WO2010117984A1 - Nouvelles stratégies d'amélioration des vaccins anticancéreux - Google Patents

Nouvelles stratégies d'amélioration des vaccins anticancéreux Download PDF

Info

Publication number
WO2010117984A1
WO2010117984A1 PCT/US2010/030045 US2010030045W WO2010117984A1 WO 2010117984 A1 WO2010117984 A1 WO 2010117984A1 US 2010030045 W US2010030045 W US 2010030045W WO 2010117984 A1 WO2010117984 A1 WO 2010117984A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
antigen
antibody
moiety
seq
Prior art date
Application number
PCT/US2010/030045
Other languages
English (en)
Inventor
Chien-Hsing Chang
David M. Goldenberg
Original Assignee
Immunomedics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US12/544,476 external-priority patent/US7901680B2/en
Application filed by Immunomedics, Inc. filed Critical Immunomedics, Inc.
Priority to EP10762283A priority Critical patent/EP2416807A4/fr
Publication of WO2010117984A1 publication Critical patent/WO2010117984A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001124—CD20
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2833—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3007—Carcino-embryonic Antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/44—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere, e.g. haptens, metals, DNA, RNA, amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/80—Vaccine for a specifically defined cancer
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/77—Internalization into the cell
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction

Definitions

  • the present invention relates to compositions and methods for improved vaccines.
  • the compositions and methods relate to xenoantigens, chemically modified antigens, antigens in conjunction with Th epitopes, dendritic cells loaded with antigens, immunoconjugates or fusion proteins comprising dendritic cell targeting antibodies attached to antigens and/or dendritic cell targeting lentiviral vectors expressing antigens.
  • the vaccines are of use for therapy of a wide variety of diseases, including but not limited to cancer, autoimmune disease, immune dysfunction disease, metabolic disease, neurological diseases such as Alzheimer's and cardiovascular disease.
  • Therapeutic vaccination against cancer is an important modality complementing current standard therapies, and may lead to long-term control of cancer. Numerous strategies are in development in an attempt to achieve better effectiveness, but except for the recent advent of vaccines against HPV, the long effort to produce a cancer vaccine has not succeeded.
  • TSAs tumor-specific antigens
  • TAAs tumor-associated antigens
  • TAAs tumor-associated antigens
  • TSAs are molecules unique to cancer cells, such as the products of mutated normal cellular genes, viral antigens expressed on tumor cells, endogenous human retrovirus activated and expressed in cancer cells (Takahashi et al., J Clin Invest 118:1099-1109, 2008), and a recently identified placenta-specific antigen that is not found in any adult normal somatic tissue but highly expressed in a variety of tumor types, particularly in breast cancer (Chen et al., Beijing Da Xue Xue Bao 38:124-27, 2006; Koslowski et al., Cancer Res 67:9528-34, 2007; Old, Cancer Immunity 7:19, 2007).
  • TAAs are molecules shared, but differently expressed, by cancer cells and normal cells.
  • TSAs are the ideal targets for immunotherapy and vaccination, the fact that they are expressed only on individual patients' cancer cells or small subsets of tumors would require the development of personalized therapy for individual patients, thus limiting their wide application (Baxevanis et al., Cancer Immunol Immunother 58:317024, 2009).
  • TAAs which are largely self-antigens (self-Ags) already tolerized by the immune system through a tightly controlled process of negative selection in the thymus (Kruisbeek and Amsen, Curr Opin Immunol 8:233-44, 1996; Stockinger, Adv Immunol 71 :229-65, 1999) or peripheral tolerization, the major challenge is to induce a strong immune response directed selectively against cancer cells.
  • the present invention concerns novel approaches to the development of effective cancer vaccines, including but not limited to optimized antigen design, in vivo targeted dendritic cell vaccination, and cancer vaccines used in combination with chemotherapy, monoclonal antibodies, adoptive T-cell transfer, or stem cell transplantation.
  • optimized antigen design in vivo targeted dendritic cell vaccination
  • cancer vaccines used in combination with chemotherapy, monoclonal antibodies, adoptive T-cell transfer, or stem cell transplantation.
  • FIG. 1 Diagram of several novel strategies/approaches in cancer vaccination.
  • antigens to be used for cancer vaccines are optimized which includes: (1) using xenoantigen other than TAA/self antigen, (2) chemically-modified TAA, (3) inclusion of antigen-specific CD4 Th epitopes.
  • the optimized antigen is loaded to dendritic cells followed by optimized maturation ( ⁇ DCl) for ex vivo DC vaccination.
  • the antigen can also be linked to a DC-targeting antibody via genetic fusion or chemical conjugation. In vivo administration of the conjugate or fusion protein specifically delivers the antigen to DCs and initiates immune responses.
  • the optimized antigen can also be engineered with a lentivector which is pseudotyped with an envelope protein that can specifically recognize DCs (for example, a DC-SIGN antibody). In vivo administration of this recombinant lentiviral vector selectively infects DCs.
  • the antigen can also be encoded by a lentiviral vector which carries a lineage-specific internal promoter (e.g., dectin-2 gene promoter) that restricts the transgene (antigen) expression to antigen-presenting cells. All of the vaccination approaches initiate antigen-specific (both CD4+ and CD8+) T cell responses against cancer cells and/or cancer stem cells.
  • the tumor-specific CD4+ T cells provides help and survival signals to tumor-specific CD8+ T cells and maintain CD8+ T-cell memory, which are essential for long-lasting anti-tumor immunity.
  • the tumor protection efficacy can be augmented by combinational use of adoptive transfer of antigen-specific T cells, chemotherapy, monoclonal antibodies, and/or stem cell transplantation. Arrows with X represent inhibitory action, or negative effect.
  • FIG. 2 Specific binding of hLLl on human blood DC subsets, B cells, and monocytes.
  • A The gating strategy for the different APC subsets.
  • B CD74 expression in APCs.
  • C The binding efficiency of hLLl on the cells. The numbers represent mean fluorescence intensity.
  • FIG. 3 CD74 expression in and binding efficiency of hLLl with human monocyte- derived immature vs mature DCs.
  • the human monocyte-derived DCs (day 5 after culture in the presence of hGM-CSF and hIL-4) were stained with FITC-labeled anti-CD74 antibody or AlexaFluor488-labeled hLLl, in comination with the staining with fluorescence-labeled mAbs against HLA-DR and CD83.
  • the HLA-DR-positive cells are gated and analyzed.
  • A CD74 expression in immature and LPS-matured DCs.
  • B hLLl binding with immature vs LPS-matured DCs.
  • C Comparison of expression of CD83, HLA-DR, CD74 and hLLl binding in immature and mature DCs.
  • FIG. 4 Side-by-side comparison of the cytotoxic effect of hLLl on B cell malignant Daudi cells and normal DCs.
  • A Comparison of the effect of hLLl on Daudi and DCs.
  • B Effect of hLLl on cell viability of DCs in an extended doses.
  • C The cytotoxic effect of hLLl on Daudi cells.
  • D The microscopic image shows no effect of hLLl on DC viability.
  • FIG. 5. Moderate enhancement of DC constitutive maturation by hLLl .
  • the HLA- DR positive cell populations were gated from day 5 DCs derived from human monocytes in the presence of hGM-CSF and hIL-4.
  • A The expression of antigen-presenting molecule HLA-DR, costimulatory molecule CD54 and CD86 was measured by flow cytometry.
  • B Expression levels of antigen-presenting molecule HLA-DR, costimulatory molecule CD54 and CD86.
  • FIG. 6 No significant influence of hLLl on DC-mediated T cell proliferation.
  • the hLLl -treated DCs were co-cultured with CFSE-labeled allogeneic PBMCs for 8 (A) or 11 days (B).
  • the expanded T cells were stained with Percp-conjugated mAb against CD4.
  • the cell proliferation of total T cells, CD4+ and CD4- T cells were analyzed.
  • FIG. 7 Polarization of na ⁇ ve CD4+ T cells by hLL 1 -treated DCs favoring the differentiation toward ThI effector cells.
  • Na ⁇ ve CD4+ T cells isolated from human PBMCs using the depletion column with magnetic beads (MACS) were co-cultured with hLLl- treated allogeneic DCs. After different time points (day 11, 13, 18), the cells were harvested, stimulated with PMA and ionomycin, and analyzed with intracellular cytokine staining with fluorescence-labeled hlFN-gamma and hIL-4 antibodies. Thl/Th2/ThO cells populations were gated and analyzed. The flow cytokine production in T cells stimulated by hLLl- treatred DCs or by GAH-cross-linked hLLl -treated DCs was determined.
  • A The data of ThI responses in two donors, in the absence or presence of cross-linking by GAH, at different days after DC/T coculture, are shown.
  • B The dose-effect curve for increasing ThI populations by hLLl.
  • the term “about” means plus or minus ten percent (10%) of a value.
  • “about 100” would refer to any number between 90 and 110.
  • An antibody refers to a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (e.g. , an IgG antibody) or an immunologically active, antigen-binding portion of an immunoglobulin molecule, like an antibody fragment.
  • immunoglobulin molecule e.g. , an IgG antibody
  • antibodies may be murine, chimeric, humanized or human, polyclonal or monoclonal, monospecific, bi specific or multispecific.
  • an antibody fragment is a portion of an antibody such as F(ab') 2 , F(ab) 2 , Fab', Fab, Fv, scFv and the like. Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the intact antibody. For example, an anti-HLA-DR antibody fragment binds to HLA-DR.
  • antibody fragment also includes isolated fragments consisting of the variable regions, such as the "Fv” fragments consisting of the variable regions of the heavy and light chains and recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker ("scFv proteins"). As used herein, the term “antibody fragment” does not include portions of antibodies without antigen binding activity, such as Fc fragments or single amino acid residues.
  • a naked antibody or naked antibody fragment refers to an antibody or antigen binding fragment thereof which is not conjugated to a therapeutic agent.
  • naked antibodies may include murine monoclonal antibodies, as well as recombinant antibodies, such as chimeric, humanized or human antibodies.
  • a therapeutic agent is a molecule, atom or complex which is administered separately, concurrently or sequentially with an antibody moiety or conjugated to an antibody moiety, i.e., antibody or antibody fragment, and is useful in the treatment of a disease.
  • therapeutic agents include antibodies, antibody fragments, drugs, toxins, nucleases, hormones, immunomodulators, chelators, boron compounds, photoactive agents, oligonucleotides (e.g. anti-sense oligonucleotides or siRNA) and radioisotopes.
  • An immunoconi ugate is a conjugate of an antibody component with at least one therapeutic or diagnostic agent.
  • An antibody component may be conjugated with multiple therapeutic and/or diagnostic agents to form an immunoconjugate.
  • antibody fusion protein may refer to a recombinantly produced antigen- binding molecule in which one or more of the same or different single-chain antibody or antibody fragment segments with the same or different specificities are linked. Valency of the fusion protein indicates how many binding arms or sites the fusion protein has to a single antigen or epitope; i.e., monovalent, bivalent, trivalent or multivalent. The multivalency of the antibody fusion protein means that it can take advantage of multiple interactions in binding to an antigen, thus increasing the avidity of binding to the antigen. Specificity indicates how many antigens or epitopes an antibody fusion protein is able to bind; i.e., monospecific, bispecific, trispecific, multispecific.
  • a natural antibody e.g., an IgG
  • a natural antibody is bivalent because it has two binding arms but is monospecific because it binds to one epitope.
  • Monospecific, multivalent fusion proteins have more than one binding site for an epitope but only bind with one epitope.
  • the fusion protein may comprise a single antibody component, a multivalent or multispecific combination of different antibody components or multiple copies of the same antibody component.
  • the fusion protein may additionally comprise an antibody or an antibody fragment and a therapeutic agent. Examples of therapeutic agents suitable for such fusion proteins include immunomodulators and toxins.
  • One preferred toxin comprises a ribonuclease (RNase), preferably a recombinant RNase.
  • a fusion protein may comprise an AD or DDD sequence for producing a dock-and- lock (DNL) construct as discussed below.
  • DNL dock-and- lock
  • FIG. 1 Novel approaches to anti-cancer vaccine development are summarized in FIG. 1.
  • the discovery in 1996 that a single T-cell receptor can productively recognize a large continuum of related ligands has raised the possibility that T cells recognizing a xenoantigen may cross-react with its self-homologous counterpart.
  • TAA the autologous T cells specific to TAAs may have largely been deleted, but T cells specific to the xenoantigenic counterparts of TAAs may survive the negative selection.
  • T cells once induced and activated by immunization with a xenoantigen, may cross-react with their cognate TAA, due to the plasticity of TCR recognition. It is therefore an approach to overcome the immune tolerance against homologous self-Ags by immunization with the xenoantigens. [024] This concept has been verified by the accumulated evidence that immunization with xenoantigens is effective in the induction of both cellular and humoral immune responses against their self counterparts.
  • mice which are tolerant to gp75/tyrosinase-related protein- 1 (TRP-I), generated autoantibodies against gp75 after immunization with DNA encoding human gp75 but not syngeneic mouse gp75, resulting in significant tumor protection and the rejection of tumor challenge requiring CD4 + and NKl .I + cells and Fc receptor gamma-chain (Weber et al., 1998, J Clin. Invest. 102:1258-1264).
  • TRP-I gp75/tyrosinase-related protein- 1
  • HLA-A*0201 transgenic mice with human Her-2(9 435 ), the xenogeneic altered peptide ligand of its mouse homologue, significantly increased the frequency of murine Her-2(9 435 )-specific CTL, and also induced strong protective and therapeutic immunity against the transplantable ALC tumor cell line transfected to coexpress HLA-A*0201 and hRe ⁇ -2/neu or rHer-2/neu (Gritzapis et al., 2006, Cancer Res. 66(10):5452-5460).
  • FIG. 1 Another approach to break immune tolerance to self-Ags is achieved with chemical modification of antigens (FIG. 1).
  • Weigle reported that rabbits immunized with a diazonium derivative-labeled rabbit thyroglobulin produced cross-reactive antibodies to native thyroglobulin, possibly due to the chemical modification of antigen that results in immunogenic epitopes for the cross-reactive antibody responses (Weigle, 1965, J. Exp. Med. 121 :289-308).
  • Antigen-specific T-helper (Th) cells play a key role in priming, maintaining, and boosting CTL responses (Kennedy, 2008, Immunol. Rev. 222:129-144). These Th cells, upon activation at the tumor site by antigen-processing cells (APCs) expressing tumor antigens, provide local or direct growth and survival signals to the tumor-specific CTLs.
  • APCs antigen-processing cells
  • Th cells protect CTLs from activation-induced cell death (AICD), which allows CTLs to survive and to continue to kill tumor cells (Kennedy and Celis, 2006, J Immunol. 177:2862- 2872).
  • AICD activation-induced cell death
  • CD4 + T cells are required for secondary expansion and memory in CD8 + T cells (Janssen et al., 2003, Nature 421 :852-856; Shedlock and Shen, 2003, Science 300:337-339; Sun and Bevan, 2003, Science 300:339-342), and that adoptive transfer of gene-engineered CD4 + Th cells induces potent primary and secondary tumor rejections (Moeller et al., 2005, Blood 106(9):2995-3003). It is also supported by studies in infectious diseases, where HIV-specific CD4 + T cells are essential for the maintenance of effective CTL responses and the generation of functional CTL memory cells (Lichterfeld et al., 2004, J Exp. Med.
  • Immature DCs differ from mature DCs not only in the lower T-cell stimulatory capacity due to a low level of MHC class I/II and costimulatory molecules, but also in their lower capacity of migration.
  • Mature DCs induce T-cell immunity, whereas immature DCs induce tolerance.
  • a DC-based cancer vaccine thus requires fully mature DCs for effective induction of functionally specific T cells against tumors. Since CD4 + T cells provide T-cell help for generating and augmenting tumor-specific CTL responses, and ThI effector cells play a key role in mediating cellular immunity, DCs that can skew the differentiation of na ⁇ ve CD4 + T cells toward ThI cells, which are termed type-1 DCs (DCl), are preferred for DC- based vaccines.
  • DCl type-1 DCs
  • ⁇ DCl expressed similar levels of multiple costimulatory molecules (CD83, CD86, CD80, CDl Ic, and CD40), but secreted 10 to 60 times more IL-12p70, and induced much higher numbers of functional CD8 + T cells against CLL cells, indicating this type of DC is the potent inducer of tumor-specific T cells (Lee et al., 2008, J Leukoc. Biol. 84(1 ):319-325).
  • ⁇ DCl potently recruits and activates NK cells (Gustafsson et al., 2008, Cancer Res.
  • ⁇ DCl lacks the ability of attracting Tregs (Muthuswamy et al., 2008, Cancer Res. 68: 5972-5978).
  • IFN- ⁇ is the key player for priming DCs to produce high-levels of IL-12 (Mailliard et al., 2004, Cancer Res. 64:5934-5937) and CXCL9/MIG (Gustafsson et al., 2008, Cancer Res.
  • IFN- ⁇ is a potent inducer of CCR- 7 expression, which is essential for efficient migration of DCs to secondary lymphoid organs (Parlato et al., 2001, Blood 98:3022-3029; Mohty et al., 2003, J. Immunol. 171 :3385-3393; Papewalis et al., 2008, J. Immunol. 180:1462-1470).
  • a further modification of DCs to enhance their T-cell stimulatory capacity involves the use of lentiviral vectors to engineer the expression of calnexin (Kang et al., 2002, J. Biol. Chem. 277:44838-44844), which converts tolerogenic DCs into reactive DCs in multiple myeloma and effectively overcomes immune tolerance (Han et al., 2008, MoI. Ther. 16:269- 279) (FIG. 1).
  • Exosomes are 30- to 100-nm diameter vesicles derived from a diverse range of cell types.
  • DC-derived exosomes contain Ag-presenting, adhesion, and costimulatory molecules, which alone or in association with DCs can serve as a potent vaccine to stimulate strong CTL responses and induce antitumor immunity in different animal models (Chaput et al., 2004, J. Immunol. 172:2137-2146; Cho et al., 2005, Int. J. Cancer 114:613-622; Hao et al., 2007, Immunology 120:90-102).
  • Targeting antigens to DCs via an antibody specific to a select DC cell surface marker is another approach for in-vivo targeted DC vaccination, as reported for mannose receptor (He et al., 2007, J Immunol. 178:6259-6267; Ramakrishna et al., 2004, J. Immunol. 172(5), 2845-2852), CD205 (Trumpfheller et al., 2006, J. Exp. Med.
  • CD74 is a type-II integral membrane protein essential for proper MHC II folding and MHC II-CD74 complex targeting to endosomes (Stein et al., 2007, Clin. Cancer Res. 13:5556s-5563s; Matza et al., 2003, Trends Immunol. 24:264-268).
  • CD74 expression is not restricted to DCs, but is in almost all antigen-presenting cells (Freudenthal et al., 1990, Proc. Natl. Acad. Sci. U. S. A. 87:7698- 7702), including B cells, monocytes, and different DC subsets, such as blood myeloid DCl, myeloid DC2, plasmacytoid DC (Chen et al., 2008, Blood (ASH Annual Meeting Abstracts) 112: Abstract 2649), and follicular DCs (Clark et al., 1992, J Immunol. 148:3327-3335).
  • CD74 is also expressed in follicular DCs, a DC subset critical for antigen presentation to B cells (Clark et al., 1992, J. Immunol. 148:3327- 3335).
  • the humanized anti-CD74 monoclonal antibody hLLl or milatuzumab (Leung et al., 1995, MoI. Immunol. 32:1416-1427; Losman et al., 1997, Cancer 80(12 Suppl):2660-2666; Stein et al., 2004, Blood 104:3705-3711), is a therapeutic MAb currently under clinical evaluation for non-Hodgkin lymphoma, chronic lymphocytic leukemia, and multiple myeloma.
  • Milatuzumab binds efficiently to different subsets of blood DCs, B cells, monocytes, and monocyte-derived immature DCs, but has no cytotoxicity, nor functional alteration, on human monocyte-derived DCs that normally express CD74 (Chen et al., 2008, Blood (ASH Annual Meeting Abstracts) 112: Abstract 2649). These properties of milatuzumab, which internalizes rapidly upon engagement with CD74, favor its use as a DC- targeting antibody for in vivo vaccination.
  • Cancer stem cells are capable of self-renewal, possess the ability for unlimited proliferation, and are resistant to multiple therapeutic approaches, whereas most mature cancer cells can be eliminated effectively by current standard therapies.
  • a pressing question is whether cancer stem cells are sensitive to immunotherapy or vaccination.
  • CD8 + minor histocompatibility antigen-specific cytotoxic T lymphocyte clones could eliminate human acute myeloid leukemia stem cells (Bonnet et al., 1999, Pr oc. Natl. Acad. Sci. U. S. A. 96:8639-8644). More recently, Rosinski et al.
  • DDX36-encoded H-Y epitope is expressed by leukemic stem cells and can be recognized by the DDX36-specific CTLs, which can prevent engraftment of human acute leukemia in NOD/SCID mice (Rosinski et al., 2008, Blood 111 :4817-4826).
  • Another report demonstrated that engraftment of mHA myeloid leukemia stem cells in NOD/SCID ⁇ c nu " mice was completely inhibited by in vitro preincubation with the mHA-specific CTL clone (Kawase et al., 2007, Blood 1 10:1055-1063).
  • CSCs like many cancer cells, are subject to immune tolerance or evasion.
  • CD200 an immunosuppressive membrane glycoprotein overexpressed in multiple hematological malignancies, and a negative prognostic factor in multiple myeloma (Moreaux et al., 2006, Blood 108:4194-4197) and acute myeloid leukemia (Tonks et al., 2007, Leukemia 21 :566-568), has been found to be co-expressed in CSCs with other stem-cell markers in prostate, breast, brain, and colon cancers (Kawasaki et al., 2007, Biochem. Biophys. Res. Commun. 364:778-782).
  • CSCs might be able to evade immune surveillance or immunotherapy by generating a tolerogenic response facilitated by the expression of CD200 (Kawasaki et al., 2008, Trends Immunol. 29:464-468). This fact may increase the difficulty of eliminating CSCs by immunotherapy approaches. However, it is still unclear whether CSCs are more resistant to CTL killing than their progeny cells, and if so, whether CD200 is a key player for mediating the immune resistance.
  • Cancer vaccine in combination with chemotherapy and/or monoclonal antibodies Because of the immunosuppressive effects of cytotoxic therapy, it is a challenge to integrate cancer vaccines into the standard chemotherapy of cancer.
  • chemotherapy or radiotherapy was reported to eliminate regulatory T cells (Tregs) (North et al., 1986, J. Exp. Med. 164:1652-1666; Awwad et al., 1989, Cancer Res. 49:1649-1654; Ercolini et al., 2005, J. Exp. Med. 201 :1591-1602), which would potentially offer some synergistic action with vaccine-induced anti-tumor effects.
  • COX-2 cyclooxygenase-2
  • NSAIDs such as cyclooxygenase-2 (COX-2) inhibitors
  • COX-2 and its downstream prostaglandins are capable of inhibiting DC and T effector cell activity, and of stimulating Tregs (Juuti et al., 2006, J. Clin. Pathol 59:382-386; Sharma et al., 2003, Clin. Cancer Res. 9: 961-968; Sharma et al., 2005, Cancer Res. 65:5211-5220; Basu et al., 2006, J Immunol. 177(4): 2391-2402).
  • Unconjugated monoclonal antibodies exert their anti-tumor cytotoxicity usually by the mechanisms of complement-mediated cytotoxicity (CMC) and antibody-dependent cellular cytotoxicity (ADCC), or by initiating or inhibiting signaling pathways in the targeted cell that leads to apoptosis (Sharkey et al., 2006, CA Cancer J. Clin. 56:226-243).
  • CMC complement-mediated cytotoxicity
  • ADCC antibody-dependent cellular cytotoxicity
  • combining vaccine, monoclonal antibody, and chemotherapy may hold more potential for enhancing therapeutic efficacy (Baxevanis et al., 2009, Cancer Immunol. Immunother. 58:317-324) (FIG. 1).
  • Allogeneic hematopoietic stem cell transplantation (allo-HSCT), following high-dose chemotherapy and total body irradiation, provides an effective and potentially curative therapy for hematologic malignancies. It is believed that the clinical effectiveness of this approach is primarily due to the graft versus leukemia (GVL) effect, in which the recipient leukemia cells are recognized and eliminated by donor T cells.
  • the primary target antigen for allo-HSCT with HLA-identical donors is minor-histocompatibility antigen (mHA), which is derived from genetic polymorphisms in the recipient that are not present in the donor (Ofran et al., 2008, Clin. Cancer Res.
  • mHA minor-histocompatibility antigen
  • DC vaccination with Wilms' tumor 1 (WTl) peptide and keyhole limpet hemocyanin (KLH) after allo-HSCT successfully induced immune responses to the naive antigen KLH, even though a definitive immune response to WTl was not detected.
  • WTl Wilms' tumor 1
  • KLH keyhole limpet hemocyanin
  • the vaccines will comprise a tumor-specific antigen or a tumor-associated antigen. While vaccines against tumor-specific antigens provide the greatest selectivity against tumor cells, the need to specifically tailor such vaccines for the individual patient limits their widespread applicability. In contrast, tumor-associated antigens (TAAs), which may be found to a limited extent in cells of normal tissues, exhibit a much broader distribution across tumors from different patients or even different tumor types. In more preferred embodiments, the anti-cancer vaccines are targeted to TAAs. A wide variety of TAAs are known in the art and any such known TAA may be used as the basis for an anti-cancer vaccine.
  • TAAs tumor-associated antigens
  • the TAA is a CD20 xenoantigen, of use to induce an immune response against B cell cancers such as leukemias or lymphomas, or against autoimmune diseases involving B cell proliferation.
  • Other known TAAs include, but are not limited to, carbonic anhydrase IX, alpha-fetoprotein, ⁇ -actinin-4, A3, antigen specific for A33 antibody, ART-4, B7, Ba 733, BAGE, BrE3-antigen, CA125, CAMEL, CAP-I, CASP- 8/m, , CCCL19, CCCL21, CDl, CDIa, CD2, CD3, CD4, CD5, CD8, CDl IA, CD14, CD15, CD16, CD18, CD19, CD20, CD21, CD22, CD23, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD45, CD46, CD52, CD54, CD55, CD59
  • Xenoantigen amino acid sequences for a large number of TAAs may be readily obtained from public databases, such as the NCBI protein database.
  • xenoantigen CD20 amino acid sequences of potential use are readily available to the skilled artisan through such well-known public databases as the NCBI protein database (see, e.g., NCBI Accession Nos. NP 031667; P 19437; AAA37394; BAE47068; ABA29631; BAD77809).
  • CD20 amino acid sequences are known and readily available from a wide variety of species and can be incorporated into the anti-cancer vaccine complexes. Because the xenoantigen amino acid sequence is from a different species, the likelihood of self-tolerance of the host immune system is substantially reduced.
  • Dendritic Cell Targeting Antibodies are known and readily available from a wide variety of species and can be incorporated into the anti-cancer vaccine complexes. Because the xenoantigen amino acid sequence is from a different species, the likelihood of self-tolerance of the host immune system is substantially reduced.
  • the antigen to be used for vaccine production may be targeted to appropriate host cells, such as dendritic cells (DC), by attachment to an appropriate targeting antibody.
  • the DC-targeting antibody may be an anti- CD74 antibody, such as the hLLl antibody (see U.S. Patent No. 7,312,418, the Examples section of which is incorporated herein by reference).
  • other antigens associated with DCs are known, including but not limited to CD209 (DC-SIGN), CD34, CD74, CD205, TLR 2 (toll-like receptor 2), TLR 4, TLR 7, TLR 9, BDC A-2, BDCA-3, BDCA-4, and HLA- DR. Any such known DC antigen may be targeted using an appropriate antibody vaccine component.
  • An exemplary anti-HLA-DR antibody is hL243 (see U.S. Patent No. 7,612 180, the Examples section of which is incorporated herein by reference).
  • CD20 is normally expressed in cells of B cell lineage. It was recently reported that CD20 is expressed in a small population of MM cells isolated from MM cell lines or clinical specimens, which do not express the characteristic plasma cell surface antigen CDl 38 but have a highly clonogenic potential and are resistant to multiple clinical anti-myeloma drugs (Matsui et al., Blood 2004, 103:2332-6; Matsui et al., Cancer Res. 2008, 68: 190-7).
  • CD20+CD138- cells are capable of clonogenic growth in vitro and in a 3-D culture model (Kirshner et al., Blood 2008, 112:2935-45), and of differentiation into MM cells in vitro and in the engrafted NOD/SCID mouse model during both primary and secondary transplantation. It has thus been suggested that these CD138 neg CD20 + cells represent the putative multiple myeloma cancer stem cells.
  • TAAs tumor-associated Ags
  • T cells that recognize these TAAs/self-Ags with high avidity are either clonally deleted in the thymus or anergized in the periphery.
  • immunization with xenoantigen has been shown to be capable of overcoming the immune tolerance against the homologous self-Ag (Fong et al., J Immunol. 2001, 167(12):7150-6).
  • CD20 as a target for immunotherapy and vaccination against MM.
  • CD20 is a hallmark of MM cancer stem cells.
  • successful vaccination has been achieved by a xenogeneic DNA vaccine against CD20 in a tumor challenge model of B-cell lymphoma.
  • autoimmunity against B cells could be induced by a vaccine targeting CD20, it should not cause a large problem because the B cell pool is not a vital and critical tissue and can be replenished from its lineage progenitor.
  • a therapeutic vaccine targeting CD20 would be effective in selective eradication of MM cancer stem cells.
  • Monoclonal anti-CD20 antibody as a potential modality for eradication of MM stem cells.
  • the discovery of CD20+ MM progenitor cells has prompted several small clinical trials to test the efficacy of rituximab, an anti-CD20 monoclonal antibody, in MM patients.
  • rituximab an anti-CD20 monoclonal antibody
  • DCs dendritic cells
  • DC targeting vaccination is more efficient in eliciting anti-tumor immune response, and more effective in controlling tumor growth in animal models (Kretz-Rommel et al., J Immunother 2007, 30:715-726).
  • B cells are another type of potent antigen-presenting cells capable of priming Thl/Th2 cells (Morris et al, J Immunol.
  • CD74 as a potential receptor for targeting vaccination.
  • Some receptors expressed on DCs have been used as the targets for in vivo antigen targeting, such as the mannose receptor (He et al., J. Immunol 2007, 178, 6259-6267; Ramakrishna et al., J. Immunol. 2004, 172, 2845-2852) CD205 (Bonifaz et al., J Exp Med. 2004, 199:815-24), DC-SIGN (Tacken et al., Blood 2005, 106:1278-85), and LOXl (excellentste et al., Immunity 2002, 17, 353-362), etc.
  • CD74 is a type II integral membrane protein essential for proper MHC II folding and targeting of MHC II-CD74 complex to the endosomes (Stein et al., Clin Cancer Res. 2007, 13:5556s-5563s; Matza et al., Trends Immunol. 2003, 24(5):264-8). CD74 expression is not restricted to DCs, but is found in almost all antigen-presenting cells (Freudenthal et al., Proc Natl Acad Sci U S A. 1990, 87:7698-702; Clark et al., J Immunol. 1992, 148(11):3327-35).
  • CD74 in APCs may offer some advantages over sole expression in myeloid DCs, as targeting of antigens to other APCs like B cells has been reported to break immune tolerance (Ding et al., Blood 2008, 112:2817-25), and targeting to plasmacytoid DCs cross-presents antigens to na ⁇ ve CD8 T cells. More importantly, CD74 is also expressed in follicular DCs (Clark et al., J Immunol. 1992, 148(11):3327-35), a DC subset critical for antigen presentation to B cells (Tew et al., Immunol Rev. 1997, 156:39-52). This expression profile makes CD74 an excellent candidate for in vivo targeting vaccination.
  • the DNL method has generated several trivalent, bispecific, binding proteins containing Fab fragments reacting with carcinoembryonic antigen (CEA), and has been successfully used in improved cancer imaging and radioimmunotherapy through a pretargeting strategy (Goldenberg et al., J Nucl Med. 2008, 49: 158-63).
  • CEA carcinoembryonic antigen
  • hLLl is a humanized monoclonal antibody against human CD74 (Leung et al., MoI Immunol. 1995, 32:1416-1427; Losman et al., Cancer 1997, 80:2660-2666; Stein et al., Blood 2004, 104:3705-1 1).
  • This MAb in the presence of cross-linking by a second antibody, exhibits cytotoxicity against B cell malignancies.
  • the naked hLLl is also capable of controlling tumor growth in a MM mouse model.
  • our recent data demonstrate that hLLl, in the presence or absence of cross-linking, has no cytotoxicity against human monocyte-derived DCs.
  • the vaccine constructs to be prepared and used may be made by the novel dock-and-lock (DNL) technique (see, e.g., U.S. Patent Nos. 7,521,056; 7,527,787; 7,534,866; 7,550,143 and 7,666,400, the Examples section of each of which is incorporated herein by reference.)
  • DNL method is based on the specific protein/protein interactions between the regulatory (R) subunits of cAMP-dependent protein kinase (PKA) and the anchoring domain (AD) of A-kinase anchoring proteins (AKAPs) (Baillie et ah, FEBS Letters. 2005; 579: 3264. Wong and Scott, Nat. Rev.
  • PKA which plays a central role in the signal transduction pathway triggered by the binding of cAMP to the R subunits of PKA
  • the structure of the holoenzyme consists of two catalytic subunits held in an inactive form by the R subunits (Taylor, J. Biol. Chem. 1989; 264:8443). Isozymes of PKA are found with two types of R subunits (RI and RII), and each type has ⁇ and ⁇ isoforms (Scott, Pharmacol. Ther. 1991; 50:123).
  • the R subunits have been isolated only as stable dimers and the dimerization domain has been shown to consist of the first 44 amino-terminal residues (Newlon et al., Nat. Struct. Biol. 1999; 6:222). Binding of cAMP to the R subunits leads to the release of active catalytic subunits for a broad spectrum of serine/threonine kinase activities, which are oriented toward selected substrates through the compartmentalization of PKA via its docking with AKAPs (Scott et al., J. Biol. Chem. 1990; 265:21561).
  • AKAP microtubule-associated protein-2
  • AD sequence may be utilized to form a DNL complex.
  • the amino acid sequences of the AD are quite varied among individual AKAPs, with the binding affinities reported for RII dimers ranging from 2 to 90 nM (Alto et al, Proc. Natl. Acad. Sci. USA. 2003; 100:4445). Interestingly, AKAPs will only bind to dimeric R subunits. For human RIIa, the AD binds to a hydrophobic surface formed by the 23 ammo-terminal residues (Colledge and Scott, Trends Cell Biol. 1999; 6:216).
  • dimerization domain and AKAP binding domain of human RIIa are both located within the same N-terminal 44 amino acid sequence (Newlon et al, Nat. Struct. Biol. 1999; 6:222; Newlon et al, EMBO J. 2001 ; 20:1651), which is termed the DDD herein.
  • Entity B is constructed by linking an AD sequence to a precursor of B, resulting in a second component hereafter referred to as b.
  • the dimeric motif of DDD contained in a 2 will create a docking site for binding to the AD sequence contained in b, thus facilitating a ready association of a 2 and b to form a binary, trimeric complex composed of a 2 b.
  • This binding event is made irreversible with a subsequent reaction to covalently secure the two entities via disulfide bridges, which occurs very efficiently based on the principle of effective local concentration because the initial binding interactions bring the reactive thiol groups placed onto both the DDD and AD into proximity (Chimura et al, Proc. Natl. Acad. Sci. USA. 2001; 98:8480) to ligate site-specifically.
  • the AD and DDD sequences incorporated into the vaccine complex comprise the amino acid sequences of DDDl (SEQ ID NO:1) and ADl (SEQ ID NO: 3) below.
  • the AD and DDD sequences comprise the amino acid sequences of DDD2 (SEQ ID NO:2) and AD2 (SEQ ID NO:4), which are designed to promote disulfide bond formation between the DDD and AD moieties.
  • sequence variants of the AD and/or DDD moieties may be utilized in construction of the vaccine complexes.
  • the structure-function relationships of the AD and DDD domains have been the subject of investigation. (See, e.g., Burns-Hamuro et al, 2005, Protein Sci 14:2982-92; Carr et al., 2001, J Biol Chem 276:17332-38; Alto et al., 2003, Proc Natl Acad Sci USA 100:4445-50; Hundsrucker et al., 2006, Biochem J 396:297-306; Stokka et al., 2006, Biochem J 400:493-99; Gold et al., 2006, MoI Cell 24:383-95; Kinderman et al., 2006, MoI Cell 24:397-408.)
  • DDD sequence of use for construction of DNL complexes is shown in SEQ ID NO:5, wherein "X" represents a conservative amino acid substitution.
  • Conservative amino acid substitutions are discussed in more detail below, but could involve for example substitution of an aspartate residue for a glutamate residue, or a leucine or valine residue for an isoleucine residue, etc. Such conservative amino acid substitutions are well known in the art.
  • Alto et al. (2003) performed a bioinformatic analysis of the AD sequence of various AKAP proteins to design an RII selective AD sequence called AKAP-IS (SEQ ID NO:3), with a binding constant for DDD of 0.4 nM.
  • the AKAP-IS sequence was designed as a peptide antagonist of AKAP binding to PKA. Residues in the AKAP-IS sequence where substitutions tended to decrease binding to DDD are underlined in SEQ ID NO:3. Therefore, the skilled artisan will realize that variants which may function for DNL constructs are indicated by SEQ ID NO:6, where "X" is a conservative amino acid substitution.
  • the SuperAKAP-IS sequence may be substituted for the AKAP-IS AD moiety sequence to prepare vaccine constructs.
  • Other alternative sequences that might be substituted for the AKAP-IS AD sequence are shown in SEQ ID NO:8-10. Substitutions relative to the AKAP- IS sequence are underlined. It is anticipated that, as with the AKAP-IS sequence shown in SEQ ID NO:3, the AD moiety may also include the additional N-terminal residues cysteine and glycine and C-terminal residues glycine and cysteine, as shown in SEQ ID N0:4.
  • SuperAKAP-IS may be substituted for the AKAP-IS AD moiety sequence to prepare vaccine constructs.
  • Other alternative sequences that might be substituted for the AKAP-IS AD sequence are shown in SEQ ID NO:8-10. Substitutions relative to the AKAP- IS sequence are underlined. It is anticipated that, as with the AKAP-IS sequence shown in SEQ ID NO:3, the AD moiety may also include the additional
  • QIEYVAKQIVDYAIHQA (SEQ ID N0:7) Alternative AKAP sequences QIEYKAKQIVDHAIHQA (SEQ ID N0:8) QIEYHAKQIVDHAIHQA (SEQ ID N0:9) QIEYVAKQIVDHAIHQA (SEQ ID NO: 10)
  • Ht31 SEQ ID NO: 11
  • RIAD SEQ ID NO: 12
  • PV-38 SEQ ID NO: 13
  • Carr et al. (2001 ) examined the degree of sequence homology between different AKAP-binding DDD sequences from human and non-human proteins and identified residues in the DDD sequences that appeared to be the most highly conserved among different DDD moieties. These are indicated below by underlining with reference to the human PKA RIIa DDD sequence of SEQ ID NO:1. Residues that were particularly conserved are further indicated by italics. The residues overlap with, but are not identical to those suggested by Kinderman et al. (2006) to be important for binding to AKAP proteins. Thus, a potential DDD sequence is indicated in SEQ ID NO: 17, wherein "X" represents a conservative amino acid substitution.
  • sequence variants of the DDD and/or AD moieties in certain embodiments it may be preferred to introduce sequence variations in the antibody moiety or the linker peptide sequence joining the antibody with the AD sequence.
  • sequence variations in the antibody moiety or the linker peptide sequence joining the antibody with the AD sequence are shown in SEQ ID NO: 18-20.
  • L QKSLSLSPGLGSGGGGSGGCG (SEQ ID NO: 18)
  • an antibody or antigen binding fragment thereof may be incorporated into an anti-cancer vaccine.
  • the antibody binds to a tumor associated antigen (TAA) or a DC-associated antigen.
  • TAA tumor associated antigen
  • DC-associated antigen a tumor associated antigen
  • numerous tumor-associated antigens and/or DC-associated antigens are known in the art, and antibodies against any such known antigens may be used.
  • antibodies that have a direct therapeutic effect on cancer cells may be used as an adjunct therapy to an anti-cancer vaccine.
  • anti-cancer antibodies that may be utilized include, but are not limited to, hRl (anti-IGF-lR, U.S. Patent Application Serial No. 12/722,645, filed 3/12/10)
  • hPAM4 anti-mucin, U.S. Patent No. 7,282,567)
  • hA20 anti-CD20, U.S. Patent No. 7,251,164
  • hA19 anti-CD19, U.S. Patent No. 7,109,304
  • hIMMU31 anti-AFP, U.S. Patent No.
  • antigen-binding antibody fragments may be utilized.
  • Antigen- binding antibody fragments are well known in the art, such as F(ab') 2 , F(ab) 2 , Fab', Fab, Fv, scFv and the like.
  • an antigen-binding antibody fragment refers to any fragment of an antibody that binds with the same antigen that is recognized by the intact or parent antibody.
  • an antibody or fragment thereof which is not conjugated to a therapeutic agent is referred to as a "naked” antibody or fragment. Such naked antibodies are of use for cancer therapy.
  • antibodies or fragments may be conjugated to one or more therapeutic.
  • a wide variety of such therapeutic are known in the art, as discussed in more detail below, and any such known therapeutic agent may be used either conjugated to an appropriate antibody or unconjugated and administered before, simultaneously with, or after an anti-cancer antibody and/or vaccine.
  • monoclonal antibodies can be obtained by injecting mice with a composition comprising an antigen, removing the spleen to obtain B- lymphocytes, fusing the B-lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones which produce antibodies to the antigen, culturing the clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
  • MAbs can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography. See, for example, Coligan at pages 2.7.1-2.7.12 and pages 2.9.1-2.9.3. Also, see Baines et al, "Purification of Immunoglobulin G (IgG)," in METHODS IN MOLECULAR BIOLOGY, VOL. 10, pages 79-104 (The Humana Press, Inc. 1992).
  • the antibodies can be sequenced and subsequently prepared by recombinant techniques. Humanization and chimerization of murine antibodies and antibody fragments are well known to those skilled in the art. The use of antibody components derived from humanized, chimeric or human antibodies obviates potential problems associated with the immunogenicity of murine constant regions.
  • a chimeric antibody is a recombinant protein in which the variable regions of a human antibody have been replaced by the variable regions of, for example, a mouse antibody, including the complementarity-determining regions (CDRs) of the mouse antibody.
  • Chimeric antibodies exhibit decreased immunogenicity and increased stability when administered to a subject.
  • CDRs complementarity-determining regions
  • a chimeric or murine monoclonal antibody may be humanized by transferring the mouse CDRs from the heavy and light variable chains of the mouse immunoglobulin into the corresponding variable domains of a human antibody.
  • the mouse framework regions (FR) in the chimeric monoclonal antibody are also replaced with human FR sequences.
  • additional modification might be required in order to restore the original affinity of the murine antibody. This can be accomplished by the replacement of one or more human residues in the FR regions with their murine counterparts to obtain an antibody that possesses good binding affinity to its epitope.
  • the claimed methods and procedures may utilize human antibodies produced by such techniques.
  • the phage display technique may be used to generate human antibodies ⁇ e.g., Dantas-Barbosa et al., 2005, Genet. MoI. Res. 4:126-40).
  • Human antibodies may be generated from normal humans or from humans that exhibit a particular disease state, such as cancer (Dantas-Barbosa et al., 2005).
  • the advantage to constructing human antibodies from a diseased individual is that the circulating antibody repertoire may be biased towards antibodies against disease-associated antigens.
  • RNAs were converted to cDNAs and used to make Fab cDNA libraries using specific primers against the heavy and light chain immunoglobulin sequences (Marks et al., 1991, J MoI. Biol. 222:581-97).
  • Phage display can be performed in a variety of formats, for their review, see e.g. Johnson and Chiswell, Current Opinion in Structural Biology 3:5564-571 (1993).
  • Human antibodies may also be generated by in vitro activated B-cells. See U.S. Patent Nos. 5,567,610 and 5,229,275, incorporated herein by reference in their entirety. The skilled artisan will realize that these techniques are exemplary and any known method for making and screening human antibodies or antibody fragments may be utilized.
  • transgenic animals that have been genetically engineered to produce human antibodies may be used to generate antibodies against essentially any immunogenic target, using standard immunization protocols.
  • the XenoMouse® was transformed with germline-configured YACs (yeast artificial chromosomes) that contained portions of the human IgH and Igkappa loci, including the majority of the variable region sequences, along accessory genes and regulatory sequences.
  • the human variable region repertoire may be used to generate antibody producing B-cells, which may be processed into hybridomas by known techniques.
  • a XenoMouse® immunized with a target antigen will produce human antibodies by the normal immune response, which may be harvested and/or produced by standard techniques discussed above.
  • a variety of strains of XenoMouse® are available, each of which is capable of producing a different class of antibody.
  • Transgenically produced human antibodies have been shown to have therapeutic potential, while retaining the pharmacokinetic properties of normal human antibodies (Green et al., 1999).
  • the skilled artisan will realize that the claimed compositions and methods are not limited to use of the XenoMouse® system but may utilize any transgenic animal that has been genetically engineered to produce human antibodies.
  • Antibody fragments which recognize specific epitopes can be generated by known techniques.
  • Antibody fragments are antigen binding portions of an antibody, such as F(ab') 2; Fab', F(ab) 2 , Fab, Fv, sFv and the like.
  • F(ab') 2 fragments can be produced by pepsin digestion of the antibody molecule and Fab' fragments can be generated by reducing disulfide bridges of the F(ab') 2 fragments.
  • Fab' expression libraries can be constructed (Huse et al, 1989, Science, 246:1274-1281) to allow rapid and easy identification of monoclonal Fab' fragments with the desired specificity.
  • F(ab) 2 fragments may be generated by papain digestion of an antibody and Fab fragments obtained by disulfide reduction.
  • a single chain Fv molecule comprises a VL domain and a VH domain.
  • the VL and VH domains associate to form a target binding site.
  • These two domains are further covalently linked by a peptide linker (L).
  • L peptide linker
  • An antibody fragment can be prepared by proteolytic hydrolysis of the full length antibody or by expression in E. coli or another host of the DNA coding for the fragment.
  • An antibody fragment can be obtained by pepsin or papain digestion of full length antibodies by conventional methods. These methods are described, for example, by Goldenberg, U.S. Patent Nos. 4,036,945 and 4,331 ,647 and references contained therein. Also, see Nisonoff et al, Arch Biochem. Biophys. 89: 230 (1960); Porter, Biochem. J. 73: 119 (1959), Edelman et ah, in METHODS IN ENZYMOLOGY VOL. 1, page 422 (Academic Press 1967), and Coligan at pages 2.8.1-2.8.10 and 2.10.-2.10.4.
  • Known Antibodies are described, for example, by Goldenberg, U.S. Patent Nos. 4,036,945 and 4,331 ,647 and references contained therein. Also, see Nisonoff et al, Arch Biochem
  • Antibodies of use may be commercially obtained from a wide variety of known sources.
  • a variety of antibody secreting hybridoma lines are available from the American Type Culture Collection (ATCC, Manassas, VA).
  • ATCC American Type Culture Collection
  • VA Manassas
  • a large number of antibodies against various disease targets, including but not limited to tumor-associated antigens, have been deposited at the ATCC and/or have published variable region sequences and are available for use in the claimed methods and compositions. See, e.g., U.S. Patent Nos.
  • antibody sequences or antibody- secreting hybridomas against almost any disease-associated antigen may be obtained by a simple search of the ATCC, NCBI and/or USPTO databases for antibodies against a selected disease-associated target of interest.
  • the antigen binding domains of the cloned antibodies may be amplified, excised, ligated into an expression vector, transfected into an adapted host cell and used for protein production, using standard techniques well known in the art.
  • the disclosed methods and compositions may involve production and use of proteins or peptides with one or more substituted amino acid residues.
  • the DDD and/or AD sequences used to make the vaccine constructs may be further optimized, for example to increase the DDD-AD binding affinity.
  • amino acid substitutions typically involve the replacement of an amino acid with another amino acid of relatively similar properties (i.e., conservative amino acid substitutions).
  • conservative amino acid substitutions The properties of the various amino acids and effect of amino acid substitution on protein structure and function have been the subject of extensive study and knowledge in the art.
  • the hydropathic index of amino acids may be considered (Kyte & Doolittle, 1982, J. MoI. Biol., 157:105-132).
  • the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules.
  • Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte & Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (- 0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • the use of amino acids whose hydropathic indices are within ⁇ 2 is preferred, within ⁇ 1 are more preferred, and within ⁇ 0.5 are even more preferred.
  • Amino acid substitution may also take into account the hydrophilicity of the amino acid residue (e.g., U.S. Pat. No. 4,554,101). Hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0); glutamate (+3.0); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 .+-.1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). Replacement of amino acids with others of similar hydrophilicity is preferred.
  • amino acid side chain For example, it would generally not be preferred to replace an amino acid with a compact side chain, such as glycine or serine, with an amino acid with a bulky side chain, e.g., tryptophan or tyrosine.
  • a compact side chain such as glycine or serine
  • an amino acid with a bulky side chain e.g., tryptophan or tyrosine.
  • the effect of various amino acid residues on protein secondary structure is also a consideration. Through empirical study, the effect of different amino acid residues on the tendency of protein domains to adopt an alpha-helical, beta-sheet or reverse turn secondary structure has been determined and is known in the art (see, e.g., Chou & Fasman, 1974, Biochemistry, 13:222-245; 1978, Ann. Rev. Biochem., 47: 251-276; 1979, Biophys. J., 26:367-384).
  • amino acid substitutions include whether or not the residue is located in the interior of a protein or is solvent exposed.
  • conservative substitutions would include: Asp and Asn; Ser and Thr; Ser and Ala; Thr and Ala; Ala and GIy; He and Val; Val and Leu; Leu and Ile; Leu and Met; Phe and Tyr; Tyr and Trp.
  • conservative substitutions would include: Asp and Asn; Asp and Glu; Glu and GIn; Glu and Ala; GIy and Asn; Ala and Pro; Ala and GIy; Ala and Ser; Ala and Lys; Ser and Thr; Lys and Arg; Val and Leu; Leu and Ile; He and Val; Phe and Tyr.
  • therapeutic agents such as cytotoxic agents, anti-angiogenic agents, pro-apoptotic agents, antibiotics, hormones, hormone antagonists, chemokines, drugs, prodrugs, toxins, enzymes, radionuclides or other agents may be used as adjunct therapies to the vaccine constructs described herein.
  • Drugs of use may possess a pharmaceutical property selected from the group consisting of antimitotic, antikinase, alkylating, antimetabolite, antibiotic, alkaloid, anti-angiogenic, pro-apoptotic agents and combinations thereof.
  • Exemplary drugs of use may include 5-fluorouracil, aplidin, azaribine, anastrozole, anthracyclines, bendamustine, bleomycin, bortezomib, bryostatin-1, busulfan, calicheamycin, camptothecin, carboplatin, 10-hydroxycamptothecin, carmustine, celebrex, chlorambucil, cisplatin (CDDP), Cox-2 inhibitors, irinotecan (CPT-1 1), SN-38, carboplatin, cladribine, camptothecans, cyclophosphamide, cytarabine, dacarbazine, docetaxel, dactinomycin, daunorubicin, doxorubicin, 2-pyrrolinodoxorubicine (2P-DOX), cyano-morpholino doxorubicin, doxorubicin glucuronide, epirubicin glucuronide
  • Toxins of use may include ricin, abrin, alpha toxin, saporin, ribonuclease (RNase), e.g., onconase, DNase I, Staphylococcal enterotoxin-A, pokeweed antiviral protein, gelonin, diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
  • RNase ribonuclease
  • Radionuclides of use include, but are not limited to, 111 In, 177 Lu, 212 Bi, 213 Bi, 211 At, 62 Cu, 67 Cu, 90 Y, 125 I, 131 I 5 32 P, 33 P, 47 Sc, 111 Ag, 67 Ga, 142 Pr, 153 Sm, 161 Tb, 166 Dy, 166 Ho, 186 Re, 188 Re, 189 Re, 212 Pb, 223 Ra, 225 Ac, 59 Fe, 75 Se, 77 As, 89 Sr, 99 Mo, 105 Rh, 109 Pd, 143 Pr, 149 Pm, 169 Er, 194 Ir, 198 Au, 199 Au, and 211 Pb.
  • the therapeutic radionuclide preferably has a decay-energy in the range of 20 to 6,000 keV, preferably in the ranges 60 to 200 keV for an Auger emitter, 100-2,500 keV for a beta emitter, and 4,000-6,000 keV for an alpha emitter.
  • Maximum decay energies of useful beta-particle-emitting nuclides are preferably 20-5,000 keV, more preferably 100-4,000 keV, and most preferably 500-2,500 keV. Also preferred are radionuclides that substantially decay with Auger-emitting particles.
  • beta-particle-emitting nuclides are preferably ⁇ 1,000 keV, more preferably ⁇ 100 keV, and most preferably ⁇ 70 keV.
  • radionuclides that substantially decay with generation of alpha-particles. Such radionuclides include, but are not limited to: Dy-152, At-211, Bi-212, Ra-223, Rn-219, Po-215, Bi-21 1, Ac-225, Fr-221, At-217, Bi-213 and Fm-255.
  • Decay energies of useful alpha-particle-emitting radionuclides are preferably 2,000-10,000 keV, more preferably 3,000-8,000 keV, and most preferably 4,000-7,000 keV.
  • Additional potential radioisotopes of use include 11 C, 13 N, 15 O, 75 Br, 198 Au, 224 Ac, 126 I, 133 I 5 77 Br 5 113m In, 95 Ru, 97 Ru, 103 Ru, 105 Ru, 107 Hg, 203 Hg, 121m Te, 122m Te, 125m Te 5 165 Tm, 167 Tm, 168 Tm, 197 Pt 5 109 Pd, 105 Rh 5 142 Pr 5 143 Pr, 161 Tb, 166 Ho, 199 Au, 57 Co 5 58 Co, 51 Cr, 59 Fe, 75 Se, 201 Tl, 225 Ac, 76 Br, 169 Yb, and the like.
  • Some useful diagnostic nuclides may include 18 F, 52 Fe, 62 Cu 5 64 Cu 5 67 Cu, 67 Ga, 68 Ga, 86 Y, 89 Zr 5 94 Tc 5 94m Tc, 99m Tc, or 111 In.
  • Therapeutic agents may include a photoactive agent or dye.
  • Fluorescent compositions such as fluorochrome, and other chromogens, or dyes, such as porphyrins sensitive to visible light, have been used to detect and to treat lesions by directing the suitable light to the lesion. In therapy, this has been termed photoradiation, phototherapy, or photodynamic therapy. See Jori et al. (eds.), PHOTODYNAMIC THERAPY OF TUMORS AND OTHER DISEASES (Libreria Progetto 1985); van den Bergh, Chem. Britain (1986), 22:430. Moreover, monoclonal antibodies have been coupled with photoactivated dyes for achieving phototherapy. See Mew et al., J. Immunol.
  • oligonucleotides especially antisense oligonucleotides that preferably are directed against oncogenes and oncogene products, such as bcl-2 or p53.
  • a preferred form of therapeutic oligonucleotide is siRNA.
  • the therapeutic agent is an immunomodulator.
  • An immunomodulator is an agent that when present, alters, suppresses or stimulates the body's immune system. Such agents may be particularly useful in conjunction with vaccines to further modulate immune system function. Immunomodulators of use may include a cytokine, a stem cell growth factor, a lymphotoxin, a hematopoietic factor, a colony stimulating factor (CSF), an interferon (IFN), erythropoietin, thrombopoietin and a combination thereof.
  • CSF colony stimulating factor
  • IFN interferon
  • lymphotoxins such as tumor necrosis factor (TNF), hematopoietic factors, such as interleukin (IL), colony stimulating factor, such as granulocyte-colony stimulating factor (G-CSF) or granulocyte macrophage-colony stimulating factor (GM-CSF), interferon, such as interferons- ⁇ , - ⁇ or - ⁇ , and stem cell growth factor, such as that designated "Sl factor”.
  • TNF tumor necrosis factor
  • IL interleukin
  • colony stimulating factor such as granulocyte-colony stimulating factor (G-CSF) or granulocyte macrophage-colony stimulating factor (GM-CSF)
  • interferon such as interferons- ⁇ , - ⁇ or - ⁇
  • stem cell growth factor such as that designated "Sl factor”.
  • the effector moieties are cytokines, such as lymphokines, monokines, growth factors and traditional polypeptide hormones. Included among the cytokines are growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); placenta growth factor (PlGF), hepatic growth factor; prostaglandin, fibroblast growth factor; prolactin; placental lactogen, OB protein; tumor necrosis factor- ⁇ and - ⁇ ; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as N
  • amino acid sequences of protein or peptide immunomodulators such as cytokines
  • cytokines any such known sequences may be used in the practice of the instant invention.
  • the skilled artisan is aware of numerous sources of public information on cytokine sequence.
  • the NCBI database contains both protein and encoding nucleic acid sequences for a large number of cytokines and immunomodulators, such as erythropoietin (GenBank NM 000799), IL-I beta (GenPept AAH08678), GM-CSF (GenPept AAA52578), TNF- ⁇ (GenPept CAA26669), interferon-alpha (GenPept AAA52716.1), interferon-alpha 2b (GenPept AAP20099.1) and virtually any of the peptide or protein immunomodulators listed above. It is a matter of routine for the skilled artisan to identify an appropriate amino acid and/or nucleic acid sequence for essentially any protein or peptide effector moiety of interest.
  • Commercial sources of cytokines are also available and may be used, such as the full-length human IFN- ⁇ 2b cDNA clone (Invitrogen Ultimate ORF human clone cat# HORFOlClone ID IOH35221).
  • Chemokines of use may include RANTES, MCAF, MIPl -alpha, MIPl -Beta and IP-IO.
  • anti-angiogenic agents such as angiostatin, baculostatin, canstatin, maspin, anti-VEGF antibodies, anti-PIGF peptides and antibodies, anti-vascular growth factor antibodies, anti -FIk-I antibodies, anti-Fit- 1 antibodies and peptides, anti-Kras antibodies, anti-cMET antibodies, anti-MIF (macrophage migration-inhibitory factor) antibodies, laminin peptides, fibronectin peptides, plasminogen activator inhibitors, tissue metalloproteinase inhibitors, interferons, interleukin-12, IP-10, Gro- ⁇ , thrombospondin, 2- methoxyoestradiol, proliferin-related protein, carboxiamidotriazole, CMlOl, Marimastat, pentosan polysulphate, angiopoietin-2, interferon-alpha, herbimycin A, PNU145156E, 16
  • the antibody or vaccine construct may be conjugated to one or more therapeutic agents.
  • I can be incorporated into a tyrosine of a protein or peptide, or a drug attached to an epsilon amino group of a lysine residue.
  • Therapeutic agents also can be attached, for example to reduced SH groups.
  • Many methods for making covalent or non-covalent conjugates of therapeutic agents with proteins or peptides are known in the art and any such known method may be utilized.
  • a therapeutic agent can be attached using a heterobifunctional cross-linker, such as N- succinyl 3-(2-pyridyldithio)propionate (SPDP). Yu et al, Int. J. Cancer 56: 244 (1994).
  • SPDP N- succinyl 3-(2-pyridyldithio)propionate
  • a chelating agent may be attached to a protein or peptide and used to chelate a therapeutic agent, such as a radionuclide.
  • a therapeutic agent such as a radionuclide.
  • exemplary chelators include but are not limited to DTPA (such as Mx-DTPA), DOTA, TETA, NETA or NOTA.
  • Methods of conjugation and use of chelating agents to attach metals or other ligands to proteins or peptides are well known in the art (see, e.g., U.S. Patent No. 7,563,433, the Examples section of which is incorporated herein by reference).
  • Particularly useful metal-chelate combinations include 2- benzyl-DTPA and its monomethyl and cyclohexyl analogs, used with diagnostic isotopes in the general energy range of 60 to 4,000 keV, such as 125 1, 131 I, 123 I, 124 1, 62 Cu, 64 Cu, 18 F, 111 In, 67 Ga, 68 Ga, 99m Tc, 94m Tc, 11 C, 13 N, 15 O or 76 Br for radioimaging.
  • the same chelates, when complexed with non-radioactive metals, such as manganese, iron and gadolinium are useful for MRI.
  • Macrocyclic chelates such as NOTA, DOTA, and TETA are of use with a variety of metals and radiometals, most particularly with radionuclides of gallium, yttrium and copper, respectively. Such metal-chelate complexes can be made very stable by tailoring the ring size to the metal of interest.
  • Other ring-type chelates such as macrocyclic polyethers, which are of interest for stably binding nuclides, such as 223 Ra for RAIT are encompassed.
  • radioactive metals or paramagnetic ions may be attached to proteins or peptides by reaction with a reagent having a long tail, to which may be attached a multiplicity of chelating groups for binding ions.
  • Such a tail can be a polymer such as a polylysine, polysaccharide, or other derivatized or derivatizable chains having pendant groups to which can be bound chelating groups such as, e.g., ethyl enediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), porphyrins, polyamines, crown ethers, bis-thiosemicarbazones, polyoximes, and like groups known to be useful for this purpose.
  • EDTA ethyl enediaminetetraacetic acid
  • DTPA diethylenetriaminepentaacetic acid
  • porphyrins porphyrins
  • polyamines e.g., ethyl enediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), porphyrins, polyamines, crown ethers, bis-thiosemicarbazones, polyoximes,
  • the carbohydrate group can be used to increase the loading of the same agent that is bound to a thiol group, or the carbohydrate moiety can be used to bind a different therapeutic agent.
  • Methods for conjugating peptides to antibody components via an antibody carbohydrate moiety are well-known to those of skill in the art. See, for example, Shih et al, Int. J. Cancer 47:832 (1988); Shih et al, Int. J. Cancer 46 ⁇ ⁇ 0 ⁇ (1990); and Shih et al, U.S. Patent No. 5,057,313, incorporated herein in their entirety by reference.
  • the general method involves reacting an antibody component having an oxidized carbohydrate portion with a carrier polymer that has at least one free amine function. This reaction results in an initial Schiff base (imine) linkage, which can be stabilized by reduction to a secondary amine to form the final conjugate.
  • the Fc region may be absent if the antibody used as the antibody component of the immunoconjugate is an antibody fragment.
  • a carbohydrate moiety into the light chain variable region of a full length antibody or antibody fragment. See, for example, Leung et al, J. Immunol. 154 ⁇ 59 ⁇ 9 (1995); Hansen et al, U.S. Patent No. 5,443,953 (1995), Leung et al, U.S. patent No. 6,254,868, incorporated herein by reference in their entirety.
  • the engineered carbohydrate moiety is used to attach the therapeutic agent.
  • Various embodiments concern methods of treating a cancer in a subject, such as a mammal, including humans, domestic or companion pets, such as dogs and cats, comprising administering to the subject a therapeutically effective amount of a vaccine construct.
  • the administration of vaccine construct can be supplemented by administering concurrently or sequentially a therapeutically effective amount of an antibody that binds to or is reactive with an antigen on the surface of the target cell as discussed above.
  • the vaccine construct therapy can be further supplemented with the administration, either concurrently or sequentially, of at least one therapeutic agent.
  • at least one therapeutic agent for example, "CVB" (1.5 g/m 2 cyclophosphamide, 200-400 mg/m 2 etoposide, and 150-200 mg/m 2 carmustine) is a regimen used to treat non-Hodgkin's lymphoma. Patti et al, Eur. J. Haematol. 51: 18 (1993).
  • Other suitable combination chemotherapeutic regimens are well-known to those of skill in the art.
  • first generation chemotherapeutic regimens for treatment of intermediate-grade non-Hodgkin's lymphoma include C-MOPP (cyclophosphamide, vincristine, procarbazine and prednisone) and CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone).
  • a useful second generation chemotherapeutic regimen is m- BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone and leucovorin), while a suitable third generation regimen is MACOP-B (methotrexate, doxorubicin, cyclophosphamide, vincristine, prednisone, bleomycin and leucovorin).
  • Additional useful drugs include phenyl butyrate, bendamustine, and bryostatin-1.
  • Sterile phosphate-buffered saline is one example of a pharmaceutically suitable excipient.
  • suitable excipients are well-known to those in the art. See, for example, Ansel et al, PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger 1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing Company 1990), and revised editions thereof.
  • the vaccine construct can be formulated for intravenous administration via, for example, bolus injection or continuous infusion.
  • vaccine construct is infused over a period of less than about 4 hours, and more preferably, over a period of less than about 3 hours.
  • the first 25-50 mg could be infused within 30 minutes, preferably even 15 min, and the remainder infused over the next 2-3 hrs.
  • Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • a suitable vehicle e.g., sterile pyrogen-free water
  • Additional pharmaceutical methods may be employed to control the duration of action of the vaccine construct.
  • Control release preparations can be prepared through the use of polymers to complex or adsorb the vaccine construct.
  • biocompatible polymers include matrices of poly(ethylene-co-vinyl acetate) and matrices of a polyanhydride copolymer of a stearic acid dimer and sebacic acid. Sherwood et al, Bio/Technology 10: 1446 (1992).
  • the rate of release from such a matrix depends upon the molecular weight of the vaccine construct, the amount of vaccine construct within the matrix, and the size of dispersed particles. Saltzman et ah, Biophys. J. 55: 163 (1989); Sherwood et ah, supra.
  • Other solid dosage forms are described in Ansel et ah, PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger 1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing Company 1990), and revised editions thereof.
  • the vaccine construct may also be administered to a mammal subcutaneously or even by other parenteral routes. Moreover, the administration may be by continuous infusion or by single or multiple boluses. Preferably, the vaccine construct is infused over a period of less than about 4 hours, and more preferably, over a period of less than about 3 hours. [0136] More generally, the dosage of an administered vaccine construct for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. The dosage may be repeated as needed, for example, once per week for 4-10 weeks, once per week for 8 weeks, or once per week for 4 weeks.
  • a vaccine construct may be administered as one dosage every 2 or 3 weeks, repeated for a total of at least 3 dosages. Or, the construct may be administered twice per week for 4-6 weeks.
  • the dosing schedule can optionally be repeated at other intervals and dosage may be given through various parenteral routes, with appropriate adjustment of the dose and schedule.
  • the vaccine constructs are of use for therapy of cancer.
  • cancers include, but are not limited to, carcinoma, lymphoma, glioblastoma, melanoma, sarcoma, and leukemia, myeloma, or lymphoid malignancies. More particular examples of such cancers are noted below and include: squamous cell cancer (e.g., epithelial squamous cell cancer), Ewing sarcoma, Wilms tumor, astrocytomas, lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma multiforme, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, hepatocellular carcinoma, neuroendocrine tumors, medullary thyroid cancer, differentiated thyroid carcinoma, breast cancer, ovarian cancer, colon cancer, rectal
  • cancer includes primary malignant cells or tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
  • primary malignant cells or tumors e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor
  • secondary malignant cells or tumors e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor.
  • cancers or malignancies include, but are not limited to: Acute Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia, Acute Lymphocytic Leukemia, Acute Myeloid Leukemia, Adrenocortical Carcinoma, Adult (Primary) Hepatocellular Cancer, Adult (Primary) Liver Cancer, Adult Acute Lymphocytic Leukemia, Adult Acute Myeloid Leukemia, Adult Hodgkin's Lymphoma, Adult Lymphocytic Leukemia, Adult Non-Hodgkin's Lymphoma, Adult Primary Liver Cancer, Adult Soft Tissue Sarcoma, AIDS-Related Lymphoma, AIDS-Related Malignancies, Anal Cancer, Astrocytoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Brain Stem Glioma, Brain Tumors, Breast Cancer, Cancer of the Renal Pelvis and Ureter, Central Nervous System (Primary) Ly
  • the methods and compositions described and claimed herein may be used to treat malignant or premalignant conditions and to prevent progression to a neoplastic or malignant state, including but not limited to those disorders described above. Such uses are indicated in conditions known or suspected of preceding progression to neoplasia or cancer, in particular, where non-neoplastic cell growth consisting of hyperplasia, metaplasia, or most particularly, dysplasia has occurred (for review of such abnormal growth conditions, see Robbins and Angell, Basic Pathology, 2d Ed., W. B. Saunders Co., Philadelphia, pp. 68-79 (1976)).
  • Dysplasia is frequently a forerunner of cancer, and is found mainly in the epithelia.
  • Dysplasia characteristically occurs where there exists chronic irritation or inflammation.
  • Dysplastic disorders which can be treated include, but are not limited to, anhidrotic ectodermal dysplasia, anterofacial dysplasia, asphyxiating thoracic dysplasia, atriodigital dysplasia, bronchopulmonary dysplasia, cerebral dysplasia, cervical dysplasia, chondroectodermal dysplasia, cleidocranial dysplasia, congenital ectodermal dysplasia, craniodiaphysial dysplasia, craniocarpotarsal dysplasia, craniometaphysial dysplasia, dentin dysplasia, diaphysial dysplasia, ectodermal dysplasia, enamel dysplasia, encephalo-o
  • Additional pre-neoplastic disorders which can be treated include, but are not limited to, benign dysproliferative disorders (e.g., benign tumors, fibrocystic conditions, tissue hypertrophy, intestinal polyps or adenomas, and esophageal dysplasia), leukoplakia, keratoses, Bowen's disease, Farmer's Skin, solar cheilitis, and solar keratosis.
  • the method of the invention is used to inhibit growth, progression, and/or metastasis of cancers, in particular those listed above.
  • Additional hyperproliferative diseases, disorders, and/or conditions include, but are not limited to, progression, and/or metastases of malignancies and related disorders such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, lipos
  • kits containing components suitable for treating a disease in a patient.
  • Exemplary kits may contain at least one or more vaccine constructs as described herein.
  • a device capable of delivering the kit components through some other route may be included.
  • One type of device, for applications such as parenteral delivery, is a syringe that is used to inject the composition into the body of a subject. Inhalation devices may also be used.
  • a therapeutic agent may be provided in the form of a prefilled syringe or autoinjection pen containing a sterile, liquid formulation or lyophilized preparation.
  • the kit components may be packaged together or separated into two or more containers.
  • the containers may be vials that contain sterile, lyophilized formulations of a composition that are suitable for reconstitution.
  • a kit may also contain one or more buffers suitable for reconstitution and/or dilution of other reagents.
  • Other containers that may be used include, but are not limited to, a pouch, tray, box, tube, or the like.
  • Kit components may be packaged and maintained sterilely within the containers. Another component that can be included is instructions to a person using a kit for its use.
  • Still other embodiments may concern DNA sequences comprising a nucleic acid encoding an anti-cancer vaccine construct, or its constituent fusion proteins.
  • Fusion proteins may comprise an anti-CD74 antibody or CD20 xenoantigen attached to a different peptide or protein, such as the AD and DDD peptides utilized for DNL construct formation as discussed in more detail in the Examples below.
  • the encoded fusion proteins may comprise a DDD or AD moiety attached to a different antibody or xenoantigen.
  • Various embodiments relate to expression vectors comprising the coding DNA sequences.
  • the vectors may contain sequences encoding the light and heavy chain constant regions and the hinge region of a human immunoglobulin to which may be attached chimeric, humanized or human variable region sequences.
  • the vectors may additionally contain promoters that express the encoded protein(s) in a selected host cell, enhancers and signal or leader sequences. Vectors that are particularly useful are pdHL2 or GS.
  • the light and heavy chain constant regions and hinge region may be from a human EU myeloma immunoglobulin, where optionally at least one of the amino acid in the allotype positions is changed to that found in a different IgGl allotype, and wherein optionally amino acid 253 of the heavy chain of EU based on the EU number system may be replaced with alanine.
  • an IgGl sequence may be converted to an IgG4 sequence.
  • Exemplary DNL- vaccine constructs may be formed by combining, for example, an Fab-DDD fusion protein of an anti-CD74 antibody with a CD20-AD fusion protein.
  • constructs may be made that combine IgG-AD fusion proteins with CD20- DDD fusion proteins.
  • the technique is not limiting and any protein or peptide of use may be produced as an AD or DDD fusion protein for incorporation into a DNL construct.
  • the AD and DDD conjugates are not limited to proteins or peptides and may comprise any molecule that may be cross-linked to an AD or DDD sequence using any cross-linking technique known in the art.
  • independent transgenic cell lines may be developed for each DDD or AD fusion protein. Once produced, the modules can be purified if desired or maintained in the cell culture supernatant fluid. Following production, any DDD-fusion protein module can be combined with any AD-fusion protein module to generate a DNL construct. For different types of constructs, different AD or DDD sequences may be utilized. Exemplary DDD and AD sequences are discussed above.
  • the plasmid vector pdHL2 has been used to produce a number of antibodies and antibody-based constructs. See Gillies et al., J Immunol Methods (1989), 125:191-202; Losman et al., Cancer (Phila) (1997), 80:2660-6.
  • the di-cistronic mammalian expression vector directs the synthesis of the heavy and light chains of IgG.
  • the vector sequences are mostly identical for many different IgG-pdHL2 constructs, with the only differences existing in the variable domain (VH and VL) sequences. Using molecular biology tools known to those skilled in the art, these IgG expression vectors can be converted into Fab-DDD or Fab- AD expression vectors.
  • Fab-DDD expression vectors To generate Fab-DDD expression vectors, the coding sequences for the hinge, CH2 and CH3 domains of the heavy chain are replaced with a sequence encoding the first 4 residues of the hinge, a 14 residue Gly-Ser linker and the first 44 residues of human RIIa (referred to as DDDl).
  • ADl AKAP-/5 1
  • Two shuttle vectors were designed to facilitate the conversion of IgG-pdHL2 vectors to either Fab-DDD 1 or Fab- ADl expression vectors, as described below.
  • the CHl domain was amplified by PCR using the pdHL2 plasmid vector as a template.
  • the left PCR primer consisted of the upstream (5') end of the CHl domain and a SacII restriction endonuc lease site, which is 5' of the CHl coding sequence.
  • the right primer consisted of the sequence coding for the first 4 residues of the hinge (PKSC (SEQ ID NO:21)) followed by four glycines and a serine, with the final two codons (GS) comprising a Bam HI restriction site.
  • the 410 bp PCR amplimer was cloned into the PGEMT® PCR cloning vector (PROMEGA®, Inc.) and clones were screened for inserts in the T7 (5') orientation.
  • a duplex oligonucleotide, designated (G 4 S) 2 DDDl ((G 4 S) 2 disclosed as SEQ ID NO:22) was synthesized by Sigma GENOSYS® (Haverhill, UK) to code for the amino acid sequence of DDDl preceded by 11 residues of the linker peptide, with the first two codons comprising a BamHI restriction site. A stop codon and an Eagl restriction site are appended to the 3 'end.
  • the encoded polypeptide sequence is shown below.
  • oligonucleotides designated RIIA 1-44 top and RIIA 1-44 bottom, that overlap by 30 base pairs on their 3' ends, were synthesized (Sigma GENOSYS®) and combined to comprise the central 154 base pairs of the 174 bp DDDl sequence.
  • the oligonucleotides were annealed and subjected to a primer extension reaction with Taq polymerase. Following primer extension, the duplex was amplified by PCR. The amplimer was cloned into PGEMT® and screened for inserts in the T7 (5') orientation.
  • GSGGGGSGGGGSOIEYLAKOIVDNAIOQA (SEQ ID NO:24)
  • a 190 bp fragment encoding the DDDl sequence was excised from PGEMT® with BamHI and Notl restriction enzymes and then ligated into the same sites in CHl -PGEMT® to generate the shuttle vector CHl -DDDl -PGEMT®.
  • a 110 bp fragment containing the ADl sequence was excised from PGEMT® with BamHI and Notl and then ligated into the same sites in CHl -PGEMT® to generate the shuttle vector CHl -ADl -PGEMT®.
  • CHl-DDDl or CHl-ADl can be incorporated into any IgG construct in the pdHL2 vector.
  • the entire heavy chain constant domain is replaced with one of the above constructs by removing the SacII/Eagl restriction fragment (CH1-CH3) from pdHL2 and replacing it with the SacII/Eagl fragment of CHl-DDDl or CHl-ADl, which is excised from the respective pGemT shuttle vector.
  • h679-Fd-ADl-pdHL2 is an expression vector for production of h679 Fab with ADl coupled to the carboxyl terminal end of the CHl domain of the Fd via a flexible Gly/Ser peptide spacer composed of 14 amino acid residues.
  • a pdHL2-based vector containing the variable domains of h679 was converted to h679-Fd-ADl-pdHL2 by replacement of the SacII/Eagl fragment with the CHl-ADl fragment, which was excised from the CHl-ADl- SV3 shuttle vector with SacII and Eagl.
  • C-DDD l-Fd-hMN-14-pdHL2 is an expression vector for production of a stable dimer that comprises two copies of a fusion protein C-DDD 1-Fab-hMN- 14, in which DDDl is linked to hMN-14 Fab at the carboxyl terminus of CHl via a flexible peptide spacer.
  • the plasmid vector hMN-14(I)-pdHL2 which has been used to produce hMN-14 IgG, was converted to C-DDD l-Fd-hMN-14-pdHL2 by digestion with SacII and Eagl restriction endonucleases to remove the CH1-CH3 domains and insertion of the CHl-DDDl fragment, which was excised from the CH1-DDD1-SV3 shuttle vector with SacII and Eagl.
  • C-DDD2-Fd-hMN-14-pdHL2 is an expression vector for production of C-DDD2-Fab- hMN-14, which possesses a dimerization and docking domain sequence of DDD2 appended to the carboxyl terminus of the Fd of hMN-14 via a 14 amino acid residue Gly/Ser peptide linker.
  • the fusion protein secreted is composed of two identical copies of hMN-14 Fab held together by non-covalent interaction of the DDD2 domains.
  • the expression vector was engineered as follows. Two overlapping, complimentary oligonucleotides, which comprise the coding sequence for part of the linker peptide (GGGGSGGGCG, SEQ ID NO:25) and residues 1-13 of DDD2, were made synthetically. The oligonucleotides were annealed and phosphorylated with T4 PNK, resulting in overhangs on the 5' and 3' ends that are compatible for ligation with DNA digested with the restriction endonucleases BamHI and Pstl, respectively.
  • the duplex DNA was ligated with the shuttle vector CH1-DDD1-PGEMT®, which was prepared by digestion with BamHI and Pstl, to generate the shuttle vector CH1-DDD2- PGEMT®.
  • a 507 bp fragment was excised from CH1-DDD2-PGEMT® with SacII and Eagl and ligated with the IgG expression vector hMN-14(I)-pdHL2, which was prepared by digestion with SacII and Eagl.
  • the final expression construct was designated C-DDD2-Fd- hMN-14-pdHL2. Similar techniques have been utilized to generated DDD2-fusion proteins of the Fab fragments of a number of different humanized antibodies.
  • h679-Fd-AD2-pdHL2 is an expression vector for the production of h679-Fab-AD2, which possesses an anchoring domain sequence of AD2 appended to the carboxyl terminal end of the CHl domain via a 14 amino acid residue Gly/Ser peptide linker. AD2 has one cysteine residue preceding and another one following the anchor domain sequence of ADl.
  • the expression vector was engineered as follows. Two overlapping, complimentary oligonucleotides which comprise the coding sequence for AD2 and part of the linker sequence, were made synthetically.
  • the oligonucleotides were annealed and phosphorylated with T4 PNK, resulting in overhangs on the 5' and 3' ends that are compatible for ligation with DNA digested with the restriction endonucleases BamHI and Spel, respectively.
  • the duplex DNA was ligated into the shuttle vector CH1-AD1-PGEMT®, which was prepared by digestion with BamHI and Spel, to generate the shuttle vector CH1-AD2- PGEMT®.
  • a 429 base pair fragment containing CHl and AD2 coding sequences was excised from the shuttle vector with SacII and Eagl restriction enzymes and ligated into h679-pdHL2 vector that prepared by digestion with those same enzymes.
  • the final expression vector is h679-Fd-AD2-pdHL2. Generation ofTF2 Trimeric DNL Construct
  • a trimeric DNL construct designated TF2 was obtained by reacting C-DDD2-Fab- hMN-14 with h679-Fab-AD2.
  • a pilot batch of TF2 was generated with >90% yield as follows.
  • Protein L-purified C-DDD2-Fab-hMN-14 200 mg was mixed with h679-Fab-AD2 (60 mg) at a 1.4: 1 molar ratio.
  • the total protein concentration was 1.5 mg/ml in PBS containing 1 mM EDTA.
  • Subsequent steps involved TCEP reduction, HIC chromatography, DMSO oxidation, and IMP 291 affinity chromatography. Before the addition of TCEP, SE- HPLC did not show any evidence of a 2 b formation.
  • TF2 was purified to near homogeneity by IMP 291 affinity chromatography (not shown).
  • IMP 291 is a synthetic peptide containing the HSG hapten to which the 679 Fab binds (Rossi et al., 2005, Clin Cancer Res 11 :7122s-29s).
  • SE-HPLC analysis of the IMP 291 unbound fraction demonstrated the removal of a 4 , a 2 and free kappa chains from the product (not shown).
  • Non-reducing SDS-PAGE analysis demonstrated that the majority of TF2 exists as a large, covalent structure with a relative mobility near that of IgG (not shown). Reducing SDS-PAGE shows that any additional bands apparent in the non-reducing gel are product- related (not shown), as only bands representing the constituent polypeptides of TF2 were evident (not shown). However, the relative mobilities of each of the four polypeptides were too close to be resolved.
  • MALDI-TOF mass spectrometry revealed a single peak of 156,434 Da, which is within 99.5% of the calculated mass (157,319 Da) of TF2.
  • TF2 C-DDDl- hMN-14+h679-ADl (used as a control sample of noncovalent a 2 b complex), or C-DDD2- hMN-14+h679-AD2 (used as a control sample of unreduced a 2 and b components) were diluted to 1 ⁇ g/ml (total protein) and passed over a sensorchip immobilized with HSG.
  • the response for TF2 was approximately two-fold that of the two control samples, indicating that only the h679-Fab-AD component in the control samples would bind to and remain on the sensorchip.
  • a plasmid shuttle vector was produced to facilitate the conversion of any IgG-pdHL2 vector into a CH 3 -AD2-IgG-pdHL2 vector.
  • the gene for the Fc (C H2 and C H3 domains) was amplified by PCR using the pdHL2 vector as a template and the following oligonucleotide primers:
  • the amplimer was cloned in the pGemT PCR cloning vector (Promega).
  • the Fc insert fragment was excised from pGemT with Xba I and Bam HI and ligated with AD2-pdHL2 vector that was prepared by digesting h679-Fab-AD2-pdHL2 (Rossi et al., Proc Natl Acad Sci USA 2006, 103:6841-6) with Xba I and Bam HI, to generate the shuttle vector Fc-AD2- pdHL2.
  • C H3 -AD2- IgG-pdHL2 vectors (30 ⁇ g) were linearized by digestion with Sal I restriction endonuclease and transfected into Sp2/0-Agl4 (2.8 x 10 6 cells) by electroporation (450 volts, 25 ⁇ F).
  • the pdHL2 vector contains the gene for dihydrofolate reductase allowing clonal selection as well as gene amplification with methotrexate (MTX).
  • transgenic clones were selected in media containing 0.2 ⁇ M MTX.
  • Clones were screened for C H3 -AD2-IgG productivity by a sandwich ELISA using 96-well microtitre plates coated with specific antiidiotype MAbs.
  • Conditioned media from the putative clones were transferred to the micro- plate wells and detection of the fusion protein was accomplished with horseradish peroxidase-conjugated goat anti-human IgG F(ab') 2 (Jackson ImmunoResearch Laboratories, West Grove, PA). Wells giving the highest signal were expanded and ultimately used for production.
  • roller bottle cultures were seeded at 2 x 10 5 cells/ml and incubated in a roller bottle incubator at 37 0 C under 5% CO 2 until the cell viability dropped below 25% (-10 days).
  • Culture broth was clarified by centrifugation, filtered, and concentrated up to 50-fold by ultrafiltration.
  • concentrated supernatant fluid was loaded onto a Protein-A (MAB Select) affinity column. The column was washed to baseline with PBS and the fusion proteins were eluted with 0.1 M Glycine, pH 2.5.
  • DDD2-mCD20(136-178)-pdHL2 is the expression vector for DDD2-mCD20(136- 178), which comprises DDD2-linker-mCD20(136-178)-HHHHHH (HHHHHH disclosed as SEQ ID NO:28).
  • the extracellular domain of mouse CD20 (mCD20) is referred to as mCD20(136-178), comprising the sequence shown below:
  • the PCR amplimer (141 bp) is cloned into the PGEMT® vector (PROMEGA®).
  • a DDD2-pdHL2 mammalian expression vector for example, N-DDD2-hG-CSF-His-pdHL2, is prepared for ligation with the amplimer by digestion with Xbal and Bam HI restriction endonucleases.
  • the mCD20-amplimer is excised from PGEMT® with Xbal and Bam HI and ligated into the DDD2-pdHL2 vector to generate the expression vector DDD2-mCD20(l 36- 178)-pdHL2.
  • the vector DDD2-mCD20(l 36-178) is linearized by digestion with Sail enzyme and stably transfected into SpESF myeloma cells by electroporation (see, e.g., U.S. Patent 7,537,930, the Examples section of which is incorporated herein by reference).
  • a number of clones are found to have detectable levels of DDD2-mCD20(136-178) by ELISA, from which the best producing clone is selected and subsequently amplified with increasing methotrexate (MTX) concentrations from 0.1 to 0.8 ⁇ M over five weeks. At this stage, it is sub-cloned by limiting dilution and the highest producing sub-clone is expanded.
  • MTX methotrexate
  • the clone is expanded to 34 roller bottles containing a total of 20 L of serum-free Hybridoma SFM with 0.8 ⁇ M MTX and allowed to reach terminal culture.
  • the supernatant fluid is clarified by centrifugation and filtered (0.2 ⁇ M).
  • the filtrate is diafiltered into IX Binding buffer (10 mM imidazole, 0.5 M NaCl, 50 mM NaH 2 PO 4 , pH 7.5) and concentrated to 310 mL in preparation for purification by immobilized metal affinity chromatography (IMAC).
  • the concentrate is loaded onto a 30-mL Ni-NTA column, which is washed with 500 niL of 0.02% Tween 20 in IX binding buffer and then 290 mL of 30 mM imidazole, 0.02% Tween 20, 0.5 M NaCl, 50 mM NaH 2 PO 4 , pH 7.5.
  • the product is eluted with 110 mL of 250 mM imidazole, 0.02% Tween 20, 150 mM NaCl, 50 mM NaH 2 PO 4 , pH 7.5.
  • the purity of DDD2-mCD20(136-178) is assessed by SDS-PAGE under reducing conditions.
  • Example 5 Generation of 74-mCD20 DNL vaccine comprising hLLl IgG linked to four copies of mCD20(136-178)
  • C H3 -AD2-IgG-hLLl (anti-CD74) is produced as described in Examples 2 and 3.
  • the construct comprises an AD2 moiety attached to the C-terminal end of each heavy chain of the hLLl IgG.
  • DDD2-mCD20(136-178) is produced as described in Example 4.
  • a DNL reaction is performed by mixing hLLl IgG- AD2 and DDD2-mCD20(136-178) in PBS containing 1 mM reduced glutathione. On the next day oxidized glutathione is added to a final concentration of 2 mM and the reaction mixture is purified on a Protein A column 24 h later.
  • two copies of the DDD2-mCD20 are attached to each AD2 moiety, resulting in a DNL complex comprising one hLLl IgG moiety and four mCD20 xenoantigen moieties.
  • the Fab of hLLl is linked to DDD2 and the mCD20(136-178) to AD2.
  • Formation of a DNL construct as described above results in the formation of an MM vaccine, designated hLLl-F(ab) 2 -mCD20(136-178), which comprises a single mCD20(136-178) attached to two Fab moieties of hLLl.
  • the generation of AD2- mCD20(136-178) is described in Example 6..
  • AD2-mCD20(136-178)-pdHL2 is the expression vector for recombinant AD2- mCD20(136-178), which comprises AD2-linker-mCD20(136-178)-HHHHHH (HHHHHH disclosed as SEQ ID NO:28).
  • the DNA segment comprising the nucleotide sequence of mCD20(136-178) flanked by BgIl and Eag ⁇ restriction sites is obtained by PCR using a full length murine CD20 cDNA clone as template and the two primers shown below: Upstream primer: Bgl2_mCD20 primer (30-mer) 5'- AGATCTACACTTTCTCATTTTTTAAAAATG (SEQ ID NO.-33) Downstream primer: Eagl_ mCD20 primer (48-mer)
  • the PCR amplimer (162 bp) is cloned into the PGEMT® vector (PROMEGA®).
  • An AD2-pdHL2 mammalian expression vector for example, N-AD2-hTransferrin-His-pdHL2, is prepared for ligation with the amplimer by digestion with BgYl and Eag ⁇ restriction endonucleases.
  • the mCD20-amplimer is excised from PGEMT® with BgYl and Eagl and ligated into the AD2-pdHL2 vector to generate the expression vector AD2-mCD20(l 36-178)- pdHL2.
  • Clones expressing AD2-mCD20(136-178) are obtained as described in Example 4 and AD2-mCD20(136-178) is purified from culture supernatants using Ni-select.
  • Example 7 Effects of hLLl on DCs - Efficient binding of hLLl with different subsets of APCs
  • CD74 is expressed in most antigen-presenting cells including blood DCs, B cells, monocytes.
  • APCs APCs
  • MDCl myeloid DCl
  • MDC2 DC2
  • PDC plasmacytoid DC
  • hLLl bound efficiently with blood DC subsets, B cells, monocytes, and monocyte-derived immature DCs (FIG. 2C, FIG. 3B), but not LPS-matured DCs (FIG. 3B, FIG. 3C).
  • the binding efficiency of hLLl in these APC subsets correlates well with their CD74 expression levels.
  • Human IgG can interact with DCs through FcR ligation and has opposing effects on DC maturation depending on which subtype(s) of FcR is involved.
  • hLLl as a humanized IgG, may interact with human DCs not only through CD74 but also through FcR expressed on DCs. For this reason, we speculated that hLLl may influence DC functions through interaction with CD74 or FcR, or both. To investigate this, we tested the effect of hLLl on DC constitutive maturation during in vitro culture of monocytes in the presence of hGM-CSF and hIL-4.
  • hLLl As mature DCs differ from immature DCs mainly in the upregulation of antigen-presenting and costimulatory molecule expression, altered cytokine production, and enhanced T-cell stimulatory ability, we then investigated if hLLl has any effect on the expression level of antigen-presenting molecule HLA-DR and costimulatory molecules CD54 and CD86 in DCs (FIG. 5). The results show that hLLl could upregulate HLA-DR, CD54, and CD86 in a dose-dependent manner within the range of hLLl concentrations at 0.05-5ug/ml (FIG. 5A).
  • naive CD4+ T cells toward ThI effector cells by hLLl -treated DCs
  • DCs have another important function: the polarization of na ⁇ ve CD4 T cells to differentiate into different effector cells, ThI, Th2, ThI 7, as well as newly defined ThI 7-1 cells.
  • ThI cells are critical for cellular immunity against intracellular pathogens and cancers, whereas induction of Th2 cells is responsible for humoral immunity.
  • the IL-17-producing ThI 7 and ThI 7-1 cells are other polarized cell populations which have multiple functions in immunity to certain pathogens and autoimmune inflammation.
  • the polarization of these effector cells is largely mediated through DC-secreted cytokines, the so-called "signal 3", that DCs provide to T cells in the DC/T cell synapse.
  • the CD4+ na ⁇ ve T cells can differentiate into ThI, Th2 and ThO cells which mediate different effector functions, among which the ThI effector cells play an essential role in maintaining CTL response against cancer and infectious diseases.
  • ThI, Th2 and ThO cells which mediate different effector functions, among which the ThI effector cells play an essential role in maintaining CTL response against cancer and infectious diseases.
  • hLLl at 0.05 to 50 ⁇ g/ml could enhance DC constitutive maturation in a weak but dose-dependent manner, but DCs treated with these concentrations of hLLl didn't influence the DC-mediated T cell expansion (FIG. 6).
  • hLLl -treated DCs could influence the polarization of CD4+ na ⁇ ve T cells.
  • hLLl -treated DCs polarized the CD4+ na ⁇ ve T cells to differentiate toward more ThI effector cells and fewer Th2 and Tnp cells.
  • Example 8 In vitro properties of 74-mCD20 - Induction of hCD20-specific immunity by 74-mCD20 in human PBMCs
  • CD20 is a self antigen normally expressed on B cells, which is theoretically difficult to target by vaccine strategies due to immune tolerance.
  • specific T-cell immune response to CD20 has been achieved in tumor bearing mice by vaccination with a minigene encoding the extracellular domain of human CD20 (Palomba et al., Clin Cancer Res 2005; 1 1 :370-9), or a conjugate comprising the extracellular domain of human CD20 and a carrier protein with QS21 adjuvant (Roberts et al., Blood 2002; 99:3748-55).
  • Human DCs are generated from PBMCs by culturing for 5 days in the presence of hGM-CSF and hIL-4.
  • the immature DCs are loaded with 74-mCD20, and matured by LPS plus IFN-gamma.
  • the mature DCs are used to stimulate autologous PBMCs for 10 days. Restimulation with the same loaded DCs is performed twice weekly.
  • the T cells are tested for their antigen specificity by measuring cytokine response (IFN-gamma) upon stimulation by sorted CD20-positive MM cancer stem cells.
  • the CD20-negative MM cells are used as a control.
  • the T cells show a positive reaction to CD20-positive MM cancer stem cells but not to control CD20-negative MM cells.
  • 74-mCD20 or Ml-mCD20 are labeled with a ZENONTM ALEXA FLUOR® 488 human IgG labeling kit (INVITROGEN®) following the manufacturer's instructions.
  • the labeled preparations are used to stain the human PBMCs as described below..
  • Human PBMCs isolated from buffy coat using FICOLL-P AQUETM are treated with human FcR blocking Reagent (Miltenyi Biotec, 1 :20 dilution) at 4°C for 10 min. The washed cells are stained with specifically labeled mAbs and analyzed by flow cytometry (FACSCALIBUR®).
  • the labeled mAbs used for the study include FITC-labeled anti-CD74 mAb ALEXA FLUOR® 488-labeled 74-mCD20; ALEXA FLUOR® 488-labeled Ml- mCD20; PE-conjugated anti-CD19 mAb (for B cells); PE-conjugated anti- CD14 mAb (for monocytes); and APC-conjugated mAb to BDCA-I (for MDCl), BDCA-2 (for PDC), or BDCA-3 (for MDC2).
  • a gating strategy is used for identification of B cells, monocytes, MDCl, MDC2, and PDC.
  • 74-mCD20 is internalized to endosomes for further processing to MHC class II presentation and MHC class I cross-presentation, the following experiment is performed. 74-mCD20 or Ml-mCD20 is mixed with human PBMCs, and incubated at 4°C for lhr, followed by extensive washing. The cells are then transferred to 37°C, fixed at different time points (0, 15, 30, or 45 min) and stained with ALEXA FLUOR®-labeled anti-human IgG secondary antibody with or without prior permeabilization.
  • the mean fluorescence is determined by flow cytometry, and the amount of internalized antibody is calculated by subtracting the mean fluorescence in fixed cells (surface bound) from that recorded with fixed and permeabilized cells (internalized and surface bound) at various time points. [0203] The results show that the 74-mCD20 DNL complex has the same efficiency and specificity in binding with APCs as hLLl alone.
  • the specific cytotoxicity against MM cancer stem cells is assessed by a calcein AM release assay with MM cancer stem cells as the target cells.
  • the CD20+ MM cancer stem cells are isolated from the MM cell line RPMI 18226 using magnetic beads.
  • the stem cell property is verified by staining with aldehyde dehydrogenase. The results indicate that 74-mCD20 is capable of inducing an anti-hcd20 specific immune response in vivo.
  • Example 10 Therapeutic Potential of 74-mCD20 against MM Cancer stem cells: In Vivo Evaluation by hPBMC/NOD/SCID Mouse Model or Adoptive Transfer.
  • the best way for in vivo evaluation of the therapeutic effect of 74-mCD20 is to immunize an animal model that can support both the growth of MM and the development of a human adaptive immune system. Since human CD34+ cell-reconstituted Rag2-/- ⁇ c-/- mice are immune-competent, which may not support MM growth, the hPBMC/NOD/SCID mouse model is used to test the therapeutic effect of 74-mCD20against MM stem cells. The NOD/SCID mice have been used for engraftment of clonogenic multiple myeloma stem cells by Matsui et al. (Blood 2004, 103:2332-6; Cancer Res 2008, 68:190-7).
  • NOD/SCID mice are also used for evaluating the therapeutic effect by co- engraftment of tumor cells and hPBMC. By carefully adjusting the cell numbers infused, this model can support both tumor growth and hPBMC engraftment, and has been used for testing the effect of an in vivo vaccine targeting DC-SIGN.
  • mice Four to six-week-old female NOD/SCID mice (Jackson Laboratories, Barr Harbor, Maine) are irradiated with 300 cGy (84 cGy/min using a 137Cs gamma irradiator). 12-16 h later, sorted CD20+ MM cancer stem cells (2 million) are injected via dorsal tail vein. Meanwhile, a mixture of human PBMCs (3 million), immature DC (30,000) and the DNL vaccine is injected into the mice subcutaneously. At certain time points (days), mice are euthanatized and bone marrow is harvested from the long bones and the engraftment and therapeutic efficacy are determined by staining for human CD138 + MM cells.
  • mice are immunized with 74- mCD20 as described above.
  • the splenocytes are harvested and injected via the tail vein into NOD/SCID mice engrafted with CD20+ MM cancer stem cells.
  • mice are euthanatized and bone marrow is harvested from the long bones and the engraftment and therapeutic efficacy are determined by staining for human CD 138+ MM cells.
  • the results confirm that 74-mCD20 is capable of inducing an immune response against CD20 + MM stem cells in vivo.
  • a DDD2 conjugated PAP xenoantigen is generated from murine prostatic acid phosphatase according to the method of Example 4.
  • the efficacy of dendritic cell based vaccination with a PAP xenoantigen has been previously disclosed (Fong et al. J Immunol 2001, 167:7150-56).
  • a DDD2-mPAP-pdHL2 expression vector is constructed as described in Example 4 and the DDD2-mPAP xenoantigen fusion protein is expressed in cell culture according to Example 4.
  • the murine prostatic acid phosphatase sequence is disclosed, for example, in the NCBI database at Accession No. AAF23171.
  • a DDD2-mPAP-6His fusion protein (“6His" disclosed as SEQ ID NO: 28) is expressed and purified by immobilized metal affinity chromatography (IMAC) as described in Example 4.
  • a DNL construct comprising one copy of C H3 -AD2-IgG-hLLl (anti-CD74) and four copies of DDD2-mPAP is prepared according to the methods of Example 5.
  • the hLLl IgG moiety comprises an AD2 sequence attached to the C-terminal end of each heavy chain of the hLLl IgG.
  • a DNL reaction is performed by mixing MXl IgG- AD2 and DDD2-mPAP in PBS containing 1 mM reduced glutathione. On the next day oxidized glutathione is added to a final concentration of 2 mM and the reaction mixture is purified on a Protein A column 24 h later.
  • DNL vaccine anti-CD74-mPAP to subjects with prostate cancer induces an immune response against PAP expressing prostatic cancer stem cells. The immune response is effective to reduce or eliminate prostatic cancer cells in the subjects.
  • a DDD2 conjugated EGFR xenoantigen is generated from murine EGFR according to the method of Example 4.
  • the efficacy of EGFR xenoantigen at inducing a humoral immune response has been previously disclosed (Fang et al. Int J MoI Med 2009, 23:181-88).
  • a DDD2-mEGFR-pdHL2 expression vector comprising the extracellular domain of murine EGFR is constructed as described in Example 4 and the DDD2-mEGFR xenoantigen fusion protein is expressed in cell culture according to Example 4.
  • the murine EGFR sequence is disclosed, for example, in the NCBI database at Accession No. AAG43241.
  • a DDD2- mEGFR-6His fusion protein (“6His” disclosed as SEQ ID NO: 28) is expressed and purified by immobilized metal affinity chromatography (IMAC) as described in Example 4.
  • IMAC immobilized metal affinity chromatography
  • a DNL construct comprising one copy of C H3 -AD2-IgG-hLLl (anti-CD74) and four copies of DDD2-mEGFR is prepared according to the methods of Example 5.
  • the hLLl IgG moiety comprises an AD2 sequence attached to the C-terminal end of each heavy chain of the hLLl IgG.
  • a DNL reaction is performed by mixing hLLl IgG-AD2 and DDD2-mEGFR in PBS containing 1 mM reduced glutathione.
  • DNL vaccine anti-CD74-mEGFR to subjects with EGFR- expressing NSCLC induces an immune response against EGFR-expressing cancer stem cells. The immune response is effective to reduce or eliminate EGFR positive cancer cells in the subjects.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Cette invention concerne des méthodes et des compositions permettant de former des complexes de vaccins anticancéreux. Dans des modes de réalisation préférés, le complexe de vaccin anticancéreux comprend une fraction d'anticorps qui se fixe aux cellules dendritiques, par exemple un anticorps anti-CD74 ou son fragment Fab, attachée à une fraction AD (domaine d'ancrage) et un xénoantigène, par exemple le CD20, fixés à une fraction DDD (domaine de dimérisation et d'accouplage); deux copies de la fraction DDD forment un dimère qui se fixe à la fraction AD, ce qui aboutit à la formation du complexe de vaccin. Ce complexe de vaccin anticancéreux est capable d'induire une réponse immunitaire vis-à-vis des cellules cancéreuses exprimant le xénoantigène, par exemple les cellules souches CD138negCD20+ MM, et d'induire l'apoptose des cellules cancéreuses, d'inhiber leur croissance ou de les éliminer.
PCT/US2010/030045 2009-04-10 2010-04-06 Nouvelles stratégies d'amélioration des vaccins anticancéreux WO2010117984A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP10762283A EP2416807A4 (fr) 2009-04-10 2010-04-06 Nouvelles stratégies d'amélioration des vaccins anticancéreux

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US16829009P 2009-04-10 2009-04-10
US61/168,290 2009-04-10
US12/544,476 US7901680B2 (en) 2005-10-19 2009-08-20 Dock-and-lock (DNL) vaccines for cancer therapy
US12/544,476 2009-08-20

Publications (1)

Publication Number Publication Date
WO2010117984A1 true WO2010117984A1 (fr) 2010-10-14

Family

ID=42936524

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/030045 WO2010117984A1 (fr) 2009-04-10 2010-04-06 Nouvelles stratégies d'amélioration des vaccins anticancéreux

Country Status (2)

Country Link
EP (1) EP2416807A4 (fr)
WO (1) WO2010117984A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070140966A1 (en) * 2005-10-19 2007-06-21 Ibc Pharmaceuticals, Inc. Multivalent immunoglobulin-based bioactive assemblies

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2006232310B9 (en) * 2005-04-06 2011-07-21 Ibc Pharmaceuticals, Inc. Improved stably tethered structures of defined compositions with multiple functions or binding specificities
CA2734265C (fr) * 2008-08-20 2017-12-19 Ibc Pharmaceuticals, Inc. Vaccins d'accostage et de verrouillage « dock-and-lock » (dnl) pour une therapie contre le cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070140966A1 (en) * 2005-10-19 2007-06-21 Ibc Pharmaceuticals, Inc. Multivalent immunoglobulin-based bioactive assemblies

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MATSUI ET AL.: "Characterization of clonogenic multiple myeloma cells.", BLOOD, vol. 103, no. 6, 2004, pages 2332 - 2336 *

Also Published As

Publication number Publication date
EP2416807A4 (fr) 2012-06-13
EP2416807A1 (fr) 2012-02-15

Similar Documents

Publication Publication Date Title
US8562988B2 (en) Strategies for improved cancer vaccines
US7901680B2 (en) Dock-and-lock (DNL) vaccines for cancer therapy
US10377829B2 (en) Isolated nucleic acid encoding an anti-IGF-1R antibody
AU2010286642B2 (en) Bispecific immunocytokine dock-and-lock (DNL) complexes and therapeutic use thereof
US8883160B2 (en) Dock-and-lock (DNL) complexes for therapeutic and diagnostic use
US9446123B2 (en) Multimeric complexes with improved in vivo stability, pharmacokinetics and efficacy
US20110020273A1 (en) Bispecific Immunocytokine Dock-and-Lock (DNL) Complexes and Therapeutic Use Thereof
AU2010343304B2 (en) Novel class of monospecific and bispecific humanized antibodies that target the insulin-like growth factor type I receptor (IGF-1R)
WO2012162583A1 (fr) Conception et construction de nouveaux anticorps multivalents
US9550838B2 (en) Dock-and-lock (DNL) complexes for therapeutic and diagnostic use
US20170088635A1 (en) Dock-and-Lock (DNL) Complexes for Therapeutic and Diagnostic Use
EP2416807A1 (fr) Nouvelles stratégies d'amélioration des vaccins anticancéreux

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10762283

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 7776/DELNP/2011

Country of ref document: IN

REEP Request for entry into the european phase

Ref document number: 2010762283

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010762283

Country of ref document: EP