WO2010131285A1 - Murine model for male infertility obtained by glucocorticoid-induced leucine zipper gene inactivation, method for the preparation and relative uses - Google Patents

Abstract

Murine model obtained by inactivation of Glucocorticoid-lnduced Leucine Zipper gene, method for preparation and uses thereof. The present invention concerns mice to be used as animal model for the study male infertility, mice generated by genetic modification involving the suppression of GILZ gene expression.

Description

MURINE MODEL FOR MALE INFERTILITY OBTAINED BY GLUCOCORTICOID-INDUCED LEUCINE ZIPPER GENE INACTIVATION, METHOD FOR THE PREPARATION AND RELATIVE USES

The present invention refers to a murine model obtained by inactivation of Glucocorticoid-lnduced Leucine Zipper gene (GILZ) (leucine zipper gene induced by glucocorticoids), method for preparation and uses thereof. Particularly the present invention concerns a mice to be used as animal model for male infertility studies obtained by means of a genetic modification involving the suppression of GILZ gene expression.

Approximately 15% of the world-wide population has infertility problems (De Kretser and Baker 1999), however, up to now, the diagnosis and infertility treatment are rather problematic and not effective. Couple fertility potential depends on many co-ordinated and combined factors relating to male and female reproduction apparatus. It is estimated that approximately 13% of the couples in Western countries displays fertility problems and 40% thereof is dependent on males (Van Assche et al. 1996). More meaningful causes of the infertility are related to anatomical defects, gametogenesis dysfunctions, endocrine system pathologies, immunological problems, ejaculation disorders and environmental factor exposure (Matzuk and Lamb 2008). Although in the man some genetic disorders have been associated to the infertility (as for example Turner syndrome (Zinn and Ross 2001), developments in knowledge and technologies used for the understanding of infertility reasons are still insufficient to be suitable to forecasting and/or treating this dysfunction type and, above all, genes from which the infertility results have not been detected

During the last years, various genetically modified animal models have contributed in meaningful way to the detection of genetic defects and molecular mechanisms resulting in male sterility (Escalier 2001 ; Matzuk and Lamb 2008). Genes involved in male fertility regulation carry out various functions in an organism; for example, the latter take part in the processes leading to sex determination or gonad formation or can be been involved in spermatogenesis controlling mechanisms. The complexity of the reproduction system and functions thereof, however, still does not allow mechanisms responsible for development, function and regulation of male reproduction apparatus to be clearly and completely defined and in fact many disorders related to male infertility often are diagnosed like idiopathic infertility or varicocele without specification of disorder causes (Kojima et al. 2008).

The development of reproduction apparatus is a process lasting over weeks (rodents) or years (human) and leading to germinal cell maturation and future gonad formation. Particularly the development and differentiation of male germinal cell line represent a dynamic process involving the migration of primordial germinal cells (PGC) to developing testicle where PGCs are generated by entering in mitotic arrest during all the foetal development. After the birth these cells restore the mitotic activity in order to form spermatogones.

The spermatozoon differentiation process consists of three steps 1) spermatogenesis representing the proliferation and maturation step, 2) spermiogenesis representing the spermatozoon differentiation step, 3) the spermiation representing the testicle sperm release step (Wong et al. 2005).

The spermatogenesis is a complex and coordinated process leading to daily spermatozoa maturation in million amount within testicles. Mammalian testicle morphogenesis begins at embryonic level and continues also after the birth up to puberty when germinal cells are completely matured (spermatozoa). The generation and continuation of this germinal cell reproduction cycle occur inside of testicle seminipher tubules where Sertoli cells are located forming the maturation niche of immature precursors. Sertoli cells are suitable to release signals coordinating the proliferation, differentiation and survival processes of germinal cells and further secrete various factors, as GDNF (Glial cell line- Derived Neutrophic Factor, (Meng et al. 2000), involved in the regulation of spermatozoa production. Within seminipher tubule spaces Leydig cells, mainly secreting testosterone, are localized. Maturation cycles of germinal cells are also regulated by the expression of specific genes involved, together with extrinsic stimuli, in normal spermatogenesis.

Spermatogones represent immature precursors the spermatozoa are generated from. Spermatogones are adult stem cells of germinal line and are responsible for spermatogenesis maintenance, in fact, from one hand the spermatogon pool is conserved by self- reproduction, on the other hand, by a differentiation process, mature spermatozoa are generated. The equilibrium between the proliferative step and spermatogon differentiation is fundamental in order to assure the male fertility.

Biology of stem spermatogon cell has been only partially identified, particularly some molecular aspects regulated by GDNF, oct4, mvh, plzf, gpr15 and taf4b factors have been elucidated, however the true importance of these factors for spermatogenetic differentiation remains to be disclosed (Wong et al. 2005). These difficulties above all result from non availability of markers suitable to identify and follow this specific cell sub-population. The understanding of molecular mechanisms underlying the spermatogenesis is complicated from the fact that the maturation and operation of the male gonads do not depend only on the germinal cells, but also supporting ones, like Sertoli and endocrine function displaying cells, as Leydig cells. A stem cell, normally, resides in an environment named niche and survival and/or differentiation thereof depend on the cell- cell interactions and extracellular signals, as for example endocrine ones. The functional role of supporting and endocrine cells localized within the stem cell niche and interacting therewith up to now however is not clear (Li and Xie 2005).

As above described, interactions of germinal with somatic cells, both testicle components, are crucial for the normal spermatogenesis and contribute to the complex mechanisms for maintenance and development thereof. Disorders related to a single cell type can determine the testicle failure. For example, the "Sertoli cell-only" syndrome can result from germinal cell development, Sertoli cell function disorder, thus leading to loss of germinal cells, or from an endocrine system disorder, also involved in the control of spermatogenesis normal process (Bettocchi et al. 1998).

Given said cell interaction complexity in spermatogenesis, the system as a whole cannot be reproduced in vitro and genetically modified mice model provides for an attractive alternative. Using this approach, we can study the defects that can result from a specific gene lack and find new genes responsible candidate for an aberrant phenotype like the infertility. The defect can become apparent in various steps of male gonad development, starting from foetal development, like in the case of KO mice not able to develop a normal testicle due to transcription steroidogenic factor 1 (SF-1) (Luo et al. 1994). Several K. O. mice with post-birth germinal cell maturation defect have been described. For example, mice having a deletion in jsd locus (juvenile spermatogonia! depletion) in chromosome 1 are born with normal undifferentiated primordial germinal cell but subsequently are unable to differentiate in type A spermatogones (Boettger-Tong et al. 2001). Testicles of these mice completely lack in germinal line cells and reproduce the diagnostic syndrome in humans as "Sertoli cell-only". Another gene with spermatogon maturation defect, again studied with KO model, is DAZL (Schrans-Stassen et al. 2001), encoding for a RNA binding protein and involved in germinal line differentiation.

A development step has been made using animal models for the transplant of germinal stem cells (Brinster 2007). In these models, germinal cells are injected in recipient testicles. These cells successively should be suitable to colonize seminipher tubules of recipients resulting in restoration of normal spermatozoa production. For example, the transplant of spermatogon stem cells (SSC) allowed cell specific defects in many mutant not fertile mice, as for example those lacking in c-Kit and receptor thereof, to be identified (Ohta et al. 2000).

However, in spite of up to now carried out studies it is not still clear how many and which genes are involved in the control of germinal line generation (De Kretser and Baker 1999; Matzuk and Lamb 2008). In fact, although a number of genes candidate for the control of fertility regulating complex mechanisms has been identified thanks to animal model analysis, the complexity of the reproduction system still in general terms did not allow spermatogenesis regulation essential gene to be identified.

In the light of above it is therefore apparent the need to provide for new means to study the causes and possible treatments for infertility overcoming the disadvantages of known art.

GILZ gene has been originally cloned in 1997 during a systematic study relating to apoptosis induced by glucocorticoids (GC) and GC induced genes (D'Adamio et al. 1997). Later on, it has been demonstrated that GILZ can mediate GC various functions, as modulation of T lymphocyte activation, interleukyn-2 (IL-2) production, cell proliferation and death (Ayroldi et al. 2001 ; Dolphin et al. 2004; Ayroldi et al. 2007). More recently, new functions by GILZ have been defined, including those relating to T helper cell differentiation regulation, dendritic cell function (Cohen et al. 2006; Hamdi et al. 2007), increase of Na⁺ transport in the kidney (Muller et al. 2003; Soundararajan et al. 2005) and control of the neoplastic transformation through the inhibition of RAS oncogene activity (Ayroldi et al. 2007).

GILZ is expressed at various levels in many tissues and interacts with various proteins, in particular up to now carried out studies have demonstrated the interaction activity thereof with transcription molecules and factors involved in inflammatory process control, cell cycle and programmed cell death. In fact, the alteration of GILZ normal expression and/or function would seem to be associated with the alteration of molecular mechanisms responsible for inflammatory response, as well as tissue homeostasis by cell cycle and apoptosis control.

As above mentioned GILZ is expressed or induced as a response to GCs in many cell lines mediating immunosuppressive and anti-inflammatory responses (D'Adamio et al. 1997; Ayroldi et al. 2001 ; Berrebi et al. 2003; Cannarile et al. 2006; Cannarile et al. 2009).. However, although GILZ expression is usually GC induced, some studies have evidenced that GILZ induction is possible also in other experimental models without GC presence. For example, IL-2 removal results in GILZ expression in T cells (Asselin-Labat et al. 2004). Vasopressin and aldosterone stimulate expression thereof in renal epithelial cells (Soundararajan et al. 2005), IL-10 in mice macrophage (Berrebi et al. 2003) and endothelial cells (Gleissner et al. 2007). GILZ is also expressed in mice decidua at the pregnancy end (Zhao et al. 2006). Moreover, GILZ is repressed in T lymphocytes after activation by anti-CD3 (Ayroldi et al. 2001), in B lymphocytes by activation of B cell receptor (Glynne et al. 2000), in cells derived from MCF-7 breast tumour by estrogens (Tynan et al. 2004), in epithelial bronchial human cells by pro-inflammatory IL-1 , TNF-a, IFN-g cytokines (Eddleston et al. 2007).

GILZ contains a leucine zipper motif and therefore initially it had been considered a transcription factor. GILZ DNA binding domain, however, is not canonical and it is necessary for omo- or hetero- dimehzation with other family members (D'Adamio et al. 1997) or in vitro interaction with another leucine zipper protein, i.e. c-Fos (Mittelstadt and Ashwell 2001); moreover GILZ is suitable to interact also with NF-kB transcription factor that is a "non-leucin zipper" protein. The first study relating to the interaction between GILZ and NF-kB sub-unit describes the inhibition of nuclear translocation; DNA binding and NF-kB trans-activation (Ayroldi et al. 2001). Successively it has been demonstrated that GILZ/NF- kB interaction depends on 29 amino acid domain (98-127 position) of PER region located C-terminal next to Leucine Zipper and that this domain is necessary for NF-kB binding and transcription repression (Di Marco et al. 2007).

GILZ through Ras binding domain (RBD) (Ayroldi et al. 2002) also interacts with RaM protein mediating MEK-ERK transduction pathway to which Ras pathway (Ayroldi et al. 2007) more recently has been added. In particular, GILZ interacts mainly with Ras, although, together with Raf, can form a ternary complex whose formation depends on Ras actiyation condition. Moreover, DNA binding studies by means of ChIP (chromatin immunoprecipitation) have demonstrated that GILZ acts as transcription repressor for peroxisome-proliferator-activated receptor- Ύ2 (PPAR-V2) gene (Shi et al. 2003). Said study demonstrated, using an experimental in vitro model, the interaction of GILZ with histone deacetylase 1 (HDAC1) (Shi et al. 2003).

The authors of present the invention now have found that GILZ Knock Out (KO) male mice are sterile, in particular the most important difference of normal (wild-type, WT) compared to GILZ KO mice has been found to occur in testicles, wherein a remarkable size reduction together with a complete emptying of seminipher tubules of germinal cell has been observed. The differences of normal compared to GILZ KO mice are apparent, both from morphologic and functional points of view, during post-birth maturation step of germinal cells . The differences detected among GLIZ isoform expressing and non expressing mice are correlated to an apoptosis increase of cells maturating inside of the seminipher tubules.

Based on above the authors of the present invention generated a genetically manipulated cell line in order to generate knock-out mice with conditioned expression, in order to evaluate the physiological and/or pathological role of GILZ protein in various tissues. The bioinformatic and genetic analysis of GILZ gene locus allowed the nature of gene to be characterised and pointed out that at least three different isoforms can be produced by aforesaid gene. Among these there is long-GILZ (L-GILZ), which has been cloned and recently characterized by our laboratory (GenBank n. EU81878), as below described. The genetic manipulation of this locus on mice stem embryonic cells allowed GILZ (GILZ KO) knock out (KO) mice to be generated wherein no GILZ isoform can be produced.

The animal model according to the present invention, therefore, can contribute in a fundamental way to elucidate the spermatogenesis regulating mechanisms. Moreover, the identification of GILZ isoform role, as essential proteins for a successful maturation of male germinal cells, discloses new therapeutic approaches both in terms of gene therapy and screening of molecules suitable to modify GILZ functions, as for example agonists, antagonists, inhibitors, etc... , for the treatment of male sterility

Therefore, herein described studies demonstrate that GILZ is an important gene encoding for proteins (GILZ and above all L-GILZ) essential for spermatogenesis. Importantly the spermatogenetic defect of GILZ KO mice is a good mimic of Syndrome "Sertoli cell only" human pathology, which results in male sterility.

Moreover, GILZ KO mice represents an important model, as a recipient, for germinal cell transplant experiments in order to verify regenerative capacity thereof (cell therapy) also where the same have been subjected to pre-transplant gene manipulation. Such an approach is also imp ortant in order to verify the possible toxic effect (deleterious) resulting from medicaments and substances on spermatogenetic precursors. Finally, if a gene mutation in mice or human results in the infertility, the protein produced by said gene can be a future target both for the generation of new contraceptive systems, suitable to obtain a temporary or permanent infertility (by gene expression modulation or antagonist molecule use etc..) and for spermatogenesis stimulation suitable to antagonise male sterility. In this context as above described GILZ KO mice can represent a disease model and a model suitable to regenerative and/or curative transplant experiments of the germinal line.

It is therefore a specific object of the present invention a transgenic murine animal, preferably mice, obtained by means of tissue specific conditional deletion using GILZ gene CRE recombinase. In particular, the transgenic murine animal according to the invention can be obtained by GILZ gene exon 6 deletion.

The use of transgenic murine animal according to the invention as model for study and research for male infertility treatment is a further object of the present invention.

The present invention further concerns a method for preparation of a transgenic murine animal as above defined comprising or consisting of the following steps: a) isolation from BAC of GILZ gene nucleotide sequence encoding for proteins having GenBank accession number AAD01789.1 , ACJ09091 , AAG41220.1 ; b) preparation of a targeting vector by donation of the nucleotide sequence of step a) in a vector containing LoxP sites at GILZ hexone 6 sides in order to delete the sequence contained within LoxP sites when CRE recombinase is present in same cell; c) introduction of targeting vector and consequent genetic manipulation of GILZ gene locus in C57BL/6 strain Bruce4 murine stem embryonic cells by means of homologous recombination with the final targeting vector; d) injection of clones wherein gene modification of GILZ locus occurred in C57BL/6 origin blastocysts implanted in the uterus of pseudo-pregnant recipient mice; e) generation of chimeras and screening of animals allowing the genetic transmission of modified GILZ locus in order to obtain transgenic animal; and f) cross-breeding of male chimeras obtained in step e) with CMV-CRE female mice so as to obtain GILZ Knockout mice for all the organs and tissues. In particular, the isolation of GILZ gene nucleotide sequence of step a) can be carried out using the following primers: 5^l-CACTCCCCTTCTCACTCTGC-3¹ (sense) (SEQ ID NO: 1) and δ'-GAACTπATAAGCAGTCATCCC-S¹ (antisense) (SEQ ID NO: 2).

C57BL/6 strain Bruce4 murine stem embryonic cells resulting from a) to c) steps of as above defined method represent a further object of the invention.

Finally the invention concerns a transgenic animal obtainable according to the method as above defined.

The murine model according to the present invention can be advantageously used for the study and research of the male infertility treatment. In particular, the model can be used as Sertoli type cell-only syndrome disease model or other X-linked disorders, to study the mechanisms regulating the spermatogenesis in the mammals, possibility to associate GILZ gene and spermatogenesis and sterility related defects. Moreover, GILZ gene can be used as contraception target or diagnosis by genomic DNA sequencing for the presence of polymorphism or by analysis using biopsy and GILZ protein detection.

The present invention now will be described by illustrative, but not limitative way, according to preferred embodiments thereof, with particular reference to figures in the enclosed drawings.

Figure 1 : A. Diagram of murine GILZ gene locus modified according to Genome Browser on Mice j uly 2007 assembly of UCSC (University of Saint California Cruz). Representation of mice X chromosome of qF1 region, strand-, chrX: 137074068-137135061 position. B. Open Reading Frame (ORF) of GILZ isoforms. Numbers below the bars represent exones as named in A diagram. Over bars ORFs of the isoforms with relative length expressed as amino acid number (aa) are indicated.

C. L-GILZ has a transcription initiation containing not canonical CUG codon.

D. Comparison o f Gl LZ and L-GILZ is oforms. The numbers represent the position of amino acids. TSC: TGF-b stimulated clone-box; LZ: leucine zipper domain; PER: proline (P) and glutamic acid (E) rich (R) region.

Figure 2: GILZ locus in X chromosome (modified according to CloneFinder NCBI da tabase). GILZ exons are represented from black boxes with respective numbers below. X: recognition site for Xbal restriction enzyme, useful for GILZ gene fragment sub-cloning in targeting vector. A, B: insertion sites of LoxP sequences.

Lower, Diagram of pBSX9.3GILZ targeting vector where most important characteristics are pointed out, as described in Material and Methods section.

Figure 3: Genetic modification of GILZ gene locus. A. schematic representation of GILZ gene locus and modification strategy by homologous recombination to inactivate GILZ gene. B. Verification, by southern blot analysis, of GILZ gene locus successful modification.

Figure 4: GILZ and L-GILZ isoform thereof are not expressed in GILZ KO te.sticle mice. A. Control of GILZ and L-GILZ mRNA expression in GILZ WT or KO mice as reported in figure by RT-PCR. The expression of HPRT housekeeping gene message has been used as a control. B. Control of GILZ and L-GILZ protein expression in GILZ WT or KO mice as indicated in figure by Western blot a nalysis.1: positive control; 2: WT spleen; 3: KO spleen; 4: WT testicle; 5: KO testicle. The expression of β- actin protein has been used as a control.

Figure 5: Expression of GILZ (A) and L-GILZ (B) in various C57BL/6 mice tissues estimated by Real Time PCR. Fold induction: relative expression ratio of HPR T housekeeping gene to tested gene. Columns represent the average of five different experiments ± standard deviation. The GILZ expression has been arbitrarily considered as the unit.

Figure 6: Testicle atrophy in GILZ KO mice. A. Images of testicles excised from 12 week WT (wild-type, upper line) or KO (knockout, lower line) mice. B. Weight average (N=5) of GILZ WT (black column) or KO (white column) mice body weights; C. Weight average (N=5) of GILZ WT (black column) or KO (white column) mice testicle weights; Weight average (N=5) of GILZ WT (black column) or KO (white column) mice cell count* < p<0,05.

Figure 7: Analysis of normal and GILZ KO mice weight at different age as indicated in the figure. The values in figure represent the weight average ± standard deviation of the weight for10 mice for group.

Figure 8: Spermatogenesis blocking in GILZ KO adult mice. A. Hematoxylin-Eosin staining of testicle sections excised from GILZ WT (A) or KO (B). mice. Magnification 2Ox. The arrows indicate Sertoli cells. L letter indicates Leydig cells outside of seminipher tubules. C. Seminipher tubules from adult GILZ KO mice contains only Sertoli cells. Magnification 63x.

Figure 9: Analysis of mRNA expression for marker specific of various cell populations occurring in mice testicles by RT-PCR in 3 different GILZ WT or KO mice as reported in figure. The expression of HPRT housekeeping gene message has been used as a control. Figure 10: Absence of haploid and tetraploid cells in GILZ KO adult mice estimated by cytofluorimetric analysis on propidium iodide stained testicle cells. The diagram represents the weight average (N=5) ± standard deviation of GILZ WT (black column) or KO (white column) stained cells.

Figure 11 : The expression of essential genes for the survival and differentiation of PGC (primordial germ cells) cells is strongly altered in GILZ KO mice testicles. RT-PCR analysis carried out on markers expressed from Sertoli (A) or germinal (B) cells of WT and GILZ KO adult mice. The message expression of HPRT housekeeping gene has been used as a control.

Figure 12: Expression of GILZ and L-GILZ during the maturation of germinal cells . Analysis of GILZ and L-GILZ mRNA levels in C57BL/6 WT mice testicles at various days post-birth as indicated in figure, (dpp: day postpartum, days after the birth). Fold induction: relative expression ratio of HPRT housekeeping gene to tested gene.

Figure 13: Spermatogenesis blocking in GILZ KO mice in pre- puberal and adult age. Hematoxylin-Eosin staining of testicle sections excised from GILZ WT (image on the left) or KO (right) mice at different age as indicated in figure (dpp: day post partum, days after the birth).

Figure 14: Analysis of marker genes specific for different spermatogenesis steps. Expression of RNA messenger of OCT4, CycA1 , CycA2 and Bmpδa in WT and GILZ KO mice testicles at different age as indicated in figure, (dpp: day post partum, days after the birth). This is a RT-PCR experiment representative for three different experiments. The expression of HPRT housekeeping gene has been used as a control.

Figure 15: Apoptosis alteration in GILZ KO mice at different neonatal age. TUNEL assays on testicle sections excised from GILZ WT mice (image on the left) or KO (right) at different ages as indicated in figure (dpp: day post partum, days after the birth).

Figure 16: The expression of genes essential for normal control of apoptotic processes is not different for WT e GILZ KO mice testicles. RT-PCR analysis carried out on WT and GILZ KO neonatal mice at different neonatal ages as indicated in figure (dpp: day post partum). The expression of beta-Actin, b-Act, HPRT housekeeping gene has been used as a control.

Figure 17: Cells remaining inside of seminipher tubules of GILZ KO adult mice are Sertoli cells. GATA-1 immunofluorescence on WT and GILZ KO adult mice. Magnification 2Ox.

Figure 18: A Expression of hormonal receptors in WT or GILZ KO adult mice testicles by RT-PCR. The expression of HPRT message has been used as a control. B. Testosterone levels for WT or GILZ KO adult mice as estimated by RIA assay. C. FSH and LH expression estimated by RT-PCR on hypophysis of WT or GILZ KO adult mice. The expression of HPRT message has been used as a control.

Example 1: Preparation and study of GILZ KO mice according to the invention

MATERIALS AND METHODS

L-GILZ cloning.

By computational analysis on database of University of California Santa Cruz (UCSC) Genome Browser, (http://qenome.ucsc.edu/). it is possible to point out that GILZ gene (or TSC22d3) maps on the negative strand of chromosome X long arm at 137074068-137135061 position. Totally it consists of a genomic sequence comprising 39007 bp wherein 6 exons and 5 introns occur (Fig. 1). GILZ has been already cloned by our laboratory (D'Adamio et al. 1997). GILZ messenger RNA has a length of 1963 bp, of which 414 bp represent "open reading frame" encoding for a protein comprising 137 amino acid residues, while remaining pairs are part of the transcribed and 5' and 3¹ not translated region. EAST sequence analysis (Expressed Sequence Tags) and the prediction based on RefSeq, Genbank, and UniProt data shows that at least other 2 alternative transcripts generated from same locus and sharing second and third GILZ exons are possible (Fig. 1 B).

From these data we have designed primers based on the sequence in aforesaid named uc009ulb.1 database (SEQ ID NO: 60 represented in Table I).

Table I

>uc009ulb.1 length=2149 tcactccccttctcactctgcgtgcgtgcgggctgctgggcaagtctctcgaggggtcgacggagccgg tttacctgaagtggcagcttgtttttccgggcaccctggagtcccaaaaggctagctccgcaggtgcgc acctgccggccgcccccgacctccctgagcaggccgccgccgccgctgcctccaagccggagaag atggcccagcccaagaccgagtgccgctcacctgttggcctcgactgctgcaactgctgcctcgacct ggccaaccgctgcgagctccagaaggagaagagcggggagagcccgggcagccccttcgtgag caactttcggcagctgcaggagaagctcgtcttcgagaacctcaacactgacaagctgaacaacata atgcgccaggattccatggagcccgtggtgcgcgacccctgctacctgatcaatgagggcatctgcaa ccgcaacatagaccagaccatgctctccattctacttttcttccacagtgcctccggagccagtgtggtg gccctagacaacaagattgagcaggccatggacctcgtgaagaaccacctgatgtacgctgtgaga gaggaggtggaggtcctaaaggagcagattcgtgagctgcttgagaagaactccc agctggagcgcgagaacaccctcctgaagacgctggcaagccccgagcaactggaaaagttcca gtcccggctgagccctgaagagccagcacctgaagccccagaaaccccggaaaccccggaagcc cctggtggttctgcggtgtaagtggctctgtccttagggtgggcagagccacatcttgttctacctagttcttt ccagtttgtttttggctccccaagcgtcatctcatgtggagaactttacacctaacatagctggtgccaag agatgtcccaaggacatgcccatctgggtccactccagtgacagacccctgacaaagagcaggtctc tggagactaagttgcatggggcctagtaacaccaagccagtgagcctgtcgtgtcaccgggccctgg gggctcccagggcctgggcaacttagttacagctgaccaaggagaaagtagttttgagatgtgatgcc agtgtgctccagaaagtgtaaggggtctgtttttcatttccatggacatcttccacagcttcacctgacaat gactgttcctatgaagaagccacttgtgttctaagcagaagcaacctctctcttcttctctgtcttttccaggc aggggcagagatgggagagattgagccaaatgagccttc tgttggttaatactgtataatgcatggctttgtgcacagcccagtgtggggttacagctttgggatgactgct tataaagttctgtttggttagtattggcatcgtttttctatatagccataatgcgtatatatacccatagggcta gatctatatcttagggtagtgatgtatacatatacacatacacctacatgttgaagggcctaaccagcttt gggagtactgactggtctcttatctcttaaagctaagtttttgactgtgctaatttaccaaattgatccagtttg tcctttagattaaataagactcgatatgagggagggaggggagaccagcctcacaatgcggccaca gatgccttgctgctgcagtcctccctgatctgtccactgaagacatgaagtcctcttttgaatgccaaacc caccattcattggtgctgactacatagaatggggttgagagaagatcagtttggacttcacatttttgtttta agtWaggttgttttttmggttttgWgWgWgWgWgtttttgtttmgtttttcttttttttaagttcttgtgggaaa ctttggggttaatcaaaggatgtagtcctgtggtagaccagaggagtaactagttttgatccctt tggggtgtggaaaatgtacccaggaagcttgtgtaaggaggttctgtgacagtgaacactttccactttct gacacctcatcctgctgtacgactccaggatttggatttggatttttcaaatgtagcttgaaatttcaataaa ctttgctcctttttctaaaaataaa

This sequence represents the longest transcript which GILZ gene can generate. This isoform is produced by splicing of exons 1 and 2 going on 5 and 6 exons, as described in Fig. 1. We obtained cDNA from murine cells, firstly by RNA total extraction using Trizol Reagent (Invitrogen) and then cDNA retro -transcription using Sup erScript III kit (Invitrogen). The primers used for annealing to 5¹ - and 3' - not translated regions of transcript to be cloned were: δ'-CACTCCCCTTCTCACTCTGC- 3' (sense) (SEQ ID NO: 1) and δ'-GAACTTTATAAGCAGTCATCCC-S ' (antisense) (SEQ ID NO: 2). The PCR obtained product has been cloned in pcDNA3.1-mice vector (Invitrogen). Thus cloned sequence has a length of 1402 base pairs and was named L-GILZ sequence (GenBank Accession number EU818782; protein ID ACJ09091).

Construction of pBSX9.3GILZ targeting vector.

The first step for generation of a genetically modified mice is to localize the region of gene locus to be modified or deleted. In order to make this it is necessary to prepare a "targeting" named vector with homology regions flanking the region to be modified.

The genomic fragment containing GILZ gene locus has been obtained by BAC digestion (#RP23-384P21 , position 136928703- 137123544, chromosome X XqF1 lane) from BACPAC Resources Center (BPRC), Children's Hospital and Research Center at Oakland (CHRCO), Oakland, CA, USA. BAC digestion has been carried out using various restriction enzymes. Fragments useful for the preparation of GILZ gene targeting vector have been isolated by purification on agarose gel and sub-cloned using Xbal restriction enzyme in pBlueScript vector. Successively two sequences, respectively upstream and downstream to exon 6, named A and B (137076141-137076272 and 137073825- 137074044 position, respectively), suitable to the insertion of 34 bp LoxP sites, have. been detected (Fig. 2). These sequences have been inserted by ET recombination technique (Zhang et al. 1998) so as to obtain the pBSX9.3GILZ final targeting vector (Fig. 2). To be pointed out as indicated in the figure, the following portions inserted in the pBSX9.3GILZ vector: a cassette containing neomycin phosphotransferase bacterial gene under the control of thymidine kinase promoter, in order to confer G418 substance resistance (NEO); cassette containing Ampicillin antibiotic resistance (AmpR); unique recognition site for Notl restriction enzyme, necessary for targeting vector linearization before electroporation in embryonic stem cells (Fig. 2). pBSX9.3GILZ final targeting vector has been controlled by restriction map with various enzymes and sequenced in splicing points. After validation of these analyses, a "maxi" preparation of pBSX9.3GILZ plasmid has been carried out using maxi-kit for "endotoxin-free" plasmid extraction (Qiagen), in order to have a sufficient plasmid amount for ES cell electroporation.

Generation of mice recombinant stem embryonic cells and production of chimeras.

The successive step for the preparation of KO mice is gene locus targeting in ES cells using pBSX9.3GILZ targeting vector.

30 μg of pBSX9.3GILZ targeting vector have been electroporated in 1x10⁶ Bruce4 stem embryonic murine cells (C57BL/6 strain) with a single 240 Volt impulse, 500 μF. 24 hours after electroporation, G418 for selection has been added to culture medium. After 7 days selective medium resistant clones have been collected from culture plates and individually expanded on 96 well plate for two weeks in triplicate (one copy has been frozen and two used for the extraction of genomic DNA). Genomic DNA extracted from these cells is used to evaluate the clone genotype and detect by homologous recombination those wherein the modification of the GILZ gene locus occurred. These recombination events have been verified by Southern blot as described in Fig. 3. Three positive clone have been further expanded in vitro on plate and successively injected on C57BL/6 origin blastocysts. Generated chimeras have been genotypized by Southern blot, with the same strategy used for the screening of the embryonic stem cells and involving two probes (5¹ and 3' probes) as indicated in Fig. 3A. Cross-breeding of positive male chimera with CMV-CRE female mice (Su et al. 2002) allowed the generation of mice with modified allele removing exon 6. Thus all the mice harbouring this modification in X chromosome have inactivated GILZ gene. All the analyses have been carried out on C57BL/6 pure strain mice.

RNA purification and RT-PCR analysis.

Total RNA has been isolated from same age and litter WT or KO mice testicles using Trizol (Invitrogen) reagent according to the producer instructions. The retro-transcription has been carried out using Qiagen QuantiTect Reverse Transcription kit. The primers used for RT- PCR on different tissues analysed for cDNA amplification are listed in Table II.

Table Il

AAGACCTGCCTGATCTGTGG (SEQ ID NO

AR for 3)

TCGTTTCTGCTGGCACATAG (SEQ ID NO

AR rev 4)

GCGAATTGGAGATGAACTGGAC (SEQ ID

Bax for NO 5)

AGCAAAGTAGAAGAGGGCAACC (SEQ ID

Bax rev NO 6)

GCAGCAGTGAAGAAGGAACC (SEQ ID NO

BAZF for 7)

AGCCACAGCCTCACAGTTCT (SEQ ID NO

BAZF rev 8)

BCL2 for AGTACCTGAACCGGCATCTG (SEQ ID NO • 9)

GGTATGCACCCAGAGTGATG (SEQ ID NO

BCL2 rev 10)

GAATGACCACCTAGAGCCTTG (SEQ ID

BcI-XL for NO 11)

GAACCACACCAGCCACAG (SEQ ID NO

BcI-XL rev 12)

CCAACCGTGAAAAGATGACC (SEQ ID NO

Beta Actin for 13)

CGTGAGGGAGAGCATAGCC (SEQ ID NO

Beta_Actin rev 14)

ATTACTGTGCTGGGGAGTGC (SEQ ID NO

Bmp-8b for 15)

TGGGGATGATATCTGGCTTC (SEQ ID NO

Bmp-8b rev 16)

CAGAGCTCCAAGAGTGGAG (SEQ ID NO

CyclinAI for 17)

AGTGGAGATCTGACTTGAGC (SEQ ID NO

CyclinAI rev 18)

CACCTCGAGGCATTCGGG (SEQ ID NO

CyclinA2 for 19)

CGGGTAAAGAGACAGCTGC (SEQ ID NO

CyclinA2 rev 20)

GATGGGCTTATTGACCAACC (SEQ ID NO

ER_alpha for 21)

CCAGGCACACTCCAGAAGG (SEQ ID NO

ER_alpha rev 22)

CCGAGTTGTCGTCCTGTAG (SEQ ID NO

ERM for 23)

ACTGGCTTTCAGGCATCATC (SEQ ID NO

ERM rev 24) ACCCCAGTACACCCTCTGAA (SEQ ID NO

FasL for 25)

GATCACAAGGCCACCTTTCT (SEQ ID NO

FasL rev 26)

TCAGCTTTCCCCAGAAGAGA (SEQ ID NO

FSH_beta for 27)

CCGAGCTGGGTCCTTATACA (SEQ ID NO

FSH_beta rev 28)

CCAAGCTTCGAGTCATTCCA (SEQ ID NO

FSHR for 29)

ATGCAAGTTGGGTAGGTTGG (SEQ ID NO

FSHR rev 30)

CGGACGGGACTCTAAGATGA (SEQ ID NO

GDNF for 31)

CGTCATCAAACTGGTCAGGA (SEQ ID NO

GDNF rev 32)

CCATGTTCCTAGCCACTCTG (SEQ ID NO

GFRA1 for 33)

CACTGGCTTTCACACAGTCC (SEQ ID NO

GFRA1 rev 34)

TCTTGTTGTCTAGGGCCACC (SEQ ID NO

GILZ rev 35)

AGGGGATGTGGTTTCCGTTA (SEQ ID NO

GILZ for 36)

AACTGGAATAGGTGCCAAGG (SEQ ID NO

GR for 37)

GAGCACACCAGGCAGAGTTT (SEQ ID NO

GR rev 38)

CGTCGTGATTAGCGATGATG (SEQ ID NO

HPRT for 39)

HPRT rev ACAGAGGGCCACAATGTGAT (SEQ ID NO 40)

CGCCTCACCCAACTAGATATCA (SEQ ID

HSP 70-2 for NO 41)

GCTTCATATCGGACTGCACTGT (SEQ ID

HSP 70-2 rev NO 42)

ACCGCAACATAGACCAGACC (SEQ ID NO

LGILZ for 43)

TCTTGTTGTCTAGGGCCACC (SEQ ID NO

LGILZ rev 44)

AGTTCTGCCCAGTCTGCATC (SEQ ID NO

LH-beta for 45)

TGAGGGCTACAGGAAAGGAG i (SEQ ID NO

LH-beta rev 46)

TCACAAGCTTTCAGGGGACT (SEQ ID NO

LHCGR for 47)

GCAGG I I I I I GGTGTTCTGG (SEQ ID NO

LHCGR rev 48)

GCTATCCACTGCTGCTTGA ( SEQ D NO

NGN3 for 49)

CCGGGAAAAGGTTGTTGTGT (SEQ ID NO

NGN3 rev 50)

GAGCACGAGTGGAAAGCAAC - (SEQ ID NO

OCT4 for 51)

TTCTGCAGGGCTTTCATGTC (SEQ ID NO

OCT4 rev 52)

TTCAGTTCATTGGGACCATC (SEQ ID NO p53 for 53)

ATATCCGACTGTGACTCCTC (SEQ ID NO p53 rev 54)

AGTACCCGCATCTGCACAAC (SEQ ID NO

SOX9 for 55) AATCGGGGTGGTCTTTCTTG (SEQ ID NO SOX9 rev 56)

PCR reaction conditions were as below: denaturation 95°C for 5 minutes then 30 cycles consisting of: denaturation 95°C for 20 seconds: annealing 60⁰C for 20 seconds; extension 72°C for 20 seconds.

PCR Real-Time Analysis.

For quantitative Real-Time PCR following primers have been used: GILZ sense 5¹ - GGTGGCCCTAGACAACAAGA-S¹ (SEQ ID NO: 57), antisense 5 ' - TCπCTCAAGCAGCTCACGA-3¹ (SEQ ID NO: 58). L- GILZ, sense 5'- ACCGCAACATAGACCAGACC-S¹ (SEQ ID NO: 43), antisense δ'-TCπCTCAAGCAGCTCACGA-S¹ (SEQ ID NO: 59). HPRT₁ sense 5¹-CGTCGTGATTAGCGATGATG-3¹ (SEQ ID NO: 39), antisense 5¹- ACAGAGGGCCACAATGTGAT-S¹ (SEQ ID NO: 40). The polymerization reaction occurred using CHROMO 4 (MJ Research Bio Rad, Milan, Italy) thermocycler with DyNAmo HS SYBR GREEN qPCR kit (Finnzymes; Celbio). Reaction cycle conditions were as below: denaturation (95⁰C for 15 min), amplification and quantization schedule for 40 times, 95°C for 20 sec, 58°C for 20 sec, 72⁰C for 20 sec, denaturation profile 70-95°C, 0.5 °C/sec heating rate).

In order to calculate the relative amounts of GILZ, L-GILZ and HPRT mRNA, ΔΔC(t) comparative method has been used. C(t) value has been determined using Opticon Monitor 2 (MJ Research Bio Rad) software.

Histologic analysis of neonatal and adult mice testicles and TUNEL reaction.

Testicles have been excised from WT and KO different age mice and fixed in Bouin solution (Sigma) for 24 hours at 4°C, progressively dehydrated in graded ethanol and paraffin embedded (Paraplast, SIGMA). Successively 5 micron paraffin embedded tissue sections have been mounted on glass slides. These sections have been used for immunohistochemical experiments, immunohistochemistry, immuno- fluorescence, TUNEL reaction (terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling) and hematoxylin-eosin staining.

As to TUNEL the instructions of commercial ApopTAg Red kit in situ (Chemicon International) have been followed. Shortly, the sections have been pre-treated with K proteinase (20 μg/ml) for 15 min. at room temp. After 2 PBS 1x washings, samples have been incubated with TdT containing reaction buffer for 1 hour at 3 7°C. After PBS 1x washing, samples have been incubated for 30 min. at room temp with buffer containing anti-digoxigenine rhodamine-conjugated antibody. Before the assembly the slides have been stained also with 15 μl of DAPI (1 μg/ml) for five minutes. The samples have been stored in the dark at -20⁰C up fluorescence microscope analysis.

For immunofluorescence analysis, the sections have been incubated, after antigen de-masking procedure (reflux 1 hour in sodium citrate buffer 10 mM pH 6), cells have been washed three times with PBS 1x and successively incubated with primary antibody (GATA-1 , Cruz Saint, dilution 1 :100) for 1 hour at room temp, in PBS 3% + BSA 0,1% + Triton X- 100. Same incubation times and buffer for secondary antibody (anti-rat Alexa-Fluor conjugated, Molecular Probes). DAPI (Sigma) staining has been carried out at room temp for five minutes quickly before slide mounting. Image acquisition has been made with Leica microscope equipped with a Diagnostic Instruments television camera.

Western blot Analysis.

An equal protein amount (30 μg) of various tissues of each genotype has been separated by SDS-PAGE and successively analyzed by immu noblotting as previously described (Bruscoli et al. 20 06). T he following antibodies have been analyzed: anti-GILZ rabbit polyclonal antibody (Saint Cruz, FL-134); anti-β-actin mice monoclonal antibody (Sigma). All the primary antibodies have been incubated for all the night at 4°C. Peroxidase-conjugated anti-rabbit and anti-rat secondary antibodies (HRP, Thermo Scientific) have been incubated at room temp, for 1 hour. Proteins have been transferred on PVDF membranes (Hybond plus) from Amersham. For chemiluminescence reactions SuperSignal solutions (Pierce) have been used.

RIA Test.

Testosterone levels have been estimated using a RIA (Radioimmuno assay) commercial kit (ICN Pharmaceuticals Ltd., Basingstoke, UK) as previously described (OShaughnessy and Sheffield 1990). Sera from five normal adult or GILZ KO mice, have been collected to form WT or GILZ KO group to be tested.

Statistical Analysis.

All the experiments, also where not explicitly expressed, have been carried out at least in triplicate. For data analysis, Student t-test has been applied using STATPAC computer program and P<0.05 has been considered significant.

RESULTS

Analysis of GILZ gene locus

The bioinformatic analysis of murine GILZ gene locus has been carried out using UCSC (University of Saint California Cruz) database. GILZ gene is located on X chromosome at 137,074,068-137,135,061 position. GILZ has been cloned in our laboratory in 1997, as previously described (D'Adamio, Immunity, 1997). Recently we have cloned and subjected a new amino acidic sequence for a new isoform produced by GILZ gene, named L-GILZ. This new variant has an ORF containing {open reading frame) 705 base pairs (bp) and encodes for a protein having 234 amino acids and 26 KDa predicted molecular weight and is different than GILZ isoform only for N-terminal portion (Fig 1 B). A particular feature of this alternative transcript is to have a not canonical non-AUG transcription origin site; in fact, the transcript starts with CTG where there is a high homology with Kozak consensus sequence, characteristic of transcription origin sites (Fig. 1C). At least three isoforms are generated by GILZ gene and all are generated from a different alternative exon 1 then converging in 5 and 6 exons shared by all isoforms as shown in the diagram of Figure 1A. These, isoforms share an important portion of the amino acidic sequence. Shared exons encode for an important portion of protein ORF and comprises leucine zipper domains (LZ), Tsc-box and PER (Fig. 1D), important for the protein GILZ function, as already previously demonstrated (Ayroldi et al. 2002; Ayroldi et al. 2007; Di Marco et al. 2007).

Generation of GILZ KO

In designing the deletion strategy for GILZ function the possible presence of alternative transcripts is to be considered since the deletion of a single isoform could lead to a compensation effect resulting from another isoform. Therefore when th e t argeting strategy has been provided we decided to modify the locus by determining a deletion of exon 6 since it is shared by all gene transcripts and contains an important portion of GILZ protein. In fact, exon 6 encodes for the most of GILZ protein (approximately 65%); encodes for up to now known functional domains responsible for dimerization and direct interaction with other proteins as NF-kB; the elimination of exon 6 assures also that others 2 possible proteins generated by alternative transcripts are lacking in above said functional domains.

GILZ KO mouse has been generated from stem embryonic cells (ES) wherein GILZ gene has been genetically modified by homologous recombination with pBSX9.3 GILZ {targeting vectoή vector, containing modified allele with LoxP sites to the sides of GILZ exon 6 (Fig. 2A). The injection of thus modified ES in C57BL/6 mouse blastocysts resulted in 4 chimeras containing GILZ locus modified as in targeting vector. Two of these chimeras have been cross-bred with CMV-CRE transgenic mice, containing CRE recombinase that recognises LoxP sites and specifically eliminates the DNA portion between these sites. This cross-breeding resulted in the immediate removal of cassette inside of LoxP sites, generating a modified allele as in figure 3A. All the produced transcripts from GILZ gene in the modified chromosome thus would have to be inactivated and no GLZ functional transcripts would have to be produced as a result, of GILZ exon 6 removal. New born individuals have been controlled by Southern blot and PCR in order to detect the successful genetic transmission of modification (Fig 3B). These animals thus became progenitors of a new genetically manipulated mice strain, wherein, on pure C57BL/6 background, GILZ gene has been inactivated. These mice will be named from now on GILZ KO mice.

Phenotype analysis of GILZ KO mice

GILZ KO are born vital and the newborn number for delivery, delivery frequency and male to female ratio are normal. At the birth the newborn does not display apparent signs of diseases or morphologic, anatomical or behavioural defects.

Firstly we have verified wheter, at the successful inactivation of GILZ gene, corresponded the absence of RNA messenger and protein of GILZ gene produced isoforms. In Fig. 4A is shown that GILZ and L-GILZ mRNA is detectable in WT mice testicles, while it is completely absent in GILZ KO mice. The same is true as to the protein expression (Fig. 4B₁ line 4 versus line 5). It is interesting to point out that with respect to testicles, the most expressed isoform is L-GILZ (Fig. 4B₁ line 4), while in the spleen mostly expressed is GILZ isoform (Fig 4B, line 2).

Studies on the expression of various GILZ isoforms in various tissues, carried out by RealTime PCR, show as the various GILZ transcripts are differently expressed in various tissues (Fig. 5). As previously demonstrated (D'Adamio et al. 1997; Cannarile et al. 2001), GILZ is expressed in lymphoid, but also in other tissues as skeletal muscle and lung (Fig 5A). On the contrary L-GILZ seems to be mainly expressed in testicles, in comparison to other tissues, as lymphoid ones (Fig. 5B).

The autopsy of young male mice in adult age (10-12 weeks) has not shown substantial appreciable differences as to the fol lowing organs: thymus, lungs, heart, liver, kidneys, intestine, stomach, spleen, pancreas, blister.

The unique organ where there are apparent differences of normal compared to GILZ KO mice is testicle. As it is apparent from Fig. 6A₁ GILZ KO mice testicles have a size reduced by 70-80% compared to same age WT mice. Moreover, while the weight of WT and KO mice is comparable (Fig. 6B, on the left), the weight and testicle cell counts are meaningfully different for WT and GILZ KO mice (Fig. 6B, in middle and right).

Each of three GILZ KO mice has been mated with a pair of C57BL/6 female mice for a 6 month period and no mated female was pregnant.

During the first 9 months of mice life there are no appreciable weight differences for WT and GILZ KO mice (Fig. 7)

From this first phenotype analysis therefore it is possible to conclude that GILZ KO male mice is vital, reaches adult age and is sterile.

GILZ is essential for the normal spermatogenesis

On the base of the infertility and atrophy observed in testicles of GILZ KO mice we studied spermatogenesis in GILZ KO mice testicle.

Histological analysis carried out on testicle sections of WT and GILZ KO adult mice show s that GILZ KO mice testicles are smaller, approximately 1/5^th of normal ones and display a complete depletion of germinal line cell within seminipher tubules (Fig 8B, C compared to 8A).

The absence of germinal cells in adult GILZ KO mice is confirmed by RT-PCR analysis. In fact, while the mRNA expression of SOX-9 and luteinizing hormone receptor (LHGCR), Sertoli and Leydig cell specific markers, respectively, is similar in WT and GILZ KO mice, the expression of Oct-4, germinal cell marker, is completely absent in GILZ KO mice (Fig. 9).

These data are confirmed by cytofluorimetric analysis determining the cell DNA content, by propidium iodide (Pl) staining. In the cells of GILZ KO mice testicles tetraploid and haploid populations, characterizing more mature steps of germinal cells, from spermatocytes in meiotic step to spermatozoa, are absent (Fig. 10).

Alteration of the expression of molecular markers essential for the maintenance and differentiation of germinal cell immature precursors. (PGC) in GILZ KO mice.

The maintenance of a normal fertility in mammals firstly depends on the mechanisms regulating the renewal of undifferentiated cell pool and PGC differentiation (Wong et al. 2005).

These cells interact physically with Sertoli cells, somatic cells occurring in seminipher tubules, acting as a support for renewal and PGC differentiation. It is known, for example, that Sertoli cells produce GDNF that controls the maintenance of the PGC in a dose-dependent way (Meng et al. 2000; Wong et al. 2005). In GILZ KO adult mice, the GDNF production seems to be normal, comparable to WT mice levels (Fig. 11A). Also the ERM expression, a molecule occurring on Sertoli cells important for PGC renewal (Chen et al. 2005), is similar WT and GILZ KO adult mice (Fig. 11A).

GDNF binds a receptor, occurring in PGC, consisting of two different molecules, Ret and GRF-α1 (Meng et al. 2000; Wong et al. 2005). In GILZ KO adult mice, one of these transcripts, i.e. GRF-α1 , is almost not detectable by RT-PCR (Fig. 11B). Moreover, we have estimated intrinsic factors, mostly expressed in PGC, as ngn3 and BAZF, important for the maintenance of undifferentiated PGC cells (Oatley et al. 2006; Yoshida et al. 2006), Hsp70-2, whose lack results in a defect during meiotic step (DIX et al. 1996).

All these transcripts disappear in adult GILZ KO mice (Fig. 11B) in comparison to the normal expression on WT mice testicles.

These data support the hypothesis that the defect in GILZ KO mice testicles concerns directly germinal cells and does not concern the presence and support function of Sertoli cells inside of seminipher tubules.

The spermatogenesis defect in GILZ KO mice is determined during first maturation steps of germinal line cell.

Then testicle sections of GILZ KO mice just born and in first life days have been analyzed, when the various maturation steps of the germinal cell occur, up to 28 days, when the maturation is complete and spermatozoa start to appear inside of seminipher tubules.

First of all GILZ and L-GILZ expression in testicles of mice just born and at various ages during the various steps of murine spermatogenesis, it is pointed out that the amount of L-GILZ transcript increases progressively over the days, till to arrive to maximum expression level during the adult age, while levels of GILZ isoform remain always low (Fig 12).

Once arrived into gonads PGC cells are divided to form type A1 spermatogones. These are stem cells that after various divisions are divided generating another type A1 spermatogon and a type A2 spermatogon, type A2 spermatogones on turn are successively divided generating type A3 spermatogones and type A4 spermatogones. Spermatogones are stem cells which during sexual maturation, approximately at 10 days for mice, can have various fates: 1) self- replication generating other spermatogones, 2) cellular death (apoptosis) or 3) generation of type B spermatogones, precursors of primary spermatocytes (de Rooij 2001 ; Oatley and Brinster 2008).

The first step of the spermatogenesis, in mice during the first 10 days of life, involves that at birth, inside of the seminipher tubules, only spermatogones, undifferentiated precursors of germinal and Sertoli line cells are present.

The examination of WT and KO GILZ mice sections at 7 days of life shows that in both groups the number and morphology of Sertoli cells and spermatogones are normal (Fig. 13, 7 days). On the contrary, already at 14 days differences are observed, not so much for the number as for the type of cells, occurring in GILZ KO mice tubules. (Fig. 13, 14 days). In fact, in GILZ KO mice Sertoli cells and spermatogones are observed, it seems that at various development steps do not occur spermatocytes as observed in WT mice tubules (Fig 13, 14 days.). These differences result to be more apparent at 21 days, where the normal progression of the spermatogenesys observed in WT mice, is counteracted by the emptying of the germinal line cells in GILZ KO tubules (Fig. 13, 21 days). This phenotype grows till to reach a complete absence of germinal cells in five month old GILZ KO mice (Fig. 12, adult).

These morphologic analyses of Hematoxylin-Eosin stained sections show as in GILZ KO mice it is a progressive degeneration of germinal cells and never appear spermatocytes successive spermatogenesys steps, that in normal mice enter in meiotic step leading in subsequent days to the formation of male haploid gametes (spermatydes and spermatozoa).

Therefore, up to now analyzed data suggest that the maturation of germinal cells is blocked in GILZ KO mice testicles in a premature step during the neonatal age.

Analysis of spermatogenesis marker at different maturation steps.

In order to characterize and detect the step wherein the spermatogenesis of GILZ KO mice is blocked, we analysed the expression of testicle expresse d genes at different steps o f spermatogenesis. As shown in Fig. 14, RT-PCR analysis carried out on BMP-8, i.e. a gene expressed in initial step of spermatogenesis (Zhao and Hogan, Mech Dev 1996), there are not apparent expression genotype differences up to 21 days. Instead, as to the expression of genes as Cyclin A1 , which occurs in pachytene step sp ermatocytes (Sweeny, Dev to you 1996), is always absent in GILZ KO mice, also in 21 day old mice, when, on the contrary, begins to appear in WT mice, indicating that in GILZ KO mice there are no pachytene step spermatocytes (Fig 14). As control, it is possible to see that in the same samples the expression of Cyclin A2, that instead is constitutively expressed in all maturation steps of germinal cell development (Sweeney et al. 1996), is expressed in equal amount both in WT and GILZ KO mice (Fig 14).

Analogously, also the expression of Oct4, marker of germinal line cells, is present in all steps of WT mice spermatogenesis, while from 21 days on is completely absent GILZ KO mice.

These result suggest that the germinal cells of GILZ KO mice end differentiation process surely before the spermatocyte step during pachytene meiosis is reached.

Increase of the apoptosis inside of seminipher tubules in GILZ KO mice testicles.

Successively, we have carried out TUNEL tests to estimate the levels of cells dead due to apoptosis, in order to understand if the continuous degeneration of germinal cells in development premature step could result from an altered control on the processes regulating the cell death.

As is shown in figure 15, in just born mice, the number of TUNEL method stained cells, therefore during apoptosis, is very limited, both on testicle sections of WT and GILZ KO 7 day mice, even if the apoptotic events inside of GILZ KO mice tubules seem to be more frequent.

These differences become very more apparent at 14 days, at which time a massive apoptosis in some GILZ KO mice tubules are observed. Later on, at 21 days, in WT mice a normal frequency of apoptotic cells is observed, due to a normal cell maturation and differentiation turn-over, while GILZ KO mice tubules, as already evidenced by Hematoxylin-Eosin staining, are already nearly empty and therefore apoptotic events are no more observed (Fig. 15).

These results indicate that GILZ KO mice germinal cells are subjected to apoptosis during a premature development step, about at the start of the first step of meiotic division and this cellular death increase results in a progressive elimination of germinal line cells inside of seminipher tubules.

The proliferation rate of germinal line cells, one among the highest in the organism, is very well regulated; thus it is not at all surprising that genes growth (as Kit, Cfs and Bmpδa) and apoptosis (as Apaf-1 , Bax, BcIX) involved genes, are involved for a normal maintenance and development of the spermatogones. During the process of these cell maturation, approximately 75% dies before to reach the mature spermatozoa step. A balance of expression levels of anti-apoptotic as BcI- 2, Bcl-6, BcIX, and pro-apoptotic genes as Bax protein, is of extreme importance to regulate the survival of germinal cells (de Rooij 2001 ; Sofikitis et al. 2008). It is possible that defects relating to this delicate balance between proliferation and death contributes to the generation of male infertility. In mice, for example, the absence of BcIX results in a complete loss of germinal cells before the birth (Kasai et al. 2003).

We have evaluated some of the most important factors relating to the control of the apoptosis in WT and GILZ KO mice during first seven days of life. As it is observed by RT-PCR analysis in Fig. 16, the levels of Bcl2, Bax, BcIXL, p53 transcripts for normal and GILZ KO mice are comparable, suggesting that these genes are not involved in increase of apoptosis occurring in GILZ KO mice as previously illustrated.

The seminipher tubules of GILZ KO mice testicles contain only Sertoli cells

The results analysed up to now clearly show that a progressive depletion of germinal cells inside of GILZ KO mice testicle tubules occurs. Various research studies indicate that GATA-1 can be considered a good marker for Sertoli cell definition inside of seminipher tubules (Meng et al. 2000; Chen et al. 2005). We have taken advantage of this peculiarity in order to establish whether in seminipher tubules of GILZ KO adult mice atrophic testicles effectively only Sertoli cells remain. In order to carry out this evaluation we carried out immunofluorescence experiments on WT and GILZ KO 5 month old mice testicle sections. Results as shown in Fig. 17 indicate that at the bottom of GILZ KO adult mice emptied seminipher tubules only Sertoli cells remain, as pointed out by GATA-1 staining which stains all the cells remaining inside of the tubule. On the contrary, in WT mice tubules there are 10-15% GATA-1 positive cells, as expected for a cell distribution inside of tubule (Fig 17).

This analysis confirms that viable remaining cells inside of the seminipher tubules of GILZ KO mice testicles are Sertoli cells.

The hormonal levels of hormone receptors involved in testicle maintenance and function do not vary among WT and GILZ KO mice.

The testicle normal functions are affected both from endocrine (extra-testicular) and paracrine (intra-testicular) system factors. LH and FSH gonadotropines, being major endocrine hormones which are involved, are secreted by hypophysis. The latter regulate functions of specific cells inside of testicle by specific receptors (LHGCR luteinizing hormone and follicle-stimulating hormone FSHR receptors), which are expressed from Leydig and Sertoli cells, respectively. The paracrine regulation of the spermatogenesis depends on the steroidal hormone production, as testosterone and extradiol, which are synthesised from Leydig cells in testicle tubular interstice (Sharpe et al. 2003; Sofikitis et al. 2008). KO mice for androgen receptor (AR) are unable to mature normal male gonads (Yeh et al. 2002). Moreover it seems that also glucocorticoid receptor (GR) is important for the normal function of the cells supporting the maturation of germinal cells (Weber et al. 2000).

RT-PCR analysis shows that the levels of estrogen (ERa), AR, FSHR, LHGCR₁ GR receptor message level for WT and GILZ KO mice are comparable (Fig. 18A).

Also Testosterone (Fig. 18B), FSH and LH (Fig. 18C) hormonal levels are similar in WT and GILZ KO mice.

As whole these results suggest that the endrocrine functions of GILZ KO mice do not appear to be affected from the absence of GILZ gene and therefore the defect in the maturation of germinal line cells does not depend on alteration of signals coming from hypothalamus- hypophysis-gonads axis, the latter appearing normal as a whole. BIBLIOGRAPHY

Asselin-Labat, M. L., David, M., Biola-Vidamment, A., Lecoeuche, D., Zennaro, M. C₁ Bertoglio, J., and Pallardy, M. 2004. GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal-induced apoptosis. Blood 104(1): 215-223. Ayroldi, E., Migliorati, G., Bruscoli, S., Marchetti, C, ZoIIo, O., Cannarile, L., D'Adamiø, F., and Riccardi, C. 2001. Modulation of T-cell activation by the glucocorticoid-induced leucine zipper factor via inhibition of nuclear factor kappaB. Blood 98(3): 743-753.

Ayroldi, E., ZoIIo, O., Bastianelli, A., Marchetti, C, Agostini, M., Di Virgilio, R., and Riccardi, C. 2007. GILZ mediates the antiproliferative activity of glucocorticoids by negative regulation of Ras signaling. The Journal of clinical investigation 117(6): 1605-1615.

Ayroldi, E., ZoIIo, O., Macchiarulo, A., Di Marco, B., Marchetti, C₁ and Riccardi, C. 2002. Glucocorticoid-induced leucine zipper inhibits the Raf- extracellular signal-regulated kinase pathway by binding to RaM . Molecular and cellular biology 22(22): 7929-7941.

Baker, H.W. 2000. Management of male infertility. Baillieres best practice & research 14(3): 409-422.

Berrebi, D., Bruscoli, S., Cohen, N., Foussat, A., Migliorati, G., Bouchet- Delbos, L., Maillot, M. C₁ Portier, A., Couderc, J., Galanaud, P., Peuchmaur, M., Riccardi, C₁ and Emilie, D. 2003. Synthesis of glucocorticoid-induced leucine zipper (GILZ) by macrophages: an antiinflammatory and immunosuppressive mechanism shared by glucocorticoids and IL-10. Blood 101(2): 729-738.

Bettocchi, C₁ Parkinson, M. C, Ralph, D.J., and Pryor, J. P. 1998. Clinical aspects associated with Sertoli-cell-only histology. British journal of urology 82(4): 534-537.

Boettger-Tong, H. L., Rohozinski, J., Agoulnik, A.I., Dohmae, K., Nishimune, Y., Levy, N., and Bishop, CE. 2001. Identification and sequencing the juvenile spermatogonia! depletion critical interval on mice chromosome 1 reveals the presence of eight candidate genes. Biochemical and biophysical research communications 288(5): 1129-1135. Brinster, R. L. 2007. Male germline stem cells: from mice to men. Science (New York, NY 316(5823): 404-405.

Bruscoli, S., Di Virgilio, R., Donato, V., Velardi, E., Baldoni, M., Marchetti, C₁ Migliorati, G., and Riccardi, C. 2006. Genomic and non-genomic effects of different glucocorticoids on mice thymocyte apoptosis. European journal of pharmacology 529(1-3): 63-70.

Cannarile, L., Cuzzocrea, S., Santucci, L., Agostini, M., Mazzon, E.,

Esposito, E., Muia, C₁ Coppo, M., Di Paola, R., and Riccardi, C. 2009.

Glucocorticoid-induced leucine zipper is protective in Th1 -mediated models of colitis. Gastroenterology 136(2): 530-541.

Cannarile, L., Fallarino, F., Agostini, M., Cuzzocrea, S., Mazzon, E.,

Vacca, C, Genovese, T., Migliorati, G., Ayroldi, E., and Riccardi, C. 2006.

Increased GILZ expression in transgenic mice up-regulates Th-2 lymphokines. Blood 107(3): 1039-1047.

Cannarile, L., ZoIIo, O., D'Adamio, F., Ayroldi, E., Marchetti, C₁ Tabilio, A.,

Bruscoli, S., and Riccardi, C. 2001. Cloning, chromosomal assignment and tissue distribution of human GILZ, a glucocorticoid hormone-induced gene. Ce// death and differentiation 8(2): 201-203.

Chen, C, Ouyang, W., Grigura, V., Zhou, Q., Carnes, K., Lim, H., Zhao,

G. Q., Arber, S., Kurpios, N., Murphy, T.L., Cheng, A.M., Hassell, J.A.,

Chandrashekar, V., Hofmann, M. C₁ Hess, R.A., and Murphy, K.M. 2005.

ERM is required for transcriptional control of the spermatogonia! stem cell niche. Nature 436(7053): 1030-1034.

Cohen, N., Mouly, E., Hamdi, H., Maillot, M.C., Pallardy, M., Godot, V.,

Capel, F., Balian, A., Naveau, S., Galanaud, P., Lemoine, F. M., and

Emilie, D. 2006. GILZ expression in human dendritic cells redirects their maturation and prevents antigen-specific T lymphocyte response. Blood

107(5): 2037-2044.

D'Adamio, F., ZoIIo, O., Moraca, R., Ayroldi, E., Bruscoli, S., Bartoli, A.,

Cannarile, L., Migliorati, G., and Riccardi, C. 1997. A new dexamethasone-induced gene of the leucine zipper family protects T lymphocytes from TCR/CD3-activated cell death. Immunity 7(6): 803-812.

De Kretser, D. M. and Baker, H.W. 1999. Infertility in men: recent advances and continuing controversies. The Journal of clinical endocrinology and metabolism 84(10): 3443-3450. de Rooij, D. G. 2001. Proliferation and differentiation of spermatogonia! stem cells. Reproduction (Cambridge, England) 121(3): 347-354. Delfino, D.V., Agostini, M., Spinicelli, S., Vito, P., and Riccardi, C. 2004. Decrease of Bcl-xL and augmentation of thymocyte apoptosis in GILZ overexpressing transgenic mice. Blood 104(13): 4134-4141. Di Marco, B., Massetti, M., Bruscoli, S., Macchiarulo, A., Di Virgilio, R., Velardi, E., Donato, V., Migliorati, G., and Riccardi, C. 2007. Glucocorticoid-induced leucine zipper (GILZ)/NF-kappaB interaction: role of GILZ homo-dimerization and C-terminal domain. Nucleic Acids Res 35(2): 517-528.

Dix, D.J., Allen, J.W., Collins, B.W., Mori, C₁ Nakamura, N., Poorman- Allen, P., Goulding, E. H., and Eddy, E. M. 1996. Targeted gene disruption of Hsp70-2 results in failed meiosis, germ cell apoptosis, and male infertility. Proceedings of the National Academy of Sciences of the United States of America 93(8): 3264-3268.

Eddleston, J., Herschbach, J., Wagelie-Steffen, A.L., Christiansen, S. C, and Zuraw, B. L. 2007. The anti-inflammatory effect of glucocorticoids is mediated by glucocorticoid-induced leucine zipper in epithelial cells. J Allergy Clin Immunol 119(1 ): 115-122.

Escalier, D. 2001. Impact of genetic engineering on the understanding of spermatogenesis. Human reproduction update 7(2): 191-210. Gleissner, C.A., Zastrow, A., Klingenberg, R., Kluger, M.S., Konstandin, M., CeNk, S., Haemmerling, S., Shankar, V., Giese, T., Katus, H.A., and Dengler, T.J. 2007. IL-10 inhibits endothelium-dependent T cell costimulation by up-regulation of ILT3/4 in human vascular endothelial cells. Eur J Immunol 37(1): 177-192.

Glynne, R., Ghandour, G., Rayner, J., Mack, D. H., and Goodnow, CC. 2000. B-lymphocyte quiescence, tolerance and activation as viewed by global gene expression profiling on microarrays. Immunol Rev 176: 216- 246.

Hamdi, H., Godot, V., Maillot, M. C₁ Prejean, M.V., Cohen, N., Krzysiek, R., Lemoine, F. M., Zou, W., and Emilie, D. 2007. Induction of antigen- specific regulatory T lymphocytes by human dendritic cells expressing the glucocorticoid-induced leucine zipper. Blood 110(1): 211-219. Kasai, S., . Chuma, S., Motoyama, N., and Nakatsuji, N. 2003. Haploinsufficiency of Bcl-x leads to male-specific defects in fetal germ cells: differential regulation of germ cell apoptosis between the sexes. Developmental biology 264( 1 ) : 202-216.

Kojima, Y., Kurokawa, S., Mizuno, K., Umemoto, Y., Sasaki, S., Hayashi, Y., and Kohri, K. 2008. Gene transfer to sperm and testis: future prospects of gene therapy for male infertility. Current gene therapy 8(2): 121-134. Kristensen, D.M., Sonne, S.B., Ottesen, A.M., Perrett, R.M., Nielsen, J. E., Almstrup, K., Skakkebaek, N. E., Letters, H., and Meyts, E.R. 2008. Origin of pluripotent germ cell tumours: the role of microenvironment during embryonic development. Molecular and cellular endocrinology 288(1-2): 111-118.

Li, L. and Xie, T. 2005. Stem cell niche: structure and function. Annual review of cell and developmental biology 21 : 605-631. Luo, X., Ikeda, Y., and Parker, K.L. 1994. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Ce// 77(4): 481-490.

Matzuk, M. M. and Lamb, D.J. 2008. The biology of infertility: research advances and clinical challenges. Nature medicine 14(11): 1197-1213. Meng, X., Lindahl, M., Hyvonen, M. E., Parvinen, M., de Rooij, D. G., Hess, M.W., Raatikainen-Ahokas, A., Sainio, K., Rauvala, H., Lakso, M., Pichel, J. G., Westphal, H., Saarma, M., and Sariola, H. 2000. Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science (New York, NY 287(5457): 1489-1493.

Mittelstadt, P.R. and Ashwell, J. D. 2001. Inhibition of AP-1 by the glucocorticoid-inducible protein GILZ. J Biol Chem 276(31): 29603-29610. Muller, O. G., Parnova, R. G., Centeno, G., Rossier, B.C., Firsov, D., and Horisberger, J. D. 2003. Mineralocorticoid effects in the kidney: correlation between alphaENaC, GILZ, and Sgk-1 mRNA expression and urinary excretion of Na+ and K+. J Am Soc Nephrol 14(5): 1107-1115. OShaughnessy, P.J. and Sheffield, J.W. 1990. Effect of testosterone on testicular steroidogenesis in the hypogonadal (hpg) mice. Journal of steroid biochemistry 35(6): 729-734.

Oatley, J. M., Avarbock, M. R., Telaranta, A.I., Fearon, D.T., and Brinster, R. L. 2006. Identifying genes important for spermatogonial stem cell self- renewal and survival. Proceedings of the National Academy of Sciences of the United States of America 103(25): 9524-9529.

Oatley, J. M. and Brinster, R.L. 2008. Regulation of spermatogonial stem cell self-renewal in mammals. Annual review of cell and developmental biology 24: 263-286.

Ohta, H., Yomogida, K., Dohmae, K., and Nishimune, Y. 2000. Regulation of proliferation and differentiation in spermatogonial stem cells: the role of c-kit and its ligand SCF. Development (Cambridge, England) 1 27(10): 2125-2131.

Rajpert-de Meyts, E. and Hoei-Hansen, CE. 2007. From gonocytes to testicular cancer: the role of impaired gonadal development. Annals of the New York Academy of Sciences 1120: 168-180.

Schrans-Stassen, B. H., Saunders, P.T., Cooke, H.J., and de Rooij, D. G. 2001. Nature of the spermatogenic arrest in Dazl -/- mice. Biology of reproduction 65(3): 771-776.

Sharpe, R.M., McKinnell, C, Kivlin, C₁ and Fisher, J. S. 2003. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction (Cambridge, England) 125(6): 769-784.

Shi, X., Shi, W., Li, Q., Song, B., Wan, M., Bai, S., and Cao, X. 2003. A glucocorticoid-induced leucine-zipper protein, GILZ, inhibits adipogenesis of mesenchymal cells. EMBO Rep 4(4): 374-380.

Sofikitis, N., Giotitsas, N., Tsounapi, P., Baltogiannis, D., Giannakis, D., and Pardalidis, N. 2008. Hormonal regulation of spermatogenesis and spermiogenesis. The Journal of steroid biochemistry and molecular biology 109(3-5): 323-330.

Soundararajan, R., Zhang, T.T., Wang, J., Vandewalle, A., and Pearce, D. 2005. A novel role for glucocorticoid-induced leucine zipper protein in epithelial sodium channel-mediated sodium transport. The Journal of biological chemistry 280(48): 39970-39981.

Su, H., Mills, A.A., Wang, X., and Bradley, A. 2002. A targeted X-linked

CMV-Cre line. Genesis 32(2): 187-188.

Sweeney, C₁ Murphy, M., Kubelka, M., Ravnik, S. E., Hawkins, C. F.,

Wolgemuth, D.J., and Carrington, M. 1996. A distinct cyclin A is expressed in germ cells in the mice. Development (Cambridge, England) 122(1): 53-

64.

Tynan, S. H., Lundeen, S.G., and Allan, G.F. 2004. Cell type-specific bidirectional regulation of the glucocorticoid-induced leucine zipper (GILZ) gene by estrogen. J Steroid Biochem MoI Biol 91(4-5): 225-239.

Van Assche, E., Bonduelle, M., Tournaye, H., Joris, H., Verheyen, G.,

Devroey, P., Van Steirteghem, A., and Liebaers, I. 1996. Cytogenetics of infertile men. Human reproduction (Oxford, England) 11 Suppl 4: 1-24; discussion 25-26.

Weber, M.A., Groos, S., Hopfl, U., Spielmann, M., Aumuller, G., and

Konrad, L. 2000. Glucocorticoid receptor distribution in rat testis during postnatal development and effects of dexamethasone on immature peritubular cells in vitro. Andrologia 32(1): 23-30.

Wong, M. D., Jin, Z., and Xie, T. 2005. Molecular mechanisms of germline stem cell regulation. Annual review of genetics 39: 173-195.

Yeh, S., Tsai, M.Y., Xu, Q., Mu, X.M., Lardy, H., Huang, K.E., Lin, H., Yeh,

S.D., Altuwaijri, S., Zhou, X., Xing, L., Boyce, B.F., Hung, M.C., Zhang, S.,

Gan, L., and Chang, C. 2002. Generation and characterization of androgen receptor knockout (ARKO) mice: an in vivo model for the study of androgen functions in selective tissues. Proceedings of the National

Academy of Sciences of the United States of America 99(21): 13498-

13503.

Yoshida, S., Sukeno, M., Nakagawa, T., Ohbo, K., Nagamatsu, G., Suda,

T., and Nabeshima, Y. 2006. The first round of mice spermatogenesis is a distinctive program that lacks the self-renewing spermatogonia stage.

Development (Cambridge, England) 133(8): 1495-1505.

Zhang, Y., Buchholz, F., Muyrers, J., and Stewart, F. 1998. A new logic for DNA engineering using recombination in Escherichia coli. Nature Genetics

20: 123-128

Zhao, B., Koon, D., and Bethin, K.E. 2006. Identification of transcription factors at the site of implantation in the later stages of murine pregnancy.

Reproduction 131(3): 561-571.

Zinn, A.R. and Ross, J. L. 2001. Molecular analysis of genes on Xp controlling Turner syndrome and premature ovarian failure (POF).

Seminars in reproductive medicine 19(2): 141-146.

Claims

1) Transgenic murine animal obtained by means of tissue specific conditional deletion using GILZ gene CRE recombinase.

2) Transgenic murine animal according to claim 1 obtained by GILZ gene exon 6 deletion..

3) Transgenic animal according to anyone of claims 1-2, wherein said animal is a mice.

4) Use of transgenic murine animal according to anyone of claims 1-3 as an experimental model for study and research for male infertility treatment.

5) Method for preparation of a transgenic murine animal as defined in anyone of claims 1-3 comprising or consisting of the following steps: a) isolation from BAC of GILZ gene nucleotide sequence encoding for proteins having GenBank accession number AAD01789.1 , ACJ09091 , AAG41220.1 ; b) preparation of a targeting vector by donation of the nucleotide sequence of step a) in a vector containing LoxP sites at GILZ hexone 6 sides; c) introduction of targeting vector and consequent genetic manipulation of GILZ gene locus in C57BL/6 strain Bruce4 murine stem embryonic cells by means of homologous recombination with the final targeting vector; d) injection of clones wherein gene modification of GILZ locus occurred in C57BL/6 origin blastocysts implanted in the uterus of pseudo-pregnant recipient mice; e) generation of chimeras and screening of animals allowing the genetic transmission of modified GILZ locus in order to obtain trasgenic animal; and f) cross-breeding of male chimeras obtained in step e) with CMV-CRE female mice so as to obtain GILZ Knockout mice for all the organs and tissues.

6) Method according to claim 5, wherein the isolation of the nucleotide sequence of GILZ gene of step a) is carried out using the following primers: 5 ' - CACTCCCCπCTCACTCTGC-3¹ (sense) (SEQ ID NO: 1) and 5 ' - GAACTTTATAAGCAGTCATCCC -3 ' (antisense) (SEQ ID NO: 2).

7) Bruce4 C57BL/6 strain stem embryonic murine cells obtainable using from a) to c) steps of the method as defined in anyone of claims 5-6.

8) Transgenic animal obtainable according to the method as defined in anyone of claims 5-6.