WO2010135782A1 - Plant resistant to white rust - Google Patents

Abstract

The invention relates to a Brassica oleracea plant resistant to white rust disease caused by the oomycete A. candida race 9 Australian variant. The invention also relates to a part of the plant including an embryo, protoplast, meristematic cell, pollen, leaf, anther, stem, petiole, root, root tip, flower, seed, or head, and to propagation or tissue culture material derived from the plant or part of the plant.

Description

PLANT RESISTANT TO WHITE RUST

The present invention relates to plants which are resistant to white rust. The present invention further relates to a method for providing plants which are resistant to white rust, DNA markers for white rust resistance and their use in identifying plants resistant to white rust .

BACKGROUND

The oomycete Albugo Candida (Pers. ex. Lev.) Kuntze is an obligate biotrophic pathogen of the Brassicaceae family, also known as the crucifer family, and causes the widespread disease known as white rust (also known as white blister, staghead, A. cruciferum or A. cruelferatum) . This disease is destructive to many vegetable and oilseed crops such as broccoli, cabbage, rape, mustard and radish.

White rust has been observed worldwide, in countries as geographically and environmentally diverse as India,

Canada, Europe and Australia. In Australia, white rust has spread to Brassicaceae crops in southern parts of the country.

A. Candida is highly specialized, grows between living host cells and causes a range of symptoms that can be the result of local or systemic infection. The genus Albugo includes several species that cause white rust on a range of hosts and within A. Candida various host- specialized forms have been reported. The growth of A. Candida leads to two types of infections, local or systemic. Local infection is characterised by white or creamy-yellow pustules of zoosporangia that form under the epidermis of the host . These usually develop on the lower (abaxial) surface of the leaf and to a lesser extent on the upper (adaxial) surface and occur more commonly on mature leaves. However, they may be localized on any aerial host organ. Initially, the pustules are small and discrete but eventually become large and confluent. Once the pustule is fully developed, the host epidermis ruptures to release a dry, powdery burst of zoosporangia. Subsequently, necrosis of the surrounding leaf tissue may occur.

Localized infection does not usually result in extensive yield loss but systemic infection can have a severe impact on the productivity of crops grown for seed or floral parts. Systemic infection appears to trigger sexual reproduction of the oomycete and causes distortion, hyperplasia and hypertrophy of the inflorescences, stems and leaves. It can also result in sterility if the flower petals, ovules and pollen grains are malformed as a result of the disease. A. Candida grows best at moderate temperatures of between 10 and 20⁰C and in moist conditions. A leaf wetness period of 2.5 hours is sufficient to result in infection, which becomes symptomatic after an incubation period of 10 to 14 days. Brassica is a plant genus in the family Brassicaceae

(formerly referred. to as Cruciferae) . The genus Brassica comprises a number of important agricultural and horticultural crops, including rape, cauliflower, broccoli and turnip. Almost all parts of these plants can be used as food. Rape and rape seed are also used for oil, both for consumption and for fuel. Some species with white or purple flowers or distinct colour or shaped leaves are cultivated for ornamental purposes. The Brassicaceae family occurs worldwide and comprises annuals, biennials and perennials. The family also comprises a large number of wild species.

In some crops white rust can cause huge losses in yield. In other Brassica crops white rust affects the appearance of the plant so the crop is no longer commercially viable because of the cosmetic damage. There is therefore a great need for Brassica crops which are resistant to white rust. The inheritance of resistance to white rust has been shown to vary both between and within host species. Resistance to white rust has been studied in B. rapa, B. napus and A. thaiiana and has been found to be controlled either by a single dominant gene, as in B. juncea, B. ca.rin.ata, B. nigra, or by multiple genes where the resistance is said to be polygenic. Resistance to white rust has also been associated with specific biochemical properties of the host, such as elevated levels of certain sugars, chlorophyll or phenols.

A. Candida is now subdivided into several races that are specialised to infect specific hosts. This high degree of host specificity is a characteristic of A. Candida.

Table 1

Recently, these races of A. Candida have been subdivided to acknowledge the existence of different variants within a race. Two broad variants of race 7 have been identified, based on their virulence to two varieties of B. rapa, and four variants of race 2 have been characterised, based on their virulence to eleven cultivars of B. juncea.

Over the past few years, A. Candida race 9 has spread to B. oleracea cv Italica (broccoli) and B. oleracea cv Botrytis (cauliflower) crops in southwest Australia, making this pathogen the number one concern for broccoli and cauliflower breeding in Australia. This oomycete pathogen is growing on Broccoli leaves, stem or curds showing white spot symptoms on leaves and transforming buds into white erected pin heads that affect the curd quality and shelf life. The Australian A. Candida strain infecting B. oleracea differs from the one generally accepted in other parts of the world as A. Candida race 9. Further, the Australian race 9 appears in some experiments to be more aggressive towards broccoli than towards cabbage while in Europe, the race 9 appears to be more aggressive towards cabbage and Brussels sprouts. It is therefore believed that race 9 comprises at least two variants, the European variant and the Australian variant. The white rust outbreaks in many broccoli crops have been reported to be very serious. In many situations infection rates have been as high as 100%, with the only recourse being to destroy the entire crop. In neglected fields, complete infection of every part of every plant, from the leaves to the broccoli head, is often observed. The spore load from the mature sporangia is so extensive that a cloud of spores can be seen upon physical disruption of an infected plant.

At the moment few agents are known which can be used to control white rust in Brassicas. Current control methods generally involve a combination of management practices (controlled watering, ventilation, balanced program of nutrition) and a fungicide spray program. However, an increasing number of countries have implemented policy aimed at reducing the use of chemical crop protection agents. If the use of chemical control agents is banned completely, this would result in major problems in the cultivation of Brassica species.

Genetic resistance to A. Candida in broccoli (Brassica oleracea var. italica) would be beneficial in the control of white rust. Such resistance would not only increase the stability of crop protection, but would also result in a reduced, or eliminated, requirement for environmentally harmful, and not always effective, fungicide applications.

WO2008130503 illustrates B. oleracea plants allegedly containing a monogenic dominant resistance gene to A. Candida, but not to the Australian variant. Therefore, there is an unfulfilled need for broccoli plants with an improved resistance to the Australian variant of A. Candida.

SUMMARY

A first aspect provides a plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, comprising a resistance gene which is dominant, the resistance being introduced into the plant or its progeny by plant breeding with a resistant plant or recombinant manipulation. The invention also provides parts of such plants including, but not limited to embryos, protoplasts, meristematic cells, pollen, leaves, anthers, stems, petioles, roots, root tips, shoots, flowers, seeds, and heads.

The invention also extends to progeny of the plant of the first aspect.

In one embodiment of the first aspect, the resistance gene is monogenic.

In one embodiment of the first aspect, the resistance gene comprises SEQ ID NO : 1 or SEQ ID NO: 2 or a variant of either thereof having at least 50% sequence identity with SEQ ID NO : 1 or SEQ ID NO: 2 and being capable of conferring resistance to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

In an alternative embodiment of the first aspect, the resistance gene is linked to the nucleic acid sequence provided as SEQ ID NO : 1 or SEQ ID NO: 2. In this embodiment the resistance gene is "linked" to SEQ ID NO: 1 or 2 and does not contain either sequence. It may be that the resistance gene overlaps in part with SEQ ID NO: 1 or 2 but does not contain the whole of either sequence, either in the entire resistance gene or the coding region of the resistance gene.

The plant of the first aspect, being genetically resistant to white rust, provides a new, environmentally desirable option for the cultivation of brassicas . This is particularly important in light of the trend towards the reduction and elimination of chemical means of pathogen control throughout the world. Without adequate control of white rust, commercial cultivation of brassicas would be impossible due to the cosmetic and yield impact of the oomycete A. Candida race 9 Australian variant.

A second aspect provides an isolated nucleic acid molecule comprising or linked to SEQ ID NO: 1 or SEQ ID NO: 2 or a homologue of either thereof either capable of conferring resistance to white rust disease caused by the oomycete A. Candida race 9 Australian variant or linked to a nucleic acid molecule capable of conferring resistance to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

In an embodiment of the second aspect, the nucleic acid molecule comprising or linked to SEQ ID NO: 1 is less than 10.0 kb long, or less than 7.5 kb long, or less than 5.0 kb long, or less than 3.5 kb long, or less than 3.3 kb long, or less than 3.0 kb long, or less than 2.5 kb long, or less than 2.0 kb long, or less than 1.5 kb long, or less than 1.0 kb long, or less than 750 bases long, or less than 500 bases long, or less than 450 bases long, or less than 400 bases long. In a specific embodiment the nucleic acid molecule consists essentially of, or has, the nucleic acid sequence provided as SEQ ID NO: 1.

In another embodiment of the second aspect, the nucleic acid molecule comprising or linked to SEQ ID NO: 2 is less than 10.0 kb long, or less than 7.5 kb long, or less than 5.0 kb long, or less than 3.5 kb long, or less than 3.3 kb long, or less than 3.0 kb long, or less than 2.5 kb long, or less than 2.0 kb long, or less than 1.5 kb long, or less than 1.0 kb long, or less than 750 bases long, or less than 500 bases long, or less than 450 bases long, or less than 400 bases long or less than 350 bases long, or less than 300 bases long, or less than 250 bases long, or less than 200 bases long, or less than 150 bases long, or less than 100 bases long. In a specific embodiment the nucleic acid molecule consists essentially of, or has, the nucleic acid sequence provided as SEQ ID NO: 2.

The isolated nucleic acid molecules of the second aspect are capable of being used to distinguish resistant plants generated by breeding techniques from those plants that failed to inherit the resistance gene. The identification of these nucleic acid fragments provides a rapid and accurate means of confirming white rust resistance that eliminates the requirement for traditional field inoculation tests. This is a great improvement that will save time and money in the development of new white rust resistant brassica varieties.

A third aspect provides the use of the nucleic acid molecule of the second aspect in the production of a transgenic plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

The creation of transgenic plants resistant to specific pathogens has been a great advance in agricultural technology. It allows for the insertion of specific traits without the long development times associated by traditional plant breeding methods.

A fourth aspect provides a method for producing a plant resistant to A. Candida race 9 Australian variant, the method comprising crossing a plant with the resistant plant of the first aspect .

While transgenic plants are desirable in some respects, there is still a large market for varieties developed through more traditional breeding techniques. The invention provides a method for easily transferring the disease resistance contained in the plant according to the first aspect into any other compatible plant.

A fifth aspect provides a molecular marker specific for a plant according to the first aspect. In one embodiment the marker comprises SEQ ID NO: 1 and/or SEQ ID NO: 2.

A sixth aspect provides the use of the marker of the fifth aspect for identifying resistant B. oleracea plants.

In an embodiment of the fifth or sixth aspects, the DNA markers are selected from the group consisting of P12M46_M406.5 (SEQ ID NO: 1), P12M41_M130.4 (SEQ ID NO: 2), P11M51_M199.2 and CAPS M406.5.

In an embodiment of the fifth or sixth aspects, the DNA markers are identified by DNA primer pair 406FW and 406RVl (SEQ ID NO : 3 and 4) for P12M46_M406.5 or CAPS M406.5 for DNA primer pair 130FW and 130RV (SEQ ID NO: 5 AND 6) for P12M41 M130.4. These markers provide a rapid and accurate means of identifying plants that will be resistant to white rust. This has benefits in cost reduction and reduction of development times for new brassica varieties.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 provides validation of candidate AFLP markers on the F2 plants used for the bulk segregant analysis . Figure 2 provides Single Nucleotide Polymorphism (SNP in color) between the susceptible genome (SEQ ID NO: 7) and the resistant genome (SEQ ID N0:l) within the fragment of 361 bases corresponding to molecular marker P12M46_M406.5.

Figure 3 provides agarose gel of the CAPS_M406.5 fragments after digestion with Taql . First lane is the

50bp ladder, the 2 first wells = non digested fragment of 361 bp, the other wells contain fragment after digestion. The observed genotype is S for Susceptible, R for resistant and Rs for the heterozygous resistant plants. Figure 4 provides the CAPS sequence (comprising SEQ

ID N0:l) .

Figure 5 provides the F2 population analysis using the CAPS marker.

DETAILED DESCRIPTION

There are numerous stages involved in the development of any novel, desirable plant line using traditional plant breeding techniques . Plant breeding begins with an analysis of the strengths and weaknesses of existing varieties, and the selection of suitable parental lines for use as genetic donors in hybridization crosses. These parental lines are crossed with each other with the ultimate aim being, to combine in a single plant, as many of the strengths and as few of the weaknesses as possible. Progeny displaying the desired combinations are selected after each cross . These progeny may be either crossed with additional parental donor lines or be self crossed depending on the desired outcome. This process may be repeated several times before the desired genetic combination is achieved.

The invention provides a plant resistant to white rust disease caused by the oomycete A. Candida race 9

Australian variant, comprising a resistance gene which is dominant. The resistance gene according to the invention may be present either homozygously or heterozygously in the genome of the B. oleracea plant and may comprise SEQ ID NO: 1 or/and SEQ ID NO : 2 or be linked to SEQ ID NO : 1 or/and SEQ ID NO: 2.

Plants showing resistance to A. Candida race 9 Australian variant were identified when a test field of broccoli became infected with white rust. Most plants were susceptible to infection but some were found to be resistant. The resistant plants were selected and crossed with susceptible plants to determine if the resistance could be inherited. Additional work to identify the resistance gene may lead to the production of transgenic plants which are resistant to A. Candida race 9 Australian variant .

Resistant plants were tested alongside several commercial varieties of broccoli for resistance to white rust in artificially inoculated field trials. It was found that all of the commercial varieties were susceptible to A. Candida race 9 Australian variant at varying levels, while the plants of the invention were completely resistant to A. Candida race 9 Australian variant. This was particularly unexpected considering that the Iron CMS and Belstar varieties, which showed resistance in European field trials, were found to be susceptible. This data also supports the division of race 9 into at least two different variants, the Australian and the European. Seeds of a B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant plant were deposited under the Budapest Treaty under NCIMB accession number NCIMB 41618 on 23 April 2009. This plant has been named AcR by the present inventors. In one embodiment the resistant plant is derived from the deposited material . Alternatively, said B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant plant may be selected from the group consisting of B. oleracea convar. botrytis var . botrytis (cauliflower, romanesco) , B. oleracea convar. botrytis var. cymosa (broccoli) , B. oleracea convar. botrytis var. asparagoides (sprouting broccoli), B. oleracea convar. oleracea var. gemnifera (Brussels sprouts), B. oleracea convar. capitata var. alba (white cabbage, oxheart cabbage), B. oleracea convar. capitata var. rubra (red cabbage) , B. oleracea convar. capitata var. sabauda (savoy cabbage) B. oleracea convar. acephela var. sabellica (curly cale cabbage) , B. oleracea convar. acephela var. gongyloides (turnip cabbage) and B. oleracea var. tronchuda syn. costata (Portuguese cabbage) . The B. oleracea plant of the first aspect may be an inbred or a dihaploid plant, or it may be a hybrid. The B. oleracea plant may be cytoplasmic male sterile.

The aspect encompasses parts of the B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, including but not limited to embryos, protoplasts, meristematic cells, pollen, leaves, anthers, stems, petioles, shoots, roots, root tips, flowers, seeds, and heads, or any propagation or tissue culture material capable of being derived from said plant. The invention particularly contemplates seeds of the plant of the first aspect and progeny of the plant of the first aspect, especially when grown from seed.

The disease resistance to white rust disease caused by the oomycete A. Candida race 9 Australian variant in the B. oleracea plant of the invention may be characterised by at least one marker selected from the group consisting of markers P12M46_M406.5 , P12M41_M130.4 and P11M51_M199.2 and CAPS M406.5

These markers were developed by the comparison of pooled DNA taken from the resistant plants and pooled DNA taken from susceptible plants.

Also provided is a DNA fragment amplified from S. oleracea genome, wherein said DNA fragment is approximately 361 bp long and comprises SEQ ID NO: 1. Also provided is a DNA fragment amplified from a S. oleracea genome, wherein said DNA fragment is approximately 98 bp long and comprises SEQ ID NO : 2. Either of these DNA fragments can be used to identify a B. oleracea plant that is resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant. SEQ ID NO: 1 and/or SEQ ID NO: 2 may form part of the resistance gene or may be found in a region of the genome close to the resistance gene, in which case they are referred to as "linked" to the resistance gene.

Also provided is a DNA primer pair 406FW and 406RVl (SEQ ID NO: 3 & SEQ ID 4) and a DNA primer pair 130FW and 130RV (SEQ ID 5 & SEQ ID 6) . These primers flank the molecular marker for resistance to white rust disease caused by the oomycete A. Candida race 9 Australian variant and can be used to identify a B. oleracea plant that is resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

Also provided are an expression cassette comprising SEQ ID NO: 1, SEQ ID NO : 2 or the resistance gene, a vector comprising SEQ ID NO: 1, SEQ ID NO : 2, the resistance gene, or said expression cassette and a plant cell comprising SEQ ID NO : 1, SEQ ID NO: 2, the resistance gene, said expression cassette, or said vector.

Also provided is a marker for the resistance gene, the marker comprising SEQ ID NO: 1, SEQ ID NO: 2 or a homologue or variant thereof contained in or linked to a gene capable of conferring resistance to A. Candida race 9 Australian variant. The DNA marker may be selected from the group consisting of markers P12M46_M406.5, P12M41_M130.4, P11M51_M199.2 and CAPS M406.5.

Also provided is the use of SEQ ID N0.-1, SEQ ID NO: 2 or the resistance gene in the production of transgenic B. oleracea plants resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, either through plant breeding or genetic manipulation.

Also provided is a method of producing a transgenic B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, wherein the method comprises the steps of transforming a plant cell from a susceptible plant with SEQ ID NO : 1, SEQ ID NO: 2 or the resistance gene, an expression cassette comprising SEQ ID NO: 1, SEQ ID NO : 2 or the resistance gene, or a vector comprising SEQ ID NO: 1, SEQ ID NO: 2, the resistance gene, or the expression cassette comprising SEQ ID NO: 1 or SEQ ID NO : 2, and regenerating a plant from the transformed cell.

Also provided is a transgenic B. oleracea plant resistant to white rust disease caused by A. Candida race 9 Australian variant, comprising SEQ ID NO : 1 or SEQ ID NO: 2 or comprising a gene linked to SEQ ID NO : 1 or SEQ ID NO: 2.

Also provided is a method of producing a B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, wherein the method comprises the steps of crossing the B. oleracea plant according to the first aspect with a susceptible B. oleracea plant to produce seeds and selecting plants grown from the seeds that are resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant .

Also provided is a method for producing B. oleracea plants resistant to A. Candida race 9 Australian variant by crossing a susceptible plant with the resistant plant of the first aspect to produce seeds, and selecting plants grown from those seeds that are resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant. The resistant plants could be selected or identified by using at least one specific molecular marker linked to the resistance gene. Said DNA marker may be selected from the group consisting of markers P12M46_M406.5, P12M41_M130.4 , P11M51_M199.2 and CAPS M406.5. The method may detect a single marker or multiple markers. The method may identify a specific molecular marker comprising SEQ ID NO: 1 or SEQ ID NO : 2. Also provided is a method of identifying a B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant comprising detecting in said B. oleracea plant specific molecular markers linked to the resistance gene. Said DNA marker may be selected from the group consisting of markers P12M46_M406.5 , P12M41_M130.4 , P11M51_M199.2 and CAPS M406.5. The method may detect a single marker or multiple markers. The method may identify a specific molecular marker comprising SEQ ID NO: 1 or SEQ ID NO: 2. Also provided is the use of the DNA primer pairs

406FW and 406RV1 (SEQ ID NO: 3 & SEQ ID 4) and a DNA primer pair 130FW and 130RV (SEQ ID 5 & SEQ ID 6) to identify a B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

"Resistant" as used herein refers to a plant that is capable of withstanding infection by a pathogenic organism. Resistance in many host varieties is inherited simply, as a monogenic trait, although complex multigene resistance has also been detected wherein multiple genes confer a variety of host defence traits that inhibit pathogenic growth.

"Monogenic" refers to a trait that is controlled by a single gene that possesses at least two alleles. Often, research has concentrated on identifying simple sources of resistance as these genotypes are easily exploited in breeding programs. However, this type of resistance is often short-lived because the pathogen rapidly overcomes the plant's defense system through natural selection of races that retain virulence on the resistant host varieties. For more long-term protection, it may be preferable to use cultivars with complex multigene resistance .

"Susceptible" as used herein refers to a plant that is at least partially incapable of withstanding damage by a pathogenic organism. "Variety/varieties" as used herein refers to members of the same genus or species that possess different characteristics that are discernable both genetically and phenotypically . The term is used interchangeably with "cultivar" . Specifically, varieties of broccoli are described that possess different levels of resistance to white rust. The level of resistance refers to the severity of disease caused by infection with white rust. Varieties that are highly susceptible and develop severe symptoms after infection have a very low level of resistance. Varieties that are slightly susceptible and develop only mild disease symptoms after infection have a higher level of resistance. However, it should be noted that the only varieties to be called resistant herein are those that show no symptoms of infection at all. Any presence of symptoms associated with white rust infection results in the variety being labelled as susceptible.

"White rust disease" as used herein refers to the disease caused by infection of a susceptible host plant with the oomycete A. Candida. Specifically this invention relates to white rust disease caused by A. Candida race 9 Australian variant. Note that for A. Candida, the term "race" as used herein refers to a variety of a pathogen that can infect some species of a host genus and not others whereas in most pathosystems it is taken to mean a variety of pathogen that can infect some varieties of a host species but not others .

"Progeny" defines any offspring of a plant. "Variant" as used herein refers to a strain of a pathogen that is pathologically and genetically distinct from other members of the same species of pathogen.

For the purposes of this specification it will be clearly understood that the word "comprising" means "including but not limited to", and that the word "comprises" has a corresponding meaning.

"Resistance gene" as used herein refers to a gene that confers resistance to a pathogen. Such resistance, when conferred by a resistance gene is said to be genetic resistance. In one embodiment the resistance gene comprises SEQ ID NO: 1 and/or 2. In another embodiment the resistance gene is found in a region of the genome close to the nucleic acid sequence provided as SEQ ID NO-.l or 2 , in which case the resistance gene is linked to SEQ ID NO: 1 or 2.In this embodiment the region may be within 10.0 kb, 7.5 kb, 5.0kb, 3.5 kb, 3.3 kb, 3.0 kb, 2.5 kb, 3.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 750 bp, 500 bp, 250 bp, 200 bp, 150 bp, 100 bp, 50 bo, 25 bp or overlapping with SEQ ID NO: 1 or 2.

That the resistance gene is found within a region of the genome close to the nucleic acid sequence provided as SEQ ID NO:1 or 2 is intended to mean that the resistance gene is close in the genome to SEQ ID NO: 1 or 2 but does not contain one or both sequences .

Since SEQ ID NOS 1 and 2 are markers of diseases resistance, if the resistance gene does not comprise SEQ ID NO: 1 or 2 , one of these sequence must at least be genetically "linked" to resistance. By linked it is meant that resistance can be indicated by the sequence. It may be that SEQ ID NO: 1 and/or 2 are not responsible for resistance per se but are involved in signalling or otherwise involved in resistance . "Dominant" as used herein refers to a gene, the trait of which is evident in the individual possessing said dominant gene, when there is either one or two alleles of said gene present in the genome of the individual . This is as distinct from recessive, in which the trait requires two alleles of the gene to be present for the trait to become evident in the individual . "Allele" as used herein refers to one member of a pair or series of nucleic acid sequences, which may be a gene or a non-gene sequence, located at a specific position of a chromosome. In a diploid organism, there will be two alleles for each nucleic acid sequence, one for each copy of the chromosome .

"Part of a plant" as used herein refers to any part of a plant including, but not limited to embryos, protoplasts, meristematic cells, pollen, leaves, anthers, stems, petioles, shoots, roots, root tips, flowers, seeds, and heads. These parts may be naturally occurring, as in seeds, or they ma be created by artificial means, such as dissection, sectioning, or chemical treatment.

By "isolated" we mean free from at least one material with which in nature the nucleic acid molecule is normally associated, that is in an environment different from that in which the nucleic acid molecule naturally occurs.

"Isolated" is meant to include partially or substantially purified.

"Nucleic acid" as used herein refers to an oligonucleotide, polynucleotide, nucleotide and fragments or portions thereof, as well as to peptide nucleic acids (PNA), fragments, portions or antisense molecules thereof, and to DNA or RNA of genomic or synthetic origin which can be single- or double-stranded, and represent the sense or antisense strand.

Where "nucleic acid" is used to refer to a specific nucleic acid sequence "nucleic acid" is meant to encompass polynucleotides that encode a polypeptide that is functionally equivalent to the recited polypeptide, e.g., polynucleotides that are degenerate variants, or polynucleotides that encode biologically active variants or fragments of the polypeptide, including polynucleotides having at least 50%, 60, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity relative to the sequences provided herein. "Percent (%) sequence identity" with respect to the nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the specific nucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

In one embodiment the nucleic acid variant encodes a protein having one or more amino acid substitutions, additions, insertions or deletions relative to SEQ ID NO:1 or SEQ ID NO : 2. In one embodiment any substitutions are conservative substitutions. The number of amino acid additions, deletions, insertions or substitutions may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90 or 100, provided the variant provides or is linked to a gene that provides resistance to A. Candida race 9 Australian variant.

In another embodiment the nucleic acid variant encodes a protein identical to the protein encoded by SEQ ID N0:l or SEQ ID NO : 2. The nucleic acid molecule may be double stranded or single stranded. The invention encompasses a nucleic acid molecule complementary to the nucleic acid molecule of the second aspect or capable of hybridising to the nucleic acid molecule of the second aspect.

Complementary as used herein in relation to nucleic acid molecule "complementary" to the nucleic acid sequence of the first aspect is intended to encompass those sequences that are capable of hybridising under high stringency conditions to the nucleic acid molecules defined.

"Hybridisation" in relation to nucleic acids is the forming of a hybrid of two single complementary strands of nucleic acid to form a double strand.

"Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general , longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybrid!zable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al . , Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1994) and Sambrook et al . , Molecular Cloning, A Laboratory Manual, 2nd Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) .

Reference herein to "high stringency conditions" may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50⁰C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/O.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5xSSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5xDenhardt ' s solution, sonicated salmon sperm DNA (50 μ/ml) , 0.1% SDS, and 10% dextran sulfate .at 42°C, with washes at 42°C in 0.2xSSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash consisting of 0. IxSSC containing EDTA at 55°C.

The invention also encompasses a fragment of the nucleic acid molecule for the first aspect. A "fragment" is defined as a portion or domain of the full length sequence provided according to the present invention, which fragment retains the functionality of the parent molecule, that is the ability to encode a protein capable of confering disease resistance to A. Candida race 9 Australian variant or be linked to a protein capable of confering disease resistance to A. Candida race 9 Australian variant.

The terms "nucleotide sequence" and "nucleic acid sequence" are used herein interchangeably. As used herein a "transgenic plant" refers to a plant that contains recombinant genetic material ( "transgene" ) not normally found in a wild-type plant of the same species. Thus, a plant that is generated from a plant cell or cell line into which recombinant DNA has been introduced by transformation is a transgenic plant, as are all offspring of that plant containing the introduced transgene (whether produced sexually or asexually) .

"Cross" as used herein refers to the act of fertilising of one line of a plant with a different line of a plant to create an Pl population. "Fl" population as used herein refers to the plant population generated from the seed of a first generation hybrid. This first generation hybrid might also be named HFl. "F2" population as used herein refers to the plant population generated from the seed of a self-fertilised Fl hybrid.

"Backcross" as used herein refers to the process or its result in which a breeder repeatedly crosses hybrid progeny back to one of the parents, for example, a first generation hybrid Fl with one of the parental plant of the Fl hybrid.

"Hybrid" is a plant line obtained by the fertilisation of one line of a plant with a different line of a plant to create a plant with genetic material from two distinctly different parental lines.

"Heterologous host" as used herein refers to a host that is not identical to the original host, whereas "homologous host" as used herein refers to a host that is identical to the original host.

"Molecular markers" as used herein refers to nucleotide sequences that are found at specific locations of the genome. They are used to 'flag' the position of a particular gene or the inheritance of a particular characteristic. In a genetic cross, the characteristics of interest will stay linked with the molecular markers. Thus, individuals can be selected in which the molecular marker is present, since the marker indicates the presence of the desired characteristic. The term "molecular marker" is used interchangeably with "DNA marker" .

"Amplified Fragment Length Polymorphism" (AFLP) as used herein refers to a molecular marker generated by a combination of restriction digestion and PCR amplification. Differences in restriction fragment size are produced as a result of differences in the nucleic acid sequence at a particular location.

"Linkage Group" as used herein refers to a group of genes that are located close together on the same chromosome and are usually inherited together.

"Virulence" as used herein refers to a qualitative trait defining the ability of a pathogen to colonize its host and "aggressiveness" as used herein refers to the ability of a pathogen to multiply and cause damage to a susceptible host. Based on this definition, the race of A. Candida affecting the broccoli crops in Australia must be described as being ^λ super-aggressive' .

"Segregation" as used herein refers to the number of plants resulting from a cross or self-fertilisation that are either positive or negative for the desired trait. The segregation ratio provides information about the number of genes involved in the regulation of a trait.

"Single Nucleotide Polymorphism" (SNP) as used herein refers to the mutation of a single nucleotide at a point (locus) of a nucleic acid molecule.

"Homozygous" means that the plant in question possesses two identical alleles of the gene in question.

"Heterozygous" means that the plant possesses two different alleles of the gene in question.

"Bulk Segregant Analysis" as used herein refers to the technique by which markers that are closely linked to a specific trait are identified. DNA is pooled from individuals exhibiting similar phenotypes (e.g. 10 resistant plants or 10 susceptible one) . Each of these bulk DNA samples contains a random sample of all the loci in the genome, except for those that are in the region of the gene upon which the bulking occurred (i.e. the resistance gene) . Therefore, any difference in AFLPs between these two bulks is linked to the locus upon which the bulk was developed.

A "transformed" cell is a cell is one into which a nucleic acid molecule has been introduced by molecular biology techniques. As used herein, the term "transformation" encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with a viral vector, transformation with a plasmid vector, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. In this context "heterologous" nucleic acid means that the nucleic acid introduced into transformed cells is a nucleic acid not naturally occurring in the cells in this form. On the one hand, it may be nucleic acid which does naturally not at all occur in these transformed cells or nucleic acid which, even if it does occur in these cells, is integrated at other genetic positions as exogenous nucleic acid and is therefore situated within another genetic environment . An "expression cassette" is a nucleic acid molecule made up of at least a promoter, a site for inserting heterologous nucleic acid such that the expression of the heterologous nucleic acid in a transformed cell is driven by the promoter and a terminator. The expression cassette will preferably comprise at least one restriction enzyme site to facilitate insertion of the heterologous nucleic acid. In practice, the expression cassette used to transfect the plant nucleus will generally additionally comprise various control elements. Such control elements may include a ribosome binding site (RBS) , positioned at an appropriate distance upstream of a translation initiation codon to ensure efficient translation initiation. A person skilled in the art will be readily able to determine suitable expression cassettes. Preferably most or all of the constituents of the expression cassette are operably linked.

A "recombinant" nucleic acid is one having a sequence that is not naturally occurring or having a sequence made by an artificial combination of two otherwise separated sequences. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.

A "vector" is a nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell . A vector may include one or more nucleic acid sequences, such as an origin of replication, that permit the vector to replicate in a host cell . A vector also may include one or more selectable marker genes and other genetic elements known in the art . The term "vector" as used herein is intended to encompass any carrier for nucleic acid, including plasmids and phage.

It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art, in Australia or in any other country.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Embodiments of the present invention will now be described in the following non-limited examples. EXAMPLES

Example 1: Identification of a resistant plant

Brassica oleracea plants growing in a test field in South Australia became infected with white blister, later determined to be A. Candida race 9 Australian variant. Most plants became infected but some were resistant. Resistant plants were used for crossing to produce Fl and F2 progeny and these subjected to further testing to select 10 susceptible F2 plants and 10 resistant F2 plants to generate the bulks for BSA approach

Example 2 : Field trial comparisons

Data pertaining to the resistance of both commercial and experimental plant and varieties of B. oleracea to white rust disease caused by A. Candida race 9 Australian variant was obtained from field trials conducted in Australia. The experimental plants, whether inbred lines or hybrids were designated T24, T25, T36, T9, TB 6XXX (with X being any number) , AcR, W5 and W6.

A scoring system from 0 to 3 was used to rate the level of resistance, with 0 designating complete resistance and 3 designating severe white rust infection. A score of 0 is given to a plant line or variety in which none of the plants of the population exhibit any symptoms of white rust infection. A score of 1 is given when (1% to 20%) of the plants of the population exhibit symptoms, a score of 2 is given when (20% to 30%) of the plants of the population exhibit symptoms, and a score of 3 is given when more than 30% of the plants of the plot show disease symptoms . Table 2 - Field trial scores for resistance to A. Candida

Table 3 - Further field trial scores for resistance to A. Candida

It can be seen that all of the experimental plants containing the monogenic dominant resistant gene are resistant to white rust disease caused by A. Candida race 9 Australian variant, while all of the commercial • varieties are susceptible.

The inventors were surprised by the susceptibility of both the cultivars Iron CMS and Belstar which showed resistance in European field trials in the Netherlands. This finding confirms the existence of variants within race 9 of A. Candida. Table 4 - Further field trial scores for resistance to A. Candida

Susceptible plants are any plants ranking 1, 2 or 3, while resistant plants are plants ranking 0 only.

The CLX 3506, 1858, 1339, CLX 35104 (also named AcR by the inventors and deposited under the Budapest Treaty under NCIMB accession number NCIMB 41618 on 23 April 2009) , CLX 35106 and CLX 3503 plants are hybrids containing the gene of resistance.

This data clearly shows that the very same plants, in different environments, i.e. when facing different strains, do react differently. As the genetic profile does not change, the environmental factor shall be considered as the changing factor. The inventors presume that the environmental factor is different strains of the same Albugo pathogen. Example 3: Marker development:

The inventors used Amplified Fragment Length Polymorphism (AFLP) (AFLP: a new technique for DNA fingerprinting, Vos et al . , 1995 Nucleic Acid research., 23:4407-4414 combined with Bulk Segregant Analysis (BSA) (Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations., Michelmore et al., 1991 Proc Natl Acad Sci U S A. 1991 Nov 1;88(21) .-9828-32) to develop molecular markers linked to the resistance gene. The AFLP markers have been mapped at the extremity of Linkage Group Bo-LGl. (An integrated AFLP and RFLP Brassica oleracea linkage map from two morphologically distinct double haploid mapping populations, Sebastian RL et al . (2000) TAG 100 :75-81) .

For BSA analysis, a broccoli white rust resistant plant was crossed with a broccoli plant from a susceptible plant and an F2 population generated. Sixty of these F2 plants were submitted to an artificially inoculated A.

Candida field trial in Templestowe (Australia) . A row of Albugo-susceptible hybrid varieties was planted on either side of 2 rows of F2 plants in order to maintain a high pressure of inoculum. The Albugo symptoms were individually recorded for each of the F2 plants. A total of 16 susceptible plants and 42 resistant plants were identified. This correlated with the expected dominant monogenic segregation of ¹A susceptible and % resistant. From this dominant monogenic heritability, the present inventors started a Bulk Segregant Analysis (BSA) strategy using a bulk of 10 susceptible F2 plants and a bulk of 10 resistant F2 plants. The BSA strategy was carried out on 6 pools: the bulk of 10 resistant plants, the bulk of 10 susceptible plants, two different white rust resistant plants and two plants from susceptible plants . The AFLP protocol was used as described by Vos et al . 1995, starting with lOOng of DNA extracted using a Qiagen DNeasy plant extraction kit . This DNA was digested with the restriction enzymes Msel and PstI. Four types of pre- amplification templates were amplified using the primer combinations (PC) : Pst+A / Mse+A; Pst+C / Mse+A; Pst+A / Mse+C; Pst+C / Mse+C

A total of 160 Amplified Fragment Length Polymorphism (AFLP) primer combinations were amplified from the 6 DNA samples using Mse+3 and Pst+2 primer combinations. The Pst+2 primer is labelled in 5' extremity with the FAM or HEX dye to be submitted to a capillary electrophoresis on a MegaBacelOOO platform (General Electrics Healthcare) . The raw data was normalized with Fragment Profiler software (General Electrics Healthcare) , then converted into an artificial gel via X-pose software (Keygene, NV) . The AFLP scoring is done with QuantarPro software (Keygene, NV) .

Of the 160 Primer combinations tested, forty candidate AFLP fragments were checked for the 20 individual F2 plants comprising the 2 bulks and the parental (both susceptible and resistant) lines. Seven candidate AFLP markers linked to the Albugo dominant gene were found :

• P12M41_M130 . 4

• P15M54_M80 . 5 • Pl 7M45 JVIl 23 . 0

• P11M51_M199 . 2

• P12M46_M406 . 5

• P12M46_M77 . 3

• P16M62__M316 . 4 Six of these candidate markers were then checked on the 58 individual F2 plants to validate the linkage between the AFLP markers and the Albugo disease score (Figure 1) .

Except for susceptible F2 plant number 61, all the genotypes obtained with the Albugo resistance- linked band markers P12M46_M406.5, P12M41_M130.4 and P11M51_M199.2 match with the observed F2 plant phenotypic Albugo infection scoring. The band marker P17M45_M123 displayed one disaccording score between the genotype and the phenotype .

Example 4 : Validation of candidate markers and genetic mapping.

To select the best predictive markers and to validate them, the inventors tested 250 BCl plants (back cross plants of first generation resistant plants) segregating for the dominant A. Candida race 9 Australian variant resistance gene in a Templestowe (Victoria, Australia) field test .

The 250 BCl plants were submitted to both an AFLP analysis using 10 AFLP primer combinations, including the A. Candida race 9 Australian variant resistance-linked band markers, and an artificially inoculated A. Candida field test. The A. Candida race 9 Australian variant infection scoring on each plant was used to select closely linked band markers.

The observed phenotypic disease score of each plant was compared to the genotype generated with the scoring of 5 markers. From this it was concluded that the markers P12M46_M406.5, P12M41_M130.4 and P11M51_M199.2 have a complete predictive value for resistance to A. Candida race 9 Australian variant.

These segregating BCl plants were used to make a short genetic map of the dominant Albugo resistance locus using Carte Blanche software (Keygene, NV) . The complete linkage of the 3 AFLP markers and the targeted trait confirm that F2 plant No. 61 was either incorrectly phenotyped or there was some human error at the time the leaves were harvested. This plant was most probably a resistant plant.

Example 5: Sequencing of the APLP band markers and SNP development.

The linked AFLP band markers were extracted from a silver stained acrylamide gel and re-amplified using proof-reading Taq polymerase (Ex~Taq polymerase, Takara) . The re-amplified fragment was cloned into pGEM-T vector (Promega) and sequenced. Internal primers for the AFLP bands were designed and the AFLP fragments re-amplified from DNA extracted from susceptible and resistant genotypes. The re-amplified AFLP fragments were compared using BLAST or CLUSTAL tools (National Center for Biotechnology Information, NCBI) to find a consensus sequence of each fragment . The inventors further redesigned the internal primers to amplify and sequence susceptible and resistant genotypes and compared the products to identify potential internal Single Nucleotide Polymorphisms (SNPs) that could distinguish the resistant and susceptible genotypes. The NCBI Brassica and Arabidopsis thaliana nucleotide databases were searched using BLAST analysis to identify fragments homologous to the sequenced AFLP band. The inventors cloned and sequenced two of the three closely linked markers; P12M46_M406.5 and P12M41_M130.4.

Example 6: Identification of the predictive markers

A good consensus sequence of 361 bases was obtained from the original P12M46_M406.5 marker (SEQ ID N0:l) using the primers 406-Fw (SEQ ID NO: 3) and 406-Rvl (SEQ ID NO.4) .

This sequence has 91% identity with an Acyl carrier protein from B. campestris. The inventors found also 84% of identity over 113 bases with an A. thaliana fragment (At3g05050) (SEQ ID NO: 8) . Using the link http : //atidb . org/cgi-perl/gbrowse/atibrowse/ the inventors found a Bacterial Artificial Chromosome (BAC) from B. rapa (>KBrB037C07) that contains the Arabidospsis homolous gene .

A sequence of 98 bases from the original AFLP band P12M41_M130.4 was obtained (SEQ ID 2) using the primers

130-Fw (SEQ ID 5) and 130-Rv (SEQ ID 6) . This sequence has 96% identity with a B. napus ATSK12 protein and 93% with the A. thaliana homologous protein. The inventors found also 96% identity with a B. rapa BAC (>KBRB003A10) . Using the same link http : //atidb . org/cgi -perl/gbrowse/atibrowse/ the inventors found a third BAC (>KBrH012A23) which overlaps the two previous BACs. They confirmed the close physical association of the two identified AFLP markers, P12M46_M406.5 and P12M41_M130.4 , in a chromosomal region of 330,000 bases in the B. rapa BAC sequences and the homologous A. thaliana gene.

The 84% homologies found are as follow:

Arabidopsis thaliana chromosome 3, complete_^sequence Length=23470805

Features in this part of subject sequence: protein kinase family protein

Score = 130 bits (70), Expect = 3e-29 Identities = 113/134 (84%), Gaps = 2/134 (1%) Strand=Plus/Minus

Query 184 ATGGCTGA-TTTGTT-TTCTTGATGTACAGTTTTTCATGACAAAGCCATTTCCATGTGAA 241

Sbjct 1409527 A uTGrnGCCG HATT nTTuGTnTGT nTGT mTGTT mGTGC iAnGTnTCT mTCAiCG iAnCGGA mGCCiAnTTiGGC uATrnGTCA nA. 1409468 Query 242 CCTTCTGATCTACCTAAGTATCCTCCAAGTAAAGAGATTGATGCCAGGAAACGAGATGAA 301

Sbjct 1409467 C 1C 1T 1T 1C 1T 1G 1A 1T 1C 1T 1CC ICiGA iAtAT mATCmCTCmCAAmGTAmAAGmAGAmTTGiAmTGCmCAAG nAGA mCGAmGACG mAA 1409408 Query 302 GAGTTTAGGAGGTA 315

Sbjct 1409407 GmAGTiATiCG1G1A1G1G1T1A1 1409394

Example 7 : Sequencing of the AFLP fragment and SNP development .

The consensus sequence of 361 bases from the original P12M46_M406.5 marker was re-amplified on DNA extracted from a set of susceptible and resistant genotypes. The PCR products were then sequenced, and the consensus sequence of susceptible plants compared to the consensus sequence of resistant plants. The inventors found seven SNPs capable of distinguishing the resistant/susceptible plants (see figure 2) . One of these SNPs is included in the restriction site of Taql endonuclease . This SNP was subsequently used to transform the AFLP marker sequence into a co-dominant CAPS assay (Cleaved Amplified Polymorphic Sequence) .

The resistant genotype (~~TCGA~~) comprises the Taql restriction site, resulting in the 361 bp fragment being cleaved into fragment of 83 bp and 278 bp after digestion. The susceptible genotype (~~CCGA~~) is not cleaved by the endonuclease, meaning that the fragment remains 361 bp after digestion with Taql .

Example 8: F2 population analysis with the CAPS marker The Cleaved Amplified Polymorphic Sequence (CAPS) CAPS406 marker has been used on the F2 population.

The results are shown in Fig. 5. The pattern of the CAPS406 marker displays the same segregation as the original AFLP fragment P12M46_M406.5. (See Figure 4).

PCR Condi tions for the CAPS406

Primer sequences : SEQ ID 3: 406-Fw 5' - ATTTTGGCTAATTCAATCCG - 3' SEQ ID 4: 406-Rvl 5' - CATGAATGCATCTCTTAGGC - 3'

PCR mix:

DNA (adapted dilution) 5μL

H₂O 4.35μL

BufferlOX (Invitrogen) 1.5μL

MgCl₂ (25mM) 1.5μL dNTP (2.5mM) 1.5μL

406-Fw (lOμM) 0.50μL

406-Rvl (lOμM) 0.50μL

Tag Invitrogen 0.15μL

Volume 15 μL Amplification parameter on thermocycling machine (MJ Research or ABI2700) :

First step 5 minutes at 94⁰C

35 cycles : 30 seconds at 94⁰C 30 seconds at 52⁰C 30 seconds at 72°C

Final step 5 minutes at 72⁰C

PCR digestion with endonuclease :

PCR product 7μL

H₂O 9μL

1OX buffer 2μL

Endonuclease

Taql (lOU/μL) 2μL

Volume 20μL

Incubation 2H at 65⁰C

Electrophoresis conditions

- 1.5 % Agarose gel with IX TBE buffer - Add 5μL loading buffer to 20 μL digest mix

- Load 15-20 μL/gel well

Ih 15 min electrophoresis for a 4 comb gel at 80 Volts

15 minutes in ethidium bromide for staining - 15 minutes in water for destaining

The inventors demonstrate that this Cleaved Amplified Polymorphic Sequence (CAPS) marker is co-dominant. The susceptible F2 plant No. 61 was found to be heterozygous with this marker, which confirms that it should have been identified previously as a resistant plant (see fig. 3) . ' Sequences :

SEQ ID NO:1: Consensus sequence of the AFLP marker P12M46 M406.5

ATTTTGGCTAATTCAATCCGGTTCATTTCAGTTATTTATTTATTTTTGAAAATCAAAA

ACCGAATCATTTTTCAAAACCCCATCGAACTAAACCGAACTGAAAACCGTAACTGAAC CAAΆAAATTTGGTTCGGCTGGTTCGGTTCAGACAAAATCCCTATGGCTGATTTGTTTT CTTGATGTACAGTTTTTCATGACAAAGCCATTTCCATGTGAACCTTCTGATCTACCTA AGTATCCTCCAAGTAAAGAGATTGATGCCAGGAAACGAGATGAAGAGTTTAGGAGGTA CATTTTTTTCAGTTTTCTTTGTCCTCTTGTGACTATGTTTGGTTTCTGTTTGCCTAAG AGATGCATTCATG

SEQ ID NO: 2: Consensus sequence of the AFLP marker P12M41_M130.4

ACCAGACATCAATGGCTGTAGTATACTCAGTGGCTCCAAAAATAAGCTCAGGTGCCCT GTAATACCTTGAGCATATATATGAΆATGTTTGGCTCTCCT

SEQ ID NO: 3: Primer 406-FW

ATTTTGGCTAATTCAATCCG

SEQ ID NO:4: Primer 406-RVl

CATGAATGCATCTCTTAGGC

SEQ ID NO: 5: Primer 130 -FW

ACCAGACATCAATGGCTG

SEQ ID NO: 6: Primer 130-RV AGGAGAGCCAAACATTTC

Claims

' CLAIMS :

1. A B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, comprising a resistance gene which is monogenic and dominant, the resistance being introduced into the plant or its progeny by crossing with a resistant plant or recombinant manipulation.

2. The B. oleracea plant according to claim 1 wherein said resistance gene is present heterozygously in the genome of said plant .

3. The B. oleracea plant according to claim 1 wherein said resistance gene is present homozygously in the genome of said plant.

4. The B. oleracea plant according to claim 1 wherein said resistance gene comprises SEQ ID NO: 1 and/or SEQ ID NO: 2.

5. The B. oleracea plant according to claim 1, wherein the plant is derived from material deposited under NCIMB accession number NCIMB 41618.

6. The plant according to claim 1, wherein said B. oleracea plant is chosen from the group consisting of B. oleracea convar. botrytis var. botrytis (cauliflower, romanesco) , B. oleracea convar. botrytis var. cymosa (broccoli), B. oleracea convar. botrytis var. asparagoides (sprouting broccoli), B. oleracea convar. oleracea var. gemnifera (Brussels sprouts) , B. oleracea convar. capitata var. alba (white cabbage, oxheart cabbage), B. oleracea convar. capitata var. rubra (red cabbage), B. oleracea convar. capitata var. sabauda (savoy cabbage) B. oleracea convar. acephela var. sabellica (curly cale cabbage), B. oleracea convar. acephela var. gongyloides (turnip cabbage) and B. oleracea var. tronchuda syn. costata (Portuguese cabbage) .

7. The plant according to any one of claims 1 to 6, wherein said B. oleracea plant is an inbred or a dihaploid plant .

8. The plant according to any one of claims 1 to 6 , wherein said B. oleracea. plant is a hybrid.

9. The B. oleracea plant according to any one of claims 1 to 8 , wherein said JS. oleracea plant is cytoplasmic male sterile.

10. A part of a plant according to any one of claims 1 to 9, wherein said part is embryo, protoplast, meristematic cell, pollen, leaf, anther, stem, petiole, root, root tip, flower, seed, or head.

11. Propagation or tissue culture material derived from the plant according to any one of claims 1 to 8 or part of a plant according to claim 9.

12. The plant according to any one of claims 1 to 9 wherein the presence of the resistance to white rust disease caused by the oomycete A. Candida race 9 Australian variant is characterised by at least one marker selected from the group consisting of markers

P12M46_M406.5, P12M41_M130.4 and P11M51_M199.2 and CAPS M406.5.

13. A DNA fragment amplified from B. oleracea genome, wherein said DNA fragment is approximately 361 bp long and comprises SEQ ID NO : 1.

14. A DNA fragment amplified from a J3. oleracea genome, wherein said DNA fragment is approximately 98 bp long and comprises SEQ ID NO : 2.

15. The use of the DNA fragment according to claim 13 or 14 to identify a B. oleracea plant that is resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

16. A DNA primer pair 406FW and 406RV1 (SEQ ID NO : 3 Sc SEQ ID 4) .

17. A DNA primer pair 130FW and 130RV (SEQ ID 5 & SEQ ID 6) .

18. A method of producing a B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, wherein the method comprises the steps of:

(a) crossing the B. oleracea plant according to claim 1 with a susceptible B. oleracea plant to produce seeds,

(b) selecting plants grown from the seeds of step (a) that are resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

19. A method of identifying a B. oleracea plant resistant to white rust disease caused by the oomycete A.

Candida race 9 Australian variant comprising detecting in said B. oleracea plant a nucleic acid fragment comprising

SEQ ID NO: 1 and/or SEQ ID NO: 2.

20. The method of claim 18 or claim 19 wherein the resistant plant is identified using at least one DNA marker linked to the resistance gene.

21. The method of claim 20 wherein the DNA marker is selected from the group consisting of markers P12M46_M406.5, P12M41_M130.4 , P11M51_M199.2 and CAPS M406.5.

22. The use of the DNA primer pair according to claim 16 or 17 to identify a B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

23. Progeny of the plant according to claim 1.

24. An expression cassette comprising SEQ ID NO: 1 or SEQ ID NO : 2.

25. A vector comprising SEQ ID NO: 1 or SEQ ID NO: 2, or the expression cassette according to claim 24.

26. A plant cell comprising SEQ ID NO: 1 or SEQ ID NO: 2, the expression cassette according to claim 24, or the vector according to claim 25.

27. A method of producing a transgenic B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, wherein the method comprises the steps of: (a) transforming a plant cell from a resistant plant with the nucleic acid according to claim 13 or 14, the expression cassette according to claim 24, or the vector according to claim 25

(b) regenerating a plant from the transformed cell 28. A transgenic B. oleracea plant resistant to white rust disease caused by A. Candida race 9 Australian variant, comprising a resistance gene which is monogenic and dominant .

29. The transgenic plant according to claim 28 wherein the resistance gene comprises SEQ ID NO: 1 or SEQ ID NO : 2.

30. Use of the nucleic acid according to claim 13 or claim 14 to produce a transgenic B. oleracea plant resistant to A. Candida race 9 Australian variant.

31. A method of producing a transgenic B. oleracea plant resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant, wherein the method comprises the steps of:

(a) crossing the B. oleracea plant according to claim 28 or 29 with a susceptible B. oleracea plant to produce seeds, and (b) selecting plants grown from the seeds of step (a) that are resistant to white rust disease caused by the oomycete A. Candida race 9 Australian variant.

32. The method of claim 27 or 31 wherein resistance to A. Candida race 9 Australian variant is confirmed by an artificially inoculated field test.