WO2010117090A1

WO2010117090A1 - Novel isoquinolinyloxymethyl heteroaryl derivatives

Info

Publication number: WO2010117090A1
Application number: PCT/JP2010/056883
Authority: WO
Inventors: Keisuke Arakawa; Yuichi Sugimoto; Yasuhiro Sasaki; Atsushi Satoh; Teruyuki Nishimura
Original assignee: Banyu Pharmaceutical Co.,Ltd.
Priority date: 2009-04-10
Filing date: 2010-04-09
Publication date: 2010-10-14

Abstract

The present invention relates to a compound represented by a formula (I): wherein: X¹ to X⁵ are all CR and the like, and a formula (II): is a pyridinyl group, a pyrrolyl group and the like, X is N(R²), an oxygen atom or CH₂, Y is a lower alkylene group, R is a hydrogen atom, a halogen atom and the like, R¹ is a halogen atom, a cyano group and the like, R² is a hydrogen atom or a lower alkyl group, m is an integer of 0 to 3, or a pharmaceutically acceptable salt thereof.

Description

DESCRIPTION

NOVEL ISOQUINOLINYLOXYMETHYL HETEROARYL DERIVATIVES

TECHNICAL FIELD

The present invention relates to isoquinolinyloxymethyl heteroaryl derivatives useful in the pharmaceutical field. A compound of the present invention acts as a GPR131 receptor function regulator, especially as a GPR131 agonist, and is useful as agents for treating and/or preventing diabetes, obesity and hyperlipidemia.

BACKGROUND ART

A GPR131 which is a G protein-coupled receptor transmits a signal into a cell via binding to bile acid such as lithocholic acid whereby inducing various in vivo reactions. The effects of the GPR131 and its ligand are reported, in an intestinal tract cell line, to promote the secretion of a GLP-I (glucagon-like-peptide-1 ) which serves to reduce blood glucose level (see Non-patent document 1 ). The GLP- I is a peptide hormone released by an L cell which is a intestinal secreting cell present in ileum, large intestine and the like, and was demonstrated to induce insulin secretion depending on blood glucose level. Accordingly, a compound having a GLP- I secretion-promoting effect is expected to be used as a therapeutic agent for diabetes which can avoid a risk of hypoglycemia due to overdose. In addition, since the GLP- I has an ability of inducing pancreatic β cell proliferation and its differentiation from stem cells(see Non-patent document 2), it is suggested to be effective in delaying apoptosis of β cells in Type II diabetes and in sustaining the effect of islet implantation in Type I diabetes.

The GPR131 is known to be expressed also in a skeletal muscle. This organ is very important in energy consumption. A D2 gene (type 2 iodothyronine deiodinase: an enzyme required in cells to convert a thyroid hormone into its active form) is also expressed in the skeletal muscle. An increase in cAMP concentration due to activation of the GPRl 31 is known to serve to activate the D2, thus having an energy metabolism-stimulating effect (see Non-patent document 3). Thus, an anti- obesity effect of a novel mechanism can be expected when utilizing the GPR131 agonistic effect to increase the concentration of an active form thyroid hormone in an organ critical in the energy consumption whereby increasing the energy consumption. Based on the above description, a compound having a GPRl 31 agonistic activity is considered to be very useful as a therapeutic or prophylactic agent for diabetes and obesity.

As compounds related structurally to the compounds according to the present invention, those represented by following formula:

were reported (See Patent document 1). These compounds are described to be an LXR and/or FXR modulator. It is also described that the LXR and/or FXR modulator is useful in treating diabetes and obesity.

Nevertheless, LXR and FXR are both intranuclear receptors, while the GPR131 is a G protein-coupled receptor, whose function is quite different.

In addition, while the compound described in Patent document 1 has a pyrazolyl group or an imidazolyl group as an essential structure, a compound according to the invention has no such groups. Moreover, said pyrazolyl group or an imidazolyl group is not described or suggested to be capable of being substituted for a group possessed by the compound according to the invention.

As a compound having an isoquinoline backbone, a compound of formula:

is also described (see Non-patent document 4). The Non-patent document 4 describes that these compounds were synthesized by a combinatorial chemistry. Nevertheless, these compounds are not described or suggested to be useful in treating/preventing diabetes, obesity and/or hyperlipidemia. patent document 1 : WO2008/073825 Publication Non-patent document 1 : Biochemical and biophysical research communications, Katsuma S. et al., Vol.329, p.386-390 (2005). Non-patent document 2: Cell Metabolism, Drucker DJ. et al., Vol.3, p.152- 165 (2006).

Non-patent document 3: Nature, Watanabe S. et al., Vol.439, p.484-489 (2006). Non-patent document 4: Journal of combinatorial chemistry, Vol.4, No.5, p.442-456 (2002).

DISCLOSURE OF THE INVENTION

An objective of the present invention is to provide a novel isoquinolinyloxymethyl heteroaryl derivative having a GPR13 1 agonistic effect.

We made an effort to develop a compound having a GPR13 1 function regulatory effect, especially an agonistic effect, and finally found that the compound according to the invention is effective as a compound having a GPR131 function regulatory effect, especially an agonistic effect, and based on such findings the present invention was accomplished.

Thus, the invention relates to a compound represented by a formula (I), or a pharmaceutically acceptable salt thereof;

(I) wherein: X¹ to X⁵ are all CR or one of X¹ to X⁵ is a nitrogen atom and the others are

CR;

A formula (II):

(H) is a group selected from a group consisting of a phenyl group, a pyridinyl group, a pyrrolyl group, a pyrimidinyl group, an oxazolyl group, a pyridonyl group and a benzimidazolyl group;

X is N(R²), an oxygen atom or CH₂; Y is a lower alkylene group;

R is selected from a group consisting of a hydrogen atom, a halogen atom, a lower alkyl group and a lower alkoxy group, said lower alkyl group and lower alkoxy group is optionally substituted with 1 to 3, same or different atoms or groups selected from a group consisting of a halogen atom and a hydroxy group;

R¹ is selected from the group consisting of a halogen atom, a cyano group, a lower alkylthio group, a lower alkyl group and a lower alkoxy group, said lower alkyl group and lower alkoxy group is optionally substituted with 1 to 3, same or different atoms or groups selected from a group consisting of a halogen atom and a hydroxy group;

R² is a hydrogen atom or a lower alkyl group; m is an integer of 0 to 3; provided that 5-([l, l-biphenyl]-2-ylmethoxy)- isoquinoline is excluded; or the pharmaceutically acceptable salt thereof.

The invention also relates to a GPRl 31 function regulating agent containing as an active ingredient the compound represented by the formula (I) or the pharmaceutically acceptable salt thereof, and especially the invention relates to a GPR131 agonist containing as an active ingredient the compound represented by the formula (I) or the pharmaceutically acceptable salt thereof.

The invention also relates to an agent for treating and/or preventing diabetes, obesity and/or hyperlipidemia containing as an active ingredient the compound represented by the formula (I) or the pharmaceutically acceptable salt thereof. Furthermore, the invention relates to a pharmaceutical composition containing the compound represented by the formula (I) and a pharmaceutically acceptable carrier.

The compound (I) according to the invention and the pharmaceutically acceptable salt thereof have a potent GPRl 3 1 function regulating effect, especially an agonistic effect, and are useful in treating and/or preventing diabetes, obesity or hyperlipidemia.

The followings are definitions of terms employed in the specification and describe the compounds according to the invention in more detail.

A "halogen atom" includes for example a fluorine atom, a chlorine atom, a bromine atom, an iodine atom and the like.

A "lower alkyl group" means a straight or branched alkyl group having 1 to 6 carbon atoms, such as a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, an isobutyl group, a s-butyl group, a t-butyl group, a pentyl group, an isoamyl group, a neopentyl group, an isopentyl group, a 1 , 1-dimethylpropyl group, a 1 -methylbutyl group, a 2-methylbutyl group, a 1 ,2-dimethylpropyl group, a hexyl group, an isohexyl group, a 1-methylpentyl group, a 2-methylpentyl group, a 3- methylpentyl group, a 1, 1-dimethylbutyl group, a 1 ,2-dimethylbutyl group, a 2,2- dimethylbutyl group, a 1,3-dimethylbutyl group, a 2,3-dimethylbutyl group, a 3,3- dimethylbutyl group, a 1-ethylbutyl group, a 2-ethylbutyl group, a 1 ,2,2- trimethylpropyl group, l-ethyl-2-methylpropyl group and the like.

A "lower alkoxy group" means a group in which a hydrogen atom of the hydroxy group is substituted by the lower alkyl group described above, for example, a methoxy group, an ethoxy group, a propoxy group, an isopropoxy group, a butoxy group, a s-butoxy group, a t-butoxy group, a pentyloxy group, an isopentyloxy group, a hexyloxy group, an isohexyloxy group and the like.

Each symbol employed in the formula (I):

« is described specifically below.

X¹ to X⁵ are all CR or one of X¹ to X⁵ is a nitrogen atom and the others are CR.

R is selected from the group consisting of a hydrogen atom, a halogen atom, a lower alkyl group and a lower alkoxy group, and said lower alkyl group and lower alkoxy group are optionally substituted with 1 to 3, same or different atoms or groups selected from the group consisting of a halogen atom and a hydroxy group.

A "halogen atom" represented by R includes for example an atom similar to the halogen atom defined above, and specifically includes a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

A "lower alkyl group" represented by R means a group similar to the lower alkyl group defined above, and specifically includes a methyl group, an ethyl group, a n-propyl group, an isopropyl group and the like. Said lower alkyl group is optionally substituted with 1 to 3, same or different atoms or groups selected from the group consisting of the halogen atom defined above and a hydroxy group.

A "lower alkoxy group" represented by R means a group similar to the lower alkoxy group defined above, and specifically includes a methoxy group, an ethoxy group, a n-propoxy group, an isopropoxy group and the like.

Said lower alkoxy group is optionally substituted with 1 to 3, same or different atoms or groups selected from the group consisting of the halogen atom defined above and a hydroxy group.

A group represented by a formula (III):

On) is preferably a phenyl group optionally substituted with 1 to 3 groups selected from the group consisting of a halogen atom and a lower alkyl group optionally substituted with 1 to 3 same or different halogen atoms, wherein: -^ is the position of binding to a group represented by the formula (II):

(H)

Groups represented by the formula (III) include, for example:

wherein:

has a meaning described above.

In the formula (I), a formula (II):

(H) is a group selected from a group consisting of a phenyl group, a pyridinyl group, a pyrrolyl group, a pyrimidinyl group, an oxazolyl group, a pyridonyl group, and a benzimidazolyl group.

Among the groups represented by the formula (II) described above, a groups represented by a formula (II- 1 ):

(IM) especially preferred, and a groups represented by a formula (II-l-l):

(II-1-1)

is more preferred, and groups represented by the formula (II-2):

wherein: (D

is the position of binding to:

(III) and, (2)

is the position of binding to Y.

X is N(R²), an oxygen atom or CH₂. Here, R² is a hydrogen atom or a lower alkyl group.

A "lower alkyl group" represented by R² means a group similar to the lower alkyl group defined above, and specifically includes a methyl group, an ethyl group, a n-propyl group, an isopropyl group and the like.

R² is preferably a hydrogen atom. A preferred embodiment of X is the case where X is NH or an oxygen atom.

Another preferred embodiment of X is the case where X is CH₂.

Y is a lower alkylene group.

A "lower alkylene group " represented by Y means a straight or branched lower alkylene group having 1 to 6 carbon atom, and specifically includes a methylene group, an ethylene group, a propylene group, a tetramethylene group, a methylmethylene group, a dimethylmethylene group, a methylethylene group, a 1 , 1- dimethylethylene group, or a 1 ,2-dimethylethylene group and the like.

Y is preferably a methylene group.

R¹ is selected from a group consisting of a halogen atom, a cyano group, a lower alkylthio group, a lower alkyl group and a lower alkoxy group, said lower alkyl group and lower alkoxy group are optionally substituted with 1 to 3, same or different atoms or groups selected from the group consisting of a halogen atom and a hydroxy group.

A "halogen atom" represented by R¹ means an atom similar to the halogen atom defined above, and specifically includes a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

A "lower alkylthio group" represented by R¹ means the lower alkyl group defined above bound to a sulfur atom, and specifically includes a methylthio group, an ethylthio group, a n-propylthio group, an isopropylthio group and the like. A "lower alkyl group" represented by R¹ means a group similar to the lower alkyl group defined above, and specifically includes a methyl group, an ethyl group, a n-propyl group, an isopropyl group and the like. Said lower alkyl group is optionally substituted with 1 to 3 same or different atoms or groups selected from the group consisting of the halogen atom defined above and a hydroxy group.

Said lower alkoxy group is optionally substituted with 1 to 3 same or different atoms or groups selected from a group consisting of the halogen atom defined above and a hydroxy group. m is an integer of 0 to 3.

When m is 0, then the formula (II):

(H) except for binding to Y and the formula (III):

(III) means that the substituents on the formula (II) are hydrogen atoms.

The compound according to the present invention do not include 5-([l , l - biphenyl]-2-ylmethoxy)-isoquinoline.

The compound according to the present invention represented by the formula (I) should specifically be, but are not limited to, the followings: N-{ [3-(4-fluoro-2-methylphenyl)-2-pyridinyl]methyl}-5-isoquinolinamine,

N-{ [3-(2-chloro-4-fluorophenyl)-4-methyl-2-pyridinyl]methyl}-5-isoquinolinamine,

N-{ [2-chloro-4-(2,4-difluorophenyl)-3-pyridinyl]methyl}-5-isoquinolinamine,

5-({[3-(2-chloro-4-fluorophenyl)-2-pyridinyl]methyl}oxy)isoquinoline,

5 -({[6-chloro-3-(2-chloro-4-fluorophenyl)-2-pyridinyl] methyl }oxy)isoquinoline, 5-({ [3-(4-fluoro-2-methylphenyl)-2-pyridinyl]methyl}oxy)isoquinoline, 5-({ [2-chloro-4-(2-fluorophenyl)-3-pyridinyl]methyl}oxy)isoquinoline, 5-({[3-(4-fluoro-2-methylphenyl)-4-pyridinyl]methyl}oxy)isoquinoline,

5-{ [(2'-chloro-4'-fluoro-2-biphenylyl)methyl]oxy)isoquinoline, 5-{[(4'-fluoro-2',6'-dimethyl -2-biphenylyl)methyl]oxy)isoquinoline,

5-({[3-methyl-2-(2-pyridinyl)phenyl]methyl}oxy)isoquinoline,

5-({[l -(2-chloro-4-fluorophenyl)-5-fluoro-l H-benzimidazol-2- yl] methyl }oxy)isoquinoline,

5-{2-[ l -(2-chloro-4-fluorophenyl)-5-fluoro-l H-benzimidazol-2-yl]ethyl} isoquinoline,

N-({ l -[2-(trifluoromethyl)phenyl]-lH-pyrrol-2-yl}methyl)-5-isoquinolinamine, or,

5-[({ l -[2-(trifluoromethyl)phenyl]-lH-pyrrol-2-yI}methyl)oxy]isoquinoline

Methods for producing compounds according to the invention are described below.

The compound (I) according to the present invention:

(I) wherein symbols are as described above can be produced for example by the following methods.

(1) (I) wherein symbols are as described above. (Step 1)

This step is a method for producing the compound ( 1) according to the invention by subjecting the compound ( 1 ) and the compound (2) to a coupling reaction in the presence of a catalyst and a base.

The reaction in this step is a so called Suzuki coupling reaction, which can be conducted by methods described in references, methods analogous thereto, or standard method combined therewith.

The amount of the compound ( 1 ) employed, is usually 1 to 10 equivalents, preferably, 1 to 3 equivalents relative to 1 equivalent of the compound (2).

Catalysts employed may for example be Pd(PPh₃)₄, Pd₂(dba)3, PdCl₂, (dppf)₂ and the like.

The amount of such a catalyst, is usually 1 to 200 % by mole, preferably, 5 to 20 % by mole relative to 1 equivalent of the compound (2).

Bases employed include for example sodium carbonate, potassium carbonate and the like. The amount of such a base, is usually 1 to 10 equivalents, preferably, 1 to 5 equivalents relative to 1 equivalent of the compound (2).

The reaction time is usually 30 minutes to 48 hours, preferably 6 to 12 hours.

The reaction temperature is usually 0 to 150°C, preferably 50 to 120°C.

Reaction solvents employed in this step may be any one of those having no adverse effect on the reaction, and include toluene, DMF, NMP, dioxane, THF, DMSO, water and the like, with toluene, DMF and NMP being preferred.

A compound (1-1) according to the invention:

(M) wherein symbols are as described above can be produced for example by the following methods.

wherein L₁ is a leaving group and other symbols are as described above. (Step T)

This step is a method for producing a compound (5) by reacting a compound

(3) and a compound (4) in the presence of a reducing agent. The amount of the compound (3) employed, is usually 1 to 5 equivalents, preferably, 1 to 2 equivalents relative to 1 equivalent of the compound (4).

Reducing agents employed include for example sodium borohydride, sodium cyanoborohydride, sodium triacetoxyborohydride and the like, with sodium cyanoborohydride being preferred.

The amount of such a reducing agent, is usually 1 to 10 equivalents, preferably, 1 to 3 equivalents relative to 1 equivalent of the compound (4).

It is also possible to add additives such as anhydrous sodium sulfate, acetic acid, zinc chloride and the like to the reaction system. The reaction time is usually 10 minutes to 48 hours, preferably 10 minutes to

5 hours.

The reaction temperature is usually 0 to 100°C, preferably 0 to 50°C.

Reaction solvents employed in this step may be any one of those having no adverse effect on the reaction, including methanol, ethanol, chloroform, methylene chloride, THF, 1 ,4-dioxane and the like.

When using acetic acid and the like in the reaction system, such an acetic acid and the like may be used as a reaction solvent.

The compound (5) thus obtained can be isolated and purified in a known separation and purification method such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like, or subjected to the next step without isolation or purification. (Step 3)

This step is a method for producing the compound (1- 1 ) according to the invention by reacting the compound (5) and the compound (2) in the presence of a catalyst and a base.

The reaction in this step is a so called Suzuki coupling reaction, which can be conducted by methods similar to that in Step 1, methods analogous thereto, or standard method combined therewith.

The compound (1- 1 ) thus obtained can be isolated and purified in a known separation and purification method such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like.

Also, the compound (1-2) according to the present invention:

(1-2) wherein Xa is an oxygen atom or N(R²) and other symbols are as described above can be produced for example by the following methods.

(1-2) wherein L₂ is a leaving group, L₃ is a methanesulfonyl group or p-toluenesulfonyl group and the like, Hal is a halogen atom, and other symbols are as described above. (Step 4)

This step is a method for producing a compound (7) by reacting a compound (6) and the compound (2) in the presence of a catalyst and a base. The reaction in this step is a so called Suzuki coupling reaction, which can be conducted by methods similar to that Step 1 , methods analogous thereto, or standard method combined therewith.

The compound (7) thus obtained can be isolated and purified bin a known separation and purification method such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like, or subjected to the next step without isolation or purification. (Step 5)

This step is a method for producing a compound (9) by reacting the compound (7) and a compound (8) in the presence of a base. Bases employed include for example triethylamine, diisopropylethylamine and the like.

The amount of such a base, is usually 1 to 10 equivalents, preferably, 1 to 5 equivalents relative to 1 equivalent of the compound (7).

The compound (8) employed include for example methansulfonyl chloride, p- toluenesulfonyl chloride and the like.

The amount of the compound (8) employed, is usually 1 to 5 equivalents, preferably, 1 to 3 equivalents relative to 1 equivalent of the compound (7).

The reaction time is usually 1 to 10 hours, preferably 1 to 5 hours.

The reaction temperature is usually 0 to 100°C, preferably 0 to 50°C. Reaction solvents employed in this step may be any one of those having no adverse effect on the reaction, including ethyl acetate, methylene chloride, chloroform, DMF, DMA.

The compound (9) thus obtained can be isolated and purified in a known separation and purification method such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like, or subjected to the next step without isolation or purification. (Step 6)

This step is a method for producing a compound (1-2) according to the invention by reacting the compound (9) and a compound (10) in the presence of a base.

Bases employed include for example cesium carbonate, potassium carbonate, sodium carbonate, triethylamine and the like.

The amount of such a base, is usually 1 to 10 equivalents, preferably, 1 to 3 equivalents relative to 1 equivalent of the compound (9). The amount of the compound (10) employed, based on 1 equivalent of the compound (9), is usually 1 to 5 equivalents, preferably, 1 to 3 equivalents.

The reaction time is usually 1 to 24 hours, preferably 1 to 5 hours.

The reaction temperature is usually 0 to 100°C, preferably 0 to 50°C.

Reaction solvents employed in this step may be any one of those having no adverse effect on the reaction, and include DMF, DMA, THF, chloroform, methylene chloride and the like.

The compound (1-2) according to the present invention thus obtained can be isolated and purified in a known separation and purification means such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like.

Also, A compound (1-3) according to the invention:

-3) wherein each symbol is as described above can be produced for example by the following methods.

(H) (13) (14)

(16) (1-3) wherein L₄, L₅, and L₆ are leaving groups, and other symbols are as described above. (Step 7) This step is a method for producing a compound (13) by reacting a compound

( 11) and a compound (12) in the presence of a base.

Bases employed include for example potassium t-butoxide, sodium t-butoxide, NaH and the like.

The amount of such a base is usually 1 to 5 equivalents, preferably, 1 to 3 equivalents relative to 1 equivalent of the compound ( 1 1).

The leaving group L₄ in the compound (12) includes for example a fluorine atom.

The amount of said compound is usually 1 to 5 equivalents, preferably, 1 to 3 equivalents relative to 1 equivalent of the compound (1 1).

The reaction time is usually 1 to 10 hours, preferably 1 to 5 hours.

The reaction temperature is usually 0 to 100°C, preferably 0 to 50°C.

Reaction solvents employed in this step may be any one of those having no adverse effect on the reaction, and include dimethyl sulfoxide (DMSO), NMP, THF and the like.

The compound ( 13) thus obtained can be isolated and purified in a known separation and purification means such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like, or subjected to the next step without isolation or purification. (Step 8)

This step is a method for producing a compound (14) by reducing the nitro group possessed by the compound ( 13).

Reducing agents employed include for example stannic chloride, electrolytic iron, triphenylphosphine and the like.

The amount of said reducing agent is usually 1 to 20 equivalents, preferably, 1 to 5 equivalents relative to 1 equivalent of the compound ( 13).

The reaction time is usually 1 to 24 hours, preferably 1 to 5 hours.

The reaction temperature is usually 0 to 200°C, preferably 0 to 100°C. Reaction solvents employed in this step may be any one of those having no adverse effect on the reaction, and include methanol, ethanol, THF, DMF and the like.

The compound ( 14) thus obtained can be isolated and purified in a known separation and purification means such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like, or subjected to the next step without isolation or purification. (Step 9)

This step is a method for producing a compound (16) by reacting the compound ( 14) and a compound (15).

L₅ and L₆ in the compound (15) include for example both chlorine atoms. The amount of the compound (15) is usually 1 to 20 equivalents, preferably, 1 to 5 equivalents relative to 1 equivalent of the compound ( 14).

A base may be added to the reaction system.

Such a base includes for example triethylamine, potassium carbonate, cesium carbonate and the like.

The amount of such a base is usually 1 to 10 equivalents, preferably, 1 to 5 equivalents relative to 1 equivalent of the compound (14).

The reaction time is usually 1 to 24 hours, preferably 1 to 5 hours. The reaction temperature is usually 0 to 200°C, preferably 0 to 100°C.

Reaction solvents employed in this step may be any one of those having no adverse effect on the reaction, and include for example DMF and the like.

The compound (16) thus obtained can be isolated and purified in a known separation and purification means such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like, or subjected to the next step without isolation or purification. (Step 10)

This step is a method for producing a compound (1-3) according to the present invention by reacting the compound (16) and the compound (10) in the presence of a base.

The amount of such a base, is usually 1 to 20 equivalents, preferably, 1 to 5 equivalents relative to 1 equivalent of the compound ( 16). The amount of the compound (10) employed, is usually 1 to 10 equivalents, preferably, 1 to 3 equivalents relative to 1 equivalent of the compound (16).

The reaction time is usually 1 to 24 hours, preferably 1 to 5 hours.

The reaction temperature is usually 0 to 200°C, preferably 0 to 100⁰C.

The compound (1-3) according to the present invention thus obtained can be isolated and purified by a known separation and purification means such as concentration, concentration under reduced pressure, reprecipitation, solvent extraction, crystallization, chromatography and the like.

Introduction and removal of protective groups can be accomplished by methods described in references (Protective Groups in Organic Synthesis, T. W. Green,

2nd Edition, John Wiley & Sons, 1991), methods analogous thereto, or standard method combined therewith.

A compound according to the invention can exist as a pharmaceutically acceptable salt, and said salt can be produced according to a standard method using the compounds represented by the formula (I) described above and formulae (1- 1), (I- 2) and (1-3) encompassed therein.

The acid-addition salts include, for example, hydrohalides such as hydrochlorides, hydrofluorides, hydrobromides, hydroiodides; inorganic acid salts such as nitrates, perchlorates, sulfates, phosphates, carbonates; lower alkylsulfonates such as methanesulfonates, trifluoromethanesulfonates, ethanesulfonates; arylsulfonates such as benzenesulfonates, p-toluenesulfonates; organic acid salts such as fumarates, succinates, citrates, tartrates, oxalates, maleates; other organic acid- addition salts with amino acid such as glutamates, aspartates.

When the compounds of the invention have an acid group in the molecule, for example, when they have a carboxyl group, then the compounds may be processed with a base so as to convert them into the corresponding pharmaceutically- acceptable salts.

The base-addition salts include, for example, alkali metal salts with sodium or potassium; alkaline earth metal salts with calcium or magnesium; ammonium salts; organic base-addition salts with guanidine, triethylamine, dicyclohexylamine, etc.

In addition, the compounds of the invention may also be in any other form of hydrates or solvates of their free compounds or their salts.

Conversely, conversion from a salt or an ester into a free compound may also be accomplished according to a standard method. Depending on the type of the substituents therein, the compounds of the invention include stereoisomers and tautomers such as optical isomers, diastereomeric isomers and geometrical isomers. Needless-to-say, the compounds of the invention include all these isomers. Further needless-to-say, the compounds of the invention include all mixtures of such isomers. In producing medicines for prevention and remedy for type II diabetes or diseases or symptoms associated with it, the compounds of the formula (I) of the invention may be combined with carrier substances. The dose of the compounds of the formula (I) of the invention for prevention or remedy for diseases naturally varies, depending on the property of the symptom to which the treatment is directed, the specific compound selected for it and the administration route. In addition, the dose also varies depending on the age, the body weight and the sensitivity of patients. In general, the daily dose for one-time or plural- times administration may be from about 0.001 mg/kg-body weight to about 100 mg/kg-body weight, preferably from about 0.01 mg/kg-body weight to about 50 mg/kg-body weight, even more preferably from about 0.1 mg/kg-body weight to about 10 mg/kg-body weight. As the case may be, administration of a dose over the range may be necessary.

An example of a suitable dose for oral administration is described. The daily dose for one-time or two- to four-times administration may be at least from about 0.01 mg to at most 2.0 g. Preferably, the daily administration frequency is once or twice a day, and the daily dose is from about 1.0 mg to about 200 mg. More preferably, the daily dose is from about 10 mg to 100 mg for one-time administration a day.

For intravenous administration or oral administration, a typical dose of the compound (I) may be from about 0.001 mg/day/kg-body weight to about 100 mg/day/kg-body weight (preferably from 0.01 mg/day/kg-body weight to about 10 mg/day/kg-body weight), more preferably from about 0.1 mg/day/kg-body weight to 10 mg/day/kg-body weight.

As so mentioned hereinabove, the pharmaceutical composition of the invention comprises a compound of the formula (I) and a pharmaceutically-acceptable carrier. The term "composition" is meant to contain not only a product produced by directly or indirectly combining, hybridizing or aggregating 2 or more ingredients, a product produced as a result of dissociation of one or more ingredients, or a compound produced as a result of reaction or interaction of different types of ingredients, but also an active and inactive ingredient of constituting a carrier (pharmaceutically-acceptable vehicle).

As combined with a pharmaceutically-acceptable carrier, the composition of the invention preferably contains a compound of the formula (I) in an amount effective for remedy and prevention of type II diabetes and for retardation of the onset of the disease.

For administering the effective dose of the compound of the invention to mammals, especially to humans, employable is any suitable administration route. For example, the route may be oral administration, rectal administration, local administration, intravenous administration, ophthalmic administration, lung administration or nasal administration. Examples of the administration forms are tablets, troches, powders, suspensions, solutions, capsules, creams, aerosols. Preferred are oral tablets. In preparing oral compositions, usable are any ordinary pharmaceutical media. Their examples are water, glycol, oil, alcohol, fragrant additives, preservatives, colorants. In preparing liquid compositions for oral administration, for example, mentioned are suspensions, elixirs and solutions. Their carriers are, for example, starch, sugar, microcrystalline cellulose, diluent, granulating promoter, lubricant, binder, disintegrator. In preparing solid compositions for oral administration, for example, mentioned are powders, capsules and tablets. Above all, such solid compositions for oral administration are preferred.

In view of the easiness in their administration, tablets and capsules are the most advantageous forms for oral administration. If desired, the tablets may be coated according to standard aqueous or non-aqueous coating techniques.

In addition to the above-mentioned ordinary administration modes for them, the compounds of the formula (I) may also be administered according to controlled release systems and/or controlled delivery systems, for example, as in US Patents 3,845,770, 3,916,899, 3,536,809, 3,598, 123, 3,630,200 and 4,008,719. The pharmaceutical composition of the invention suitable for oral administration includes capsules, cashews and tablets that contain a predetermined amount of the active ingredient in the form of powders or granules thereof, or in the form of water-soluble liquids, water-insoluble liquids, oil-in-water emulsions or water-in-oil emulsions thereof. These compositions may be prepared in any pharmaceutical methods, and all the methods include a process of combining the active ingredient with a carrier of one or more necessary ingredients.

In general, the active ingredient is uniformly and fully mixed with a liquid carrier, or a well-separated solid carrier or with both the two, and then, if desired, the product is shaped into suitable forms to prepare the composition. For example, tablets are produced through compression and shaping, optionally along with one or more side components. Using a suitable machine, compressed tablets may be produced by mixing the active ingredient optionally with binder, lubricant, inert vehicle, surfactant or dispersant and compressing the resulting mix in any desired manner into powders or granules.

Shaped tablets may be prepared by shaping a mixture of a powdery wet compound and an inert liquid diluent, using a suitable machine.

Preferably, the tablets each contain from about 1 mg to 1 g of the active ingredient; and the cashews and the capsules each contain from about 1 mg to 500 mg of the active ingredient.

Examples of the administration modes of the compounds of formula (I) for pharmaceutical use are as follows: Table 1

Table 3

Table 4

The compounds of the formula (I) may be used, as combined with any other drugs usable not only for type II diabetes-associated diseases or symptoms but also for remedy/prevention/retardation of the onset of type II diabetes. The additional drugs may be administered in any administration route and dose generally employed in the art, simultaneously with or separately from the compound of the formula (I).

In case where the compound of the formula (I) is used along with one or more other drugs, then a pharmaceutical composition comprising the compound of the formula (I) and the additional drug is preferred. Accordingly, the pharmaceutical composition of the invention may comprise not only the compound of the formula (I) but also one or more such active ingredients. Examples of the active ingredients that may be combined with the compounds of the formula (I) are mentioned below, which, however, are not limitative. These may be separately administered or may be administered simultaneously as contained in the same pharmaceutical composition, (a) other GPR120 agonists (b) glucokinase activators,

(c) bis-guanides (e.g., buformin, metoformin, fenformin,), (d) PPAR agonists (e.g., triglytazon, pioglytazon, nosiglytazon),

(e) insulin,

(f) somatostatin,

(g) α-glucosidase inhibitors (e.g., boglybose, miglytol, acarbose), (h) insulin secretion promoters (e.g., acetohexamide, calbutamide, chlorpropamide, glybomlide, glycrazide, glymerpiride, glypidide, glyquidine, glysoxepide, glyburide, glyhexamide, glypinamide, fenbutamide, trazamide, tolbutamide, tolcyclamide, nateglynide, repaglynide), (i) DPP-IV (dipeptidyl peptidase IV) inhibitors, and The weight ratio of the compound of the formula (I) to the second active ingredient may vary within a broad range, and depends on the effective amount of the individual active ingredients. Accordingly, for example, when the compound of the fformula (I) is combined with a PPAR agonist, then the weight ratio of the compound of the formula (I) to the PPAR agonist may be generally from about 1000/1 to 1/1000, preferably from about 200/1 to 1/200. The combination of the compound of the formula (I) and the other active ingredient may be within the above- mentioned range. In any case, an effective amount of the individual ingredients should be in the combination. While a compound according to the invention has GPR120 function regulating effect, the "GPRl 20 function regulating effect" herein means that the function of the GPR120 receptor is activated or inhibited and a GPR 120 agonist is included in those having GPR120 function regulating effects.

EXAMPLES

Formulation Example 1 :

10 parts of the compound of Example 1 , 15 parts of heavy magnesium oxide and 75 parts of lactose are uniformly mixed to give a powdery or particulate preparation of at most 350 μm in size. The preparation is encapsulated to prepare capsules.

Formulation Example 2:

45 parts of the compound of Example 1 , 15 parts of starch, 16 parts of lactose, 21 parts of crystalline cellulose, 3 parts of polyvinyl alcohol and 30 parts of distilled water are uniformly mixed, then ground, granulated and dried, and thereafter sieved to prepare granules having a size of from 1410 to 177 μm in diameter.

Formulation Example 3 :

Granules are prepared in the same manner as in Preparation Example 2. 3 parts of calcium stearate is added to 96 parts of the granules, and shaped under compression to give tablets having a diameter of 10 mm.

Formulation Example 4:

10 parts of crystalline cellulose and 3 parts of calcium stearate are added to 90 parts of the granules obtained according to the method of Preparation Example 2, and shaped under compression to give tablets having a diameter of 8 mm. These are coated with a mixture suspension of syrup gelatin and precipitated calcium carbonate to prepare sugar-coated tablets.

In Examples, the silica gel column chromatography employed a column prepacked with Wakogel (trade mark, Wako Pure Chemical) C-300 or KP-SiI (trade mark) Silica from Biotage. The preparative chromatography employed a

Kieselgel™60F₂₅₄, Art.5744 from Merck. The basic silica gel column chromatography employed Chromatorex (trade mark) NH ( 100 to 250 mesh or 200 to

350 mesh) from Fij i Silicia Chemical. A ¹H-NMR was obtained using JEOL AL400 (400 MHz), Mercury (400 MHz),

Inova (400 MHz), together with a tetramethylsilane as a reference standard. A mass spectrum was obtained by an electrospray ionization method (ESI) or an atmospheric pressure chemical ionization method (APCI) using a Waters micromass ZQ. The following abbreviations are used in Examples described below. i-Bu: Isobutyl group n-Bu: n-Butyl group t-Bu: tert-Butyl group

Boc: tert-Butoxycarbonyl group

Me: Methyl group Et: Ethyl group

Ph: Phenyl group i-Pr: Isopropyl group n-Pr: n-Propyl group CDCl₃: Heavy chloroform

CD₃OD: Heavy methanol

DMSO-Cl₆: Heavy dimethyl sulfoxide

The meanings of abbreviations in a nuclear magnetic resonance spectrometry are shown below. s: Singlet d: Doublet dd: Double doublet dt: Double triplet ddd: Double double doublet

Sept: Septet t: Triplet m: Multiplet br: Broad brs: Broad singlet q: Quartet

J: Coupling constant

Hz: Hertz

Example 1 Synthesis of N-{ [3-(4-fluoro-2-methylphenvn-2-pyridinyl^"|methyl) -5- isoquinolinamine

1) N-[(3-Bromo-2-pyridinvOmethyl]-5-isoquinolinamine

To a solution of 3-bromo-2-pyridinecarboaldehyde (130 mg) in methanol (3.5 ml) was added 5-aminoisoquinoline (121 mg) and acetic acid (0.12 ml), and the reaction solution was stirred for 1 hour at room temperature. The reaction solution was cooled to 0°C, and then sodium cyanoborohydride (67 mg) was added and stirring was conducted further for 1 hour at room temperature. The reaction solution was diluted with water, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous sodium chloride solution, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=9: l to 8:2) to obtain the title compound (163 mg) as a yellow oil. 2) N-{[3-(4-fluoro-2-methylphenvπ-2-pyridinyllmethyU-5-isoquinolinamine

To a solution the compound (20 mg) obtained in step 1) in dioxane (0.4 ml) was added tetrakis triphenylphosphine palladium (7.0 mg), 4-fluoro-2- methylphenylboric acid (15 mg) and a 2M aqueous solution of sodium carbonate (0.1 ml), and stirred for 1 hour at 80°C. The reaction solution was diluted with a saturated aqueous solution of ammonium chloride, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous solution of sodium chloride, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=5:5 to 8:2) to obtain the title compound (12 mg) as a white solid. 1 H-

NMR(CDCl₃ )δ:4.09(l H,d,J=15.7Hz),4.23( lH,d,J=15.7Hz),6.51(l H,d,J=7.4Hz),6.95- 7.05(2H,m),7.10(lH,dd,J=8.6,5.9Hz),7.26(lH,d,J=8.2Hz),7.3 1 - 7.39(2H,m),7.48(lH,dd,J=7.6, 1.8Hz),7.75(lH,d,J=5.9Hz),8.48(lH,d,J=5.9Hz),8.66- 8.69(lH,m),9.13(lH,s)

ESI-MS(m/e):344.6[M+H]⁺

Example 2

Synthesis of N-( r3-(2-chloro-4-fluorophenvO-4-methyl-2-pyridinyl1methyU-5- isoquinolinamine

The title compound was obtained as a colorless solid using 3-bromo-4- methyl-2-pyridinecarboaldehyde by the method similar to that in Example 1 , methods analogous thereto, or standard method combined therewith. 1 H-

NMR(CDCl₃ )δ:2.06(3H,s),4.29(2H,s),6.54(lH,d,J=7.4Hz),7.16(lH,td,J=8.4, 2.5Hz),7. 27- 7.41(5H,m),7.84(lH,d,J=6.3Hz),8.32(l H,d,J=6.3Hz),8.47(lH,d,J=5.1Hz),9.04( l H,s) ESI-MS(m/e):378.0[M+H]⁺

Example 3

Synthesis of N-{[2-chloro-4-(2,4-difluorophenvO-3-pyridinyl]methyl}-5- isoquinolinamine

The title compound was obtained as a colorless solid using 2-chloro-4-iodo-3- pyridinecarboaldehyde by the method similar to that in Example 1 , methods analogous thereto, or standard method combined therewith.

¹ H-

NMR(CDCl₃ )δ:4.42(2H,s),4.54(lH,brs),6.53( lH,d,J=6.6Hz), 6.87(2H,q,J=8.7Hz),7.14

-7.17(lH,m),7.18-7.24( l H,m),7.30-

7.34(2H,m),7.38(lH,d,J=5.9Hz),8.40(2H,t,J=5.5Hz),9.12(lH,s) ESI-MS(m/e):382.4[M+H] ⁺

Example 4

Synthesis of 5-( { [3-(2-chloro-4-fluorophenvP-2-pyridinyllmethyUoxyMsoquinoline

1^*) [3 -(2-chloro-4-fluorophenyP-2-pyridinvπ methanol To a solution (3-bromo-2-pyridinyl)methanol (500 mg) in dioxane (10 ml) was added tetrakis triphenylphosphine palladium (300 mg), 2-chloro-4- fluorophenylboric acid (560 mg) and a 2M aqueous sodium carbonate solution (2.5 ml), and stirred for 1 hour at 80°C. The reaction solution was diluted with a saturated aqueous ammonium chloride solution, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous solution of sodium chloride, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=9: l to 2:8) to obtain the title compound (521 mg) as a colorless solid.

2) 5-(([3-(2-chloro-4-fluorophenyl)-2-pyridinyllmethyl)oxyMsoquinoline

To a solution of the compound ( 120 mg) obtained in Step 1) in ethyl acetate (2,5 ml) was added triethylamine (0.22 ml) and methanesulfonyl chloride (0.08 ml), and the reaction solution was stirred for 1 hour at room temperature. The reaction solution was filtered through celite, and the filtrate was distilled off under reduced pressure to obtain a crude product as a colorless oil. To a solution of the resultant crude product in dimethyl formamide (2.5 ml) was added cesium carbonate (450 mg) and 5-hydroxyisoquinoline (1 10 mg), and stirred for 1 hour at room temperature. To the reaction solution was added saturated aqueous ammonium chloride solution, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous solution of sodium chloride, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=7:3 to 2:8) to obtain the title compound (88 mg) as a colorless solid. l H-NMR(CDCl₃ )δ:5.22( l H,d,J=l 1.7Hz), 5.28(l H,d,J=l 1.7Hz),6.83- 6.87( lH,m),6.95(l H,d,J=7.4Hz),7.13-7.17(2H,m),7.33-

7.38(2H,m),7.45( l H,d,J=8.2Hz),7.55( lH,dd,J=7.8, 1.6Hz),7.64( l H,d,J=5.9Hz),8.40( l H,d,J=5.9Hz),8.68-8.70(lH,m),9.12(lH,s) ESI-MS(m/e):365.2[M+H]⁺

Example 5

Synthesis of 5-(( [6-chloro-3-(2-chloro-4-fluorophenyl)-2- pyridinyl] methyl) oxyMsoquinoline

1) r3-(2-chloro-4-fluorophenvπ-l-oxide-2-pyridinyl1methanol

To a solution of [3-(2-chloro-4-fluorophenyl)-2-pyridinyl]methanol (50 mg) in chloroform (1.1 ml) was added methachloroperbenzoic acid (70 mg) at O⁰C, and stirred for 4 hours at room temperature. The reaction solution was diluted with a saturated aqueous solution of sodium hydrogen carbonate, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous solution of sodium chloride, and dried over anhydrous magnesium sulfate. The resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=5:5 to 8:2) to obtain the title compound (51 mg) as a colorless solid.

2) 5-({[3-(2-chloro-4-fluorophenyl)- l -oxide-2-pyridinyl1methyl)oxy)isoquinoline

The title compound was obtained as a colorless solid using the compound obtained in Step 1) by the method similar to that in Example 4 (2), methods analogous thereto, or standard method combined therewith. 3) 5-( ([6-chloro-3-(2-chloro-4-fluorophenyπ-2-pyridinyllmethyUoxy)isoquinoline To the compound (30 mg) obtained in Step 2) was added phosphorus oxychloride (0.50 ml) and the reaction solution was stirred for 2 hours at 80°C. The reaction solution was cooled, and then excessive phosphorus oxychloride was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=5:5 to 8:2) to obtain the title compound

(26 mg) as a white solid.

¹ H-

NMR(CDCl₃ )δ:5.18( lH,d,J=11.7Hz),5.24( lH,d,J=11.7Hz),6.83( l H,td,J=8.2,2.7Hz),6.

92(lH,d,J=7.8Hz),7.09-7.15(2H,m), 7.36- 7.41(2H,m),7.48(l H,d,J=8.2Hz),7.52( l H,d,J=8.2Hz),7.59( l H,d,J=5.9Hz),8.40( lH,d,J

=5.9Hz),9.14( lH,s)

ESI-MS(m/z):400.1 [M+H]⁺

Example 6 Synthesis of 5-(( [3-(4-fluoro-2-methylphenyπ-2-pyridinyllmethyl)oxy")isoquinoline

The title compound was obtained as a colorless solid using (3-bromo-4- pyridinyl)methanol by the method similar to that in Example 4, methods analogous thereto, or standard method combined therewith. 1 H-

NMR(CDCl₃ )δ: 1.99(3H,s),5.10(lH,d,J=1 1.2Hz),5.23(lH,d,J=1 1.2Hz),6.85( lH,td,J=8. 3,2.4Hz),6.92(l H,dd,J=9.5,2.7Hz),6.99( l H,d,J=7.8Hz),7.13( lH,dd,J=8.8,5.9Hz),7.37- 7.42(2H,m),7.49(lH,d,J=8.3Hz),7.55( lH,dd,J=7.6, 1.7Hz),7.75( l H,d,J=5.9Hz),8.45(l H,d,J=5.9Hz),8.72(lH,dd,J=4.9, 1.5Hz),9.16(lH,s) ESI-MS(m/e):345.0[M+H]⁺

Example 7

Synthesis of 5 -(^"( r2-chloro-4-(2-fluorophenvD-3-pyridinyll methyl joxyΗsoquinoline

The title compound was obtained as a pale yellow solid using 2-chloro-4- iodo-3-pyridinecarboaldehyde by the method similar to that in Example 4, methods analogous thereto, or standard method combined therewith.

¹ H-NMR(CDCl₃ )δ:5.22(2H,brs),6.93(lH,d,J=7.3Hz),7.07- 7.16(2H,m),7.30(2H,td,J=7.6,2.0Hz),7.33-

7.39( l H,m),7.44(lH,t,J=8.0Hz),7.54(lH,d,J=8.3Hz),7.78( l H,d,J=5.9Hz),8.46( l H,d,J=

5.9Hz),8.50( l H,d,J=5.4Hz),9.19( l H,s)

ESI-MS(m/e):365.0[M+H]⁺

Example 8

Synthesis of 5-({r3-(4-fluoro-2-methylphenyO-4-pyridinyl]methyl)oxy)isoquinoline

The title compound was obtained as a colorless solid using (3-bromo-4- pyridinyl)methanol by the method similar to that in Example 4, methods analogous thereto, or standard method combined therewith. 1H-

NMR(CDCl₃ )δ:2.13(3H,s),4.97(2H,dd,J=32.0,13.4Hz), 6.79(lH,d,J=7.3Hz),6.98(lH,td ,J=8.3,2.9Hz),7.05(lH,dd,J=9.8,2.9Hz),7.17(lH,dd,J=8.3,5.9Hz),7.42(lH,t,J=7.8Hz), 7.56(lH,d,J=8.3Hz),7.71(lH,d,J=4.9Hz),8.03(lH,d,J=5.9Hz),8.46(lH,s),8.57(lH,d,J= 5.9Hz),8.71(lH,d,J=5.4Hz),9.22(lH,s) ESI-MS(m/e):345.0[M+H]⁺

Example 9

Synthesis of 5-{r(2'-chloro-4'-fluoro-2-biphenylvOmethvπoxy)isoquinoline

The title compound was obtained as a colorless oil using (2- iodophenyl)methanol by the method similar to that in Example 4, methods analogous thereto, or standard method combined therewith. 1H-

NMR(CDCl₃ )δ:4.99(lH,d,J=l 1.9Hz), 5. H(lH,d,J=12.1Hz)),6.87(lH,d,J=7.6Hz),6.99( lH,td,J=8.2,2.6Hz),7.22-

7.26(2H,m),7.31(lH,dd,J=8.5,6.2Hz),7.43(lH,t,J=7.9Hz),7.46-

7.54(3H,m),7.72(lH,dd,J=7.5,l.lHz),7.99(lH,dt,J=5.9,0.9Hz),8.52(lH,d,J=5.9Hz),9.2 0(lH,d,J=1.0Hz) ESI-MS(m/e):364.2[M+H]⁺ Example 10

Synthesis of 5- { |Y4'-fluoro-2',6'-dimethyl -2-biphenylv0methyl1oxy')isoquinoline

The title compound was obtained as a colorless oil using (2-bromo-3- methylphenyl)methanol by the method similar to that in Example 4, methods analogous thereto, or standard method combined therewith. 1 H-

NMR(CDCl₃ )δ:2.01 (3H,s),2.02(3H,s),4.81(2H,d,J=2.0Hz),6.79(lH,d,J=7.3Hz), 6.90( 1 H,td,J=8.4,2.6Hz),6.98( lH,dd,J=9.8,2.4Hz),7.08(lH,dd,J=8.0,6.1Hz),7.32- 7.42(4H,m),7.50-

7.56(2H,m),8.02(0.8H,m),8.15(0.2H,m),8.52(0.6H,brs),9.20(0.4H,brs) ESI-MS(m/e):358.0[M+H]⁺

Example 11 Synthesis of 5-({r3-methyl-2-(2-pyridinyl)phenyl^"lmethvUoxy)isoquinoline

5 -({ r3-methyl-2-(2-pyridinvπphenyl] methyl loxyMsoquinoline

The title compound was obtained as a colorless oil using (2-bromo-3- methylphenyl)methanol by the method similar to that in Example 4, methods analogous thereto, or standard method combined therewith.

¹ H-

NMR(CDCl₃ )δ:2.14(3H,s),5.00(2H,s),6.83( lH,d,J=7.3Hz),7.21 (l H,ddd,J=7.8,4.9, 1.0

Hz), 7.30-

7.41(4H,m),7.49(2H,t,J=7.8Hz),7.66( l H,td,J=7.6, 1.8Hz),7.96( lH,d,J=5.9Hz),8.49(l H ,d,J=5.9Hz),8.69(l H,d,J=4.4Hz),9.17( l H,s)

ESI-MS(m/e):327.0[M+H]⁺ Example 12

Synthesis of 5-( {f l -(2-chloro-4-fluorophenyl)-5-fluoro-lH-benzimidazol-2- y 1^"I methyl }oxy)isoquinoline

1) 2-chloro-4-fluoro-N-(4-fluoro-2-nitrophenyπaniline

To a solution of 2-chloro-4-fluoroaniline (1.0 g) in dimethyl sulfoxide (20 ml) was added potassium t-butoxide (1.41 g) and 2,5-difluoronitrobenzene (1.0 g) and the reaction solution was stirred for 1 hour at room temperature. The reaction solution was combined with water, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous sodium chloride solution, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=9: l to 1 : 1 ) to obtain the title compound (500 mg) as a yellow solid.

2) l-(2-Chloro-4-fluorophenvπ-4-fluorobenzene- 1.2-diamine

To a solution of the compound (200 mg) obtained in Step 1) in methanol (10 ml) was combined with stannic chloride dihydrate (800 mg), and the reaction solution was heated under reflux for 4 hours. The reaction solution was cooled and then an aqueous sodium hydrogen carbonate solution was added and then extracted with chloroform. The organic phases were combined, washed with a saturated aqueous sodium chloride solution, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=9: l to 1 :9) to obtain the title compound (1 10 mg) as a red oil.

3) l -(2-Chloro-4-fluorophenvπ-2-(chloromethyl)-5-fluoro- lH-benzimidazole

To a solution of the compound (1 10 mg) obtained in Step 2) in dimethyl formamide (3 ml) was added chloroacetyl chloride (98 mg) and the reaction solution was stirred while heating for 2 hours at 100°C. The reaction solution was cooled, diluted with ethyl acetate, washed with water and a saturated aqueous sodium chloride solution, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=9: l to 1 :9) to obtain the title compound (55 mg) as a yellow solid.

4) 5-({ [l -(2-chloro-4-fluorophenyπ-5-fluoro-l H-benzimidazol-2- yllmethvUoxyMsoquinoline

To a solution of the compound (34 mg) obtained in Step 3) in dimethyl formamide (3 ml) was added cesium carbonate and 5-isoquinolinol (20 mg) and the reaction solution was stirred for 1 hour at 80°C. The reaction solution was cooled, diluted with a saturated aqueous ammonium chloride solution, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous solution of sodium chloride, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=9: l to 1 :9) to obtain the title compound (33 mg) as a white solid.

¹ H-NMR(CDCl₃ )δ:5.41(lH,d,J=10.2Hz),5.53(1 H,d,J=10.2Hz),6.89-6.92( 1 H,m),7.01 - 7.10(2H,m),7.22(l H,d,J=6.7Hz),7.26-7.35(2H,m),7.45( l H,t,J=6.7Hz),7.55- 7.59(3H,m),8.45(lH,d,J=6.7Hz),9.18( l H,s) ESI-MS(m/e):422.0[M+H]⁺

Example 13

Synthesis of 5-{2-r i -(2-chloro-4-fluorophenvD-5-fluoro-lH-benzimidazol-2-

To a solution of the compound (50 mg) obtained in Example 12 (2) and 3-(5- isoquinolinyl)propionic acid (55 mg) in pyridine (22 ml) was added l-ethyl-3-(3- dimethylaminopropyl)-carbodiimide ( 121 mg), and the reaction solution was stirred for 18 hours at room temperature. To the reaction solution was added IN aqueous hydrochloric acid solution, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous solution of sodium chloride, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure to obtain an amide form as a crude product. The resultant compound was dissolved in trifluoroacetic acid (0.5 ml) and stirred for 18 hours at 60°C. The reaction solution was cooled, combined with a saturated aqueous sodium hydrogen carbonate solution, and extracted with ethyl acetate. The organic phases were combined, washed with water and a saturated aqueous sodium chloride solution, and dried over anhydrous magnesium sulfate. The solvent was distilled off under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=9: l to 1 :9) to obtain the title compound (88 mg) as a white solid. 1 H-NMR(CDCl₃ )δ:2.91-2.98(lH,m),3.10-3.17(lH,m),3.57-3.62(2H,m),6.78- 6.80( lH,m),6.80-6.91 ( l H,m),6.95-7.02(2H,m),7.34-7.36(l H,m),7.46-7.48(2H,m),7.55- 7.58( lH,m),7.82-7.85( l H,m),8.44( l H,d,J=6.4Hz),9.24(lH,s) ESI-MS(m/e):420.0[M+H]⁺

Example 14 Synthesis of N-( { l -[2-(trifluoromethvnphenyl1-lH-pyrrol-2-yU methyl)-5- isoquinolinamine

To a solution of l-[2-(trifluoromethyl)phenyl]- lH-pyrrol-2-carboaldehyde (60 mg) in acetic acid (2 ml) was added anhydrous sodium sulfate (356 mg), and the solution was stirred for 30 minutes at room temperature, followed by addition of sodium acetoxyborohydride ( 159 mg), and stirred for 6 hours at room temperature. The reaction solution was poured into an aqueous sodium hydrogen carbonate, and extracted with ethyl acetate. The organic phases were washed with water and a saturated aqueous sodium chloride solution, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=l :2) to obtain the title compound (40 mg) as a yellow oil. 1 H- NMR(CDCl₃ )δ:4.17(lH,d,J=13.7Hz),4.24(lH,d,J= 13.7Hz), 6.30(lH,t,J=3.2Hz),6.39(1 H,dd,J=3.4, 1.5Hz),6.65(lH,d,J=7.8Hz),6.80(lH,brs),7.29(lH,d,J=7.8Hz),7.36- 7.40(3H,m),7.50-7.53(2H,m),7.76(lH,dd,J=6.8,2.4Hz),8.43( l H,d,J=6.3Hz),9.13( l H,s) ESI-MS(m/e):368.0[M+H] ⁺

Example 15

Synthesis of 5-IYπ-r2-(trifluoromethvnphenyll-lH-pyrrol-2- vUmethvDoxylisoquinoline

1) U -r2-(trifluoromethyl)phenyl]-l H-pyrrol-2-vU methanol To a solution of l-[2-(trifluoromethyl)phenyl]-lH-pyrrol-2-carboaldehyde (42 mg) in methanol (3 ml) was sdded sodium borohydride (31 mg) while cooling on ice, and stirred for 30 minutes at 0°C. The reaction solution was concentrated under reduced pressure, water was added, and extracted with ethyl acetate. The organic phases were washed with water and a saturated aqueous solution of sodium chloride, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=3: l to 1 : 1) to obtain the title compound (39 mg) as a yellow oil.

2) 5-r(π -[2-(trifluoromethyDphenyl^"|-lH-pyrrol-2-yl}methyπoxylisoquinoline

To a solution of the compound (39 mg) obtained in Step 1) in tetrahydrofuran (5 ml) was added triphenylphosphine (64 mg), 5-hydroxyisoquinoline (35 mg) and diisopropyl azodicarboxylate (48 μl), and the solution was stirred for 12 hours at room temperature. The reaction solution was concentrated under reduced pressure, and the resultant residue was purified by a silica gel chromatography (hexane:ethyl acetate=2: l to 1 :2) to obtain the title compound (7 mg) as a yellow solid. ' H-NMR(CDCl₃ )δ:4.08(2H,s),5.77- 5.78( l H,m),6.16(lH,t,J=3.2Hz),6.91 ( lH,d,J=7.8Hz),7.06(lH,d,J=7.8Hz),7.22-

7.24( lH,m),7.46-7.51 (3H,m),7.74-

7.78(2H,m),8.08(lH,d,J=5.9Hz),8.50( lH,d,J=5.9Hz),9.23( l H,s)

ESI-MS(m/e):369.0[M+H]⁺ The usefulness of a compound encompassed by the formula (1) as a pharmaceutical can be verified for example in the following Experiments.

Evaluation of the usefulness of a compound according to the invention was conducted by an in vitro assay described below.

Experiment 1 : Gene cloning Primers were synthesized from the regions before and after the base sequence of an ORF of GPRl 3 1 , which is a known GPCR in GenBank Accesion

No.NM_001077194 (human) and No. NM_174985 (mouse), and an RT-PCR was conducted to clone the gene. The primers employed had the following base sequences. hGPR131_F 12:CCCCTGTCCCCAGGACCAAGATG (SEQ.ID.No. l ) hGPR13 I-R I S ITTAGTTCAAGTCCAGGTCGACACTGCTTT (SEQ. ID. No.2) mGPR131_F 12:GTGCCAAGACCCATGATGACACCC (SEQ.ID.No.3) mGPR131_R13 :CTAATTCAAGTCCAGGTCAATGCTGC (SEQ.ID.No.4)

A human fetus marathon-ready cDNA (CLONTECH: presently TaKaRa) as a human GPR131 receptor gene and a cDNA reverse-transcribed from a mouse BAT tissue-derived RNA as a mouse GPRl 3 1 receptor were employed as samples in the

PCR.

The PCR involved amplification using 94°C for 9 minutes followed by 94°C for 30 seconds and then 68°C for 3 minutes which were repeated for 26 cycles in AmpliTaq Gold (Roche). The PCR products thus amplified were cloned using pCR2.1 -TOPOTA cloning kit (Invitrogen). Verification of the base sequences were based on the base sequencing after electrophoresis using BigDye Terminator Cycle

Sequencing Ready Reaction Kit ver.3.0 and DNA sequencer 377 (Applied

Biosynthesis). The GPR13 1 receptor gene cloned into a pCR2.1 -TOPO vector was cut out from the vector using a restriction enzyme BamHI and EcoRV, and then subcloned into the BamHI and EcoRI recognition sites in an eukaryotic expression vector pIREShyg3 (clonetech).

Experiment 2: Expression cell production Using LIPOFECTAMINE (Invitrogen), the cDNA of the GPRl 31 receptor was transfected to HEK/CRE-BLA cells, from which drug-resistant cells were isolated to obtain cell lines exhibiting stable expression of the GPR131. The HEK cells expressing the GPR13 1 were cultured in a DMEM/F 12 medium containing 10% fetal bovine serum, 100 units/mL penicillin, 0.1 mg/mL streptomycin sulfate, 250 ug/mL Hygromycin. Experiment 3 : Intracellular cAMP content assay

On the day of the measurement, 10,000 human GPR131 -expressing HEK cells in each well of a 384-well plate (Coning) were exposed to a test compound in the presence of 100 μM Ro-20- 1724, and assayed for the intracellular cAMP content by HitHunter XS+ kit (Discoverx), whereby examining the agonistic effects.

The GPR131 agonistic effects of the group of the compounds included in the inventive compounds were demonstrated as described below.

[Table 5]

Examp le EC 5 0 ( μM )

Co . No .

2 3 . 0

6 3 6 . 6

9 13 1 . 2

12 0 . 2 2 9 13 12 . 14 14 2 . 2 4 15 26 3 . 1

Based on the results shown above, the compounds according to the invention have the GPR131 agonistic effects, and are useful in treating and/or preventing diabetes, obesity, and hyperlipidemia.

Claims

CLAIMS 1. A compound represented by a formula (I):

(I) or a pharmaceutically acceptable salt thereof, wherein: X¹ to X⁵ are all CR or one of X¹ to X⁵ is a nitrogen atom and the others are

CR;

A formula (II):

(H) is a group selected from a group consisting of a phenyl group, a pyridinyl group, a pyrrolyl group, a pyrimidinyl group, an oxazolyl group, a pyridonyl group, a triazolyl group and a benzimidazolyl group;

X is N(R²), an oxygen atom or CH₂; Y is a lower alkylene group;

R is a group selected from a group consisting of a hydrogen atom, a halogen atom, a lower alkyl group and a lower alkoxy group, said lower alkyl group and lower alkoxy group are optionally substituted with 1 to 3, same or different atoms or groups selected from a group consisting of a halogen atom and a hydroxy group;

R¹ is a group selected from a group consisting of a halogen atom, a cyano group, a lower alkylthio group, a lower alkyl group and a lower alkoxy group, said lower alkyl group and lower alkoxy group are optionally substituted with 1 to 3, same or different atoms or groups selected from a group consisting of a halogen atom and a hydroxy group;

R² is a hydrogen atom or a lower alkyl group; m is an integer of 0 to 3; provided that 5-([ l , l -biphenyl]-2-ylmethoxy)-isoquinoline is excluded.

2. The compound according to Claim 1 , or the pharmaceutically acceptable salt thereof, wherein: the group of the formula (II):

(H) is a group selected from a group consisting of a formula (II- 1 ):

(II-1) wherein: (1)

is the position of binding to:

(III) and

(2) is the position of binding to Y.

3. The compound according to Claim 1 , or the pharmaceutically acceptable salt thereof, wherein: the group of the formula (II):

(") is a group selected from a group consisting of a formula (II- l - l ):

(II-1-1) wherein each symbol has a meaning same to that in Claim 1.

4. The compound according to Claim 1 , or the pharmaceutically acceptable salt thereof, wherein: the group of the formula (II):

(H) is a group selected from a group consisting of a formula (II-2):

(II-2) wherein each symbol has a meaning same to that in Claim 1.

5. The compound according to any one of Claims 1 to 4, or the pharmaceutically acceptable salt thereof, wherein X is NH or an oxygen atom.

6. The compound according to any one of Claims 1 to 4, or the pharmaceutically acceptable salt thereof, wherein X is CH₂.

7. The compound according to any one of Claims 1 to 4, or the pharmaceutically acceptable salt thereof, wherein Y is a methylene group.

8. The compound according to any one of Claims 1 to 4, or the pharmaceutically acceptable salt thereof, wherein the group of the formula (III):

(III) is a phenyl group optionally substituted with a group selected from a group consisting of a halogen atom and a lower alkyl group; said lower alkyl group is optionally substituted with 1 to 3 same or different halogen atoms; wherein:

is the position of binding to a group of the formula (II):

(H) and other symbols are same to those in Claim 1, or the pharmaceutically acceptable salt thereof.

9. The compound according to Claim 1 , or the pharmaceutically acceptable salt thereof, wherein: the compoound of the formula (I) is: N-{[3-(4-fluoro-2-methylphenyl)-2-pyridinyl]methyl}-5-isoquinolinamine, N-{[3-(2-chloro-4-fluorophenyl)-4-methyl-2-pyridinyl]methyl}-5-isoquinolinamine, N-{ [2-chloro-4-(2,4-difluorophenyl)-3-pyridinyl]methyl}-5-isoquinolinamine, 5-({ [3-(2-chloro-4-fluorophenyl)-2-pyridinyl]methyl}oxy)isoquinoline, 5-({ [6-chloro-3-(2-chloro-4-fluorophenyl)-2-pyridinyl]methyl}oxy)isoquinoline, 5-({ [3-(4-fluoro-2-methylphenyl)-2-pyridinyl]methyl}oxy)isoquinoline, 5-({[2-chloro-4-(2-fluorophenyl)-3-pyridinyl]methyl}oxy)isoquinoline, 5-({[3-(4-fluoro-2-methylphenyl)-4-pyridinyl]methyl}oxy)isoquinoline, 5-{[(2'-chloro-4'-fluoro-2-biphenylyl)methyl]oxy)isoquinoline, 5-{[(4'-fluoro-2',6'-dimethyl -2-biphenylyl)methyl]oxy)isoquinoline, 5-({[3-methyl-2-(2-pyridinyl)phenyl]methyl}oxy)isoquinoline, 5-({[ l-(2-chloro-4-fluorophenyl)-5-fluoro- l H-benzimidazol-2- yl] methyl }oxy)isoquinoline, 5-{2-[ l -(2-chloro-4-fluorophenyl)-5-fluoro- l H-benzimidazol-2-yl]ethyl} isoquinoline, N-({ l-[2-(trifluoromethyl)phenyl]-lH-pyrrol-2-yl}methyl)-5-isoquinolinamine, or, 5-[({ l -[2-(trifluoromethyl)phenyl]-l H-pyrrol-2-yl}methyl)oxy]isoquinoline.

10. A GPR13 1 agonist containing as an active ingredient the compound according to any one of claims 1 to 9 or the pharmaceutically acceptable salt thereof.

11. A therapeutic and/or prophylactic agent for hyperlipidemia, diabetes and/or obesity containing as an active ingredient the compound according to any one of claims 1 to 9 or the pharmaceutically acceptable salt thereof.

12. A pharmaceutical composition containing the compound according to any one of claims 1 to 9 and a pharmaceutically acceptable carrier.