WO2010121578A1 - Method for in vitro diagnostics of invasive aspergillosis - Google Patents
Method for in vitro diagnostics of invasive aspergillosis Download PDFInfo
- Publication number
- WO2010121578A1 WO2010121578A1 PCT/CZ2010/000052 CZ2010000052W WO2010121578A1 WO 2010121578 A1 WO2010121578 A1 WO 2010121578A1 CZ 2010000052 W CZ2010000052 W CZ 2010000052W WO 2010121578 A1 WO2010121578 A1 WO 2010121578A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- aspergillus
- homology
- sequence
- oligonucleotide
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Definitions
- the present invention relates to a method for diagnostics of invasive aspergillosis using quantitave PCR from biological samples taken from the body of immunocompromised patients. It further relates to oligonucleotides useful in this method.
- Aspergillus spp. is saprophytic mold, growing in soil on organic debris. During its life-cycle each organism produces thousands of conidia that are dispersed into the environment. Inhalation of conidia by individuals having a healthy immune system does not lead to any health complications, conidia are removed by common tissue and native immunity mechanisms; allergic reaction might occasionally occur in people working in environment with increased mold load (agriculture). But an increased frequency of patients currently treated with aggressive immunosuppressive regimens leads to a high increase of frequency of invasive fungal disease (IFD) (Marr, K. A., et al., Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and risk factors. Blood, 2002. 100(13): p.
- IFD invasive fungal disease
- IA invasive aspergillosis
- Aspergillus spp. were described as possible cause of IA (A. terreus, A. flavus, A. niger etc.).
- Early diagnostics and rapid initiation of effective antifungal therapy are crucial for patient outcome.
- Classical microbiological methods like cultivation or histology lose their sensitivity due to early initiation of empirical antifungal therapy or are positive in too advanced stages of the infection. Therefore, the importance of novel non-cultivation methods, serological (detecting antigens of fungal pathogens) or molecular (PCR diagnostics), is increasing, although no standardized protocol for detection of Aspergillus DNA in clinical samples was established so far.
- BALF blood or bronchoalveolar lavage fluid
- Object of the present invention is a method for in vitro diagnostics of invasive aspergillosis by means of isolation and detection of Aspergillus spp. DNA in clinical samples taken from the body of a patient, particularly in samples of blood, tissue and bronchoalveolar lavage fluids (BALF).
- the subject matter of the present invention contains the following steps: a) isolation of DNA from the clinical samples, b) preamplif ⁇ cation of fungal DNA using primers targeting conservative parts of Aspergillus ribosomal DNA (rDNA) genes, c) quantitative real-time PCR detection of species specific region of the internal transcribed spacer 2 (ITS2) part of rDNA genes of an Aspergillus species.
- the Aspergillus species according to this invention include A. fumigatus, A. flavus, A. niger, A. nidulans and A. terreus.
- the starting material for the method of the present invention are clinical samples taken from patients, particularly samples of blood, tissue and BALF samples; BALF and tissue samples are preferred. Samples might be stored frozen before processing.
- the method of the invention is particularly useful for patients at risk of development of IFD.
- the first step of the method of the present invention is the isolation of total DNA from the clinical sample. This step may be performed, e.g., by mechanical disruption method using a commercially available DNA isolation kit.
- the next step is the preamplif ⁇ cation of fungal DNA using primers that target conservative parts of Aspergillus ribosomal DNA genes and surround the region detected by the quantitative real-time PCR.
- the region amplified in this external round may be amplified using, e.g., the following primers that target the conservative parts of the Aspergillus rDNA, while ensuring that the species specific ITS2 region is part of the sequence amplified in this step: forward primer: CTGTCCGAGCGTCATTGCT (primer Asp-F) reverse primer: TCCTCCGCTTATTGATATGCTTAA (primer ITS-R) .
- the ITS2 DNA which is specific for the Aspergillus species to be detected, is quantitatively detected using real-time PCR, preferably using TaqMan or TaqMan MGB (minor groove binder) probes, wherein the primers and probes specific for the desired Aspergillus species are used.
- Aspergillus rDNA genes are present as multicopy genes (about 40 copies per 1 genome) and consist of three subunits 18S rDNA, 5.8S rDNA and 28S rDNA that are the conservative parts, and the three subunits are separated by two ITS regions (ITSl and ITS2) that are species specific. The presence of multiple copies increases the sensitivity of the PCR assay and the unique ITS2 regions enable species specific detection and quantification. (Scha holeer-Gurtner, C, et al., Development of novel real-time PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens. J Clin Microbiol, 2007. 45(3): p. 906-914).
- sequence preamplified in the external round may be as follows (SEQ ID NO. 1) (forward and reverse primer sequences are highlighted): ctgtccgagcgtcattgctgccctcaagcacggcttgtgtgttgggccccgtccccccctccgggggacgggcccgaaaggcagcggcggcaccgcgtccggtcctcgagcg tatggggctttgtcacctgctctgtaggcccggccggcggcgccagccgacacccaactt tatttttctaaggttgacctcggatcaggtagggatacccgctgaacttaagcggaggaggaggaggaggaggaggagga
- A. fumigatus ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. fumigatus, having at least 85% homology to the following sequences:
- the region amplified by the quantitative real-time PCR specific for A. fumigatus has the following sequence (SEQ ID NO.6): ggctttgtcacctgctctgtaggcccggccggcgccagccgacacccaactttattt ttctaaggttgacctcggatcag
- A. flavus ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. flavus, having at least 85% homology to the following sequences:
- the region amplified by the quantitative real-time PCR specific for A. flavus has the following sequence (SEQ ID NO.10): tccgatcctcgagcgtatggggctttgtcacccgctctgtaggcccggccggcgctt gccgaacgcaaatcaatctttttccaggtt
- A. niger ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. niger, having at least 85% homology to the following sequences:
- the region amplified by the quantitative real-time PCR specific for A. niger has the following sequence (SEQ ID NO.14): tgtcacatgctctgtaggattggccggcgcctgccgacgttttccaaccattctttc caggttgacct
- A. nidulans ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. nidulans, having at least 85% homology to the following sequences:
- the region amplified by the quantitative real-time PCR specific for A. nidulans has the following sequence (SEQ ID NO.18): cacccgctcgattagggccggccgggcgccagccggcgtctccaaccttatttttct caggttgacctcggatc
- A. terreus ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. terreus, having at least 85% homology to the following sequences:
- Example of the region amplified by the quantitative real-time PCR specific for A. terreus has the following sequence (SEQ ID NO.22). Sequence might differ due to intraspecies variability: cgtatggggcttcgtcttccgctccgtaggcccggccggcgcccgccgacgcattta tttgcaacttgttttttccaggttgacctcggatc
- the present invention includes a combination of the protocol for fungal DNA isolation with commercial kit, with minor modifications of the manufacturer's protocol as described below in the examples that illustrate the invention, however, they should not be construed as limiting its scope, and originally designed species specific oligonucleotides (primers and probes) and real-time PCR reaction conditions.
- the application of the procedure of the present invention does not require any other technical equipment than that routinely used for real-time PCR with TaqMan probes.
- the invention encompasses also oligonucleotides that have at least 85% homology to oligonucleotides selected from the group comprising GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO.2), CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO.3), CCGACACCCAACTTT (SEQ ID NO.4),
- AACCTGGAAAAAGATTGATTTGC (SEQ ID NO.8), TTGTCACCCGCTCTGTAGGCCCG (SEQ ID NO.9),
- CGCCCGCCGACGCAWTT (SEQ ID NO.21).
- the sequences with at least 85% homology may differ from the original sequences by deletion or addition of bases on 3' or 5' end of the oligonucleotides.
- the invention encompasses also the use of these oligonucleotides in diagnostics of invasive aspergillosis.
- SEQ ID NO. 1 DNA region amplified in external round for A. fumigatus.
- SEQ ID NO. 2 Forward primer for internal round for quantitative detection of A. fumigatus.
- SEQ ID NO. 3 Reverse primer pro for internal round for quantitative detection of A. fumigatus.
- SEQ ID NO. 4 Sequence of TaqMan MGB probe for quantitative detection of A. fumigatus.
- SEQ ID NO. 5 Sequence of TaqMan probe for quantitative detection of A. fumigatus
- SEQ ID NO. 6 DNA region amplified in internal round A. fumigatus.
- SEQ ID NO. 7 Forward primer for internal round for quantitative detection of A. flavus.
- SEQ ID NO. 8 Reverse primer for internal round for quantitative detection of A. flavus.
- SEQ ID NO. 9 Sequence of TaqMan probe for quantitative detection of A. flavus
- SEQ ID NO. 10 DNA region amplified in internal round A. flavus.
- SEQ ID NO. 11 Forward primer for internal round for quantitative detection of A. niger
- SEQ ID NO. 12 Reverse primer for internal round for quantitative detection of A. niger.
- SEQ ID NO. 13 Sequence of TaqMan probe for quantitative detection of A. niger.
- SEQ ID NO. 14 DNA region amplified in internal round A. niger.
- SEQ ID NO. 15 Forward primer for internal round for quantitative detection of A nidulans.
- SEQ ID NO. 16 Reverse primer for internal round for quantitative detection of A. nidulans.
- SEQ ID NO. 17 Sequence of TaqMan probe for quantitative detection of A. nidulans.
- SEQ ID NO. 18 DNA region amplified in internal round A nidulans.
- SEQ ID NO. 19 Forward primer for internal round for quantitative detection of A. terreus.
- SEQ ID NO. 20 Reverse primer for internal round for quantitative detection of A. terreus.
- SEQ ID NO. 21 Sequence of TaqMan probe for quantitative detection of A. terreus.
- SEQ ID NO. 22 DNA region amplified in internal round A. terreus.
- bronchoalveolar lavage was performed because of suspicion for IFD.
- DNA isolation Two ml of BALF were taken to a sterile vial and centrifiigated for 10 min, 4000 - 6000 xg, room temperature. The supernatant was discarded and lysis solution from ZR Fungal Bacterial kit (Zymo Research) was added to the pellet. The lysate was then transferred to a vial containing glass beads and the vial was vortexed for 15 min at maximum speed (8000-10000 rpm) at room temperature. Next steps were performed according to manufacturers' protocol. DNA was eluted using 50 microlitres of elution buffer.
- IP IP » 0.5
- both PCR and GM in BALF are highly positive, in peripheral blood was A. fumigatus DNA detected only in patient number 1.
- Patient number 3 whose positivity of all markers is relatively lower compared to previous two patients, developed serious symptoms of IA within one week after BAL was performed - the detected values reflected an early stage of IA.
- AML acute myeloid leukemia
- HL Hodkin lymphoma
- TTP trombotic trombocytopenic purpura
- MCL mantle-cell lymfoma
- AIHA Autoimunne hemolytic anemia
- CLL chronic lymfoblastic leukemia
- MM multiple myeloma
- GM galactomanan
- EORTC European Organisation for Research and Treatment of Cancer.
- Table 2 List of species tested for cross-reactivity and results of assays specific for A flavus, A. niger and A. nidulans
- CLL chronic myeloid leukemia
- the method of the present invention is useful for rapid and early diagnosis in patients with the risk of development of invasive aspergillosis.
Abstract
The present invention relates to a method for in vitro diagnostics of invasive aspergillosis from biological samples taken from the body of a patient using quantitative PCR, which contains the steps of isolation of DNA from the clinical samples, preamplification of fungal DNA using primers targeting conservative part of fungal ribosomal DNA (rDNA), and quantitative real-time PCR detection of species specific region of the internal transcribed spacer 2 (ITS2) gene of an Aspergillus species. It further relates to oligonucleotides useful in this method.
Description
Method for in vitro diagnostics of invasive aspergillosis
Field of the Invention
The present invention relates to a method for diagnostics of invasive aspergillosis using quantitave PCR from biological samples taken from the body of immunocompromised patients. It further relates to oligonucleotides useful in this method.
Background Art
Aspergillus spp. is saprophytic mold, growing in soil on organic debris. During its life-cycle each organism produces thousands of conidia that are dispersed into the environment. Inhalation of conidia by individuals having a healthy immune system does not lead to any health complications, conidia are removed by common tissue and native immunity mechanisms; allergic reaction might occasionally occur in people working in environment with increased mold load (agriculture). But an increased frequency of patients currently treated with aggressive immunosuppressive regimens leads to a high increase of frequency of invasive fungal disease (IFD) (Marr, K. A., et al., Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and risk factors. Blood, 2002. 100(13): p. 4358- 4366.; Jordanides, N.E., et al., A prospective study of real-time panfungal PCR for the early diagnosis of invasive fungal infection in haemato-oncology patients. Bone Marrow Transplant, 2005. 35(4): p. 389-95.; Racil, Z., et al., Invazivni mykoticke infekce u onkologickych nemocnych: zmeny v epidemiologii a diagnostice. Postgrad Med, 2007. 9(3): p. 240-252.).
Over 90 % of cases of invasive aspergillosis (IA) are caused by A. fumigatus. Recently also other Aspergillus spp. were described as possible cause of IA (A. terreus, A. flavus, A. niger etc.). Early diagnostics and rapid initiation of effective antifungal therapy are crucial for patient outcome. Classical microbiological methods like cultivation or histology lose their sensitivity due to early initiation of empirical antifungal therapy or are positive in too advanced stages of the infection. Therefore, the importance of novel non-cultivation methods, serological (detecting antigens of
fungal pathogens) or molecular (PCR diagnostics), is increasing, although no standardized protocol for detection of Aspergillus DNA in clinical samples was established so far.
Detection of Aspergillus DNA in body fluids, particularly in blood or bronchoalveolar lavage fluid (BALF) (obtained after lavage of lower respiratory airways by saline solution) is now a widely discussed topic. The sensitivity and negative predictive value of the PCR test in BALF is about 90-100 % but positive predictive value is only 32-52 % (Raad, I., et al., Diagnosis of invasive pulmonary aspergillosis using polymerase chain reaction-based detection of aspergillus in BAL. Chest, 2002. 121(4): p. 1171 - 1176). False positive results are common because detection of Aspergillus DNA in lower respiratory tract might reflect not only active infection but also colonization of the airways. If we assume that the amount of the pathogen is significantly lower in case of colonization when compared to active infection, then the use of quantitative methods might overcome this problem (Rantakokko-Jalava, K., et al., Semiquantitative detection by real-time PCR of Aspergillus fumigatus in bronchoalveolar lavage fluids and tissue biopsy specimens from patients with invasive aspergillosis. J Clin Microbiol, 2003. 41(9): p. 4304 - 4311). Setup of a suitable cutoff value might then help to distinguish patients with a low or a high risk of development of IFD.
Disclosure of the Invention
Object of the present invention is a method for in vitro diagnostics of invasive aspergillosis by means of isolation and detection of Aspergillus spp. DNA in clinical samples taken from the body of a patient, particularly in samples of blood, tissue and bronchoalveolar lavage fluids (BALF). The subject matter of the present invention contains the following steps: a) isolation of DNA from the clinical samples, b) preamplifϊcation of fungal DNA using primers targeting conservative parts of Aspergillus ribosomal DNA (rDNA) genes, c) quantitative real-time PCR detection of species specific region of the internal transcribed spacer 2 (ITS2) part of rDNA genes of an Aspergillus species.
The Aspergillus species according to this invention include A. fumigatus, A. flavus, A. niger, A. nidulans and A. terreus.
The starting material for the method of the present invention are clinical samples taken from patients, particularly samples of blood, tissue and BALF samples; BALF and tissue samples are preferred. Samples might be stored frozen before processing. The method of the invention is particularly useful for patients at risk of development of IFD.
The first step of the method of the present invention is the isolation of total DNA from the clinical sample. This step may be performed, e.g., by mechanical disruption method using a commercially available DNA isolation kit.
The next step is the preamplifϊcation of fungal DNA using primers that target conservative parts of Aspergillus ribosomal DNA genes and surround the region detected by the quantitative real-time PCR. The region amplified in this external round may be amplified using, e.g., the following primers that target the conservative parts of the Aspergillus rDNA, while ensuring that the species specific ITS2 region is part of the sequence amplified in this step: forward primer: CTGTCCGAGCGTCATTGCT (primer Asp-F) reverse primer: TCCTCCGCTTATTGATATGCTTAA (primer ITS-R) .
In the next step, the ITS2 DNA, which is specific for the Aspergillus species to be detected, is quantitatively detected using real-time PCR, preferably using TaqMan or TaqMan MGB (minor groove binder) probes, wherein the primers and probes specific for the desired Aspergillus species are used.
Aspergillus rDNA genes are present as multicopy genes (about 40 copies per 1 genome) and consist of three subunits 18S rDNA, 5.8S rDNA and 28S rDNA that are the conservative parts, and the three subunits are separated by two ITS regions (ITSl and ITS2) that are species specific. The presence of multiple copies increases the sensitivity of the PCR assay and the unique ITS2 regions enable species specific detection and quantification. (Schabereiter-Gurtner, C, et al., Development of novel
real-time PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens. J Clin Microbiol, 2007. 45(3): p. 906-914).
Detection of A. fumigatus
The sequence preamplified in the external round may be as follows (SEQ ID NO. 1) (forward and reverse primer sequences are highlighted): ctgtccgagcgtcattgctgccctcaagcacggcttgtgtgttgggcccccgtcccc ctctcccgggggacgggcccgaaaggcagcggcggcaccgcgtccggtcctcgagcg tatggggctttgtcacctgctctgtaggcccggccggcgccagccgacacccaactt tatttttctaaggttgacctcggatcaggtagggatacccgctgaacttaagcatat caataagcggagga
A. fumigatus ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. fumigatus, having at least 85% homology to the following sequences:
The region amplified by the quantitative real-time PCR specific for A. fumigatus (primers and MGB probe sequences are highlighted) has the following sequence (SEQ ID NO.6): ggctttgtcacctgctctgtaggcccggccggcgccagccgacacccaactttattt ttctaaggttgacctcggatcag
Detection of A. flavus
A. flavus ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. flavus, having at least 85% homology to the following sequences:
The region amplified by the quantitative real-time PCR specific for A. flavus (primers and probe sequences are highlighted) has the following sequence (SEQ ID NO.10): tccgatcctcgagcgtatggggctttgtcacccgctctgtaggcccggccggcgctt gccgaacgcaaatcaatctttttccaggtt
Detection of A. niger
A. niger ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. niger, having at least 85% homology to the following sequences:
The region amplified by the quantitative real-time PCR specific for A. niger (primers and probe sequences are highlighted) has the following sequence (SEQ ID NO.14): tgtcacatgctctgtaggattggccggcgcctgccgacgttttccaaccattctttc caggttgacct
Detection of A. nidulans A. nidulans ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. nidulans, having at least 85% homology to the following sequences:
Detection of A terreus
A. terreus ITS2 DNA is quantitatively detected using real-time PCR with TaqMan or TaqMan MGB probes and sequences of the primers for the detection of A. terreus, having at least 85% homology to the following sequences:
Example of the region amplified by the quantitative real-time PCR specific for A. terreus (primers and probe sequences are highlighted) has the following sequence (SEQ ID NO.22). Sequence might differ due to intraspecies variability: cgtatggggcttcgtcttccgctccgtaggcccggccggcgcccgccgacgcattta tttgcaacttgtttttttccaggttgacctcggatc
The present invention includes a combination of the protocol for fungal DNA isolation with commercial kit, with minor modifications of the manufacturer's protocol as described below in the examples that illustrate the invention, however, they should not be construed as limiting its scope, and originally designed species specific oligonucleotides (primers and probes) and real-time PCR reaction conditions. When compared to similar commercially available products, the application of the procedure of the present invention does not require any other technical equipment than that routinely used for real-time PCR with TaqMan probes.
The invention encompasses also oligonucleotides that have at least 85% homology to oligonucleotides selected from the group comprising GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO.2), CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO.3),
CCGACACCCAACTTT (SEQ ID NO.4),
CCAGCCGACACCCAACT (SEQ ID NO.5),
TCCGATCCTCGAGCGTATG (SEQ ID NO.7),
AACCTGGAAAAAGATTGATTTGC (SEQ ID NO.8), TTGTCACCCGCTCTGTAGGCCCG (SEQ ID NO.9),
TGTCACATGCTCTGTAGGATTGG (SEQ ID NO.l 1),
AGGTCAACCTGGAAARAATGGTT (SEQ ID NO.12),
CGGCGCCTGCCGACGTTTT (SEQ ID NO.13),
CACCCGCTCGATTAGGG (SEQ ID NO.15), GATCCGAGGTCAACCTGAG (SEQ ID NO.16),
CGCCAGCCGGCGTCTCCA (SEQ ID NO.17),
CGTATGGGGCTTYGTCTTCC (SEQ ID NO.19),
GATCCGAGGTCAACCTGGAAA (SEQ ID NO.20),
CGCCCGCCGACGCAWTT (SEQ ID NO.21). The sequences with at least 85% homology may differ from the original sequences by deletion or addition of bases on 3' or 5' end of the oligonucleotides. The invention encompasses also the use of these oligonucleotides in diagnostics of invasive aspergillosis.
Sequence listing:
SEQ ID NO. 1 : DNA region amplified in external round for A. fumigatus.
SEQ ID NO. 2: Forward primer for internal round for quantitative detection of A. fumigatus. SEQ ID NO. 3: Reverse primer pro for internal round for quantitative detection of A. fumigatus.
SEQ ID NO. 4: Sequence of TaqMan MGB probe for quantitative detection of A. fumigatus.
SEQ ID NO. 5: Sequence of TaqMan probe for quantitative detection of A. fumigatus SEQ ID NO. 6: DNA region amplified in internal round A. fumigatus.
SEQ ID NO. 7: Forward primer for internal round for quantitative detection of A. flavus.
SEQ ID NO. 8: Reverse primer for internal round for quantitative detection of A. flavus.
SEQ ID NO. 9: Sequence of TaqMan probe for quantitative detection of A. flavus
SEQ ID NO. 10: DNA region amplified in internal round A. flavus. SEQ ID NO. 11 : Forward primer for internal round for quantitative detection of A. niger
SEQ ID NO. 12: Reverse primer for internal round for quantitative detection of A. niger.
SEQ ID NO. 13: Sequence of TaqMan probe for quantitative detection of A. niger. SEQ ID NO. 14: DNA region amplified in internal round A. niger.
SEQ ID NO. 15: Forward primer for internal round for quantitative detection of A nidulans.
SEQ ID NO. 16: Reverse primer for internal round for quantitative detection of A. nidulans. SEQ ID NO. 17: Sequence of TaqMan probe for quantitative detection of A. nidulans.
SEQ ID NO. 18: DNA region amplified in internal round A nidulans.
SEQ ID NO. 19: Forward primer for internal round for quantitative detection of A. terreus. SEQ ID NO. 20: Reverse primer for internal round for quantitative detection of A. terreus.
SEQ ID NO. 21: Sequence of TaqMan probe for quantitative detection of A. terreus.
SEQ ID NO. 22: DNA region amplified in internal round A. terreus.
Examples of carrying out the Invention
Example 1
Detection of A. fumigatus in BALF of a patient with acute myeloid leukemia
In a patient suffering from acute myeloid leukaemia (AML), bronchoalveolar lavage (BAL) was performed because of suspicion for IFD.
DNA isolation:
Two ml of BALF were taken to a sterile vial and centrifiigated for 10 min, 4000 - 6000 xg, room temperature. The supernatant was discarded and lysis solution from ZR Fungal Bacterial kit (Zymo Research) was added to the pellet. The lysate was then transferred to a vial containing glass beads and the vial was vortexed for 15 min at maximum speed (8000-10000 rpm) at room temperature. Next steps were performed according to manufacturers' protocol. DNA was eluted using 50 microlitres of elution buffer.
Preamplification:
Five microlitres of DNA were used as a template.
External round reactants:
Reaction conditions: l: 95°C/15min
2: 95°C /15s
3: 60°C /lmin
4: go to 2, 19x
*,** - according to Schabereiter-Gurtner, C, et al., Development of novel real-time
PCR assays for detection and differentiation of eleven medically important
Aspergillus and Candida species in clinical specimens. J Clin Microbiol, 2007.
45(3): p. 906-14.
In the external round (preamplification), fungal DNA present in the sample was amplified. One microlitre of the PCR product from the external round was used as a template for real-time PCR with species specific oligonucleotides targeting ITS2 - internal round.
Quantitative real-time PCR:
Internal round reactants:
Reaction conditions: l: 95°C/15min 2: 950C /15s 3: 60°C /lmin 4: go to 2, 45x
In the same run of PCR were tested, besides the clinical sample, also vials containing standard DNA - plasmid with cloned target sequence with a known number of molecules in one reaction. The amplification of these standard DNAs enabled the construction of the standard curve that was used for the calculation of the number of copies of Aspergillus DNA in the tested sample vial and subsequently in 1 ml of BALF taken from patient.
In our AML patient, 46 576 259 copies of A. fumigatus were detected in the PCR reaction, this number corresponds to 8.72 log copies/ml (i.e., 10 (exp 8.72) copies/ml) of BALF and means that the sample is highly positive. Another markers
for invasive aspergillosis - detection of galactomannan (GM) in serum and BALF were also highly positive. Index of positivity (IP) of GM in BAL - IP = 6,32 a GM in serum IP = 0,66 - cut-off for positivity is IP = 0,5. This patient is patient number 1 in Table 1.
Example 2
Summary of results of detection of A. fumigatus in BALF samples
The above described protocol for DNA isolation and A. fumigatus detection was used for analysis of 74 BALF samples from 74 patients at risk of IFD. 12 samples (16.2%) were positive for A. fumigatus. Basic clinical characteristics of these cases are described in Table 1. The table shows that the PCR positivity correlates with the detection of GM, another marker of invasive aspergillosis (IA), in BALF and serum.
High fungal load detected by real-time PCR correlates with high IP (IP » 0.5). In patients 1 and 2, both PCR and GM in BALF are highly positive, in peripheral blood was A. fumigatus DNA detected only in patient number 1. Patient number 3, whose positivity of all markers is relatively lower compared to previous two patients, developed serious symptoms of IA within one week after BAL was performed - the detected values reflected an early stage of IA. In patients 4 to 12 the PCR detected low fungal load and detection of GM was below IP=O.5 (negative) - these results correspond more to colonization than to infection.
Table 1
IFD according
Patient IFD according to number Sample taken Diagnosis* BAL Peripheral blood to EORTC clinician log
GM log copies/ml GEM copies/ml
1 19.3.2008 AML 6.32 8.72 0.66 64533 PROBABLE PROVEN
2 10.6.2004 AML,HL 8.58 8.16 1.16 ND PROVEN PROVEN
3 26.9.2007 AML 0.98 4.30 0.1 0 PROBABLE PROVEN
4 19.10.2007 TTP 0.13 5.29 0.08 0 NO IFD NO IFD
5 4.4.2008 AML 0.12 4.34 0.14 ND PROBABLE NO IFD
6 11.3.2008 AML 0.26 4.39 0.17 0 POSSIBLE NO IFD
7 2.10.2007 MCL 0.23 4.92 0.16 0 NO IFD NO IFD
8 13.6.2007 AIHA 0.42 4.97 0.19 ND POSSIBLE NO IFD to
9 7.5.2007 CLL 0.19 5.42 0.18 ND POSSIBLE NO IFD
10 28.2.2007 AML/CLL 0.19 4.14 0.16 ND POSSIBLE NO IFD
11 15.12.2006 CLL 0.36 3.72 0.06 ND POSSIBLE NO IFD
12 24.6.2004 MM 0.16 3.67 0.19 ND NO IFD NO IFD
* - AML = acute myeloid leukemia, HL = Hodkin lymphoma, TTP = trombotic trombocytopenic purpura, MCL = mantle-cell lymfoma, AIHA = Autoimunne hemolytic anemia, CLL = chronic lymfoblastic leukemia, MM = multiple myeloma, GM = galactomanan, EORTC = European Organisation for Research and Treatment of Cancer.
Example 3
Assessment of cut-off of PCR positivity
Analysis of all clinical samples showed that 3 groups of patients might be observed. In most of the patients no A. fumigatus DNA was detected (0 copies/PCR reaction) and these patients do not have pulmonary infection caused by this fungal species. Patients in which the detected copy numbers are up to 5 log copies/ml of BALF - in these patients the detection of A.fumigatus DNA reflects colonization of the airways by this fungal species. The last group of patients are those in whom the detected numbers of copies are higher than 7 log copies/ml of BALF and in these the diagnosis of IA is confirmed.
Example 4
Analysis of specificity of real-time PCR assays for Aspergillus species other than A. fumigatus
Specificity of the assays was tested by PCR amplification of DNA isolated from various Aspergillus and air-borne fungi strains obtained from Czech Collection of Microorganisms or isolated from clinical samples. The assays were carried out according to the procedure described in Example 1, using the respective species- specific primers and probes in the quantitative real-time PCR step, as described in the Diclosure of the Invention chapter. The results are presented in Table 2. All PCR assays were positive only with their respective target species, no cross-reactivity with other species or air-borne fungi was observed.
Table 2: List of species tested for cross-reactivity and results of assays specific for A flavus, A. niger and A. nidulans
*CCM - Czech Collection of Microorganisms
Example 5
Detection of A. flavus in lung tissue of patient with chronic myeloid leukemia (CLL)
In a patient with CLL and symptoms of pulmonary infection was performed high resolution computed tomography (HRCT) - a "halo sign" typical for invasive aspergillosis was found. Because GM detection in serum was repeatedly negative, fine-needle biopsy of the lungs was performed to obtain a sample directly from affected tissue to clarify the etiology of the infection. Histological examination proved the presence of fungal hyphae in the sample but the culture was negative. In this sample we detected 676 445 243 copies of A. flavus in PCR reaction, which corresponds to 8.33 log copies and means the sample was highly positive. Final clinical diagnosis was IA caused by A. flavus.
Example 6 Detection of A. terreus in lung tissue of a patient with multiple myeloma
In a patient with multiple myeloma, a highly positive GM in serum (IP=6.22) was repeatedly detected. HRCT findings were negative but the cultivation of sputum samples was positive for Aspergillus spp. Due to the progression of the clinical symptoms BAL was performed and we detected 35 000 000 copies of A. terreus in
PCR reaction, this corresponds to 8.24 log copies/ml of BALF. Detection of GM in
BALF resulted in IP=I 2.77. The final clinical diagnosis was IA caused by A. terreus.
Industrial Applicability
The method of the present invention is useful for rapid and early diagnosis in patients with the risk of development of invasive aspergillosis.
Claims
1. A method for in vitro diagnostics of invasive aspergillosis, characterized in that it contains the following steps: a) isolation of DNA from the clinical samples, b) preamplification of fungal DNA using primers targeting conservative parts of Aspergillus ribosomal DNA (rDNA) genes, c) quantitative real-time PCR detection of species specific region of the internal transcribed spacer 2 (ITS2) part of rDNA genes of an Aspergillus species.
2. The method of claim 1, wherein the Aspergillus species are selected from the group comprising Aspergillus fumigαtus, Aspergillus flαvus, Aspergillus niger, Aspergillus nidulαns and Aspergillus terreus.
3. The method of claim 1, wherein the clinical samples are samples of blood, tissue or BALF samples.
4. The method of claim 1, wherein step a) is performed by mechanical disruption method.
5. The method of claim 1, wherein the step c) is performed using as forward primer an oligonucleotide having at least 85% homology to the sequence GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO.2), as reverse primer an oligonucleotide having at least 85% homology to the sequence CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO.3) and as a probe an oligonucleotide having at least 85% homology to a sequence selected from the group comprising CCGACACCCAACTTT (SEQ ID NO.4) and CCAGCCGACACCCAACT (SEQ ID NO.5) and wherein the Aspergillus species is Aspergillus fumigαtus.
6. The method of claim 1, wherein the step c) is performed using as forward primer an oligonucleotide having at least 85% homology to the sequence TCCGATCCTCGAGCGTATG (SEQ ID NO.7), as reverse primer an oligonucleotide having at least 85% homology to the sequence
AACCTGGAAAAAGATTGATTTGC (SEQ ID NO.8) and as a probe an oligonucleotide having at least 85% homology to the sequence TTGTCACCCGCTCTGTAGGCCCG (SEQ ID NO.9) and wherein the Aspergillus species is Aspergillus flavus.
7. The method of claim 1, wherein the step c) is performed using as forward primer an oligonucleotide having at least 85% homology to the sequence TGTCACATGCTCTGTAGGATTGG (SEQ ID NO.11), as reverse primer an oligonucleotide having at least 85% homology to the sequence AGGTCAACCTGGAAARAATGGTT (SEQ ID NO.12) and as a probe an oligonucleotide having at least 85% homology to the sequence CGGCGCCTGCCGACGTTTT (SEQ ID NO.13) and wherein the Aspergillus species is Aspergillus niger.
8. The method of claim 1, wherein the step c) is performed using as forward primer an oligonucleotide having at least 85% homology to the sequence CACCCGCTCGATTAGGG (SEQ ID NO.15), as reverse primer an oligonucleotide having at least 85% homology to the sequence GATCCGAGGTCAACCTGAG (SEQ ID NO.16) and as a probe an oligonucleotide having at least 85% homology to the sequence CGCCAGCCGGCGTCTCCA (SEQ ID NO.17) and wherein the Aspergillus species is Aspergillus nidulans.
9. The method of claim 1, wherein the step c) is performed using as forward primer an oligonucleotide having at least 85% homology to the sequence CGTATGGGGCTTYGTCTTCC (SEQ ID NO.19), as reverse primer an oligonucleotide having at least 85% homology to the sequence GATCCGAGGTCAACCTGGAAA (SEQ ID NO.20) and as a probe an oligonucleotide having at least 85% homology to the sequence CGCCCGCCGACGCAWTT (SEQ ID NO.21) and wherein the Aspergillus species is Aspergillus terreus.
10. Oligonucleotides, characterized in that they have at least 85% homology to oligonucleotides selected from the group comprising
GGCTTTGTCACCTGCTCTGTAG (SEQ ID NO.2),
CTGATCCGAGGTCAACCTTAGAAA (SEQ ID NO.3), CCGACACCCAACTTT (SEQ ID NO.4),
CCAGCCGACACCCAACT (SEQ ID NO.5),
TCCGATCCTCGAGCGTATG (SEQ ID NO.7),
AACCTGGAAAAAGATTGATTTGC (SEQ ID NO.8),
TTGTCACCCGCTCTGTAGGCCCG (SEQ ID NO.9), TGTCACATGCTCTGTAGGATTGG (SEQ ID NO.11 ),
AGGTCAACCTGGAAARAATGGTT (SEQ ID NO.12),
CGGCGCCTGCCGACGTTTT (SEQ ID NO.13),
CACCCGCTCGATTAGGG (SEQ ID NO.15),
GATCCGAGGTCAACCTGAG (SEQ ID NO.16), CGCCAGCCGGCGTCTCCA (SEQ ID NO.17),
CGTATGGGGCTTYGTCTTCC (SEQ ID NO.19),
GATCCGAGGTCAACCTGGAAA (SEQ ID NO.20),
CGCCCGCCGACGCAWTT (SEQ ID NO.21).
11. Oligonucleotides according to claim 10 for use in the diagnostics of invasive aspergillosis.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CZ20090253A CZ302670B6 (en) | 2009-04-21 | 2009-04-21 | Method of diagnosing invasive aspergillosis and oligonucleotides used in this method |
| CZPV2009-253 | 2009-04-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010121578A1 true WO2010121578A1 (en) | 2010-10-28 |
Family
ID=42556997
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CZ2010/000052 WO2010121578A1 (en) | 2009-04-21 | 2010-04-20 | Method for in vitro diagnostics of invasive aspergillosis |
Country Status (2)
| Country | Link |
|---|---|
| CZ (1) | CZ302670B6 (en) |
| WO (1) | WO2010121578A1 (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015002560A1 (en) * | 2013-07-03 | 2015-01-08 | Universidade Do Minho | Peptide nucleic acid probe (pna), kit and method for detection of aspergillus fumigatus and applications thereof |
| CN107130015A (en) * | 2016-02-29 | 2017-09-05 | 上海翔琼生物技术有限公司 | A kind of PCR kit for fluorescence quantitative for detecting aspergillus fumigatus |
| CN107164478A (en) * | 2017-05-27 | 2017-09-15 | 山西维尔生物乳制品有限公司 | A kind of probe, primer and genetic chip for differentiating aspergillus fumigatus |
| EP3257951A3 (en) * | 2016-06-17 | 2018-03-14 | AdvaTect Diagnostics, LLC | Methods and compositions for identifying and quantifying fungal dna |
| US10030278B2 (en) | 2008-08-22 | 2018-07-24 | Advatect Diagnostics, Llc | Methods and compositions for identifying yeast |
| US10036748B2 (en) | 2006-04-01 | 2018-07-31 | Advatect Diagnostics, Llc | Methods and compositions for detecting fungi and mycotoxins |
| US10443106B2 (en) | 2009-10-08 | 2019-10-15 | Advatect Diagnostics, Llc | Methods and compositions for identifying sulfur and iron modifying bacteria |
| CN113106167A (en) * | 2021-04-26 | 2021-07-13 | 北京大学第一医院 | Primer and probe for invasive aspergillosis pathogenic bacteria, implementation method and detection system thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998050584A2 (en) * | 1997-05-02 | 1998-11-12 | THE GOVERNMENT OF THE UNITED STATES OF AMERICA as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES, c/o Centers for Disease Control and Prevention, Technology Transfer Offic | Nucleic acids for detecting aspergillus species and other filamentous fungi |
| WO2007101664A2 (en) * | 2006-03-08 | 2007-09-13 | Fungus Bioscience Gmbh | Improved aspergillosis test in clinical samples |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002079512A2 (en) * | 2001-03-29 | 2002-10-10 | University Of Nevada - Las Vegas | Method for detection and quantification of the fungus aspergillus fumigatus using quantitative pcr |
-
2009
- 2009-04-21 CZ CZ20090253A patent/CZ302670B6/en unknown
-
2010
- 2010-04-20 WO PCT/CZ2010/000052 patent/WO2010121578A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998050584A2 (en) * | 1997-05-02 | 1998-11-12 | THE GOVERNMENT OF THE UNITED STATES OF AMERICA as represented by THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES, c/o Centers for Disease Control and Prevention, Technology Transfer Offic | Nucleic acids for detecting aspergillus species and other filamentous fungi |
| WO2007101664A2 (en) * | 2006-03-08 | 2007-09-13 | Fungus Bioscience Gmbh | Improved aspergillosis test in clinical samples |
Non-Patent Citations (15)
| Title |
|---|
| HINRIKSON H P ET AL: "MOLECULAR METHODS FOR THE IDENTIFICATION OF ASPERGILLUS SPECIES", MEDICAL MYCOLOGY, INFORMA HEALTHCARE, ABINGDON LNKD- DOI:10.1080/13693780500064722, vol. 43, no. SUPPL. 01, 1 May 2005 (2005-05-01), pages S129 - S137, XP009068121, ISSN: 1369-3786 * |
| JORDANIDES, N.E. ET AL.: "A prospective study of real-time panfungal PCR for the early diagnosis of invasive fungal infection in haemato-oncology patients", BONE MARROW TRANSPLANT, vol. 35, no. 4, 2005, pages 389 - 95 |
| LANDLINGER C ET AL: "Species-specific identification of a wide range of clinically relevant fungal pathogens by use of Luminex xmap technology", JOURNAL OF CLINICAL MICROBIOLOGY 2009 AMERICAN SOCIETY FOR MICROBIOLOGY USA LNKD- DOI:10.1128/JCM.01558-08, vol. 47, no. 4, 25 February 2009 (2009-02-25), pages 1063 - 1073, XP002598144, ISSN: 0095-1137 * |
| LENGEROVA M ET AL.: "Abstract: Detection of Aspergillus fumigatus in Bronchoalveolar Lavage Samples from Immunocompromised Patients Using Real-Time PCR with Fungal DNA Preamplification", 2008, Retrieved from the Internet <URL:http://www.abstractsonline.com/viewer/ViewAbstractPrintFriendly.asp?CKey={BBF41A13-6FFE-4428-9F9A-EC59EF41A61C}&MKey={26DFAE32-3D6D-446F-9AE5-B759FE42C683}&AKey={B156596F-4F2B-4B7B-9988-53EF0A523ACC}&SKey={8D9407C8-A1D0-4B18-A84C-FE54C2F4D547}> [retrieved on 20100821] * |
| LENGEROVA M ET AL: "Detection of Aspergillus fumigatus in Bronchoalveolar Lavage Samples from Immunocompromised Patients Using Real-Time PCR with Fungal DNA Preamplification", PROGRAM AND ABSTRACTS OF THE INTERSCIENCE CONFERENCE ON ANTIMICROBIAL AGENTS AND CHEMOTHERAPY (ICAAC); 48TH ANNUAL INTERSCIENCE CONFERENCE ON ANTIMICROBIAL AGENTS AND CHEMOTHERAPY/46TH ANNUAL MEETING OF; WASHINGTON, DC, USA; 20081025, PY, WASHINGTON,, vol. 48, 1 January 2008 (2008-01-01), pages 630, XP008125835, ISSN: 0733-6373 * |
| LENGEROVA M ET AL: "Detection of invasive aspergillosis by PCR and real-time PCR - Benefits and drawbacks", KLINICKA MIKROBIOLOGIE A INFEKCNI LEKARSTVI = CLINICAL MICROBIOLOGY AND INFECTIOUS DISEASES, TRIOS S.R.O, CZ, vol. 13, no. 5, 1 January 2007 (2007-01-01), pages 184 - 189, XP008125836, ISSN: 1211-264X * |
| LENGEROVA M ET AL: "Poster: Detection of Aspergillus fumigatus in Bronchoalveolar Lavage Samples from Immunocompromised Patients Using Real-Time PCR with Fungal DNA Preamplification", 2008, XP002598143, Retrieved from the Internet <URL:http://www.mindcull.com/images/posters/icaac2008/icaac08.M-710.pdf> [retrieved on 20100821] * |
| MARR, K.A. ET AL.: "Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and riskfactors", BLOOD, vol. 100, no. 13, 2002, pages 4358 - 4366 |
| RAAD, I. ET AL.: "Diagnosis of invasive pulmonary aspergillosis using polymerase chain reaction-based detection of aspergillus in BAL", CHEST, vol. 121, no. 4, 2002, pages 1171 - 1176 |
| RACIL, Z. ET AL.: "Invazivni mykotické infekce u onkologických nemocných: zmény v epidemiologii a diagnostice", POSTGRAD MED, vol. 9, no. 3, 2007, pages 240 - 252 |
| RANTAKOKKO-JALAVA, K. ET AL.: "Semiquantitative detection by real-time PCR of Aspergillus fumigatus in bronchoalveolar lavage fluids and tissue biopsy specimens from patients with invasive aspergillosis", J CLIN MICROBIOL, vol. 41, no. 9, 2003, pages 4304 - 4311 |
| SCHABEREITER-GURTNER CLAUDIA ET AL: "Development of novel real-time PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens.", JOURNAL OF CLINICAL MICROBIOLOGY MAR 2007 LNKD- PUBMED:17251398, vol. 45, no. 3, March 2007 (2007-03-01), pages 906 - 914, XP002598142, ISSN: 0095-1137 * |
| SCHABEREITER-GURTNER, C. ET AL.: "Development of novel real-time PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens", J CLIN MICROBIOL, vol. 45, no. 3, 2007, pages 906 - 14, XP002598142, DOI: doi:10.1128/JCM.01344-06 |
| SCHABEREITER-GURTNER, C. ET AL.: "Development of novel real-time PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens", J CLIN MICROBIOL, vol. 45, no. 3, 2007, pages 906 - 914, XP002598142, DOI: doi:10.1128/JCM.01344-06 |
| SKLADNY H ET AL: "Specific detection of Aspergillus species in blood and bronchoalveolar lavage samples of immunocompromised patients by two-step PCR.", JOURNAL OF CLINICAL MICROBIOLOGY DEC 1999 LNKD- PUBMED:10565898, vol. 37, no. 12, December 1999 (1999-12-01), pages 3865 - 3871, XP002598145, ISSN: 0095-1137 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10036748B2 (en) | 2006-04-01 | 2018-07-31 | Advatect Diagnostics, Llc | Methods and compositions for detecting fungi and mycotoxins |
| US10274493B2 (en) | 2006-04-01 | 2019-04-30 | Advatect Diagnostics, Llc | Methods and compositions for detecting fungi and mycotoxins |
| US10030278B2 (en) | 2008-08-22 | 2018-07-24 | Advatect Diagnostics, Llc | Methods and compositions for identifying yeast |
| US10793920B2 (en) | 2008-08-22 | 2020-10-06 | Mycodart, Inc. | Methods and compositions for identifying yeast |
| US10443106B2 (en) | 2009-10-08 | 2019-10-15 | Advatect Diagnostics, Llc | Methods and compositions for identifying sulfur and iron modifying bacteria |
| WO2015002560A1 (en) * | 2013-07-03 | 2015-01-08 | Universidade Do Minho | Peptide nucleic acid probe (pna), kit and method for detection of aspergillus fumigatus and applications thereof |
| CN107130015A (en) * | 2016-02-29 | 2017-09-05 | 上海翔琼生物技术有限公司 | A kind of PCR kit for fluorescence quantitative for detecting aspergillus fumigatus |
| CN107130015B (en) * | 2016-02-29 | 2023-07-11 | 上海翔琼生物技术有限公司 | Fluorescent quantitative PCR kit for detecting aspergillus fumigatus |
| EP3257951A3 (en) * | 2016-06-17 | 2018-03-14 | AdvaTect Diagnostics, LLC | Methods and compositions for identifying and quantifying fungal dna |
| CN107164478A (en) * | 2017-05-27 | 2017-09-15 | 山西维尔生物乳制品有限公司 | A kind of probe, primer and genetic chip for differentiating aspergillus fumigatus |
| CN113106167A (en) * | 2021-04-26 | 2021-07-13 | 北京大学第一医院 | Primer and probe for invasive aspergillosis pathogenic bacteria, implementation method and detection system thereof |
| CN113106167B (en) * | 2021-04-26 | 2022-09-20 | 北京大学第一医院 | Primer and probe for invasive aspergillosis pathogenic bacteria, implementation method and detection system thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CZ2009253A3 (en) | 2010-11-03 |
| CZ302670B6 (en) | 2011-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2010121578A1 (en) | Method for in vitro diagnostics of invasive aspergillosis | |
| Ahmad et al. | Invasive candidiasis: a review of nonculture-based laboratory diagnostic methods | |
| Vollmer et al. | Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens | |
| de Aguirre et al. | Rapid differentiation of Aspergillus species from other medically important opportunistic molds and yeasts by PCR-enzyme immunoassay | |
| AU733810B2 (en) | Nucleic acids for detecting (aspergillus) species and other filamentous fungi | |
| Fricke et al. | A real‐time PCR assay for the differentiation of Candida species | |
| Song et al. | Recent advances in the diagnosis of Pneumocystis pneumonia | |
| Reddy et al. | PCR for the diagnosis and species identification of microsporidia in patients with keratitis | |
| RU2422535C1 (en) | METHOD FOR Yersinia pestis Yersinia pseudotuberculosis STRAIN IDENTIFICATION | |
| Johnson et al. | Biomarkers for invasive aspergillosis: the challenges continue | |
| Shipitsyna et al. | Evaluation of polymerase chain reaction assays for the diagnosis of Trichomonas vaginalis infection in Russia | |
| Rahn et al. | A novel comprehensive set of fungal Real time PCR assays (fuPCR) for the detection of fungi in immunocompromised haematological patients—A pilot study | |
| Foongladda et al. | Multi-probe real-time PCR identification of four common Candida species in blood culture broth | |
| Osman et al. | Microarray detection of fungal infection in pulmonary tuberculosis | |
| Ricna et al. | Detection and identification of fungi in bronchoalveolar lavage fluid from immunocompromised patients using panfungal PCR | |
| Badiee et al. | Early detection of systemic candidiasis in the whole blood of patients with hematologic malignancies | |
| CN110093432A (en) | It is a kind of for distinguishing the sRNA marker and application thereof of tubercle bacillus and BCG vaccine | |
| Shigemura et al. | Subcutaneous abscess due to the basidiomycete Phellinus mori in a patient with chronic granulomatous disease | |
| Badiee et al. | Molecular detection of invasive aspergillosis in hematologic malignancies | |
| Mishra et al. | Targeted metagenomics using next generation sequencing in laboratory diagnosis of culture negative endophthalmitis | |
| Hizel et al. | Polymerase chain reaction in the diagnosis of invasive aspergillosis. | |
| Badiee et al. | Invasive fungal infection in renal transplant recipients demonstrated by panfungal polymerase chain reaction | |
| El-Morsy et al. | Allergic fungal rhinosinusitis: detection of fungal DNA in sinus aspirate using polymerase chain reaction | |
| Deshpande et al. | Standardization of fungal polymerase chain reaction for the early diagnosis of invasive fungal infection | |
| AU2017204102A1 (en) | Methods and compositions for identifying and quantifying microbial DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10734434 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10734434 Country of ref document: EP Kind code of ref document: A1 |