
26. A cell comprising a vector of any one of the claims 21, 22, 24, and 25.
27. A method of enhancing expression of a target gene comprising operably linking the gene to an engineered DNA construct of any one of claims 1-20 or a modified promoter of claim 23 to form a gene expression construct.
28. A method for enhancing gene expression from a transcription factor (TF) dependent promoter comprising: a. engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive TFRE sequences, wherein each of the TFRE is separated by 9-15 base-pairs (bp), and wherein all of the TFREs are response elements (REs) of one transcription factor (TF); b. engineering a second DNA construct to further comprise at least two TFRE segments of step (a), wherein the TFRE segments are separated by 200-700 base pairs; and c. operably linking the engineered second DNA construct upstream (5') of an ATG start codon of a target gene regulated by the TF dependent promoter that is operably linked to the gene to make a gene expression construct.
29. A method for modifying a promoter to enhance gene expression from a transcription factor dependent promoter comprising: a. identifying a native transcription factor response element (TFRE) in a DNA sequence comprising the promoter that is located upstream (5') of an ATG start codon of a target gene that is operably linked to the transcription factor dependent promoter; b. engineering a first DNA construct comprising a transcription factor response element (TFRE) segment comprising between four and 16 consecutive native transcription factor RE sequences, wherein each of the TFREs are separated by 9-15 base-pairs (bp); and wherein all of the TFREs are response elements (REs) of a transcription factor (TF) that binds the native TFRE; c. engineering a second DNA construct to further comprise at least two TFRE segments, wherein the TFRE segments are separated by 200-700 base pairs; and d. operably linking the engineered second DNA construct upstream (5') of the ATG start codon of the target gene regulated by transcription factor dependent promoter that is operably linked to the gene to make a gene expression construct.
30. The method of claim 28 or 29, wherein the TFRE is in forward direction.
31. The method of any of claims 28, 29 or 30, wherein the promoter is a mammalian promoter.
32. The method of any of claims 27-31, wherein the gene expression construct is further transduced into a host cell.
33. A method of enhancing expression of a target gene comprising transducing into a host cell with a vector of claims 21, 22, 24, and 25.
34. The method of claim 33, wherein the host cell is selected from a group consisting of stem cells, adult stem cells, embryonic stem cells, induced pluripotent stem cells, hepatocytes, pancreatic beta cells, intestinal mucosal cells, intestinal mucosal cells, renal proximal tubule cells, hematopoietic cells, epidermal cells, endothelial cell, pre-myocytes, myocytes, and muscle cells.
35. The method of claim 34, wherein the expression is in vivo.
36. The method of claim 34, wherein the expression is in vitro.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/375,587 US8829177B2 (en) | 2009-06-05 | 2010-06-05 | Enhanced engineered native promoters and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18447509P | 2009-06-05 | 2009-06-05 | |
| US61/184,475 | 2009-06-05 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010141924A2 true WO2010141924A2 (en) | 2010-12-09 |
| WO2010141924A3 WO2010141924A3 (en) | 2011-04-21 |
Family
ID=43298586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/037551 Ceased WO2010141924A2 (en) | 2009-06-05 | 2010-06-05 | Enhanced engineered native promoters and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US8829177B2 (en) |
| WO (1) | WO2010141924A2 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014071272A1 (en) * | 2012-11-02 | 2014-05-08 | The Johns Hopkins University | Methods and compositions for detecting internal tandem duplication mutations |
| US10058624B2 (en) | 2015-04-16 | 2018-08-28 | Emory University | Recombinant promoters and vectors for protein expression in liver and use thereof |
| EP3495487A4 (en) * | 2016-06-29 | 2019-12-04 | Universidad De Chile | PROMOTER COMPRISING A REGION RICH IN CITOSIN-GUANINE DINUCLEOTIDES, VECTORS, CELL LINES, PROCESS FOR PRODUCING RECOMBINANT PROTEIN |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023121377A1 (en) * | 2021-12-24 | 2023-06-29 | 주식회사 툴젠 | Novel promoter and use thereof |
| JP2026504811A (en) * | 2022-12-29 | 2026-02-10 | エンコーデッド セラピューティクス, インコーポレイテッド | Materials and methods for characterizing efficacy |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU1203801A (en) | 1999-10-14 | 2001-04-23 | Regents of The University of California System, The | Chimeric transcriptional regulatory element compositions and methods for increasing prostate-targeted gene expression |
| DE10220894A1 (en) | 2002-05-10 | 2003-11-27 | Rhein Biotech Proz & Prod Gmbh | Promoters with changed transcription efficiency |
-
2010
- 2010-06-05 WO PCT/US2010/037551 patent/WO2010141924A2/en not_active Ceased
- 2010-06-05 US US13/375,587 patent/US8829177B2/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014071272A1 (en) * | 2012-11-02 | 2014-05-08 | The Johns Hopkins University | Methods and compositions for detecting internal tandem duplication mutations |
| US10058624B2 (en) | 2015-04-16 | 2018-08-28 | Emory University | Recombinant promoters and vectors for protein expression in liver and use thereof |
| US10898588B2 (en) | 2015-04-16 | 2021-01-26 | Emory University | Recombinant promoters and vectors for protein expression in liver and use thereof |
| EP3495487A4 (en) * | 2016-06-29 | 2019-12-04 | Universidad De Chile | PROMOTER COMPRISING A REGION RICH IN CITOSIN-GUANINE DINUCLEOTIDES, VECTORS, CELL LINES, PROCESS FOR PRODUCING RECOMBINANT PROTEIN |
Also Published As
| Publication number | Publication date |
|---|---|
| US20120094375A1 (en) | 2012-04-19 |
| WO2010141924A3 (en) | 2011-04-21 |
| US8829177B2 (en) | 2014-09-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Serfling et al. | Enhancers and eukaryotic gene transcription | |
| Lichtsteiner et al. | A glycosylated liver-specific transcription factor stimulates transcription of the albumin gene | |
| AU2004263865B2 (en) | Methods and compositions for targeted cleavage and recombination | |
| CA2554966C (en) | Methods and compostions for targeted cleavage and recombination | |
| JP7258031B2 (en) | Functional nucleic acid molecule and use thereof | |
| EP2643459B1 (en) | Inducible expression system transcription modulators comprising a distributed protein transduction domain and methods for using the same | |
| US8829177B2 (en) | Enhanced engineered native promoters and uses thereof | |
| KR20110119650A (en) | Triple-helical protein and its manufacturing method | |
| Cheng et al. | Aberrant splicing events caused by insertion of genes of interest into expression vectors | |
| Martin et al. | Upstream stimulatory factor (USF) and neurogenic differentiation/beta-cell E box transactivator 2 (NeuroD/BETA2) contribute to islet-specific glucose-6-phosphatase catalytic-subunit-related protein (IGRP) gene expression | |
| CN101979547B (en) | Isolation and cloning of a promoter suitable for porcine skeletal muscle gene expression and identification of its core region | |
| KR20230137399A (en) | Functional nucleic acid molecules and methods | |
| WO2024010028A1 (en) | Circular rna molecule, and translation control method, translation activation system and pharmaceutical composition using same | |
| Zhang et al. | Genome writing to dissect consequences of SVA retrotransposon disease X-Linked Dystonia Parkinsonism | |
| EP4314302A1 (en) | Tetracycline-inducible expression systems | |
| CN109207517B (en) | Drug-inducible CRISPR/Cas9 systems for genome editing and transcriptional regulation | |
| JP2004500884A (en) | Methods and means for regulating gene expression | |
| Pineyro et al. | GAGA factor repression of transcription is a rare event but the negative regulation of Trl is conserved in Drosophila species | |
| Pruzina et al. | Transcriptional activation by hypersensitive site three of the human β-globin locus control region in murine erythroleukemia cells | |
| Salato et al. | An exonic splicing enhancer within a bidirectional coding sequence regulates alternative splicing of an antisense mRNA | |
| WO2007021353A2 (en) | Improving antibody expression using vectors containing insulator elements | |
| NL2027815B1 (en) | Genomic integration | |
| Hu | Co-opting regulation bypass repair (CRBR) as gene editing strategy in mouse and human pancreatic beta cells | |
| Gallagher et al. | Systematic characterization of existing and novel inducible transgenic systems in human pluripotent stem cells after prolonged differentiation | |
| Huang et al. | Boosting native promoter activities with non-adjacent response-element multimers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10784216 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13375587 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10784216 Country of ref document: EP Kind code of ref document: A2 |





