WO2010131235A1

WO2010131235A1 - Inhibitory antibody fragments to human tissue factor

Info

Publication number: WO2010131235A1
Application number: PCT/IB2010/052186
Authority: WO
Inventors: Sarah Muriel Meiring
Original assignee: University Of The Free State
Priority date: 2009-05-15
Filing date: 2010-05-17
Publication date: 2010-11-18

Abstract

The present invention relates to a novel antibody fragment that inhibits the action of human Tissue Factor thus inhibiting blood coagulation The present antibody fragment may be obtainable by selection by means of phage display procedure or by way of recombinant techniques and can be used in a variety of methods for diagnosing, treating and/or preventing diseases or disorders

Description

INHIBITORY ANTIBODY FRAGMENT TO HUMAN TISSUE FACTOR Technical Field The present invention relates to a novel antibody fragment that inhibits the action of human Tissue Factor The present invention also extends to the use of said antibody fragment in the inhibition of blood coagulation and in a variety of methods for diagnosing, treating and/or preventing diseases and disorders Background to the Invention

The technique of phage display is a powerful and quick way to select antibody fragments with specific affinities and activities toward a target protein Its power lies in the combination of functional activity and genetic information Although not extensively, this technique has been used in the field of thrombosis and haemostasis Antibody libraries have been used to select antibodies that bind to the platelet receptor GPIIb/llla [Schwarz et al 2006] and human vascular endothelial growth factor [Lm ef al , 2008] The present invention relies on the use of two single chain variable fraction antibody libraries to select inhibitory antibody fragments to commercially available human Tissue Factors by using phage display technology

Recent developments in the field of thrombosis and haemostasis highlighted the crucial role of the Tissue Factor/Factor Vila complex in the initiation of the coagulation processes Coagulation is triggered by exposure of zymogen Factor VII (FVII) to its membrane bound cofactor, Tissue Factor (TF), to form the TF/FVII complex The TF/FVII complex is converted to the enzymatically active TF/FVIIa complex by Factor Xa (FXa) or auto catalytically by TF/FVIIa The TF/FVIIa complex can then activate Factor IX (FIX) to FIXa, FX to FXa and FVII to FVIIa FX can also be activated to FXa by the complex of FIXa with its cofactor FVIIIa and FIX can be activated to FIXa by FXIa FXa in complex with its cofactor, Factor V (FV), activates prothrombin to thrombin Thrombin cleaves fibrinogen to fibrin, ultimately resulting in the formation of a fibrin clot Thrombin further amplifies coagulation by activation of cofactors, such as FV and FVIII and zymogens such as FXI Moreover, thrombin activates platelets leading to platelet aggregation, which is necessary for the formation of a haemostatic plug [Mann et al , 2003]

Furthermore, a significant increase in Tissue Factor expression levels as well as enhanced Tissue Factor activity have been observed in patients who suffer from thrombotic complications and disorders such as, inter alia, atherosclerosis, pulmonary- and arterial embolism, deep vein thrombosis (DVT), unstable angina, ischemic heart disease and coronary syndrome High levels and activity of Tissue Factor have also been detected in diseases that are not directly related to thrombotic diseases These include cancer, inflammatory disorders like sepsis, metabolic disorders like obesity and diabetes and infectious diseases such as HIV A major challenge in the field of cardiovascular research is to develop antithrombotic agents to prevent uncontrolled thrombosis, but with less bleeding complications than the existing widespread clinical used drugs (coumaπns and heparins) Heparins enhance the antithromin III mediated inhibition of thrombin and Factor Xa, whereas coumarins impair the function of the vitamin K- 5 dependent proteins including procoagulants (thromin, FXa, FIXa and FVIIa) and anticoagulants (activated protein C and protein S) Although unfractionated heparins and coumarins are of great clinical value, they both require careful dosing and frequent monitoring Significant progress has been made by introducing low molecular weight heparin and pentasaccaπdes, but there is still a need for improved anticoagulants with a broad therapeutic window [Hirsh and Weitz, 1999]

I O The TF/FVIIa complex is an interesting target in thrombosis-related disease because TF/FVIIa directed inhibitors might achieve anticoagulant efficacy without significantly interfering with normal haemostasis [Frederick et al , 2005] Intravascular TF exhibits procoagulant activity and is incorporated into platelet thrombi and contribute to thrombosis Therefore, specific antι-TF antibodies may cause less bleeding because they inhibit the intravascular TF at concentrations that

15 are far below those necessary to block the high amounts of the haemostatic extra vascular TF [Giesen et al , 1999]

This invention provides a novel single chain variable fraction (scFv) antibody fragment that inhibits the function of Tissue Factor and therefore inhibits coagulation 0

Summary of the Invention

For ease of reference the ammo acid sequences and nucleotide sequences referred to in this description and contained in the sequence listing filed herewith are also set out below 5

SEQ ID NO: 1 - I l eSerSerTyrLeuftsnTrpTyrGlnGlnLys ProGl yLysAl aProLvs

SEQ ID NO: 2 - MetThrGlnSerProSe rSerLeuSe rAIaSerValGlyAspArqValThrl leThr 0 SEQ ID NO: 3 -

MetThrGlnSe rProSerSe rLeuSe rAlaSe rValGl yAspArgValThrl l eThrCy sArgAlaSe rGlnS er I l eSerSerTyrLeuAsnTrpTyr GInGInLy s ProGl /LysAl aProLysLeuLeuI l eTyrAl aAl aSe rSerLeuGlnSerGl yVal ProSerArgPheSerGlySerGlySerGlyThrAspPheThrLeuThrl leSer SerLeuGl nProG i.uAspPheAlaThrTyrTyrCysG± nGlnSerTyrSerThrProAsnThrPheGl yGl nG5 lyTb rLysValArgl l eLysArg SEQ ID NO: 4 -

GI nL_^uLe iGl uSe rGl yC i-yGlyLeuV dlGlr ProGI yG _^ ySprLeuArgLeuSerCysΛi dAi aSerGi yP

Serl rpVaxArgGlnMaProGlyLyfaGl yLeuGl

l ΘAsnProLeuClyTrpLysTb rArgTyr∑vlaGiuSerVal l ysGI yArgPh^pThrl _^eSerArgAspAsnSer Ly&Asn rhrLeuTyrLeuGlnMetAsnSe rLeuArgAl

erSe rArg

SEQ ID NO: 5 - ATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAG SEQ ID NO: 6-

ATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACT

SEQ ID NO: 7 -

ATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGG GCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAG CTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGA TCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACT GTCAACAGAGTTACAGTACCCCTAATACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGG SEQ ID NO: 8 -

CAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTG CAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAG GGGCTGGAGTGGGTCTCATCTATTAATCCGTTGGGTTGGAAGACACGTTACGCAGACTCCGT GAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAG CCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAACTTCGTCTAGG

According to a first aspect thereof, the present invention provides an isolated scFv Tissue Factor inhibitory antibody fragment that binds to human Tissue Factor, wherein the antibody fragment comprises at least one ammo acid sequence of SEQ ID NO 1

Preferably, the antibody fragment comprises an amino acid sequence comprising both SEQ ID NO 1 and SEQ ID NO 2

The amino acid sequence of SEQ ID NO 1 and the ammo acid sequence of SEQ ID NO 2 form part of the amino acid sequence of SEQ ID NO 3

In an embodiment of the invention, the antibody fragment includes light chain variable regions comprising the amino acid sequence of SEQ ID NO 3 In a further embodiment of the invention, the antibody fragment includes heavy and light chain variable regions wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO 3 and wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO 4 According to a further embodiment of the present invention, the antibody fragment identrfied herein inhibits the activation of Factor X by binding to human Tissue Factor Accordingly, the antibody fragment of the instant invention inhibits the action of human Tissue Factor thereby inhibiting blood coagulation

The invention provides for isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID NO 1 comprising a nucleotide sequence of SEQ ID NO 5

The invention further provides for isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID NO 2, comprising a nucleotide sequence of SEQ ID NO 6

The invention yet further provides for isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID NO 3, comprising a nucleotide sequence of SEQ ID NO 7 The invention still further provides for isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID NO 4, comprising a nucleotide sequence of SEQ ID NO 8

According to a second aspect thereof, the present invention provides for the antibody fragment indentified herein to be obtainable by selection by means of phage display procedure practiced on one or both of the Human Single Fold scFv antibody libraries of MRC Centre for Protein Engineering, Cambridge, UK identified as the Tomlinson I and Tomlinson J libraries with either or both of the commercially available Tissue Factor compositions commercialised by Dade-Behπng in South Africa under the trade descriptions Thromborell and Innovin In an embodiment of the invention, the antibody fragment is obtainable by selection by means of phage display procedure practiced on the Human Single Fold scFv antibody library of MRC Centre for Protein Engineering, Cambridge, UK identified as the Tomlinson J library

In a further embodiment of the invention, the antibody fragment is obtainable by practicing the phage display procedure with the commercially available Tissue Factor composition commercialised by Dade-Behring in South Africa under the trade description Thromborell

It will be appreciated that the present invention is not limited to the manner in which the antibody fragment, indentified herein, is produced It is accordingly not essential that the antibody fragments according to the present invention be produced by phage display techniques, but may be produced by recombinant techniques known and described in the art Thus the antibody fragments of SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4 may respectively be produced recombinantly by expressing the nucleotide sequence of SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 8 encoding the respective antibody fragment in a host cell With the aid of an expression vector, the nucleic acid molecules containing the nucleotide sequences of SEQ ID NO 5 , SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 8 may be transfected and expressed in a host cell Thus the present invention also relates to vectors that include the nucleotide sequences of SEQ ID NO 5 , SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 8, host cells that are genetically engineered with one or more recombinant expression vectors, and the production of at least one antibody fragment as indentified herein by recombinant techniques as is well known in the art

The present invention further provides a method for producing at least one antibody fragment, as indentified herein, that binds with human Tissue Factor, the method including the steps of a) transfecting the respective appropriate nucleic acid molecules of SEQ ID NO 5, SEQ ID

NO 6 SEQ ID NO 7 and SEQ ID NO 8 into a host cell, b) cultuπng the host cell so as to express the respective antibody fragment of SEQ ID NO 1,

SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4 in the host cell, and c) optionally, isolating and purifying the respective antibody fragment of SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4 The antibody fragment is recovered and purified from recombinant cell cultures by well-known methods in the art including, but not limited to, protein A purification, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography

According to a fourth aspect of the invention, there is provided a pharmaceutical preparation for use in the inhibition of the activity of Tissue Factor, comprising a therapeutically effective amount of at least one antibody fragment, as identified herein, in combination with one or more pharmaceutically acceptable excipients, additives or carriers The excipients are preferably inert and in any event non-toxic to the patent for which the preparation is intended

In an embodiment of this aspect of the invention, the pharmaceutical excipients and additives may include, but are not limited to including, proteins, peptides, amino acids, lipids, and carbohydrates (e g sugars, including monosaccharides, dι-, tπ-, tetra-, and oligosaccharides, deπvatized sugars such as alditols, aldonic acids, esteπfied sugars and the like, and polysaccharides or sugar polymers), which can be present singly or in combination

In a further embodiment of this aspect of the invention, there is provided for the pharmaceutical preparation to be an anti-coagulant composition

According to a fifth aspect of the invention, the present invention provides for a method of treating or diagnosing a patient suffering from a disease or disorder comprising the step of administering to such patient a therapeutically effective amount of at least one antibody fragment identified herein, or a pharmaceutical preparation as identified herein

The appropriate dosage thereof will depend on the type of disease to be treated, as defined below, the severity and course of the disease, whether the antibody fragment is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antibody The antibody is suitably administered to the patient at one time or over a series of treatments The disease symptoms and parameters for assessing improvement and the progress of the therapy can be readily monitored by conventional methods and assays known to the physician or other persons of skill in the art According to a sixth aspect of the invention, there is provided the use of at least one antibody fragment, as identified herein, in the manufacture of a medicament for the treatment, diagnosis and/or prevention of diseases and/or disorders

The diseases and/or disorders referred to above may be selected from the group consisting of hypercoagulable disorders including thrombosis, pulmonary and arterial embolism, cancer, inflammatory diseases, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, gastrointestinal disorders, disorders connected with chemotherapy treatments, and a combination thereof

A hypercoagulable disorder is one in which, due to an inherited or acquired disorder, there is an increased propensity for thrombosis This state is manifested clinically by either an increase in the number of thrombotic events or episodes, thrombosis at an early age, a familial tendency toward thrombosis, and thrombosis at unusual sites Patients that are susceptible to developing a hypercoagulable state include those having the following history (1) thrombosis at a young age (age under 50 years), (2) family history of thrombosis, (3) recurrent thrombosis, (4) thrombosis in an unusual site, and (5) pregnancies complicated by frequent miscarriage Hypercoagulable disorders can be passed onto family members that inherit particular diseases or abnormalties (e g , Factor V Leiden Deficiency, Homocystinuria or Hyperhomocysteinemia, Antithrombin III deficiency, Protein C Deficiency, Protein S Deficiency, increased Factor VIII, Fibrinolysis, and Dysfibπnogenemia) Hypercoagulable disorders can be acquired as a result of other conditions (e g pregnancy, estrogen consumption (oral contraceptives, estrogen replacement therapy, tamoxifen), surgery, trauma, infection, bites of poisonous snakes, acute liver disease, sepsis, malignancy, myeloproliferative disorder, hyperhpidemia, homocystinuria, systemic lupus, erythematosus, burns, renal disease, eclampsia, heat stroke, antiphospholipid antibodies, nephrotic syndrome and neoplasms) Manipulation of body fluids can also result in an undesirable thrombus, particularly in blood transfusions or fluid sampling, as well as procedures involving extracorporeal circulation (e g cardiopulmonary bypass surgery) and dialysis

The thrombotic disease referred to above may be ay one of the group consisting of venous thrombotic disease, congenital thrombotic disease due to protein C deficiency, deep vein thrombosis (DVT), cavernous sinus thrombosis, retroperitoneal thrombosis, perianal thrombosis, jugular vein thrombosis, cerebral venous sinus thrombosis, portal vein thrombosis, arterial thrombosis and thrombosis resulting from invasive medical procedure such as inter alia arterial, cardiac or organ transplant surgery, and thrombosis following injury or trauma

Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies More particular examples of such cancers include squamous cell cancer (e g epithelial squamous cell cancer), lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, hepatoma, breast cancer, colon cancer, rectal cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma, anal carcinoma, penile carcinoma, melanoma, multiple myeloma and B-cell lymphoma, brain, as well as head and neck cancer, and associated metastases

Inflammatory diseases according to this invention include, for example, joint inflammation, including arthritis, rheumatoid arthritis and other arthritic conditions such as rheumatoid spondylitis, gouty arthritis, traumatic arthritis, rubella arthritis, psoriatic arthritis, osteoarthritis, acute synovitis, autoimmune diabetes, autoimmune encephalomyelitis, collitis, atherosclerosis (also known as arteriosclerotic vascular disease or ASVD), peripheral vascular disease, cardiovascular disease, multiple sclerosis, asthma, psoriasis restenosis, myocarditis, inflammatory bowel disease, pelvic inflammatory disease, scleroderma and systemic lupus erythematosus

Said infectious diseases include viral infections comprising chronic hepatitis B and C, HIV/AIDS and infectious pneumonias,

Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis

Said cardiovascular diseases may include unstable angina, ischemic heart disease, coronary syndrome, brain injury and anemias including anemia in patients under dialysis in renal insufficiency, as well as anemia resulting from chronic infections, inflammatory processes, radiotherapies and chemotherapies

Said metabolic diseases may include such non-immune associated diseases as obesity and diabetes

Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression

The pharmaceutical composition described herein above may be delivered by a variety of suitable drug delivery systems known and described in the art Non-limiting examples of drug delivery systems and technologies for administering the pharmaceutical composition of the present invention in order to achieve the desired therapeutic effect include oral, nasal, and topical administration, administration by way of inhalation, administration by way of injection and administration by way of nanobiotechnoiogy pharmaceutical delivery systems and devices With respect to the latter, nanobiotechnoiogy involving chitosan (CS) and cyclodextrin (CD) derivatives as nasal carriers is also included

The invention further provides for the pharmaceutical preparation, as defined herein to optionally include a therapeutic agent The invention yet further provides for the pharmaceutical preparation, as defined herein, to optionally be administered together with an additional pharmaceutical composition or a therapeutic agent

According to a further aspect of the present invention, there is provided a composition including at least one antibody fragment, as identified herein, for use as a diagnostic agent

According to a yet further aspect of the present invention, there is provided for one or more kits including at least one antibody fragment, as identified herein, for the detection of human Tissue Factor in human plasma

These and other features of the invention are described in more detail below

Brief Description of the Drawings

Figure 1 is a graph depicting the results of the Tissue Factor activity assay in respect of 14

Tissue Factor binding phage colonies as described below

Figure 2 is a graph showing the result of an assay to illustrate the concentration dependent inhibitory effect of the JT C5 phage clone on Tissue Factor activity,

Figure 3 is a graph depicting the results of an assay to illustrate the effect of the 3 strongest

Tissue Factor inhibiting phage clones (namely, JT C5, Jl A1 and JT D1) on the thrombin times of normal plasma at different concentrations,

Figure 4 is a representation of the SDS-PAGE and Western Blotting determination in respect of the 3 strongest inhibiting phage clones, namely JT C5, Jl A1 and JT D1 , as described below,

Figure 5 is a graph depicting the concentration dependent effect of the purified JT C5 scFv antibody fragment on the thrombin times of normal plasma,

Figure 6 is a graph depicting the concentration dependent inhibitory effect of the purified JT

C5 scFv antibody fragment on Tissue Factor activity (Factor X activation),

Figure 7A is a graph depicting thrombin generation in normal pooled plasma for different JT C5 scFv antibody fragment concentrations, and

Figure 7B is a graph depicting thrombin generation in plasma from a thrombophilic patient for different JT C5 scFv antibody fragment concentrations

The invention will now be further described with reference to the foregoing Figures and the following description of an embodiment of an example of the procedure of phage display for the purpose of selecting the novel antibody fragment according to the invention, and various assays performed in the course thereof, and in respect of the purified antibody fragments of the invention The example serves to illustrate, but do not limit, the invention described herein

Example of the Invention

The following steps and assays were performed Selection of Tissue Factor binding phages

The Human Single Fold scFv libraries I and J (Tomlinson I + J, reference from http //www geneservice co uk/products/proteomιc/scFv_tomlιnsonlJ jsp) were provided by the laboratory of Prof Greg Winter's at the MRC Centre for Protein Engineering, Cambridge, UK Four Immune tubes were coated overnight with 2 ml of each of two TF preparates Two tubes were coated with Thromborell and 2 tubes with Innovin (Dade-Behπng, South Africa) respectively After 3 times washing with phosphate buffered saline (PBS), the immune tubes were blocked with 4 ml of PBS containing 2% skimmed milk powder (SM, Difco Laboratories, MD, USA) for 2 hours at room temperature The tubes were washed 3 times with PBS after the blocking solution was removed Then 1 ml of the primary I and J libraries (1 x 10¹² phages) were added to each of the Thromborell and Innovin coated tubes together with 3 ml of 4% SM solution and rotated for 1 hour at room temperature After another 1 hour incubation at room temperature, the unspecific binding phages were washed away with 0 1%Tween PBS for 10 times (20 times for the second and third round) The bound phages were eluted by 500μl trypsin-PBS (50μl of 10mg/ml trypsin stock solution added to 450μl PBS) and rotated for 10 minutes at room temperature

E-coli TG 1 cells (optical density OD600 = 0 4) cultured in 2 x TY medium (16g Tryptone, 10g Yeast Extract and 5g NaCI in 1 L distilled water) was infected by the eluted phages at 37°C for 30 minutes A portion of the infected E coli TG1 was serially diluted into 10°, 10¹, 10², 10³ and 10⁴ dilutions Ten μl of each dilution was spotted separately on TYE plates (15g Bacto-Agar, 8g NaCI, 10g Tryptone, 5g Yeast Extract ιn1 L distilled water including 100μg/ml ampicilin and 1% glucose) These plates were incubated at 37°C overnight to titre the eluted phages by counting the clones on the TYE plates At the same time, the rest of infected E coli TG1 cells were all spread out on large TYE plates (including 100μg/ml ampicilin and 1 % glucose) and also incubated overnight at 37°C The next day, bacteria on the large plates were scrapped and added into 100μl 2xTY (including 100μg/ml ampicilin and 1 % glucose) for amplification After that, the phages amplified in E coli TG1 were rescued as follows Helper phages (5 x 10¹¹ KM 13) were added to 10 ml of the amplified E coli TG1 cells and incubated for 30 mm at 37°C After centrifugation for 10 mm at 300Og, the supernatant was discarded and the cells resuspended in 50ml 2 x TY medium that contains 100μg/ml ampicilin, 50μg/ml kanamycin and 0 1 % glucose These cells were amplified overnight at 30⁰C, centrifuged at 300Og for 15 mm and the supernatant added to 10ml of polyethylene glycol (PEG) for 1 hour on ice After another centrifugation, the rescued phages were diluted in 2ml of PBS and stored at 4°C for the next selection round where 10¹² rescued phages were added into 2% SM solution to start the next selection round Four selection rounds were performed During the last selection round, the TF binding phages were specifically eluted with an excess amount of Factor VII in order to select inhibitory clones

Preparation of scFv phage for monoclonal enzyme linked immune-sorbent assay (ELISA) From the last selection round, 400 single clones from each library were randomly picked out from the TYE plates and cultured in different wells containing 100μl 2xTY medium (including 100μg/ml ampicillin and 1 % glucose) of four 96-well micro culture plates After cultuπng overnight at 37°C, a small inoculum (2μl) was transferred to other plates with 200μl 2xTY (including ampicilin and glucose) in each well The original plates were stored at 4°C temporarily The transferred plates were shaken at 37°C for 2 hours and the phages were rescued in E-coli TG1 by adding 10⁹ helper phages to each well and shaken for 1 hour at 37⁰C before spinning the plate at 180Og for 10mιn The pellets were suspended in 200μl 2xTY (including 100μg/ml ampicilin and 50μg/ml kanamycin) and shaken overnight at 30⁰C The next day, the culture plates were spun down at 180Og for 10 minutes and 100μl of the supernatant containing scFv-phage was used in monoclonal phage ELISA

Monoclonal phage ELISA

Eight ELISA plates (Nunc Maxisorp) were coated overnight at 4°C with 50μl of the Tissue Factor preparate (4 plates with Innovin and 4 plates with Thromborell) The plates were washed 3 times with PBS and blocked with 2% SM (200μl per well) for 2 hours at room temperature After 3 washing steps with PBS, 50μl of the scFv supernatant of each well of the cell culture plates were added to each of the wells of the coated ELISA plates together with 50μl of 4% SM After incubation of 1 hour at room temperature, the ELISA plates were washed 3 times with PBS-O 1% Tween-20 Subsequently, 100μl of a horseradish peroxidase-anti M13 antibody were added to each well in a 1 5000 dilution on PBS-2%SM (1 OOμl per well) and incubated for another hour at room temperature After 3 more washes with PBS-O 1% Tween-20, 100μl substrate solution (100μg/ml TMB in 100 mM sodium acetate, pH 6 0, with 30% hydrogen peroxide directly before use) was added to each well The reaction was stopped by adding 50μl 2M H₂SO₄ The absorbance at OD450 and OD₆so was determined and the 14 colonies with the highest OD_{450 650} values were amplified as described below Amplification of single colonies

The 14 strongest Tissue Factor binding phages were amplified by adding 50μl of the cell stock of the culture plates to 50ml 2xTY (wιth1% glucose) and grown at 37°C for 2 hours Ten ml of these cultures were then added to a centrifuge tube and 5x10¹⁰ helper phages were added and incubated for 30 minutes at 37°C After centπfugation at 30Og for 10 minutes, the pellets were resuspended in 50 ml 2xTY containing 100μg/ml ampicilin, 50μg/ml kanamycin and 0 1% glucose and shaken at 3O⁰C overnight The phages from the single colonies were rescued the next day by centπfuging the overnight culture at 300Og for 15 minutes The supernatants were added to 10 ml PEG/NaCI solution (20% Polyethylene glycol 6000, 2 5M NaCI) for 1 hour at 4°C to precipitate the phages After another centπfugation of 3000g for 30 minutes the phage pellets were dissolved in 2ml PBS and the phage concentration determined as follows Phage concentration (phages/ml) = OD_26O x dilution x 2 214x10¹¹ The phages from the 14 strongest binding colonies were stored in PBS with 15% glycerol at -70⁰C for further inhibition tests Tissue Factor activity assay

The Actichrome TF assay kit from America Diagnostica (CT, USA) was used to determine the TF inhibitory activity of the 14 strongest TF binding phages 450μl of the amplified phages of each of the 14 colonies was precipitated on PEG/NaCI and the pellet dissolved in 200μl assay buffer of the kit The phage concentration of each colony was determined as previously described An amount of 5 x 10¹⁰ phages of each colony was put into each of 2 wells on an ELISA plate A phage that does not bind or inhibit TF was use as a control Fifteen pM Tissue Factor was added to the phages and incubate for 10 minutes at room temperature Then, 25μl factor VII was added to each well where after 25μl factor X was added After an incubation of 15 minutes at 37°C, 25μl of the substrate, Spectrozym Xa was added to each well and the absorbance measured at 405 nm every 20 minutes for a period of 80 minutes The results are depicted in Figure 1

The 6 colonies with the lowest TF activity, therefore the 6 strongest inhibitors of this reaction were diluted 1 2 for 4 times and the kinetic reaction repeated to determine the concentration dependent inhibition of TF by these colonies The inhitory effect of one, namely phage colony JT 5C, of these six phage colonies was clearly stronger that the other five (Jl B1 , Jl E3, Jl A3, Jl A1 , JT D1) and that strongest inhibitory phage colony was subjected to further assays to demonstrate concentration dependent activity as described below The various disignations of these phage colonies, and the antibodies derived therefrom, signify by the first letter J, that they were obtained by use of the Tomlinson library J in combination with Thromborel or Innovin already referred to above, as indicated by the second letter T or I, respectively

A further assay was thus performed to demonstrate the concentration dependent Tissue Factor activity of the strongest inhibiting phage clone, designated JT C5 In this assay phage concentrations ranging from 6 125 x 10⁹ to 5 x 10¹⁰ were added to each of 2 wells on an ELISA plate 15 pM Tissue Factor were added to the phages and incubated for 10 minutes at RT Then

25μl factor VII was added to each well where after 25μl factor X was added After an incubation of

15 minutes at 37°C, 25μl of the substrate, Spectrozym Xa were added to each well and the absorbance at 405 nm measured every 15 minutes for a period of 90 minutes (n=3) The results of this assay are reflected by the graph of Figure 2 It shows that at a concentration of 5 x 10¹⁰ almost no Factor Xa activity was measured

Prothrombin time determinations

Prohrombin time (PT) assays were done on the 3 strongest inhibitory phage colonies (namely, JT C5, Jl A1 and JT D1 ) selected according to the Tissue Factor activity assay 5 x 10¹⁰ phages were incubated with the PT reagent, Thromborel for 10 minutes, whereafter normal plasma was added and the time measured until the clot was formed (n=3) The STAR-4 coagulation instrument (Siemens, South Africa) was used The results of this assay are reflected in Figure 3 Again the JT C5 phage colony showed the strongest inhibitory effect The strongest Tissue Factor inhibitory clone was chosen for the production of soluble scFv antibody fragments described below

Production of soluble scFv antibody fragments

The selected phage clone, JT C5 was used to infect HB2151, a non-suppressor E-coli strain which is then induced to give soluble expression of antibody fragments In short, 3 ml of overnight activated E-coli HB2151 (infected by the selected scFv phage) culture was transferred to 300ml 2xTY (0 1% glucose and 100μ/ml ampicilin) and shaken at 250 rpm at 37°C for ± 3 hours until OD_6Oo = 0 9 Then isopropyl β-D-thiogalactoside (IPTG, final concentration 1 mM) was added and continued shaking overnight at 30⁰C After centπfugation at 180Og for 10 minutes, the supernatant that contains the soluble antibody fragments was stored at 4°C for purification on a protein A column Purification of JT C5 scFv antibody fragments

The JT C5 scFv antibody fragments were purified from the cell culture medium by using a Protein A column Five ml of Protein A Sepharose Fast Flow from Pierce (IL, USA) was packed into a column After rinsing with 10ml of binding buffer (0 1m Phosphate, 0 15M NaCI, pH= 7 2), the cell culture medium was diluted 1 1 with binding buffer and applied to the column After the medium had been run through, the column was washed with a further 15 ml of binding buffer The antibody fragments were eluted with an acidic elution buffer (0 1 M Glycine, pH 2-3) and 1 ml fractions were collected The protein content of each fraction was measured at OD₂so and the fractions with the highest protein content were pooled The purified scFv was evaluated by a 12% SDS-PAGE and Western Blotting using a mouse anti-cMyc antibody (Pierce, USA) The purified antibody fragment was dialysed with Tπs-buffered saline (TBS) and the concentration determined using the absorbance at 280nm The results of these evaluations are reflected in Figure 4 from which it is evident that the expression of scFv JTC5 and JTD 1 was better than that of JTA1 and that each of these three fractions, has a molecular mass of about 26 kD

Functional characterisation of the Tissue Factor inhibiting antibody fragment

The selected antibody fragment was tested for TF inhibitory activity by using the Actichrome TF activity assay Prothrombin time was done with different concentrations of the antibody fragment and the effect of the antibody fragment was also tested on thrombin generation in normal plasma Prohrombin time was done on antibody fragment concentrations of 1 5μM, 0 75μM and 0 375μM The antibody fragments were incubated with the PT reagent, thromborell and buffer (TBS) for 10 minutes, where after normal plasma was added and the time measured until the clot was formed (n=3), The results of these tests are reflected in figure 5 The purified JT C5 scFv lengthened the prothrombin time dose-dependently as seen in figure 5 At a concentration of 1 5μM, the PT was lengthened almost twice the baseline value

Tissue Factor activity assay

Antibody fragment concentrations of 212nM, 106nM and 53nM were added in duplicate to the wells of an ELISA plate 15 pM Tissue Factor and assay buffer to a volume of 75μl were added to the antibody fragment and incubated for 10 minutes at RT Then 25μl factor VII was added to each well where after 25μl factor X was added After an incubation of 15 minutes at 37°C, 25μl of the substrate, Spectrozym Xa was added to each well and the absorbance at 405 nm measured every 15 minutes for a period of 90 minutes The results are depicted in Figure 6 Factor Xa activity was also inhibited by the JT C5 scFv with an IC₅₀ of 10OnM

Prothrombin time determinations

Prothrombin time determinations were done on antibody fragment concentrations of 1 5μM, 0 75μM and 0 375μM The antibody fragments were incubated with the PT reagent, thromborell and buffer (TBS) for 10 minutes, where after normal plasma was added and the time measured until the clot was formed The STAR-4 coagulation instrument (Siemens, South Africa) was used The results are reflected in Figure 6 which again shows that Factor Xa activity was also inhibited by the JT C5 scFv with an IC₅₀ of 10OnM

Thrombin generation assay

The TECHNOTHROMBIN TGA kit was used to determine thrombin generation over time in platelet poor plasma upon activation of the clotting cascade by Tissue Factor that was incubated with different concentrations of the antι-TF antibody fragment In short, the TGA reagent C which contains about 5 pM Tissue Factor was incubated with different JT C5 scFv concentrations (13μM, 6 25μM and 3 125μM) and TBS for 10 minutes at 37°C Normal pooled plasma and plasma from a thrombophilic patient with a low free protein S level of 16% were then added in parallel to the reactions (40μl per reaction) The fluorogenic TGA substrate (50μl per reaction) containing 1mM Z- G-C-R-AMC and 15mM CaCI₂ was added to start each reaction All reactions were done in duplicate and the fluorescence was measured at 360nm/460nm (excitation/emission) with the SYNERGY 2 Kinetic reader from BIOTEK, USA at 1 minute intervals for 2 hours The results of these measurements are reflected in Figures 7A and 7B from which it is evident that the thrombin generation of normal plasma and of thrombophilic plasma was decreased with increasing doses of the JT C5 scFv The effect of JT C5 was more pronounced in thrombophilic plasma, since the lag phase before the thrombin generation burst was also increased, which was not the case with normal plasma

Discussion

Currently available monoclonal antibodies are of rodent origin A primary disadvantage associated with the use of rodent antibodies in human therapy is that of immunogenicity The present invention involves the selection and characterisation, to the Applicant's knowledge, of the first human single chain variable antibody fragment that binds to and inhibits the action of human Tissue Factor by using phage display technology utilising the human single fold scFv libraries I and J (Tomlinson I +

J) libraries to select the antibody fragments with two different TF sources, namely a recombinant form and a purified extraction from human placenta Antibodies selected against the purified extraction appeared to be the strongest inhibitors The use of phage display technology allows for the production of human single chain variable antibody fragments which are not immunogenic In this way, the present invention affords an alternative and desirable method for the production of inhibitory antibody fragments to human Tissue Factor which does not suffer from the disadvantage inherent in the current production of rodent monoclonal antibodies The low molecular weight of the antibody fragment (the antibody fragment has a molecular weight of 26 kD) further attributes to the fact that the antibody fragment is not immunogenic

Four rounds of selection were conducted Most phage display applications make use of three to four selection rounds (Schwarz et al , 2008, Lm et al , 2008) An extensive amount (approximately 800) Tissue Factor binding phages were tested in the monoclonalphage ELISA for binding to Tissue Factor This is much more than other groups in the literature were using Zhang et al , 2007, Schwarz et al , 2008, Lm et al , 2008) The expression of JT C5 scFv was evaluated using SDS-PAGE and Western blotting The scFv has a molecular weight of 26 kD It was purified on a protein A column Protein A column was used for the purification of this antibody fragment, since it gives a better yield than a protein L column

The purified JT C5 scFv lengthened the prothrombin time dose dependently with a two-fold prolongation at 1 5μM (39ng/ml) This is a 1000 times stronger inhibition than the rat anti-mouse monoclonal antibody 1H1 [Kirchhofer et al , 2005] It also slowed down the factor Xa production dose-dependently in the Tissue Factor activity assay with an IC₅₀ of 10OnM which is a 10 times stronger inhibition than that of the monoclonal antι-TF antibody TF4A12 [Peng et al , 2007] It is also a stronger inhibitor than the latest orally available TF/FVIIa complex inhibitors [Miura et al , 2007

The thrombin generation assay shows a reduction in the peak thrombin concentration as well as an increase in the lag phase before thrombin is generated The effect was more pronounced in thrombophilic plasma than in normal plasma, which indicates that TF inhibitors might achieve anticoagulant activity in thromboplilic plasma without significantly interfering with haemostasis in normal plasma The reduction in peak thrombin generation by the antι-TF scFv is about 30 times less than the inhibitory effect of direct thrombin inhibitors such as Ximelagatran [Bostrom et al , 2004]

REFERENCES

Bostrom SL, Hansson GFH, Saπch TC, Woltz M 2004 The inhibitory effect of melagtran, the active form of the oral direct theomin inhibitor ximelagatran, compared with enoxaparin and r- hirudin on ex-vivo thrombin generation in human plasma Thromb Res 113: 85-91

Frederick R, Pochet L, Charlier C, Masereel B 2005 Modulators of the coagulation cascade Focus and recent advances in inhibitors of Tissue Factor, Factor Vila and their complex Curr Med Chem 12: 397-417

Giesen PLA, Rauch U, Bohrmann B, Killing D, Roque M, Fallon JT, Badiman JJ, Himber J, Riedere MA, Nemerson Y (1999) Proc Natl Acad Sci USA 96: 2311

Hirsh J and weitz Jl 1999 Thrombosis new antithrombotic agents Lancet 353 1431-1436 Kirchhofer D, Moran P, Bullens S, Peale F Bunting S 2005 A monoclonal antibody that inhibits mouse Tissue Factor function J Thromb Haemost 3: 1-2

Lm Z, Cao P, Lei H 2008 Identification of neutralizinf scFv binding to human vascular endothelial growth factor 165 (VEGF165) using a hage display antibody library Appl Biochem Biotech

144(1): 15-26

Mann KG, Butenas S, Brummer K 2003 Arteπoscler Thromb Vase Biol 23: 17 Miura M, Seki N, Koike T, lshihara T, Hirayame F, Shigengaga T, Sakai-Moπtani Y, Tagawa A, Kawasaki T, Sakamoto S, Okada M Ohta M Tsukamato S 2007 Design, synthesis and biological activity of selective and orally available TF/FVIIa complex inhibitors containing non- amide P1 hgands Bioorg Med Chem 15:160-173 Nicolaides NC, Sass PM, Grasso L 2006 Monoclonal antibodies a morphing landscape for therapeutics Drug Dev Res 67: 781-789

Peng ZP, Cai X, Zhang Y, Kong D, Guo H, Liang W₁ Tang Q, Song H Ma D 2007 A novel anti- Tissue Factor monoclonal antibody with anticoagulant potency derived from synthesized 5 multiple antigenic peptides though blocking FX combination with TF Thromb Res 121 : 85-93

Schwarz M, Meade G, Stoll P, Ylanne J, Bassier N, Chen Y, Hagemeyer C, Ahrens I₁ Moran N₁ Kenny D, Fitzgerald D₁ Bode C, Peter K 2006 Conformation-specific blockade of the integπn GPIIb/llla A novel antiplatelet strategy that selectively targets activated platelets Circ Res 99(1):25-33

I O Zhang B₁ Zhang Y, Wang J₁ Zhang Y, Chen J, Pan Y, Pen L₁ Hu Z, Zhao J, Liao M and Wang S 2007 Screening and identification of a targeting peptide to hepatocarcinoma from a phage display peptide library MoI Med 13(5-6): 246-254

15

Claims

1 An isolated scFv Tissue Factor inhibitory antibody fragment that binds to human Tissue Factor, wherein the antibody fragment comprises at least one amino acid sequence of SEQ ID NO 1

2 The antibody fragment according to claim 1 , wherein the antibody fragment comprises an amino acid sequence comprising both SEQ ID NO 1 and SEQ ID NO 2 3 The antibody fragment according to claim 1 , wherein the antibody fragment includes light chain variable regions comprising the amino acid sequence of SEQ ID NO 3

4 The antibody fragment according to claim 1 , wherein the antibody fragment includes heavy and light chain variable regions wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO 3 and wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO 4

5 The antibody fragment according to any one of the preceding claims, wherein the antibody fragment inhibits the activation of Factor X by binding to human Tissue Factor

6 The antibody fragment according to any one of the preceding claims, wherein the antibody fragment inhibits the action of human Tissue Factor thereby inhibiting blood coagulation

7 Isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID NO 1 , comprising a nucleotide sequence of SEQ ID NO 5

8 Isolated nucleic acid molecules coding for the ammo acid sequence of SEQ ID NO 2, comprising a nucleotide sequence of SEQ ID NO 6 9 Isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID NO 3, comprising a nucleotide sequence of SEQ ID NO 7

10 Isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID NO 4, comprising a nucleotide sequence of SEQ ID NO 8

11 A vector including the nucleic acid molecules according to any one of claims 7 to 10

12 A host cell including the vector according to claim 11 13 A method for producing an antibody fragment according to any one of claims 1 to 6 including the steps of a) transfecting the respective appropriate nucleic acid molecules according to any one of claims 7 to 10 into a host cell, b) culturing the host cell so as to express the respective antibody fragment of SEQ ID NO 1 , SEQ ID NO 2 SEQ ID NO 3 and SEQ ID NO 4 in the host cell and c) optionally, isolating and purifying the respective antibody fragment of SEQ ID NO 1 , SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4 A pharmaceutical preparation for use in the inhibition of the activity of Tissue Factor, comprising a therapeutically effective amount of at least one antibody fragment according to any one of claims 1 to 6 in combination with one or more pharmaceutically acceptable excipients, additives or carriers The pharmaceutical preparation according to claim 14, wherein the pharmaceutical preparation is an anti-coagulant composition A method of treating or diagnosing a patient suffering from a disease or disorder comprising the step of administering to such patient a therapeutically effective amount of at least one antibody fragment according to any one of claims 1 to 6, or a pharmaceutical preparation according to claim 14 or 15

Use of at least one antibody fragment according to any one of claims 1 to 6 in the manufacture of a medicament for the treatment, diagnosis and/or prevention of diseases and/or disorders

Use of an antibody fragment according to any one of claims 1 to 6 for the treatment, diagnosis and/or prevention of diseases and/or disorders The use according to claim 17 or 18 wherein the diseases and/or disorders are selected from the group consisting of hypercoagulable disorders including thrombosis, pulmonary and arterial embolism, cancer, inflammatory diseases, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, gastrointestinal disorders, disorders connected with chemotherapy treatments, and a combination thereof A composition including at least one antibody fragment according to any one of claims 1 to 6 for use as a diagnostic agent One or more kits including at least one antibody fragment according to any one of claims 1 to 6 for the detection of human Tissue Factor in human plasma