WO2010121308A1 - Detection of hepatitis c virus - Google Patents

Abstract

A method for detecting hepatitis C virus (HCV) in a sample comprising treating the sample containing nucleic acid with an agent that modifies unmethylated cytosine to uracil to form sequence modified nucleic acids; providing a primer set or a probe being complementary to a sequence modified nucleic acid indicative of HCV; and detecting a sequence modified nucleic acid indicative of HCV present in the sample.

Description

DETECTION OF HEPATITIS C VIRUS

Technical Field

The present invention relates generally to methods of viral pathogen detection. In particular, the present invention relates to methods of detecting hepatitis C virus (HCV) in a biological sample.

Background Art

Hepatitis C virus (HCV) is a major cause of chronic hepatitis, cirrhosis and liver cancer and is predominantly transmitted via parenteral blood exchange. Approximately 3% of the World's population (-180 million individuals) are infected, of which 70-80% will become chronically infected. Conventional lab diagnosis is based on serological tests that detect the presence of antibodies to HCV. However, one of the most sensitive methods for the detection of HCV is reverse transcriptase PCR (RT-PCR), which, in addition to improved sensitivity, can also be used to detect virus soon after infection, before antibodies are produced, and also to monitor viral load in response to anti-viral drugs.

There are a number of assays available for detecting and quantifying HCV RNA, based on endpoint PCR (NGI Superquant and Roche Cobas Amplicor HCV Monitor test 2.0), real time PCR (Roche Cobas Taqman HCV and Abbott RealTime HCV assay), branched signal amplification technology (Versant HCV RNA3.0 bDNA) and the transcription mediated amplification (TMA) assay; Siemens. Quantitative assays are useful for monitoring disease progression and influencing drug treatment regimes but these sometimes have lower levels of sensitivity than the qualitative assays and can also be susceptible to genotype biases. Furthermore, these assays are relatively expensive to perform and in some cases it is necessary to perform a qualitative test following a quantitative test in order to detect low virus levels, which results in an increased cost.

Treatment of nucleic acids with sodium bisulphite results in the chemical conversion of all unmethylated cytosines to thymine via a uracil intermediate, effectively converting a 4 base genome into a 3 base genome. This technology can be utilised to reduce the complexity of the genome of different organisms or strains so that they become more similar to each other, without loss of specificity, thus facilitating the detection of multiple organisms/strains in a single PCR reaction without the need for, or with much reduced, multiplexing. We have validated this technology and shown the sensitive and specific detection of all high-risk strains of human papillomavirus (HPV) in a single reaction. Our method was compared to the FDA-approved, industry standard for HPV diagnosis, the Qiagen Hybrid Capture Il assay (hell), in a clinical trial with 834 cervical specimens. The method demonstrated a statistically significant positive predictive value (P>0.001) when compared to the hell assay, confirming the clinical utility of the simplification approach [Baleriola C, Millar D, Melki J, et al. Comparison of a novel HPV test with the Hybrid Capture Il (hell) and a reference PCR method shows high specificity and positive predictive value for 13 high-risk human papillomavirus infections. J Clin Virol 2008; 42:22-26].

The present inventors have developed an improved assay for HCV.

Disclosure of Invention

Accordingly, in a first aspect the present invention provides methods for detecting HCV in a biological sample. In particular, the present methods relate to the positive identification of HCV using detection of molecular markers. The present methods also relate to converting the nucleic acids in a sample so that unmethylated cytosines are replaced by uracils or thymines and then detecting sequence-modified HCV molecular markers in the modified sample.

In some aspects, the present invention provides methods of detecting sequence- modified nucleic acids from HCV in a biological sample, comprising converting the unmethylated cytosines present in the nucleic acids contained in the biological sample to uracils or thymines to produce sequence modified nucleic acids, and then bringing the biological sample containing the sequence modified nucleic acids in contact with primer pairs or probes that may be used to distinguish HCV from other microorganisms.

In a first aspect, the present invention provides a method for detecting hepatitis C virus (HCV) comprising:

(a) treating a sample containing nucleic acid with an agent that modifies cytosine to uracil to form sequence modified nucleic acid;

(b) providing a primer set or probe being complementary to a sequence modified nucleic acid indicative of HCV; and

(c) detecting a sequence modified nucleic acid indicative of HCV present in the sample. In a second aspect, the present invention provides a method for detecting hepatitis C virus (HCV) comprising:

(a) treating a sample containing nucleic acid with an agent that modifies cytosine to uracil to form sequence modified nucleic acid;

(b) providing a primer set being complementary to a sequence modified nucleic acid indicative of HCV;

(c) amplifying the sequence modified nucleic acid; and

(d) detecting an amplified nucleic acid indicative of HCV present in the sample.

The sequence modified nucleic acids do not exist naturally and do not form part of a cellular HCV genome but can be used for diagnostic purposes as they correspond to native nucleic acids present in the sample before the treating step.

In a preferred form, the method includes use of a primer pair complementary to a sequence modified nucleic acid indicative of HCV; amplifying the sequence modified nucleic acid; and detecting the amplified sequence modified nucleic acid.

Preferably, the primer set is selected from the primers set out in Table 1 (SEQ ID NO: 1 to SEQ ID NO: 95). More preferably, the primer sets are set out in Table 3.

Preferably, the primer sets are selected from: SEQ ID NO: 32, SEQ ID NO: 19, SEQ ID NO: 21 ; SEQ ID NO: 32, SEQ ID NO: 28;

SEQ ID NO: 1 , SEQ ID NO: 14, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13;

SEQ ID NO: 16, SEQ ID NO: 15, SEQ ID NO: 28;

SEQ ID NO: 16, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 20;

SEQ ID NO: 1, SEQ ID NO: 14, SEQ ID NO: 19;

SEQ ID NO: 1, SEQ ID NO: 14, SEQ ID NO: 28;

SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 19, SEQ ID NO: 21; or

SEQ ID NO: 36, SEQ ID NO: 40.

Preferably, amplification is carried out by polymerase chain reaction (PCR), Real Time PCR, isothermal amplification or signal amplification. In another preferred form, the method includes use of a probe complementary to a sequence modified nucleic acid indicative of HCV; allowing the probe to bind to the sequence modified nucleic acid and detecting the bound probe.

Preferably, the probe set is selected from the probes in Table 2 (SEQ ID NO: 96 to SEQ ID NO: 103). More preferably, the probe set is in Table 4.

Preferably, the sample is treated with a bisulphite reagent such as sodium bisulphite or sodium metabisulphite.

The methods may further comprise detecting an amplification product produced by a primer pair, thereby detecting HCV, if present, in the sample of modified nucleic acids.

In third aspect, the present invention provides a primer set selected from primers in Table 1 (SEQ ID NO: 1 to SEQ ID NO: 95) or probe in Table 2 (SEQ ID NO: 96 to SEQ ID NO: 103) suitable to detect hepatitis C virus (HCV).

In a fourth aspect, the present invention provides use of a primer pair selected from the primers set out in Table 1 (SEQ ID NO: 1 to SEQ ID NO: 95) or probe set out in Table 2 (SEQ ID NO: 96 to SEQ ID NO: 103) in an assay for detecting hepatitis C virus (HCV).

In some embodiments, any of the primers or probes may be degenerate, i.e. a mixture of primers or probes is provided that have a variable sequence at one or more nucleotides. The primers may be degenerate at 1 nucleotide position, 1-2 nucleotide positions, 1-3 nucleotide positions, and at 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotide positions.

The biological sample may be brought into contact with one or more primers or probes separately or simultaneously. Where the contact occurs simultaneously (i.e. multiplexing), one or more primers are brought into contact with the biological sample and with each other to amplify the target sequences. Optionally, an internal positive control nucleic acid and a primer pair complementary to the internal positive control nucleic acid may be added to the amplification mixture.

In some aspects, the present methods use real time PCR to detect the amplification products. In certain embodiments, the detecting may be accomplished using a labeled oligonucleotide probe for each amplification product. A quencher may further be associated with the detectable label which prevents detection of the label prior to amplification of the probe's target. TaqMan® probes , molecular beacons, scorpions, minor groove binders (MGB), lux, sunrise and INA beacon probes are examples of such probes, any of which may but not limited to may be used in the amplification mixture. In some embodiments, the probe and one of the primers of the primer pair may comprise part of the same molecule (e.g. a Scorpion™ primer/probe). A Scorpion™ contains a fluorophore associated with a quencher to reduce background fluorescence. Following PCR extension, the synthesized target region is attached to the same strand as the probe. Upon denaturation, the probe portion of the Scorpion™ specifically hybridizes to a part of the newly produced PCR product, physically separating the fluorophore from the quencher, thereby producing a detectable signal.

In certain embodiments, at least one primer of a primer pair in the amplification reaction is labeled with a detectable moiety. Alternatively, a specific probe molecule labeled with a detectable moiety may be added to the amplification mixture. Thus, following amplification, the various target segrnents can be identified by using different detectable moieties such as size and/or colour. The detectable moiety may be a fluorescent dye. In some embodiments, different pairs of primers or probes in a multiplex PCR may be labeled with different distinguishable detectable moieties. Thus, for example, HEΞX, FAM₁ TET and Texas Red fluorescent dyes may be present on different primers or probes in multiplex PCR and associated with the resulting amplicons. In other embodiments, the forward primer is be labeled with one detectable moiety, while the reverse primer is labeled with a different detectable moiety, e.g. FAM dye for a forward primer and HEX dye for a reverse primer. Use of different detectable moieties is useful for discriminating between amplified products which are of the same length or are very similar in length. Thus, in certain embodiments, at least two different fluorescent dyes are used to label different primers used in a single amplification.

Analysis of amplified products from amplification reactions, such as multiplex PCR, can be performed using an automated DNA analyzer such as an automated DNA sequencer (e.g. ABI PRISM 3100 Genetic Analyzer) which can evaluate the amplified products based on size (determined by electrophoretic mobility) and/or respective fluorescent label. Detection of amplification products can also be by melting curve analysis.

In certain embodiments of the aspects provided herein, the methods further comprise a nucleic acid extraction step. Various nucleic acid extraction methods are known in the art which can be employed with the methods and compositions provided herein such as lysis methods including guanidinium isothiocyanate, phenol: chloroform and isopropanol precipitation. Nucleic acid extraction kits can also be used. In suitable embodiments, the extraction method is according to QIAamp ultrasens, QIAamp virus, AccuPrepTM Viral RNA Extraction Kit, Ambion's Mag MAX Viral RNA, High Pure Viral RNA Kit, MagMAX™ AI/ND Viral RNA Isolation Kits or phenol: chloroform extraction using Eppendorf Phase Lock Gels®.

Oligonucleotides or combinations of oligonucleotides that are useful as primers or probes in the methods are also provided. These oligonucleotides are provided as substantially purified material.

Kits comprising oligonucleotides which may be primers for performing amplifications as described herein also are provided. Kits may further include oligonucleotides that may be used as probes to detect amplified nucleic acid. Kits may also include specific nucleases or glycosylases for digesting non-target nucleic acid to increase detection of target nucleic acid by the oligonucleotide primers.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia before the priority date of each claim of this specification.

In order that the present invention may be more clearly understood, preferred embodiments will be described with reference to the following drawings and examples.

Brief Description of the Drawings

Figure 1 shows HCV genome map.

Figure 2 shows summary of preferred primers used in the HCV assay by region.

Figure 3 shows sensitivity and linearity of preferred RNA conversion assay. A dynamic range of concentrations from 9.2 IU to 1 384 615 IU/ml were purified from Acrometrix Optiqual HCV high positive control, bisulphite converted using the preferred method, reverse transcribed and 1/10^th of the cDNA subjected to real time PCR. A. Real time plot. The quantity of HCV (IU) per PCR are as follows (in order on graph); 138461.5; 46153.8; 9230.8; 2307.7; 416.5; 230.7; 92.3; 46.1 ; 23; 9.2; 4.6; 2.3; 0.92. B. Standard curve.

Figure 4 shows comparison of preferred assay with other commercially available bisulphite conversion assays. A. PCR amplification of various concentrations of HCV following bisulphite conversion and reverse transcription. Legend indicates copies of HCV RNA equivalence per PCR (1 IU = 2.7 copies).

Figure 5 shows determination of assay linearity. A. Real time PCR plots. B. Standard curve. C. Quantitation data of a range of samples.

Figure 6 shows specificity of a preferred assay according to the invention for all HCV genotypes in a Worldwide performance panel showing PCR products.

Mode(s) for Carrying Out the Invention

The present inventors aimed to produce a RT-PCR assay using 'simplified' HCV RNA as template. However, treatment of RNA with sodiunrv bisulphite, under the same conditions used for DNA conversion, results in partial or complete degradation of the RNA and thus has no clinical utility. In order to address this issue the applicant has devised a completely new method for the simplification of RNA using sodium bisulphite.

To demonstrate the performance of the assay according to the present invention, validation of the method was achieved by using a series of commercially available HCV performance, linearity and genotyping panels. Finally, the assay was assessed on a blinded panel of 413 clinical samples, which demonstrated that this multi-strain, single- assay design shows similar sensitivity and specificity to conventional approaches for the simultaneous detection of all strains of HCV.

The present invention is described herein using several definitions, as set forth below and throughout the specification.

As used herein, unless otherwise stated, the singular forms "a," "an," and "the" include plural reference. Thus, for example, a reference to "an oligonucleotide" includes a plurality of oligonucleotide molecules, and a reference to "a nucleic acid" is a reference to one or more nucleic acids.

As used herein, "about" means plus or minus 10%.

The terms "amplification" or "amplify" as used herein includes methods for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification may be exponential or linear. A target nucleic acid may be either DNA or RNA. The sequences amplified in this manner form an "amplicon." While the exemplary methods described hereinafter relate to amplification using the polymerase chain reaction (PCR), numerous other methods are known in the art for amplification of nucleic acids (e.g. isothermal methods, rolling circle methods, etc.). The skilled artisan will understand that these other methods may be used either in place of, or together with, PCR methods. See, e.g. Saiki, "Amplification of Genomic DNA" in PCR Protocols, lnnis et al., Eds., Academic Press, San Diego, CA 1990, pp 13- 20; Wharam, et al., Nucleic Acids ReS. 2001 Jun 1;29(11):E54-E54; Hafner, et al., Biotechniques 2001 Apr;30(4):852-860.

The term "complement," "complementary," or "complementarity" as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refers to standard Watson/Crick pairing rules. The complement of a nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "antiparallel association." For example, the sequence "5'-A-G-T-3"' is complementary to the sequence "3'-T-C-A-5'." Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids described herein; these include, for example, inosine, 7-deazaguanine, Locked Nucleic Acids (LNA), Peptide Nucleic Acids (PNA) and Intercalating Nucleic Acids (INA). Complementarity need not be perfect; stable duplexes may contain mismatched.base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complement sequence can also be a sequence of RNA complementary to the DNA sequence or its complement sequence, and can also be a cDNA.

The term "substantially complementary" as used herein means that two sequences specifically hybridize (defined below). The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length.

As used herein, the term "detecting" used in context of detecting a signal from a detectable label to indicate the presence of a target nucleic acid in the sample does not require the method to provide 100% sensitivity and/or 100% specificity. As is well known, "sensitivity" is the probability that a test is positive, given that the person has a target nucleic acid sequence, while "specificity" is the probability that a test is negative, given that the person does not have the target nucleic acid sequence. A sensitivity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. A specificity of at least 50% is preferred, although sensitivities of at least 60%, at least 70%, at least 80%, at least 90% and at least 99% are clearly more preferred. Detecting also encompasses assays with false positives and false negatives. False negative rates may be 1%, 5%, 10%, 15%, 20% or even higher. False positive rates may be 1%, 5%, 10%, 15%, 20% or even higher.

A "fragment" in the context of a nucleic acid refers to a sequence of nucleotides which are at least about 5 nucleotides, at least about 7 nucleotides, at least about 9 nucleotides, at least about 11 nucleotides, or at least about 17 nucleotides. The fragment is typically less than about 300 nucleotides, less than about 100 nucleotides, less than about 75 nucleotides, less than about 50 nucleotides, or less than 30 nucleotides. In certain embodiments, the fragments can be used in polymerase chain reaction (PCR), various hybridization procedures or microarray procedures to identify or . amplify identical or related parts of mRNA or DNA molecules. A fragment or segment may uniquely identify each polynucleotide sequence of the present invention.

"Genomic nucleic acid" or "genomic DNA" or "genomic RNA" refers to some or all of the DNA from a chromosome or some or all of the RNA encoded by an RNA virus. Genomic DNA , RNA or cDNA derived from genomic RNA may be intact or fragmented (e.g. digested with restriction endonucleases or glycosylases by methods known in the art). In some embodiments, genomic DNA , RNA or cDNA may include sequence from all or a portion of a single gene or from multiple genes. In contrast, the term "total genomic nucleic acid" is used herein to refer to the full complement of DNA or RNA contained in the genome. Methods of purifying DNA and/or RNA from a variety of samples are well-known in the art.

The term "multiplex PCR" as used herein refers to simultaneous amplification of two or more products within the same reaction vessel. Each product is primed using a distinct primer pair. A multiplex reaction may further include specific probes for each product, that are detectably labeled with different detectable moieties.

As used herein, the term "oligonucleotide" refers to a short polymer composed of deoxyribonucleotides, ribonucleotides or any combination thereof. Oligonucleotides are generally between about 10, 11 , 12, 13, 14 or 15 to about 150 nucleotides (nt) in length, more preferably about 10, 11, 12, 13, 14, or 15 to about 70 nt, and most preferably between about 18 to about 35 nt in length. The single letter code for nucleotides is as described in the U.S. Patent Office Manual of Patent Examining Procedure, section 2422, table 1. In this regard, the nucleotide designation "R" means purine such as guanine or adenine, "Y" means pyrimidine such as cytosine or thymidine (uracil if RNA); and "M" means adenine or cytosine. An oligonucleotide may be used as a primer or as a probe.

As used herein, a "primer" for amplification is an oligonucleotide that is complementary to a target nucleotide sequence and leads to addition of nucleotides to the 3' end of the primer in the presence of a DNA or RNA polymerase. The 3' nucleotide of the primer should generally be identical to the target sequence at a corresponding nucleotide position for optimal expression and amplification. The term "primer" as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, intercalating nucleic acid primers, and the like. As used herein, a "forward primer" is a primer that is complementary to the anti-sense strand of dsDNA. A "reverse primer" is complementary to the sense-strand of dsDNA.

Primers are typically between about 10 and about 100 nucleotides in length, preferably between about 15 and about 60 nucleotides in length, and most preferably between about 25 and about 40 nucleotides in length. There is no standard length for optimal hybridization or polymerase chain reaction amplification. An optimal length for a particular primer application may be readily determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989).

An oligonucleotide (e.g. a probe or a primer) that is specific for a target nucleic acid will "hybridize" to the target nucleic acid under suitable conditions. As used herein, "hybridization" or "hybridizing" refers to the process by which an oligonucleotide single strand anneals with a complementary strand through base pairing under defined hybridization conditions.

"Specific hybridization" is an indication that two nucleic acid sequences share a high degree of complementarity. Specific hybridization complexes form under permissive annealing conditions and remain hybridized after any subsequent washing steps. Permissive conditions for annealing of nucleic acid sequences are routinely determinable by one of ordinary skill in the art and may occur, for example, at 65⁰C in the presence of about 6^XSSC. Stringency of hybridization may be expressed, in part, with reference to the temperature under which the wash steps are carried out. Such temperatures are typically selected to be about 5⁰C to 20⁰C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Equations for calculating Tm and conditions for nucleic acid hybridization are known in the art.

As used herein, an oligonucleotide is "specific" for a nucleic acid if the oligonucleotide has at least 50% sequence identity with a portion of the nucleic acid when the oligonucleotide and the nucleic acid are aligned. An oligonucleotide that is specific for a nucleic acid is one that, under the appropriate hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 95% and more preferably at least 98% sequence identity. Sequence identity can be determined using a commercially available computer program with a default setting that employs algorithms well known in the art. As used herein, sequences that have "high sequence identity" have identical nucleotides at least at about 50% of aligned nucleotide positions, preferably at least at about 60% of aligned nucleotide positions, and more preferably at least at about 75% of aligned nucleotide positions.

Oligonucleotides used as primers or probes for specifically amplifying (i.e. amplifying a particular target nucleic acid sequence) or specifically detecting (i.e. detecting a particular target nucleic acid sequence) a target nucleic acid generally are capable of specifically hybridizing to the target nucleic acid.

As used herein, the term "sample" or "test sample" may comprise clinical samples, isolated nucleic acids, or isolated microorganisms. In preferred embodiments, a sample is obtained from a biological source (i.e. a "biological sample"), such as tissue, bodily fluid, or microorganisms collected from a subject. Sample sources include, but are not limited to, sputum (processed or unprocessed), bronchial alveolar lavage (BAL), bronchial wash (BW), blood, bodily fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g. biopsy material). Preferred sample sources include tissue samples both fresh and archival, blood, fractionated blood products, serum, plasma, pooled serum and/or plasma samples.

The term "patient sample" as used herein refers to a sample obtained from a human seeking diagnosis and/or treatment of a disease.

As used herein, the term "Scorpion™ detection system" refers to a method for real-time PCR. This method utilizes a bi-functional molecule (referred to herein as a "Scorpion™"), which contains a PCR primer element covalently linked by a polymerase- blocking group to a probe element. Additionally, each Scorpion™ molecule contains a fluorophore that interacts with a quencher to reduce the background fluorescence. The terms "target nucleic acid" or "target sequence" as used herein refer to a sequence which includes a segment of nucleotides of interest to be amplified and detected. Copies of the target sequence which are generated during the amplification reaction are referred to as amplification products, amplimers, or amplicons. Target nucleic acid may be composed of segments of a chromosome, a complete gene with or without intergenic sequence, segments or portions of a gene with or without intergenic sequence, or sequence of nucleic acids which probes or primers are designed. Target nucleic acids may include a wild-type sequence(s), a mutation, deletion or duplication, tandem repeat regions, a gene of interest, a region of a gene of interest or any upstream or downstream region thereof. Target nucleic acids may represent alternative sequences or alleles of a particular gene. Target nucleic acids may be derived from genomic DNA, cDNA, or RNA. As used herein target nucleic acid may be RNA extracted from a cell or a nucleic acid copied or amplified therefrom, or may include extracted nucleic acids further converted using a bisulfite reaction.

As used herein "TaqMan® PCR detection system" refers to a method for real time PCR. In this method, a TaqMan® probe which hybridizes to the nucleic acid segment amplified is included in the PCR reaction mix. The TaqMan® probe comprises a donor and a quencher fluorophore on either end of the probe and in close enough proximity to each other so that the fluorescence of the donor is taken up by the quencher. However, when the probe hybridizes to the amplified segment, the 5'- exonuclease activity of the Taq polymerase cleaves the probe thereby allowing the donor fluorophore to emit fluorescence which can be detected.

Sample Preparation

Specimens from which HCV can be detected and quantified with the present invention are from sterile and/or non- sterile sites. Sterile sites from which specimens can be taken are body fluids such as blood, serum, plasma, urine, cerebrospinal fluid, synovial fluid, pleural fluid, pericardial fluid, intraocular fluid, tissue biopsies or endotracheal aspirates.

Specimens may be processed prior to nucleic acid amplification.

The nucleic acid (DNA or RNA) may be isolated from the sample according to any methods well known to those of skill in the art. If necessary the sample may be collected or concentrated by centrifugation and the like. The cells of the sample may be subjected to lysis, such as by treatments with enzymes, heat surfactants, ultrasonication, mechanical disruption, or combination thereof. The lysis treatment is performed in order to obtain a sufficient amount of RNA derived from HCV, if present in the sample, to detect using polymerase chain reaction or other suitable whether signal or nucleic acid amplification technique.

Various methods of nucleic acid extraction are suitable for isolating the RNA. Suitable methods include phenol and chloroform extraction. See Maniatis et al., Molecular Cloning, A Laboratory Manual, 2d, Cold Spring Harbor Laboratory Press, page 16.54 (1989). Numerous commercial kits also yield suitable RNA including, but not limited to, QIAamp ultrasens, QIAamp virus, AccuPrepTM Viral RNA Extraction Kit, Ambion's MagMAX Viral RNA, High Pure Viral RNA Kit, MagMAX™ AI/ND Viral RNA Isolation Kits or phenol: chloroform extraction using Eppendorf Phase Lock Gels®.

Conversion of Nucleic Acids to Modified Nucleic Acids

In one aspect, the nucleic acids present in the sample are converted to sequence-modified nucleic acids prior to amplification. "Conversion" refers to the process whereby the non-methylated cytosines present in the nucleic acids are chemically deaminated and modified into uracils. Following amplification, thymidines are substituted for the uracils. In some methods, the conversion is accomplished by contacting the nucleic acids with sodium bisulphite. Thus, in unmethylated DNA or RNA, this process results in all or mostly all cystosines (C) being replaced by uracil (U) or thymidine (T), thereby converting a 4 base pair sequence into a 3 base pair sequence of A's, T's and G's. The bisulphite DNA conversion method for the detection of methylated DNA was described in Frommer et al, PNAS 89: 1827-1831 (1992) and Clark et al., Nucl Acids Res 22: 2990-7 (1994), and has been modified by the present inventors to be compatible with RNA. Numerous commercial kits are available to perform the bisulfite conversion reaction on DNA including MethylEasy™ (Human Genetic Signatures), EpiTect® Bisulfite Kit (Qiagen/Epigenomics), and Methyl Amp™ DNA Modification Kit (Epigentek).

Chemical conversion of cytosine to uracil or thymidine may be carried out as follows. First, the nucleic acid sample is denatured, if double stranded, to provide single- stranded nucleic acid without or. with minimal secondary structure. The denaturation step may be performed by contacting the nucleic acid with a heating step for RNA containing targets or with alkali for DNA containing targets. Second, the nucleic acid sample is reacted with a reagent and incubated so as to form a treated nucleic acid sample where any methylated nucleotides in the nucleic acid sample remain unchanged while unmethylated cytosine nucleotides are deaminated. Suitable reagents include, but are not limited to, sodium bisulfite. Third, the treated nucleic acid sample is purified to substantially remove any unwanted reagents or diluents from the treated nucleic acid sample. This may be accomplished, for example, by using column purification and concentration, or diluting the sample so as to reduce salt concentration and then precipitating the nucleic acid. Finally, a desulphonation step of the treated nucleic acid sample may be performed to remove sulphonate groups present on the treated nucleic acid so as to obtain a nucleic acid sample substantially free of sulphonate groups. Further detail regarding the conversion of non-methylated nucleotides can be found in U.S. Patent Application publications 2007/0020633, 2004/0219539, and 2004/0086944.

Non-methylated cytosines in the nucleic acid strand/s are converted as a result of the process just described. Consequently in the case of cDNA or DNA, following conversion the two nucleic acid strands are no longer fully complementary and will not specifically hybridize, but may hybridize under non- stringent conditions, depending on the number of non-methylated cytosines within the converted strands. If few non- methylated cytosines are present within the strand, then the strands will likely retain some complementarity after conversion. If many non-methylated cytosines are present within the strand, then the top strand and bottom strand will be less likely to hybridize even under non-stringent conditions. As used herein, the general term "strand" refers to a single chain of sugar-phosphate linked nucleosides, i.e. a strand of double-stranded DNA (dsDNA) single stranded DNA (ssDNA), complementary (cDNA) or RNA. The "top strand" refers to the sense strand of the polynucleotide read in the 5' to 3' direction, which is the strand of dsDNA or cDNA that includes at least a portion of a coding sequence of a functional protein. The "bottom strand" refers to the anti-sense strand, which is the strand of dsDNA or cDNA that is the reverse complement of the sense strand. It is understood that, while a sequence is referred to as bottom or top strand, such a designation is intended to distinguish complementary strands since, in solution, there is no orientation that fixes a strand as a top or bottom strand. It is also understood that the top strand will therefore have its own complementary strand following amplification and likewise the bottom strand will have its own complementary strand following amplification. While the original converted strands (top or bottom) will be simplified to only contain a 3 base pair sequence of A's, T¹S and G¹S, the complementary strands will necessarily only contain T's, A's and Cs. In some methods, the presence of converted nucleic acids is detected using PCR. For each target sequence, either the top strand, the bottom strand, or both may be detected using primers specific for the modified sequence of either strand. Bisulphite Treatment of Nucleic Acids

Methods for treating nucleic acid with sodium bisuphite can be found in a number of references including Frommer et al 1992, Proc Natl Acad Sci 89:1827-1831 ; Grigg and Clark 1994 BioAssays 16:431-436; Shapiro et al 1970, J Amer Chem Soc 92:422 to 423; Wataya and Hayatsu 1972, Biochemistry 11 :3583 - 3588.

Methods have also been developed by the present applicant to improve or enhance success of bisulphite treatment of nucleic acids.

An exemplary protocol for effective bisulphite treatment of nucleic acid is set out below. The protocol results in retaining substantially all DNA or RNA treated. This method is also referred to herein as the Human Genetic Signatures (HGS) method. It will be appreciated that the volumes or amounts of sample or reagents can be varied.

Preferred method for bisulphite treatment can be found in US 10/428310 or PCT/AU2004/000549.

To 2 μg or less of nucleic acid, which can be pre-digested with suitable restriction enzymes if so desired, 2 μl (1/10 volume) of 3 M NaOH (6g in 50 ml water, freshly made) was added in a final volume of 20 μl in the case of DNA or the sample heated, to a maximum of 95⁰C, in the case of RNA to substantially remove secondary structure. This step denatures the double stranded DNA molecules into a single stranded form or reduces the secondary structure commonly found in RNA molecules, since the bisulphite reagent preferably reacts with single stranded molecules and cannot access the secondary structure retained within certain regions of RNA molecules. The mixture was incubated at 37⁰C for 15 minutes for DNA or to a maximum of 95⁰C for 2 minutes for RNA containing samples. Incubation at temperatures above room temperature can be used to improve the efficiency of denaturation.

After the incubation, 208 μl 2-3 M Sodium Metabisulphite and 12 μl of 10 mM Quinol (0.055 g in 50 ml water, BDH AnalR #103122E; freshly made) were added in succession. Quinol is a reducing agent and helps to reduce oxidation of the reagents. Other reducing agents can also be used, for example, dithiothreitol (DTT), mercaptoethanol, quinone (hydroquinone), or other suitable reducing agents. The sample was overlaid with 200 μl of mineral oil. The overlaying of mineral oil prevents evaporation and oxidation of the reagents but is not essential. The sample was then incubated overnight at 55⁰C. An alternative is to place the sample and reagents into a 0.2 mL PCR tube and perform the incubation steps, without mineral oil, in a thermal cycler as follows: incubate for about 4 hours or overnight as follows: Step 1 , 55°C / 2 hr cycled in PCR machine; Step 2, 95⁰C / 2 min; Step 1 and Step 2 can be repeated as many times as is required to obtain complete conversion and can be determined empirically. Step 1 can be performed at any temperature from about 37⁰C to about 9O⁰C and can vary in length from 5 minutes to 8 hours. Step 2 can be performed at any temperature from about 7O⁰C to about 99⁰C and can vary in length from about 1 second to 60 minutes, or longer, or may not be required at all. For conversion of HCV RNA it has been found that a time of about 20 minutes at 70°C-80°C using 3M bisulphite is usually sufficient for optimal conversion.

After the treatment with Sodium Metabisulphite, the oil was removed, and 1 μl tRNA (20 mg/ml) or 2 μl glycogen were added if the DNA or RNA concentration was low. These additives are optional and can be used to improve the yield of nucleic acid obtained by co-precipitating or assisting solid phase purification with the target DNA, RNA or cDNA especially when the target nucleic acid is present at low concentrations. The use of additives as carrier for more efficient precipitation of nucleic acids is generally desired when the amount of nucleic acid is <0.5 μg. It can be appreciated that any suitable DNA, RNA or cDNA binding column or solid phase such as a magnetic microsphere could be used at this stage to remove the bisulphite reagent from the converted sample.

An isopropanol cleanup treatment was performed as follows: 800 μl of water were added to the sample, mixed and then 1 ml isopropanol was added. The water or buffer reduces the concentration of the bisulphite salt in the reaction vessel to a level at which the salt will not precipitate along with the target nucleic acid of interest. The dilution is generally about 1/4 to 1/1000 so long as the salt concentration is diluted below a desired range, as disclosed herein.

The sample was mixed again and left at 4⁰C for a minimum of 5 minutes. The sample was spun in a microfuge for 10-15 minutes and the pellet was washed 1-2x with 70% ETOH, vortexing each time. This washing treatment removes any residual salts that precipitated with the nucleic acids.

The pellet was allowed to dry and then resuspended in a suitable volume of T/E (10 mM Tris/0.1 mM EDTA) or other buffered reagent pH 7.0-12.5, such as 50 μl. Buffer at pH 10.5 has been found to be particularly effective. The sample was incubated at 37⁰C to 95⁰C for 1 min to 96 hr, as needed to resuspend and desulphonate the nucleic acids. Amplification of Nucleic Acids

Nucleic acid samples or isolated nucleic acids may be amplified by various . methods known to the skilled artisan. Preferably, PCR is used to amplify nucleic acids of interest. Briefly, in PCR, two primer sequences are prepared that are complementary to regions on opposite complementary strands of the marker sequence. An excess of deoxynucleotide triphosphates are added to a reaction mixture along with a DNA polymerase, e.g. Tag polymerase. When the template is sequence-modified, as described above, the amplification mixture preferably does not contain a UNG nuclease.

If the target sequence is present in a sample, the primers will bind to the sequence and the polymerase will cause the primers to be extended along the target sequence by adding on nucleotides. By raising and lowering the temperature of the reaction mixture, the extended primers will dissociate from the marker to form reaction products, excess primers will bind to the marker and to the reaction products and the process is repeated, thereby generating amplification products. Cycling parameters can be varied, depending on the length and sequence composition of the amplification products to be extended. An internal positive amplification control (IPC) can be included in the sample, utilizing oligonucleotide primers and/or probes. The IPC can be used to monitor both the conversion process and any subsequent amplification.

Target Nucleic Acids and Primers and Probes

In various embodiments of the present invention, oligonucleotide primers and probes are used in the methods described herein to amplify and detect target sequence- modified nucleic acids specific to HCV. In addition, primers can also be used to amplify one or more control nucleic acid sequences. The target nucleic acids described herein may be detected individually or in a multiplex format, utilizing individual labels for each target.

The skilled artisan is capable of designing and preparing primers that are appropriate for amplifying a target sequence in view of this disclosure. The length of the amplification primers for use in the present invention depends on several factors including the nucleotide sequence identity and the temperature at which these nucleic acids are hybridized or used during in vitro nucleic acid amplification. The considerations necessary to determine a preferred length for an amplification primer of a particular sequence identity are well known to the person of ordinary skill in the art. Specifically, primers and probes to amplify and detect sequence-modified nucleic acids corresponding to those set out in Table 1 , Table 2, Table 3 and Table 4 are provided by the present invention. Primers that amplify a nucleic acid molecule can be designed using, for example, a computer program such as OLIGO (Molecular Biology Insights, Inc., Cascade, CO). Important features when designing oligonucleotides to be used as amplification primers include, but are not limited to, an appropriate size amplification product to facilitate detection (e.g. by electrophoresis or real-time PCR), similar melting temperatures for the members of a pair of primers, and the length of each primer (i.e., the primers need to be long enough to anneal with sequence- specificity and to initiate synthesis but not so long that fidelity is reduced during oligonucleotide synthesis). Typically, oligonucleotide primers are 15 to 35 nucleotides in length.

A further consideration for designing primers for sequence-modified nucleic acids is that the converted sequence comprises primarily A, T, and G nucleotides or alternatively primarily T, A and C nucleotides. Accordingly, the melting temperature of the primer directed to a sequence-modified target will typically be lower than a corresponding primer directed to the unmodified target. Therefore, it may be necessary for the length of sequence-modified primers to be adjusted compared to a corresponding unmodified target primer. Therefore, the oligonucleotide primers may be longer than typical oligonucleotide primers directed to sequences comprised of all four bases (e.g. longer than 15 to 35 nucleotides). When the PCR template is sequence modified DNA, RNA or cDNA, the majority of the nucleic acid is effectively reduced to three bases (A, T, and G on one strand and T, A and C on the other strand). This decreases the complexity of target sample and can increase the incidence of primer-template interaction at "nonspecific" regions. Optionally, these non-specific interactions may be overcome by the use of a nested or semi-nested PCR or probe based detection approach.

Designing oligonucleotides to be used as hybridization probes can be performed in a manner similar to the design of primers. As with oligonucleotide primers, oligonucleotide probes usually have similar melting temperatures, and the length of each probe must be sufficient for sequence-specific hybridization to occur but not so long that fidelity is reduced during synthesis. Oligonucleotide probes are generally 15 to 60 nucleotides in length.

In some embodiments, a mix of primers is provided having degeneracy at one or more nucleotide positions. Degenerate primers are used in PCR where variability exists in the target sequence, i.e. the sequence information is ambiguous. Typically, degenerate primers will exhibit variability at no more than about 4, no more than about 3, preferably no more than about 2, and most preferably, no more than about 1 nucleotide position.

The target nucleic acids to identify HCV may be selected according to a wide variety of methods. The target may be amplified in full. Alternatively, in some embodiments, fragments or segments of the target sequences are amplified. The fragment may be derived from any region of the full sequence, but fragment length in accordance with the present methods is typically at least 30, at least 50, at least 75, at least 100, at least 150, at least 200, at least 250 or at least 300 nucleotides. As will be understood by one of skill in the art, the size and location of the particular target nucleic acid will control the selection of the amplification primers and vice versa.

In some embodiments, specific primers and probes are selected to amplify and detect a fragment of sequence modified HCV genome . The skilled artisan will understand that other primers and probes may be used.

In a suitable embodiment, PCR can be performed using a Scorpion™ primer/probe combination. Scorpion™ probes comprise a 3' primer with a 5¹ extended probe tail comprising a hairpin structure which possesses a fluorophore/quencher pair. During PCR, the polymerase is blocked from extending into the probe tail by the inclusion of hexethlyene glycol (HEG). During the first round of amplification the 3" target-specific primer anneals to the target and is extended such that the Scorpion™ is now incorporated into the newly synthesized strand, which possesses a newly synthesized target region for the 5' probe. During the next round of denaturation and annealing, the probe region of the Scorpion™ hairpin loop will hybridize to the target, thus separating the fluorophore and quencher and creating a measurable signal. Such probes are described in Whitcombe et al., Nature Biotech 17: 804-807 (1999). In another embodiment, PCR is carried out using either but not limited to TaqMan, molecular beacon, MGB, sunrise, lux or INA beacon probes.

Detection of Amplified Nucleic Acids

Amplification of nucleic acids can be detected by any of a number of methods well-known in the art such as gel electrophoresis, column chromatography, hybridization with a probe, sequencing, melting curve analysis, or "real-time" detection. In one approach, sequences from two or more fragments of interest are amplified in the same reaction vessel (i.e. "multiplex PCR"). Detection can take place by measuring the end-point of the reaction or in "real time". For real-time detection, primers and/or probes may be detectably labeled to allow differences in fluorescence when the primers become incorporated or when the probes are hybridized, for example, and amplified in an instrument capable of monitoring the change in fluorescence during the reaction. Real-time detection methods for nucleic acid amplification are well known and include, for example, the TaqMan® system, molecular Beacon, MGB, Lux, sunrise, Scorpion™ primer system and use of intercalating dyes for double stranded nucleic acid.

In end-point detection, the amplicon(s) could be detected by first size-separating the amplicons, then detecting the size-separated amplicons. The separation of amplicons of different sizes can be accomplished by, for example, gel electrophoresis, column chromatography, or capillary electrophoresis. These and other separation methods are well known in the art. In one example, amplicons of about 10 to about 150 base pairs whose sizes differ by 10 or more base pairs can be separated, for example, on a 4% to 5% agarose gel (a 2% to 3% agarose gel for about 150 to about 300 base pair amplicons), or a 6% to 10% polyacrylamide gel. The separated nucleic acids can then be stained with a dye such as ethidium bromide and the size of the resulting stained band or bands can be compared to a standard DNA ladder.

In another example, Invader™ (Third Wave Technologies, Inc) may be used to detect specific nucleic acid sequences after linear or exponential amplification. In the Invader™ assay, the DNA structure recognized by a thermostable flap endonuclease (FEN), is formed by an Invader™ probe that overlaps the signal probe by at least one base. The unpaired single- stranded flap of the signal probe is released during the FEN reaction and can be detected by various methods such as measuring fluorescence after capturing and extending the released signal probe flap with fluorescein-labeled nucleotides (ELISA-format), mass-spectrometry, denaturing gel electrophoresis, etc. A variation of the Invader™ assay uses a FRET probe. The released signal probe fragment of the initial FEN reaction subsequently serves as an Invader probe invading the stem fragment of the hairpin formed intramolecularly in the FRET probe. This process induces a second FEN reaction during which the fluorophore in the FRET probe is separated from the nearby quenching dye in the FRET probe, resulting in the generation of fluorescence. Both FEN reactions occur at isothermic conditions (near the melting temperature of the probes) which enables a linear signal amplification. In another embodiment, two or more fragments of interest are amplified in separate reaction vessels. If the amplification is specific, that is, one primer pair amplifies for one fragment of interest but not the other, detection of amplification is sufficient to distinguish between the two types - size separation would not be required.

In some embodiments, amplified nucleic acids are detected by hybridization with a specific probe. Probe oligonucleotides, complementary to a portion of the amplified target sequence may be used to detect amplified fragments. Hybridization may be detected in real time or in non-real time. Amplified nucleic acids for each of the target sequences may be detected simultaneously (i.e. in the same reaction vessel) or individually (i.e., in separate reaction vessels). In preferred embodiments, the amplified nucleic acid is detected simultaneously, using two or more distinguishably-labeled, gene-specific oligonucleotide probes, one which hybridizes to the first target sequence and one which hybridizes to the second target sequence. For sequence-modified nucleic acids, the target may be independently selected from the top strand or the bottom strand. Thus, all targets to be detected may comprise top strand, bottom strand, or a combination of top strand and bottom strand targets.

The probe may be detectably labeled by methods known in the art. Useful labels include, e.g. fluorescent dyes (e.g. Cy5®, Cy3®, FITC, rhodamine, lanthamide phosphors, Texas red, FAM, JOE, CaI Fluor Red 610®, Quasar 670®), ³²P, ³⁵S, ³H₁ ¹⁴C, ¹²⁵1, ¹³¹I, electron-dense reagents (e.g: gold), enzymes, e.g. as commonly used in an ELISA (e.g. horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase), colorimetric labels (e.g. colloidal gold), magnetic labels (e.g. DynabeadsTM), biotin, dioxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available. Other labels include ligands or oligonucleotides capable of forming a complex with the corresponding receptor or oligonucleotide complement, respectively. The label can be directly incorporated into the nucleic acid to be detected, or it can be attached to a probe (e.g. an oligonucleotide) or antibody that hybridizes or binds to the nucleic acid to be detected.

One general method for real time PCR uses fluorescent probes such as the TaqMan® probes, molecular beacons, and Scorpions™. Real-time PCR quantitates the initial amount of the template with more specificity, sensitivity and reproducibility, than other forms of quantitative PCR, which detect the amount of final amplified product. Real-time PCR does not detect the size of the amplicon. The probes employed in Scorpion™ , molecular beacon and TaqMan® technologies are based on the principle of fluorescence quenching and involve a donor fluorophore and a quenching moiety. In a preferred embodiment, the detectable label is a fluorophore. The term "fluorophore" as used herein refers to a molecule that absorbs light at a particular wavelength (excitation frequency) and subsequently emits light of a longer wavelength (emission frequency). The term "donor fluorophore" as used herein means a fluorophore that, when in close proximity to a quencher moiety, donates or transfers emission energy to the quencher. As a result of donating energy to the quencher moiety, the donor fluorophore will itself emit less light at a particular emission frequency that it would have in the absence of a closely positioned quencher moiety.

The term "quencher moiety" as used herein means a molecule that, in close proximity to a donor fluorophore, takes up emission energy generated by the donor and either dissipates the energy as heat or emits light of a longer wavelength than the emission wavelength of the donor. In the latter case, the quencher is considered to be an acceptor fluorophore. The quenching moiety can act via proximal (i.e., collisional) quenching or by Fόrster or fluorescence resonance energy transfer ("FRET"). Quenching by FRET is generally used in TaqMan® probes while proximal quenching is used in molecular beacon and Scorpion™ type probes.

In proximal quenching (a.k.a. "contact" or "collisional" quenching), the donor is in close proximity to the quencher moiety such that energy of the donor is transferred to the quencher, which dissipates the energy as heat as opposed to a fluorescence emission. In FRET quenching, the donor fluorophore transfers its energy to a quencher which releases the energy as fluorescence at a higher wavelength. Proximal quenching requires very close positioning of the donor and quencher moiety, while FRET quenching, also distance related, occurs over a greater distance (generally 1-10 nm, the energy transfer depending on R-6, where R is the distance between the donor and the acceptor). Thus, when FRET quenching is involved, the quenching moiety is an acceptor fluorophore that has an excitation frequency spectrum that overlaps with the donor emission frequency spectrum. When quenching by FRET is employed, the assay may detect an increase in donor fluorophore fluorescence resulting from increased distance between the donor and the quencher (acceptor fluorophore) or a decrease in acceptor fluorophore emission resulting from decreased distance between the donor and the quencher (acceptor fluorophore).

Suitable fluorescent moieties include the following fluorophores known in the art: 4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives (acridine, acridine isothiocyanate) Alexa Fluor® 350, Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes), 5-(2'- aminoethyl)aminonaphthalene-l -sulfonic acid (EDANS), 4- amino-N-[3- vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N- (4-anilino-l- naphthyl)maleimide, anthranilamide, Black Hole Quencher TM (BHQTM) dyes (biosearch Technologies), BODIPY® R-6G, BOPIPY® 530/550, BODIPY® FL, Brilliant Yellow , coumarin and derivatives (coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7- amino-4-trifiuoromethylcouluarin (Coumarin 151)), Cy2®, Cy3®, Cy3.5®, Cy5®, Cy5.5®, cyanosine, 4",6-diaminidino-2-phenylindole (DAPI), 5', 5"- dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red), 7-diethylamino-3 -(4¹- isothiocyanatophenyl)-4-methylcoumarin, diethylenetriamine pentaacetate, 4,4'- diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid, 4,4'- diisothiocyanatostilbene-2,2'- disulfonic acid, 5-[dimethylamino]naphthalene-l-sulfonyl chloride (DNS, dansyl chloride), 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL), 4- dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC), EclipseTM (Epoch Biosciences Inc.), eosin and derivatives (eosin, eosin isothiocyanate), erythrosin and derivatives (erythrosin B, erythrosin isothiocyanate), ethidium, fluorescein and derivatives (5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5.'-dichloro-6- carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), hexachloro-6- carboxyfluorescein (HEX), QFITC (XRITC), tetrachlorofluorescein (TET)), fluorescamine, IRI 44, IRI 446, Malachite Green isothiocyanate, 4-methylumbelliferone, ortho cresolphthalein, nitrotyrosine, pararosaniline, Phenol Red, B-phycoerythrin, R-phycoerythrin, o- phthaldialdehyde, Oregon Green®, propidium iodide, pyrene and derivatives (pyrene, pyrene butyrate, succinimidyl 1 -pyrene butyrate), QSY® 7, QSY® 9, QSY® 21, QSY® 35 (Molecular Probes), Reactive Red 4 (Cibacron® Brilliant Red 3B-A), rhodamine and derivatives (6- carboxy- X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine green, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 , sulfonyl chloride derivative of sulforhodamine 101 (Texas Red)), N,N,N',N'-tetramethyl-6- carboxyrhodamine (TAMRA), tetramethyl rhodamine, tetramethyl rhodamine isothiocyanate (TRITC), riboflavin, rosolic acid, terbium chelate derivatives.

Other fluorescent nucleotide analogs can be used, see, e.g. Jameson, 278 Meth. Enzymol. 363-390 (1997); Zhu, 22 Nucl. Acids ReS. 3418-3422 (1994). US 5,652,099 and US 6,268,132 also describe nucleoside analogs for incorporation into nucleic acids, e.g. DNA and/or RNA, or oligonucleotides, via either enzymatic or chemical synthesis to produce fluorescent oligonucleotides. US 5,135,717 describes phthalocyanine and tetrabenztriazaporphyrin reagents for use as fluorescent labels. The detectable label can be incorporated into, associated with or conjugated to a nucleic acid. Label can be attached by spacer arms of various lengths to Reduce potential steric hindrance or impact on other useful or desired properties. See, e.g. Mansfield, 9 MoI. Cell. Probes 145-156 (1995). Detectable labels can be incorporated into nucleic acids by covalent or non-covalent means, e.g. by transcription, such as by random-primer labeling using Klenow polymerase, or nick translation, or amplification, or equivalent as is known in the art. For example, a nucleotide base is conjugated to a detectable moiety, such as a fluorescent dye, and then incorporated into nucleic acids during nucleic acid synthesis or amplification.

With Scorpion™ probes, sequence-specific priming and PCR product detection is achieved using a single molecule. The Scorpion™ probe maintains a stem-loop configuration in the unhybridized state. The fluorophore is attached to the 5' end and is quenched by a moiety coupled to the 3' end, although in suitable embodiments, this arrangement may be switched. The 3' portion of the stem also contains sequence that is complementary to the extension product of the primer. This sequence is linked to the 5' end of a specific primer via a non-amplifiable monomer. After extension of the Scorpion™ primer, the specific probe sequence is able to bind to its complement within the extended amplicon thus opening up the hairpin loop. This prevents the fluorescence from being quenched and a signal is observed. A specific target is amplified by the reverse primer and the primer portion of the Scorpion™, resulting in an extension product. A fluorescent signal is generated due to the separation of the fluorophore from the quencher resulting from the binding of the probe element of the Scorpion™ to the extension product.

TaqMan® probes (Heid, et al, Genome Res 6: 986-994, 1996) use the fluorogenic 5¹ exonuclease activity of Taq polymerase to measure the amount of target sequences in cDNA samples. TaqMan® probes are oligonucleotides that contain a donor fluorophore usually at or near the 5' base, and a quenching moiety typically at or near the 3' base. The quencher moiety may be a dye such as TAMRA or may be a non- fluorescent molecule such as 4- (4 -dimethylaminophenylazo) benzoic acid (DABCYL). See Tyagi, et al., 16 Nature Biotechnology 49-53 (1998). When irradiated, the excited fluorescent donor transfers energy to the nearby quenching moiety by FRET rather than fluorescing. Thus, the close proximity of the donor and quencher prevents emission of donor fluorescence while the probe is intact.

TaqMan® probes are designed to anneal to an internal region of a PCR product. When the polymerase (e.g. reverse transcriptase) replicates a template on which a TaqMan® probe is bound, its 5' exonuclease activity cleaves the probe. This ends the activity of the quencher (no FRET) and the donor fluorophore starts to emit fluorescence which increases in each cycle proportional to the rate of probe cleavage. Accumulation of PCR product is detected by monitoring the increase in fluorescence of the reporter dye (note that primers are not labeled). If the quencher is an acceptor fluorophore, then accumulation of PCR product can be detected by monitoring the decrease in fluorescence of the acceptor fluorophore.

In a suitable embodiment, real time PCR is performed using any suitable instrument capable of detecting fluorescence from one or more fluorescent labels. For example, real time detection on the instrument (e.g. a ABI Prism® 7900HT sequence detector) monitors fluorescence and calculates the measure of reporter signal, or Rn value, during each PCR cycle. The threshold cycle, or Ct value, is the cycle at which fluorescence intersects the threshold value. The threshold value is determined by the sequence detection system software or manually.

In some embodiments, melting curve analysis may be used to detect an amplification product. Melting curve analysis involves determining the melting temperature of a nucleic acid amplicon by exposing the amplicon to a temperature gradient and observing a detectable signal from a fluorophore. Melting curve analysis is based on the fact that a nucleic acid sequence melts at a characteristic temperature called the melting temperature (Tm), which is defined as the temperature at which half of the DNA duplexes have separated into single strands. The melting temperature of a DNA depends primarily upon its nucleotide composition. Thus, DNA molecules rich in G and C nucleotides have a higher Tm than those having an abundance of A and T nucleotides.

Where a fluorescent dye is used to determine the melting temperature of a nucleic acid in the method, the fluorescent dye may emit a signal that can be distinguished from a signal emitted by any other of the different fluorescent dyes that are used to label the oligonucleotides. In some embodiments, the fluorescent dye for determining the melting temperature of a nucleic acid may be excited by different wavelength energy than any other of the different fluorescent dyes that are used to label the oligonucleotides. In some embodiments, the second fluorescent dye for determining the melting temperature of the detected nucleic acid is an intercalating agent. Suitable intercalating agents may include, but are not limited to SYBR™ GREEN idye, SYBR dyes, Pico Green, SYTO dyes, SYTOX dyes, ethidium bromide, ethidium homodimer-1 , ethidium homodimer-2, ethidium derivatives, acridine, acridine orange, acridine derivatives, ethidium-acridine heterodimer, ethidium monoazide, propidium iodide, cyanine monomers, 7-aminoactinomycin D, YOYO-I, TOTO-I, YOYO-3, TOTO-3, POPO-I, BOBO-I, POPO-3, BOBO-3, LOLO-I, JOJO-I₁ cyanine dimers, YO-PRO-I, TO- PRO-I, YO- PRO-3, TO-PRO-3, TO-PRO-5, PO-PRO-I₁ BO-PRO-I, PO-PRO-3, BO- PRO-3, LO-PRO-I, JO-PRO-I₁ and mixture thereof. In suitable embodiments, the selected intercalating agent is SYBR™ GREEN dye.

By detecting the temperature at which the fluorescence signal is lost, the melting temperature can be determined. In the disclosed methods, each of the amplified target nucleic acids may have different melting temperatures. For example, each of these amplified target nucleic acids may have a melting temperature that differs by at least about 1⁰C, more preferably by at least about 2⁰C, or even more preferably by at least about 4⁰C from the melting temperature of any of the other amplified target nucleic acids. The melting temperature(s) of the HCV targets from the respective amplification product can confirm the presence or absence of HCV in the sample.

To minimize the potential for cross contamination, reagent and mastermix preparation, specimen processing and PCR setup, and amplification and detection are all carried out in physically separated areas.

Sample Collection and Bisulphite Treatment

HCV RNA samples were obtained from Acrometrix (OptiQual HCV high positive control), or BBI diagnostics (HCV linearity panel PHW804 and Worldwide HCV genotype panel WWHV302) and purified with the QiaAmp Ultrasens Viral purification kit (Qiagen) according to the manufacturer's instructions. Excess clinical samples submitted to a local hospital for HCV testing, using either the Versant HCV RNA 3.0 bDNA assay or Cobas Monitor Amplicor HCV 2.0 assay, were de-identified, blinded and made available for testing in accordance with appropriate ethical guidelines and purified as above. Samples were bisulphite treated using a modified Methyleasy™ Xceed kit (Human Genetic Signatures, Sydney, Australia) according to the manufacturer's instructions with the exception that the samples were purified by isopropanol precipitation, prior to desulphonation in a proprietary reagent. A total of 11 μl of the converted HCV RNA samples were reverse transcribed with iScript reverse transcriptase (Biorad) using random primers according to the manufacturer's instructions. One tenth of the cDNA was then subjected to either end-point or real-time PCR amplification with primers (and probe) directed towards a region that originally encoded the 5'UTR of the HCV genome. End-point PCR was performed in 50 μl reactions containing 1.5X Promega master mix, 100 ng each of forward and reverse primers and cycled at 95°C, 3 mins; [95⁰C, 10 sees; 53⁰C, 1 min; 68⁰C, 1 min] x40 in a Hybaid PX2 thermal cycler. One third of the PCR product was electrophoresed on a 2% precast agarose e-gel (Invitrogen). Real-time PCR was performed in 25 μl reactions using 1x Sigma Jumpstart master mix, 50 ng each of forward and reverse primers, MgCI₂ to 5 mM, 400 nM FAM-labelled probe and cycled at 95⁰C, 10 mins; [95⁰C, 10 sees; 53°C, 90 sees; 6O⁰C, 30 sees] x50 in a Corbett 6000 Rotor Gene.

Assay sensitivity, specificity, positive predictive value and negative predictive value were determined using standard methods [Moskowitz CS, Pepe MS. Comparing the predictive values of diagnostic tests: sample size and analysis for pair study designs. Clin Trials 2006; 3:272-279].

Comparison of Other Commercially Available Kits to Bisulphite Convert HCV RNA

Purified HCV RNA of genotype 1a (Acrometrix OptiQual HCV high positive control) was simultaneously bisulphite converted using the modified version of MetriylEasy™ Xceed and a number of other commercially available bisulphite conversion kits, namely EpiTect® Bisulfite kit (Qiagen), Methylamp™ DNA modification kit (Epigentek), EZ DNA Methylation-Direct™ kit (Zymo Research) and methylSEQr™ Bisulfite Conversion kit (Applied Biosystems), according to the manufacturer's instructions. Equivalent amounts of converted RNA were reverse transcribed with iScript reverse transcriptase (Biorad) and 1/10^th of the cDNA was PCR amplified using primers specific for bisulphite converted 5' UTR of HCV as above.

Table 1. HCV simplified primers

K)

90

K)

O

W

K)

Abbreviations:

R=A + G₁ Y= C + T, M=A + C, K=G + T, S=G + C, W=A + T, H=A + T + C,

B=G+T + C, D=G+A + T, N=G + A + T + C, 5=LNAA, 6= LNA G, 7=LNA C, 8=LNAT

(sequences 5'-3')

W

Ul

Table 4. Preferred HCV probe

LNA Probe 8 UTR [FAM]- SEQ ID NO: 103

TC[+c]AC[+a]AA[+c]CA[+c]TA[+t]AA[+c]TC[+t]CC-

[BHQ-1]

RESULTS

HCV Molecular Targets

Figure 1 shows the genome organisation of the HCV virus. Regions of the HCV genome were selected as potential targets for molecular detection using simplification of the RNA genome into 3-base format as defined herein.

The present inventors have devised a number of other primer sets for the detection of HCV which are listed in Table 1 showing a complete list of all the primers that the present inventors have designed that cover the simplified genome of all major HCV types (1a, 1b, 1b/2k, 2a, 2b, 2c, 2k, 3a, 3b, 3k, 4a, 5a, 6a, 6g, 6b, 6d, 6h and 6k).

Table 3 and Table 4 contain the optimal wet tested primer and probe sequences for the HCV assay exemplified in the examples below.

Nucleic Acid Simplification Strategy

An example of how simplification can be applied to the detection of different HCV strains is shown in Tables 5, 6, 7 and 8. A simplification of a forward and reverse primer targeted to the NS3 region of HCV in which the forward primer shows a 99.8% reduction in primer degeneracy and the reverse primer shows a 98% reduction in primer degeneracy after the simplification process.

Table 5. Hepatitis Screening Primer Forward (Genomic DNA)

NS3 region bases 4726-4751 GENOMIC RNA SEQ ID NO:

Hepatitis C 1a TCGATTTCAGCCTTGACCCTACCTTT 104 Hepatitis C 1b TCGATTTCAGCTTGGACCCTACCTTC 105 Hepatitis C 1b/2k TCGATTTCAGCTTGGATCCCACCTTC 106 Hepatitis C 1c TCGACTTCAGCCTAGACCCTATATTC 107 Hepatitis C 2a TAGACTTCAGCCTGGACCCCACCTTC 108 Hepatitis C 2b TTGACTTTAGCCTAGACCCGACCTTT 109 Hepatitis C 2c TGGACTTCAGTTTAGACCCTACTTTT 110 Hepatitis C 2k TCGACTTCAGTTTGGACCCCACTΠT 111 Hepatitis C 3a TCGACTTCAGCCTGGACCCCACCTTT 112 Hepatitis C 3b TCGACTTCAGTCTAGACCCCACTTTC 113 Hepatitis C 3k TTGACTTTAGCCTTGACCCTACGTTT 114 Hepatitis C 4a TTGACTTCAGCTTGGACCCCACCTTC 115 Hepatitis C 5a TGGATTTCAGTCTGGATCCCACCTTT 116 Hepatitis C 6a TGGATTTCAGCTTGGACCCAACATTT 117 Hepatitis C 6g TTGACTTCAGCCTGGATCCCACCTTC 118 Hepatitis C 6b TAGACTTCAGCTTGGACCCAACTTTT 119 Hepatitis C 6d TTGATΠTAGCCTGGACCCCACCTTC 120 Hepatitis C 6h TGGACTTTAGTCTCGACCCGACATTT 121 Hepatitis C 6k TAGACTTCAGCTTGGACCCTACATTC 122

Consensus TNGAYTTYAGYYTNGAYCCNAYNTTY 123 37,768 Possible Primer Combinations 58% homology over 26 bases Table 6. Hepatitis Screening Primer Forward (Simplified RNA)

NS3 region bases 4726-4751

SIMPLIFIED RNA SEQ ID NO:

Hepatitis C 1a TTGATT TTAGTl TTGATT TTAi 1 1 1 1 124

Hepatitis C 1b TTGATT TTAGTI TGGATT TTAl I I I I 125

Hepatitis C 1b/2k TTGATT TTAGTTTGGATT TTAl I I I I 126

Hepatitis C 1 c TTGATT TTAGTTTAGATT TTATATTT 127

Hepatitis C 2a TAGATT TTAGTl TGGATT TTAl I I I I 128

Hepatitis C 2b TTGATT TTAGTI TAGATTTGA I I I I I 129

Hepatitis C 2c TGGATT TTAGT ΓTAGATI TTAl I I I I 130

Hepatitis C 2k TTGATT TTAGTI TGGATT TTAI I I I I 131

Hepatitis C 3a TTGATT TTAGTl TGGATT TTAI I I I I 132

Hepatitis C 3b TTGATT TTAGTI TAGATT TTAl I I I I 133

Hepatitis C 3k TTGATT TTAGTI TTGATT TTATGTTT 134

Hepatitis C 4a TTGATT TTAGTI TGGATT TTAI I I I I 135

Hepatitis C 5a TGGATT TTAGT ΓTGGAT ΠTAI I I I I 136

Hepatitis C 6a TGGATT TTAGTTTGGAT ΓTAATATTT 137

Hepatitis C 6g TTGATT TTAGTTTGGATT TTAI I l I l 138

Hepatitis C 6b TAGATT TTAGTI ΓTGGATTTAAI M M 139

Hepatitis C 6d TTGATT TTAGTI TGGATT TTAi 1 1 1 1 140

Hepatitis C 6h TGGATT TTAGT ΠTGATTTGATATTT 141

Hepatitis C 6k TAGATT TTAGTI TGGATI TTATATTT 142

Consensus TDGATT TTAGTTTDGATI TDATDTTT 143

81 Possible Primer Combinations 85% homology over 26 bases

Using simplification resulted in a 99.8% reduction in primer degeneracy compared to the non-converted genomic primer. Table 7. Hepatitis Screening Primer Reverse (native RNA) NS3 region bases 4994-5016 GENOMIC RNA SEQ ID NO:

Hepatitis C 1a CCAGGACCATCTTGAATTTTGGG 144 Hepatitis C 1b CCAGGATCATCTGGAGTTCTGGG 145 Hepatitis C 1b/2k CCAGGACCATCTGGAGTTCTGGG 146 Hepatitis C 1c CCAGGACCACTTGGAGTTCTGGG 147 Hepatitis C 2a CCAAGACCATCTTGAGTΠTGGG 148 Hepatitis C 2b TCAAGACCACCTGGAGTTCTGGG 149 Hepatitis C 2c CCAAGACCACCTGGAATTCTGGG 150 Hepatitis C 2k TCAGGACCATTTAGAGTTCTGGG 151 Hepatitis C 3a CCAAGACCATTTAGACTΠTGGG 152 Hepatitis C 3b CCAAGACCACCTAGACTTCTGGG 153 Hepatitis C 3k CCAAGACCATCTGGAGTTCTGGG 154 Hepatitis C 4a CCAAGACCATCTGGAATTCTGGG 155 Hepatitis C 5a TCAAGACCACCTGGAATΠTGGG 156 Hepatitis C 6a CCAAGACCACCTGGAATΠTGGG 157 Hepatitis C 6g CCAGGATCATCTAGAGTTCTGGG 158 Hepatitis C 6b CCAAGACCACCTGGAGTTTTGGG 159 Hepatitis C 6d CCAAGACCACCTCGAGTTTTGGG 160 Hepatitis C 6h CCAAGACCATCTTGAGTTTTGGG 161 Hepatitis C 6k TCAAGACCACCTGGAATTTTGGG 162

Consensus YCARGAYCAYYTNGAVTTYTGGG 163 Rev Complement CCCARAABTCNARRTGRTCYTGR 164 768 Possible Primer Combinations 65% homology over 23 bases Table 8. Hepatitis Screening Primer Reverse (simplified RNA)

NS3 region bases 4994-5016

SIMPLIFIED RNA SEQ ID NO:

Hepatitis C 1 a TTAGGATTATTTTGAATT TTGGG 165

Hepatitis C 1b TTAGGATTATTTGGAGTI TTGGG 166

Hepatitis C 1b/2k TTAGGATTATTTGGAGΠ TTGGG 167

Hepatitis C 1T TTAGGATTATTTGGAGTI TTGGG 168

Hepatitis C 2a TTAAGATTATTTTGAGTT TTGGG 169

Hepatitis C 2b TTAAGATTATTTGGAGTT TTGGG 170

Hepatitis C 2T TTAAGATTATTTGGAATT TTGGG 171

Hepatitis C 2k TTAGGATTATTTAGAGTT TTGGG 172

Hepatitis C 3a TTAAGATTATTTAGATTT ITGGG 173

Hepatitis C 3b TTAAGATTATTTAGATTT ITGGG 174

Hepatitis C 3k TTAAGATTATTTGGAGTT TTGGG 175

Hepatitis C 4a TTAAGATTATTTGGAATT TTGGG 176

Hepatitis C 5a TTAAGATTATTTGGAATT TTGGG 177

Hepatitis C 6a TTAAGATTATTTGGAATT TTGGG 178

Hepatitis C 6g TTAGGATTATTTAGAGTT TTGGG 179

Hepatitis C 6b TTAAGATTATTTGGAGTT TTGGG 180

Hepatitis C 6d TTAAGATTATTTTGAGTT TTGGG 181

Hepatitis C 6h TTAAGATTATTTTGAGTT TTGGG 182

Hepatitis C 6k TTAAGATTATTTGGAATT TTGGG 183

Consensus TTARGATTATTTDGADTT TTGGG 184

Rev Complement CCCAAAAHTCHAAATAATCYTAA 185

18 Possible Primer Combinations 87% homology over 23 bases

Using simplification resulted in a 98% reduction in primer degeneracy compared to the non-converted genomic primer. Figure 2 shows a schematic representation of each of the primer sets and details the region of the HCV genome to which they are targeted.

HCV Assay Sensitivity

A dynamic range of concentrations from 9.2 IU to 1 500 000 IU/ml were purified from Acrometrix Optiqual HCV high positive control (genotype 1a), bisulphite converted, reverse transcribed and 1/10^th of the cDNA subjected to real time PCR. The results are presented in Figure 3 and show that the preferred assay was able to sensitively detect down to 0.92 IU HCV/PCR (-2.5 copies [Saldanha J, Heath A, Lelie N et al. Calibration of HCV working reagents for NAT assays against the HCV international standard. Vox Sang 2000; 78:217-22]), purified from 9.2 IU/ml of serum, which is equivalent to, or better than, the level of detection of other commercially available HCV diagnostic assays. Furthermore, the assay demonstrated almost perfect linearity in HCV detection over the range of 150 000 to 0.92 IU seeded into the PCR reaction (R² = 0.98961), with only a slight deviation at the upper end of the concentrations tested. Importantly, the PCR primers used to specifically detect bisulphite converted HCV do not amplify native HCV sequence, even when more than 1 million IU are added to the PCR indicating that the HCV present in the sample has been 100% converted by the bisulphite reagent maximising the assay sensitivity.

Comparison of Assay with Other Bisulphite Conversion Kits

The RNA simplification assay was compared with four other commercial kits specific for bisulphite conversion of nucleic acids. A range of concentrations of HCV RNA were bisulphite converted according to the manufacturer's instructions and then reverse transcribed using iScript. Equivalent amounts of cDNA from each assay were PCR amplified using bisulphite-specific primers and the results are shown in Figure 4 and Table 9. It can be clearly seen that, of the five assays tested, only the preferred RNA conversion assay was able to successfully convert and maintain the integrity of HCV RNA. All other available kits did not yield positive signals even at the highest input RNA concentration. Furthermore, the preferred RNA (or DNA) conversion assay is quicker than any of the leading competitors. Table 9. Comparison of the steps of each assay and overall time taken to bisulphite convert nucleic acid.

Desulphonation

Temp/time Temperature Time Time - whole bisulphite process conversion methylSEQr™ 50⁰C, 16 hrs Room temp 5 min 18.5 hours

Methylamp™ 98⁰C, 6 min Room temp 10 min 3 hours

65⁰C, 90 min

EpiTect® 99⁰C, 5 min; Room temp 15 min 6 hours 6O⁰C, 25 min

99⁰C, 5 min

6O⁰C, 85 min

99⁰C, 5 min

6O⁰C, 175 min

Methyl Easy™ 7O⁰C, 20 min 40^oC 5 min 2-2.5 hours Xceecf

EZ DNA Methylation- 98⁰C, 8 min Room temp 20 min 4.5 hours Direct™ 64⁰C, 3.5 hrs

A modified version of MethylEasy Xceed was used as indicated in Methods.

Assay Linearity

The samples used to determine the assay sensitivity were diluted from a highly concentrated stock (2 500 000 IU/ml) prior to purification. In order to confirm the sensitivity and linearity at the lower range of concentrations, HCV RNA was also purified from an HCV RNA linearity panel (PHW804; BBI diagnostics), bisulphite converted, reversed transcribed and subjected to real time PCR amplification using primers and probes specifically designed to amplify and detect bisulphite converted HCV. The results are shown in Figure 5 and further demonstrate the linearity (R² = 0.99894) and sensitivitv of the preferred HCV simDlification assav. HCV Assay Specificity

The experiments above were performed with HCV genotype 1a and thus we wanted to ensure that our assay detected all HCV genotypes from diverse geographical locations. In order to test this, we purified HCV RNA from a Worldwide HCV genotype panel (WWHV302, BBI diagnostics), bisulphite converted and then PCR amplified with the same primer set for all genotypes. The results are shown in Figure 6 and Table 10 and it can be clearly seen that all genotypes amplify equally. Sample 5 did not amplify but it is likely that the actual level of HCV seeded into the PCR is below the level of detection of this assay. A further set of experiments were performed whereby each genotype sample (except sample 5) were serially diluted and PCR amplified on at least three occasions on separate days and all genotypes were consistently detectable at the level of 10 copies (~4 IU) or less.

Table 10. Quantitation and genotyping results of Worldwide performance panel WWHV 302 (BBI diagnostics)

HCV Genotyping HCV quantitation

Member Inno-

Siemens genetics Roche Cobas PCR Siemens Versant HCV Quantity per PCR^b

Trugene INNO-LIPA 3.0

ID# Origin IU/mL c/mL^a IU/mL c/mL^a IU copies

01 China 1 b 1 b 1.3x10⁵ 3.1x10⁶ 1.2x10⁶ 6.6x10⁶ 8.6x10² 2.1x10⁴

02 Thailand 1 1a 4.3x10⁵ 1.1 x10⁶ 4.3x10⁵ 2.3x10⁶ 2.8x10³ 7.3x10³

03 S Africa 1 b 1 b 1.4x10⁵ 4.0x10⁵ 7.0x10⁴ 3.7x10⁵ 9.3x10² 2.6x10³

04 China 2a 2a/2c 9.1 x10⁵ 2.5x10⁶ 5.3x10⁵ 2.7x10⁶ 6.0x10³ 1.7x10⁴

05 USA 2a 2a/2c 1.1 x10³ 2.9x10³ <615^C <3200 7.3 19.2

06 China 3b 3b 2.4x10⁶ 6.6x10⁶ 1.7x10⁶ 8.6x10⁶ 1.6x10⁴ 4.4x10⁴

07 USA 3a 3a 3.0x10⁵ 8.2x10⁵ 9.0x10⁴ 4.7x10⁵ 2.0x10³ 5.4x10³

08 Thailand 3a 3a 7.2x10⁵ 1.0x10⁶ 4.9x10⁵ 2.5x10⁶ 4.8x10³ 6.6x10³

09 Egypt 4a 4 3.8x10⁵ 1.0x10⁶ 1 .7x10⁵ 8.7x10⁵ 2.5x10³ 6.6x10³

10 Egypt 4 4 3.2x10⁴ 8.8x10⁴ 2.4x10⁴ 1.2x10⁵ 2.1x10² 8.5x10²

11 Egypt 4a 4 1.4x10⁵ 3.7x10⁵ 8.6x10⁴ 4.5x10⁵ 9.3x10² 2.5x10³

12 Unknown 5a 5a 2.4x10⁵ 6.5x10⁵ 8.4x10⁴ 4.4x10⁴ 1 .6x10³ 4.3x10³

13 S Africa 5a 5a 2.0x10" 5.5x10⁴ 8.4x10³ 4.4x10⁴ 1.3x10² 3.6x10²

14 Unknown 6a 6a 6.1x10⁵ 1.6x10⁶ 1.4x10⁵ 7.1x10⁵ 4.0x10³ 1.1x10⁴

15 USA na na <600^c na <615^C <3200 <4 na

Notes for Table 10: a copies/mL b Quantity of HCV added per PCR reaction was calculated taking into account the volume extracted, bisulphite converted and then added to the PCR and is based on quantitation values by Roche Cobas Amplicor which are in the region of 1.5-4.5 times greater than the values for Siemens Versant HCV3.0 quantitation for the same samples. Data taken from information sheet sent with worldwide HCV performance panel (WWHV302). c Quantity of HCV RNA is below the limit of detection for the respective assays.

Blind-Testing of HCV Assay on Clinical Samples

Having determined that the assay worked sensitively and specifically on all the major genotypes of HCV available, we blindly tested the optimised assay on 413 clinical samples collected over a number of years and then compared our results to those previously obtained by the testing facility. Table 11 shows the results of the preferred assay according to the present invention giving similar results to the standard assays which include Siemens Versant HCV RNA TMA assay for qualitative assessment (LOD 29 Ill/ml) and either Siemens Versant HCV RNA 3.0 (bDNA) assay (LOD 615 IU/ml) or Roche Cobas Ampliprep Taqman assay (15 IU/ml) for quantitative assessment. Genotyping was performed using lnnogenetics INNO-LIPA assay. According to the previous clinical results 239 (57.9%) of the samples were positive for HCV, whereas the preferred assay determined 237 (57.4%) of the samples to be positive.

Relative to the previous clinical results, the preferred assay demonstrated a sensitivity of 94.5%, specificity of 97.0%, positive predictive value of 97.8% and negative predictive value of 92.4%. Table 11. Determination of preferred assay sensitivity and specificity compared to standardised assays

Hospital results

+ IND Total

+ 224 5 8 237

HGS results 13 159 1 173 IND 2 0 1 3

Total 239 164 10 413

DISCUSSION

Traditionally, sodium bisulphite conversion of DNA has been used as an agent in methylation studies to determine the methylation status of cytosines in a given gene or promoter region to be used as early indicators for a number of diseases, particularly cancers. Treatment of nucleic acids with sodium bisulphite results in unmethylated cytosines being converted to thymine via a uracil intermediate, whilst methylated cytosines are unchanged. Such a treatment on a genome that is comprised of mostly unmethylated cytosines, for example, viral or bacterial genomes, effectively reduces the 4 base genome to a 3 base genome comprising only adenine, thymine and guanine. The present applicant has pioneered and adapted the use of the simplification technology to the diagnosis of infectious diseases and this is the first report of the successful bisulphite conversion of viral RNA.

Table 1 demonstrates how the preferred simplification strategy can be effectively used to drastically reduce the consensus sequence heterogeneity in originally divergent sequences. In the example given, there is a 99.7 % simplification of the original divergent sequences, which highlights the usefulness of simplification to reduce the sequence complexity and enable easier primer and probe design for the amplification and detection of multiple organisms or strains. This has been practically proven too in the detection of gram positive and negative bacteria as well as DNA and RNA viruses.

We chose the 5' UTR region of the HCV genome in order to determine initially if the method was practical, of clinical utility and also to allow direct comparison of the simplified method to other commercially available kits that target this region. The simplification method however has the advantage over standard methods in that it creates regions of similarity that were not present in the original genome opening up the possibility of utilising other unique regions not previously available for pathogen detection.

Using a modified version of the Methyleasy™ Xceed kit, redesigned specifically for RNA conversion, a range of concentrations of HCV RNA were bisulphite converted and the results are presented in Figure 3. The preferred RNA assay was able to sensitively detect down to 0.92 IU HCV/PCR (-2.5 copies), purified from 9.2 IU/ml of serum, which is equivalent or better than the level of detection of other available HCV diagnostic assays. Furthermore, the assay demonstrated almost perfect linearity in HCV detection over the range of 150 000 to 0.92 IU seeded into the PCR reaction (R² = 0.98961 ), with only a slight deviation at the upper end of the concentrations tested. This result was reproduced at the lower concentrations of viral input when a standardised set of samples from the linearity panel (BBI) were converted and amplified (Figure 5; R² = 0.99894) and further demonstrates the linearity and sensitivity of the preferred HCV assay. In addition, the bisulphite PCR assay did not show any significant inhibition even when clinical samples containing in excess of 700 000 IU were added into the reaction. Importantly, the PCR primers used to specifically detect bisulphite converted HCV do not amplify native HCV sequence, even when more than 1 million IU are added to the PCR indicating complete conversion of HCV molecules in the sample leading to maximum assay sensitivity.

To our knowledge, with one exception, no other bisulphite conversion kit has been specifically tested for its ability to convert RNA. We therefore tested four commercially available bisulphite conversion kits, including EpiTect® Bisulfite kit (Qiagen), Methylamp™ DNA modification kit (Epigentek), EZ DNA Methylation-Direct™ kit (Zymo Research) and methylSEQr™ Bisulfite Conversion kit (Applied Biosystems) to determine the efficiency of RNA conversion. Converted HCV RNA was reverse transcribed and PCR amplified in the same manner as for RNA converted using the modified MethylEasy™ Xceed method and the results demonstrate that only the preferred method produced any amplification products and was sensitive down to as few as 2.5 copies/ PCR (~1 IU; Figure 4 and Table 9). Using a modified protocol, the EpiTect® bisulfite kit has been previously demonstrated to convert tRNA, 16S rRNA and 28S rRNA. However a minimum of 10 ng cDNA was required in order to generate a PCR product which equates to 2.48 x 10¹¹ molecules of tRNA and suggests that the majority of the RNA had been degraded during the bisulphite conversion procedure. Conversely, the preferred assay is exquisitely sensitive and can detect 2.5 copies of HCV cDNA via PCR₁ derived from 25 copies (9.2 IU) of HCV RNA in the bisulphite conversion, indicating that the level of RNA degradation is negligible in this novel assay.

In addition, it was noted that the alternative bisulphite conversion protocols took considerably longer to perform than the preferred method, which is another advantage of the Human Genetic Signatures modified Xceed™ protocol. The modified method currently involves a precipitation step to clean up the converted RNA and remove any residual bisulphite reagent.

In order to ensure that the preferred HCV simplification assay detected all HCV genotypes we tested HCV RNA purified from a Worldwide HCV genotype panel (WWHV302, BBI diagnostics). It can be clearly seen that all genotypes amplify equally (Figure 6), with the exception of sample 5 (genotype 2a/c) that was also below the limit . of detection for the Versant HCV 3.0 assay. Sample 4 is also of genotype 2a/c indicating 2a/c is readily detected by the preferred assay but sample 5 was possibly degraded or below the LOD of the preferred assay due to the fact that only a small amount of sample was purified and then only 1/10^th of the sample was added to the PCR reaction. Further experiments demonstrated that all genotypes were consistently detectable at 10 copies (~4IU) or less per PCR. The samples represented in this panel are from diverse geographical locations including China, Egypt, S Africa, Thailand and USA, and the results indicate that geographically distinct isolates will be amplified equally well by our assay.

Using the preferred HCV RNA simplification assay to determine the presence or absence of HCV in serum samples derived from suspected cases of HCV demonstrated the clinical utility of this assay. The samples were tested blind and then later correlated to the results previously obtained by the testing laboratory. The samples were tested using a range of commercially available tests including Versant HCV RNA TMA assay for qualitative assessment (Siemens; LOD 29 IU/ml) and either Versant HCV RNA 3.0 (bDNA) assay (Siemens; LOD 615 IU/ml) or Cobas Ampliprep Taqman assay (Roche; LOD 15 IU/ml) for quantitative assessment.

Of the 413 clinical samples, 239 (57.9%) that were originally tested positive for HCV, 164 (39.7%) negative and 10 (2.4%) were indeterminate (Table 9). For the preferred assay, 237 (57.4%) tested positive, 173 (41.9%) negative and 3 (0.7%) were indeterminate. The distribution of HCV genotypes in the clinical samples was fairly typical of the distribution found in Australia. The samples supplied had been in storage at -20⁰C for at least one year and therefore it is quite possible that a number may have degraded somewhat in that time. In order to confirm the results for the preferred assay in those samples that were discordant with the previous results, an aliquot of the native, non-converted sample was also checked by. PCR specific for native sequence. In our experience, PCR of the native sequence is always very reliable down to sub-5 IU/PCR and served as an additional control for the RNA conversion process.

There were 5 samples that were positive by the preferred assay but negative by previous testing. These samples were all positive by native PCR and upon further investigation it was noted that 4 of these samples were genotype 3a and determined to be below the LOD of the Versant HCV RNA 3.0 (bDNA) assay. The fifth sample had no genotype or quantitative data available. Therefore it would seem that the preferred assay has improved sensitivity over the Versant HCV RNA 3.0 (bDNA) assay and/or that the latter has a lower sensitivity for samples containing HCV genotype 3a. Indeed, it has been previously reported that the Versant HCV RNA 3.0 (bDNA) assay does have a markedly lower detection or quantitation rate for genotypes 2b, 2c and 3a relative to genotype 1a [Elbeik T, Surtihadi J, Destree M et al. Multicentre evaluation of the performance characteristics of the Bayer Versant HCV RNA 3.0 assay (bDNA). J Clin Micro 2004; 42: 563-569; Sarrazin C, Gartner BC, Sizmann D et al. Comparison of conventional PCR with Real-Time PCR and branched DNA-based assays for Hepatitis C virus RNA quantification and clinical significance for genotypes 1 to 5. J Clin Micro 2006; 44: 729-737]. Furthermore, in this study, we have demonstrated that the preferred assay can reliably detect all genotypes down to at least 4 IU per PCR, equating to 40 IU/mL, which is considerably more sensitive than the Versant HCV RNA 3.0 (bDNA) assay.

There were 10 samples that were indeterminate according to prior results, eight of which tested positive by the preferred assay and were also positive by native PCR, confirming that the results are accurate. A further sample tested negative by the preferred assay and was also negative by native PCR indicating possible degradation of this sample during storage or that this sample contained PCR inhibitors. It is well recognised that serum or plasma samples can often contain PCR inhibitors such as heme and its breakdown products, leukocyte DNA, immunoglobulin G, fat or lactoferrin. The addition of BSA, gp32 or betaine to the PCR reaction may help overcome this inhibition and the inclusion of an internal positive control would confirm the failure of the PCR or the negative status of a sample.

Two serum samples that were positive for HCV according to previous results were indeterminate by the preferred assay due to very faint bands following gel electrophoresis, which could not be confidently called positive. However, both these . samples were of very low titre, according to quantitation results, and contained less than 100 μl of sample negating our ability to amplify these by native PCR or to retest these samples. In a clinical setting, greater sample volume would be available for primary analysis, and patient samples could be re-collected in the case of indeterminate results.

For the 13 samples positive by initial screening but negative by the preferred method, 9 of these were repeatedly negative by native PCR, indicating that the samples were truly negative or that the samples had degraded during storage. Four of these 9 had been just above the LOD of the commercially available tests when initially tested, which was at least one year prior to us receiving the samples. The simple act of freeze- thawing the serum samples for testing and long-term storage could have caused the HCV RNA to degrade so much that it was no longer detectable. The remaining four samples were positive by native PCR but negative by converted PCR, indicating that these samples were false negatives called by the preferred assay.

Taking all the above into account, this means that the 1^st generation preferred HCV assay is in 99.03% concordance with the commercially available assays and may in fact be even more sensitive than the Versant HCV RNA 3.0 (bDNA) assay in detecting low levels of genotype 3a. Furthermore, there were less indeterminate samples in our assay compared to the commercially available assays, which would result in less retesting of samples.

The results obtained in this study clearly demonstrate the practical and clinical utility of the simplification technology when applied to HCV detection and show that this assay is as sensitive and specific as other available assays. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

Claims

Claims:

1. A method for detecting hepatitis C virus (HCV) comprising: treating a sample containing nucleic acid with an agent that modifies cytosine to uracil to form sequence modified nucleic acid; providing a primer set having primers selected from SEQ ID NO: 1 to SEQ ID NO: 95 or a probe selected from SEQ ID NO: 96 to SEQ ID NO: 103 being complementary to a sequence modified nucleic acid indicative of HCV; and detecting a sequence modified nucleic acid indicative of HCV present in the sample.

2. The method according to claim 1 wherein agent is a bisulphite reagent.

3. The method according to claim 2 wherein the bisulphite reagent is sodium bisulphite or sodium metabisulphite.

4. The method according to any one of claims 1 to 3 wherein the probe is selected from SEQ ID NO: 96 to SEQ ID NO: 103.

^• 5. The method according to any one of claims 1 to 3 comprising providing a primer set selected from SEQ ID NO: 1 to SEQ ID NO: 95 and amplifying the sequence modified nucleic acid to form a sequence modified nucleic acid indicative of HCV.

6. The method according to claim 5 wherein the primer set is selected from: SEQ ID NO: 32, SEQ ID NO: 19,.SEQ ID NO: 21; SEQ ID NO: 32, SEQ ID NO: 28;

SEQ ID NO: 1 , SEQ ID NO: 14, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13;

SEQ ID NO: 16, SEQ ID NO: 15, SEQ ID NO: 28;

SEQ ID NO: 16, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 20;

SEQ ID NO: 1 , SEQ ID NO: 14, SEQ ID NO: 19;

SEQ ID NO: 1 , SEQ ID NO: 14, SEQ ID NO: 28;

SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 19, SEQ ID NO: 21; or

SEQ ID NO: 36, SEQ ID NO: 40.

7. The method according to claim 5 or 6 wherein amplification is carried out by polymerase chain reaction (PCR), Real Time PCR, isothermal amplification or signal amplification.

8. A primer set suitable to detect hepatitis C virus (HCV) having primers selected from SEQ ID NO: 1 to SEQ ID NO: 95.

9. The primer set according to claim 8 selected from: SEQ ID NO: 32, SEQ ID NO: 19, SEQ ID NO: 21 ; SEQ ID NO: 32, SEQ ID NO: 28;

SEQ ID NO: 1, SEQ ID NO: 14, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13;

SEQ ID NO: 16, SEQ ID NO: 15, SEQ ID NO: 28;

SEQ ID NO: 16, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 20;

SEQ ID NO: 1, SEQ ID NO: 14, SEQ ID NO: 19;

SEQ ID NO: 1, SEQ ID NO: 14, SEQ ID NO: 28;

SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 19, SEQ ID NO: 21; or

SEQ ID NO: 36, SEQ ID NO: 40.

10. A probe suitable to detect hepatitis C virus (HCV) selected from SEQ ID NO: 96 to SEQ ID NO: 103.

11. Use of a primer set according to claim 8 or 9 or a probe according to claim 10 in an assay for detecting hepatitis C virus (HCV).