WO2010115912A2 - Nucleic acid sequences based on the bacterial ssra gene and its tmrna transcript for the molecular detection of s.aureus - Google Patents

Nucleic acid sequences based on the bacterial ssra gene and its tmrna transcript for the molecular detection of s.aureus Download PDF

Info

Publication number
WO2010115912A2
WO2010115912A2 PCT/EP2010/054570 EP2010054570W WO2010115912A2 WO 2010115912 A2 WO2010115912 A2 WO 2010115912A2 EP 2010054570 W EP2010054570 W EP 2010054570W WO 2010115912 A2 WO2010115912 A2 WO 2010115912A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
kit
aureus
amplification
probe
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2010/054570
Other languages
French (fr)
Other versions
WO2010115912A3 (en
Inventor
Terry James Smith
Majella Maher
Justin O Grady
Thomas Barry
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National University of Ireland Galway NUI
Original Assignee
National University of Ireland Galway NUI
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University of Ireland Galway NUI filed Critical National University of Ireland Galway NUI
Publication of WO2010115912A2 publication Critical patent/WO2010115912A2/en
Publication of WO2010115912A3 publication Critical patent/WO2010115912A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • the invention relates to the identification of Staphylococcus aureus (S. aureus) and Staphylococcus species in mammals, in particular in humans for the diagnosis of infection, and in ruminants for the diagnosis of mastitis.
  • the invention relates to nucleic acid primers and probes to detect S. aureus species. More specifically the invention relates to the ssrA gene sequences, the corresponding RNA, specific probes, primers and oligonucleotides related thereto and their use in diagnostic assays to detect and/ or discriminate S. aureus and Staphylococcus species. Background to the Invention
  • S. aureus is an important pathogen in dairy cattle causing mastitis, an inflammation of the mammary gland reducing milk yield and quality. The disease is significant and results in losses of $200 approximately per cow per case and billions of dollars worldwide. S. aureus is a leading cause of contagious mastitis, a form of mastitis that is easily spread between animals which can result in sub-clinical mastitis. Diagnosis of the microbial agent causing mastitis is important to allow effective treatment and control of the infection. Current identification of infecting agent is by a combination of culture and biochemical tests which can take up to 3 days and have variable sensitivity.
  • Nucleic acid-based tests enable rapid and specific identification of microbial pathogens.
  • PCR- based assays for the identification of pathogens in milk have been described. Cremonesi et al. (2006) developed PCR assays based on the 23s rRNA gene for gram positive bacterial causes of mastitis including S. aureus. They tested the performance of the PCR assays on 30 bovine and caprine milk samples and achieved 100% correlation with the bacteriology results obtained for these samples.
  • Lee et al. (2008) reported the development of a biochip involving PCR for the identification of 7 microbial causes of mastitis based on detection of RNA and/or other specific genes. All but one of 82 random samples tested correlated with the bacteriology results.
  • Finnzymes Diagnostics recently released the "Pathproof TM Mastitis PCR" assay which identifies and quantifies important microbial causes of mastitis by real-time PCR.
  • S. aureus is a major cause of community acquired and nosocomial infections (Stamper et al., 2003). S. aureus bacteremia increases the risk of patient mortality particularly when the infecting agent is methicillin resistant S. aureus (Wisplinghoff et al., 2004). Nosocomial infections cost the US healthcare system between approximately $4.5 billion and $5.7 billion annually. Infections due to MRSA are increasing as are the number of deaths arising from infection by this pathogen. Survelliance for MRSA is recommended as part of clinical practice in Europe and the US (Verbrugh, 2005).
  • Nucleic acid based tests provide the potential for rapid identification of S. aureus.
  • Nucleic acid tests can combine both species identification and determination of resistance to methicillin by including a genetic marker, MecA in addition to species-specific genetic marker in the nucleic acid test.
  • Nucleic acid tests can be applied to patient screening, screening prior to admission to hospital and also for environmental monitoring. Rapid identification of MRSA enables the implementation of treatment and targeted control measures to reduce the spread of this pathogen.
  • EVIGENE MRSA detection kit Statens Serum Institut, Copenhagen, Denmark
  • S. aureus and CoNS identifies methicillin resistance based on hybridisation of probes specific for the mecA, nuc and 16sRNA genes.
  • IDI MRSA assay currently marketed as BD GeneOhm MRSA assay (Becton Dickinson) is a rapid PCR based test for identification of MRSA and S. aureus by targeting a unique S. aureus gene sequence and a region of the SCCmec cassette.
  • the GeneXpert MRSA assay (Cepheid) is run on an automated real-time PCR platform that allows integrated sample preparation and real-time PCR with a result obtained in approximately 1 hour.
  • This invention describes nucleic acid sequences based on the bacterial ssrA gene and its tmRNA transcript that can be applied in nucleic acid tests for the specific identification of S. aureus.
  • the nucleic acid sequences described may be suitable for detection of S. aureus in a direct probe hybridisation assay or in in-vitro amplification based assays for example real-time PCR or real-time nucleic sequence based amplification (NASBA).
  • NASBA is an isothermal in vitro amplification method that uses RNA for its amplification template.
  • the nucleic acid sequences described here for S. aureus could be combined with nucleic acid sequences for methicillin resistance in a nucleic acid test to detect MRSA.
  • nucleic acid sequences for other clinically relevant staphylococci based on the ssrA gene can be combined with the sequences for S. aureus in a single nucleic acid test.
  • a single primer set to amplify all relevant staphylococci species combined with a range of relevant species-specific probes.
  • miRNA is a labile RNA molecule and may be an indicator of viability in bacteria.
  • RNA as the nucleic acid target in a nucleic acid based test may provide a more accurate detection of viable bacteria compared to PCR which can amplify DNA from both viable and non- viable organisms. Additionally, tmRNA is present at approximately 1000 copies per cell in S. aureus (Glynn et al., 2007). This natural amplification of the target has the potential to enable more sensitive detection of the pathogen in nucleic acid tests involving in-vitro amplification or signal amplification direct detection assays. Definitions "Synthetic oligonucleotide” refers to molecules of nucleic acid polymers of 2 or more nucleotide bases that are not derived directly from genomic DNA or live organisms.
  • oligonucleotide is intended to encompass DNA, RNA, and DNA/RNA hybrid molecules that have been manufactured chemically, or synthesized enzymatically in vitro.
  • An "oligonucleotide” is a nucleotide polymer having two or more nucleotide subunits covalently joined together. Oligonucleotides are generally about 10 to about 100 nucleotides.
  • the sugar groups of the nucleotide subunits may be ribose, deoxyribose, or modified derivatives thereof such as OMe.
  • the nucleotide subunits may be joined by linkages such as phosphodiester linkages, modified linkages or by non-nucleotide moieties that do not prevent hybridization of the oligonucleotide to its complementary target nucleotide sequence.
  • Modified linkages include those in which a standard phosphodiester linkage is replaced with a different linkage, such as a phosphorothioate linkage, a methylphosphonate linkage, or a neutral peptide linkage.
  • Nitrogenous base analogs also may be components of oligonucleotides in accordance with the invention.
  • a "target nucleic acid” is a nucleic acid comprising a target nucleic acid sequence.
  • target nucleic acid sequence is a specific deoxyribonucleotide or ribonucleotide sequence that can be hybridized to a complementary oligonucleotide.
  • oligonucleotide probe is an oligonucleotide having a nucleotide sequence sufficiently complementary to its target nucleic acid sequence to be able to form a detectable hybrid probe:target duplex under high stringency hybridization conditions.
  • An oligonucleotide probe is an isolated chemical species and may include additional nucleotides outside of the targeted region as long as such nucleotides do not prevent hybridization under high stringency hybridization conditions.
  • Non-complementary sequences such as promoter sequences, restriction endonuclease recognition sites, or sequences that confer a desired secondary or tertiary structure such as a catalytic active site can be used to facilitate detection using the invented probes.
  • oligonucleotide probe optionally may be labelled with a detectable moiety such as a radioisotope, a fluorescent moiety, a chemiluminescent, a nanoparticle moiety, an enzyme or a ligand, which can be used to detect or confirm probe hybridization to its target sequence.
  • a detectable moiety such as a radioisotope, a fluorescent moiety, a chemiluminescent, a nanoparticle moiety, an enzyme or a ligand, which can be used to detect or confirm probe hybridization to its target sequence.
  • Oligonucleotide probes are preferred to be in the size range of from about 10 to about 100 nucleotides in length, although it is possible for probes to be as much as and above about 500 nucleotides in length, or below 10 nucleotides in length.
  • hybrid or a “duplex” is a complex formed between two single-stranded nucleic acid sequences by Watson-Crick base pairings or non-canonical base pairings between the complementary bases.
  • “Hybridization” is the process by which two complementary strands of nucleic acid combine to form a double-stranded structure (“hybrid” or “duplex”).
  • “Complementarity” is a property conferred by the base sequence of a single strand of DNA or RNA which may form a hybrid or double-stranded DNA:DNA, RNA:RNA or DNA:RNA through hydrogen bonding between Watson-Crick base pairs on the respective strands.
  • Adenine (A) ordinarily complements thymine (T) or uracil (U), while guanine (G) ordinarily complements cytosine (C).
  • stringency is used to describe the temperature, ionic strength and solvent composition existing during hybridization and the subsequent processing steps. Those skilled in the art will recognize that “stringency” conditions may be altered by varying those parameters either individually or together. Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands forming a hybrid. Stringency conditions are chosen to maximize the difference in stability between the hybrid formed with the target and the non-target nucleic acid.
  • nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences (for example, hybridization under "high stringency” conditions, may occur between homologs with about 85- 100% identity, preferably about 70-100% identity).
  • medium stringency conditions nucleic acid base pairing will occur between nucleic acids with an intermediate frequency of complementary base sequences (for example, hybridization under "medium stringency” conditions may occur between homologs with about 50-70% identity).
  • conditions of "weak” or “low” stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less.
  • 'High stringency' conditions are those equivalent to binding or hybridization at 42° C.
  • “Medium stringency' conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of 5XSSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5xDenhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.OxSSPE, 1.0% SDS at 42° C, when a probe of about 500 nucleotides in length is used.
  • 'Low stringency' conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of 5xSSPE (43.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5xDenhardt's reagent [50xDenhardt's contains per 500ml: 5g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5xSSPE, 0.1% SDS at 42° C, when a probe of about 500 nucleotides in length is used.
  • 5xSSPE 4.3.8 g/1 NaCl, 6.9 g/1 NaH 2 PO 4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH
  • 5xDenhardt's reagent [50xDenhardt
  • “stringency” is achieved by applying temperature conditions and ionic buffer conditions that are particular to that in-vitro amplification technology.
  • “stringency” is achieved by applying specific temperatures and ionic buffer strength for hybridisation of the oligonucleotide primers and, with regards to real-time PCR hybridisation of the probe/s, to the target nucleic acid for in-vitro amplification of the target nucleic acid.
  • substantially corresponding probes of the invention can vary from the referred-to sequence and still hybridize to the same target nucleic acid sequence.
  • Probes of the present invention substantially correspond to a nucleic acid sequence if these percentages are from about 100% to about 80% or from 0 base mismatches in about 10 nucleotide target sequence to about 2 bases mismatched in an about 10 nucleotide target sequence. In preferred embodiments, the percentage is from about 100% to about 85%.
  • this percentage is from about 90% to about 100%; in other preferred embodiments, this percentage is from about 95% to about 100%.
  • “sufficiently complementary” or “substantially complementary” is meant nucleic acids having a sufficient amount of contiguous complementary nucleotides to form, under high stringency hybridization conditions, a hybrid that is stable for detection.
  • nucleic acid hybrid or “probe:target duplex” is meant a structure that is a double-stranded, hydrogen-bonded structure, preferably about 10 to about 100 nucleotides in length, more preferably 14 to 50 nucleotides in length, although this will depend to an extent on the overall length of the oligonucleotide probe.
  • the structure is sufficiently stable to be detected by means such as chemiluminescent or fluorescent light detection, autoradiography, electrochemical analysis or gel electrophoresis.
  • hybrids include RNA:RNA, RNA:DNA, or DNA:DNA duplex molecules.
  • RNA and DNA equivalents refer to RNA and DNA molecules having the same complementary base pair hybridization properties. RNA and DNA equivalents have different sugar groups (i.e., ribose versus deoxyribose), and may differ by the presence of uracil in RNA and thymine in DNA. The difference between RNA and DNA equivalents do not contribute to differences in substantially corresponding nucleic acid sequences because the equivalents have the same degree of complementarity to a particular sequence.
  • oligonucleotide probes can hybridize their target nucleic acids to form stable probe:target hybrids (thereby indicating the presence of the target nucleic acids) without forming stable probe :non-target hybrids (that would indicate the presence of non-target nucleic acids from other organisms).
  • the probe hybridizes to target nucleic acid to a sufficiently greater extent than to non-target nucleic acid to enable one skilled in the art to accurately detect the presence of (for example Candida) and distinguish these species from other organisms.
  • Preferential hybridization can be measured using techniques known in the art and described herein.
  • theranostics is meant the use of diagnostic testing to diagnose the disease, choose the correct treatment regime and monitor the patient response to therapy.
  • the theranostics of the invention may be based on the use of an NAD assay of this invention on samples, swabs or specimens collected from the mammal.
  • the current inventors have made use of the ssrA gene sequences to design nucleic acid-based tests specific to S. aureus. Summary of the Invention
  • the present invention provides for a diagnostic kit for detection and identification of Staphylococcal species, comprising an oligonucleotide probe capable of binding to at least a portion of the ssrA or its corresponding tmRNA.
  • the oligonucleotide probe may have a sequence substantially homologous to or substantially complementary to a portion of the ssrA gene or its corresponding tmRNA. It will thus be capable of binding or hybridizing with a complementary DNA or RNA molecule.
  • the ssrA gene may be a bacterial ssrA gene.
  • the nucleic acid molecule may be synthetic.
  • the oligonucleotide probe may have a sequence of SEQ ID NO 9 to SEQ ID NO 37, or a sequence substantially homologous to or substantially complementary to those sequences, which can also act as a probe for the ssrA gene.
  • the kit may comprise more than one such probe.
  • the kit may comprise a plurality of such probes.
  • the kit may comprise additional probes for other Staphylococci, fungal, yeast species or viruses.
  • sequences of the invention identified as suitable targets provide the advantages of having significant intragenic sequence heterogeneity in some regions, which is advantageous and enables aspects of the invention to be directed towards group or species-specific targets, and also having significant sequence homogeneity in some regions, which enables aspects of the invention to be directed towards genus or group-specific primers and probes for use in direct nucleic acid detection technologies, signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies.
  • the sequences allow for multi-test capability and automation in diagnostic assays.
  • the ssrA nucleotide sequences both DNA and RNA can be used with direct detection, signal amplification detection and in vitro amplification technologies in diagnostics assays.
  • the ssrA sequences allow for multi-test capability and automation in diagnostic assays.
  • the kit may further comprise a primer for amplification of at least a portion of the ssrA gene.
  • the kit comprises a forward and a reverse primer for a portion of the ssrA gene.
  • the primer may have a sequence selected from the group SEQ ID NO 1 through to SEQ ID NO 8 or a sequence substantially homologous to or substantially complementary to those sequences, which can also act as a primer for the ssrA gene.
  • the kit may comprise at least one forward in vitro amplification primer and at least one reverse in vitro amplification primer, the forward amplification primer having a sequence selected from the group consisting of SEQ ID NO 1, 3, 5 and 7, or a sequence being substantially homologous or complementary thereto which can also act as a forward amplification primer for the ssrA gene, and the reverse amplification primer having a sequence selected from the group consisting of SEQ ID NO 2, 4, 6 and 8, or a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer for the ssrA gene.
  • the diagnostic kit may be based on direct nucleic acid detection technologies, signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies is selected from one or more of Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR), Nucleic Acids Sequence Based Amplification (NASBA), Strand Displacement Amplification (SDA), Transcription Mediated Amplification (TMA), Branched DNA technology (bDNA) and Rolling Circle Amplification Technology (RCAT) ), or other in vitro enzymatic amplification technologies.
  • PCR Polymerase Chain Reaction
  • LCR Ligase Chain Reaction
  • NASBA Nucleic Acids Sequence Based Amplification
  • SDA Strand Displacement Amplification
  • TMA Transcription Mediated Amplification
  • bDNA Branched DNA technology
  • RCAT Rolling Circle Amplification Technology
  • the nucleic acid molecule may comprise an oligonucleotide having a sequence substantially homologous to or substantially complementary to a portion of a nucleic acid molecule of SEQ ID NO.l to SEQ ID NO. 48.
  • the invention also provides a method of detecting a target organism in a test sample comprising the steps of:
  • the nucleic acid molecule and kits of the present invention may be used in a diagnostic assay to detect the presence of one or more bacterial species, to measure bacterial titres in a patient or in a method of assessing the efficacy of a treatment regime designed to reduce bacterial titre in a patient or to measure bacterial contamination in an environment.
  • the environment may be a hospital, or it may be a food sample, an environmental sample e.g. water, an industrial sample such as an in-process sample or an end product requiring bioburden or quality assessment.
  • kits and the nucleic acid molecule of the invention may be used in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the ssrA gene function.
  • the disruptive agent may be selected from the group consisting of antisense RNA, PNA, and siRNA.
  • a nucleic acid molecule comprising a species-specific probe can be used to discriminate between species of the same genus.
  • the oligonucleotides of the invention may be provided in a composition for detecting the nucleic acids of target organisms. Such a composition may also comprise buffers, enzymes, detergents, salts and so on, as appropriate to the intended use of the compositions. It is also envisioned that the compositions, kits and methods of the invention, while described herein as comprising at least one synthetic oligonucleotide, may also comprise natural oligonucleotides with substantially the same sequences as the synthetic nucleotide fragments in place of, or alongside synthetic oligonucleotides.
  • the invention also provides for an in vitro amplification diagnostic kit for a target bacterium comprising at least one forward in vitro amplification primer and at least one reverse in vitro amplification primer, the forward amplification primer being selected from the group consisting of one or more of a sequence being substantially homologous or complementary thereto which can also act as a forward amplification primer, and the reverse amplification primer being selected from the group consisting of one or more of or a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer.
  • the invention also provides for a diagnostic kit for detecting the presence of candidate bacterial species, comprising one or more DNA probes comprising a sequence substantially complementary to, or substantially homologous to the sequence of the ssrA gene of the candidate species.
  • the present invention also provides for one or more synthetic oligonucleotides having a nucleotide sequence substantially homologous to or substantially complementary to one or more of the group consisting of the ssrA gene or tRNA transcripts thereof, one or more of SEQ ID NO 1 -SEQ ID NO 48.
  • the nucleotide may comprise DNA.
  • the nucleotide may comprise RNA.
  • the nucleotide may comprise a mixture of DNA, RNA and PNA.
  • the nucleotide may comprise synthetic nucleotides.
  • the sequences of the invention (and the sequences relating to the methods, kits compositions and assays of the invention) may be selected to be substantially homologous to a portion of the coding region of the ssrA gene.
  • the gene may be a gene from a target bacterium.
  • the sequences of the invention are preferably sufficient so as to be able form a probe:target duplex to the portion of the sequence.
  • the invention also provides for a diagnostic kit for a target bacterium comprising an oligonucleotide probe substantially homologous to or substantially complementary to an oligonucleotide of the invention (which may be synthetic).
  • a diagnostic kit for a target bacterium comprising an oligonucleotide probe substantially homologous to or substantially complementary to an oligonucleotide of the invention (which may be synthetic).
  • sequences suitable for use as in vitro amplification primers may also be suitable for use as oligonucleotide probes: while it is preferable that amplification primers may have a complementary portion of between about 15 nucleotides and about 30 nucleotides (more preferably about 15-about 23, most preferably about 20 to about 23), oligonucleotide probes of the invention may be any suitable length.
  • hybridization and or annealing conditions will be required depending on the length, nature and structure (eg. Hybridization probe pairs for LightCycler, Taqman 5' exonuc lease probes, hairpin loop structures etc. and sequence of the oligonucleotide probe selected.
  • Kits and assays of the invention may also be provided wherein the oligonucleotide probe is immobilized on a surface.
  • a surface may be a bead, a membrane, a column, dipstick, a nanoparticle, the interior surface of a reaction chamber such as the well of a diagnostic plate or inside of a reaction tube, capillary or vessel or the like.
  • the target bacterium may be selected from the group consisting of S. aureus, S. capitis, S. chromogenes, S. cohnii, S. epidermidis, S. lactis, S. warneri, S. xylosus
  • the amplification primers and oligonucleotide probes of the invention may be designed to a gene specific or genus specific region so as to be able to identify one or more, or most, or substantially all of the desired organisms of the target organism grouping.
  • the test sample may comprise cells of the target organism.
  • the method may also comprise a step for releasing nucleic acid from any cells of the target organism that may be present in said test sample.
  • the test sample is a lysate of an obtained sample from a patient (such as a swab, or blood, urine, saliva, a bronchial lavage, dental specimen, skin specimen, scalp specimen, transplant organ biopsy, stool, mucus, or discharge sample).
  • the test samples may be a food sample, a milk sample, a water sample, an environmental sample, an end product, end product or in-process industrial sample.
  • the invention also provides for the use of any one of SEQ ID NO.l to SEQ ID NO.48 in a diagnostic assay for the presence of one or more bacterial species.
  • the species may be selected from the group consisting of S. aureus.
  • kits for use in clinical diagnostics, theranostics, food safety diagnostics, industrial microbiology diagnostics, environmental monitoring, veterinary diagnostics, bio-terrorism diagnostics comprising one or more of the synthetic oligonucleotides of the invention.
  • the kits may also comprise one or more articles selected from the group consisting of appropriate sample collecting instruments, reagent containers, buffers, labelling moieties, solutions, detergents and supplementary solutions.
  • the invention also provides for use of the sequences, compositions, nucleotide fragments, assays, and kits of the invention in theranostics, Food safety diagnostics, Industrial microbiology diagnostics, Environmental monitoring, Veterinary diagnostics, Bio-terrorism diagnostics.
  • the nucleic acid molecules, composition, kits or methods may be used in a diagnostic nucleic acid based assay for the detection of bacterial species.
  • the nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure bacterial titres in a patient.
  • the titres may be measured in vitro.
  • the nucleic acid molecules, composition, kits or methods may be used in a method of assessing the efficacy of a treatment regime designed to reduce bacterial titre in a patient comprising assessing the bacterial titre in the patient (by in vivo methods or in vitro methods) at one or more key stages of the treatment regime. Suitable key stages may include before treatment, during treatment and after treatment.
  • the treatment regime may comprise an antifungal agent, such as a pharmaceutical drug.
  • nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure potential bacterial contamination, for example, in a hospital.
  • nucleic acid molecules, composition, kits or methods may be used in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the ssrA gene function.
  • Suitable disruptive agents may be selected from the group consisting of antisense
  • RNA RNA, PNA, siRNA.
  • FIG. 1 S. aureus cRNA microarray sandwich assay with Sa20 reporter probe (Sal 9 capture probe circled) showing the detection of S. aureus cRNA.
  • Figure 3 Detection of S. aureus in spiked milk samples using the S. aureus NASBA assay.
  • RNA samples were spiked with S. aureus cells (10 8 , 10 5 -10 cells) and RNA extracted and included in the NASBA assay. Limit of detection is 10 cells/ml of milk. Controls including an S. aureus positive control (RNA), a blank broth sample, a UHT milk sample and a NASBA negative control were also included. S. aureus was not detected in the blank broth and UHT milk controls.
  • Figure 4 Detection of S. aureus strains in a S. aureus real-time PCR assay based on the ssrA gene. 10 of 10 S. aureus strains were detected.
  • S. aureus strains used for DNA sequencing, for probe evaluation and inclusivity testing of the NASBA assay and real-time PCR assay along with other Staphylococcus species strains and other bacterial species related to staphylococci or found in milk samples included in this study are listed in table 1.
  • Table 1 Strains and species included in the study
  • Conventional PCR amplification of the ssrA gene from position 4- 356 bp (353 bp fragment) was performed using primer set S aureus F/R (Table 2).
  • DNA sequencing of the ssrA gene products from these strains was performed using primer S. aureus F following clean-up of the PCR products using ExoSAP-IT by an external sequence service provider (Sequiserve, Germany). DNA sequence information was obtained for all strains sequenced.
  • DNA sequence information obtained for S. aureus and other staphylococci species strains was aligned using Clustal W with available ssrA gene sequence information for other closely related species and for species that may be present in the milk sample environment. The sequences were analysed and a selection of candidate primers and probes for the detection of S. aureus and staphylococci were designed from the sequence information.
  • Twenty-six DNA probes (Table 3) were designed and evaluated for their specificity for the detection of S. aureus and staphylococci by applying them on a DNA probe microarray (Asper Biotech) and hybridising them with in-vitro transcribed cRNA from S. aureus, staphylococci species and a range of other bacterial species.
  • the ssrA gene was amplified in S. aureus, staphylococci and selected other species and cloned into plasmid vector (Invitrogen). Plasmids were sequenced (Sequiserve, Germany) to confirm presence of correct insert and to identify insert orientation. In vitro transcription reactions were performed using MAXIscriptTM in vitro transcription kit (Ambion).
  • RNA products were purified using NUCaway spin columns (Ambion). Following transcription and purification, in vitro transcribed RNA was vacuum dried to a pellet (Eppendorf concentrator 5301) and labelled with cye-3 dye (Amersham) using standard methods (t Hoen et al. 2003). Following labelling, RNA was purified using NUCaway columns and vacuum dried as before. Labelled RNA was resuspended in 20 ⁇ l microarray hybridisation buffer (6X SSC, 0.1% SDS, 5X Denhardts). Evaluation of probe specificity was performed on microarrays using fluorescently labelled in vitro transcribed cRNAs (t Hoen et al. 2003).
  • NASBA reactions were performed using Nuclisens basic kit reagents (bioMerieux, France) according to manufacturer's instructions with the primers and molecular beacon probe included at a final concentration of 0.2 ⁇ M.
  • the assay was optimised as a real-time NASBA assay performed on the LightCycler 1.2. These primers and probe (Table 4) could be modified for application in other in-vitro amplification assays for example real-time PCR.
  • Real-time PCR primers and a TaqMan probe were designed from the sequence information and evaluated for the specific detection of S. aureus.
  • the assay was configured on the LightCycler® 2.0 thermocycler. Master mix for real-time PCR was prepared according to manufactuers instructions using the Roche LightCycler® FastStart DNA Master HybProbe Kit with primers F2/R2 included at a final concentration of 0.5mM and probe SA included at a final concentration of 0.2mM.
  • Table 3 List of probes designed for S. aureus and staphylococci species
  • NASBA probes are molecular beacons and include a stem sequence not part of the target tmRNA sequence (highlighted in bold).
  • NASBA probes are molecular beacons and include a stem sequence not part of the target tmRNA sequence (highlighted in bold).
  • Table 6 Primers and robe for the S. aureus real-time PCR assa :
  • S. aureus-specific and staphylococci probes DNA probes listed in table 3 were tested for their specificity for S. aureus and/or staphylococci species by hybridising in-vitro transcribed cRNA from S. aureus, staphylococci and selected other species listed in table 1 to the microarray as described. Seven S. aureus species specific probes Sa3, Sa4, Sa6, Sa7, Sal 8, Sa20 and Sa22 were identified and 4 staphylococci genus probes Sa8, Sal 2, Sa24 and Sa25 were identified. The potential to use these probes for the detection of S. aureus was demonstrated in a sandwich hybridisation assay where unlabelled S.
  • aureus cRNA was hybridised to the microarray and detected using Sa20 which was labelled with Cy-3 as a reporter probe.
  • Sa20 which was labelled with Cy-3 as a reporter probe.
  • One microgram cRNA plus 20pmol Sa20 reporter in a 20ul volume were hybridised to the microarray at 55C overnight and washed in 2X SSC, 0.1% SDS for 5 minutes at room temperature.
  • Figure 1 demonstrates the microarray sandwich assay. Strongest signal was obtained from Sal 9 capture probe with the S. aureus specific Sa20 reporter probe.
  • RNA template for NASBA evaluation was extracted from overnight cultures of the species listed in table 1 using the Ambion Ribopure yeast kit according to manufacturer's instructions.
  • the S. aureus real-time NASBA assay was tested for sensitivity by performing NASBA amplifications of serial dilutions of S. aureus RNA. A detection limit equivalent to 1-10 cells was determined ( Figure 2). Evaluation of the specificity was performed using a panel of RNA for species listed in table 1. Sixty-three S. aureus strains were all detected in the assay while 35 other strains (27 species) including closely related staphylococci species were not detected. This assay was sensitive and specific for the detection of S. aureus. The assay has been evaluated for the application to the detection of S.
  • specific degeneracy options are indicated in parenthesis: e.g.: (a/g) is either A or G.
  • SEQ ID NO 3 5'AATTGTAATACGACTCACTATAGGGAGTTCGTCATCAACACACA-S'
  • SEQ ID NO 4 5'-CAGAGGTCCTGATACACA-S' SEQ ID NO 5:
  • SEQ ID NO 42 >S. aureus (DSM15676)
  • SEQ ID NO 48 >S. epidermidis (DSM20044)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A diagnostic kit for a bacterial species comprising an oligonucleotide probe capable of binding to at least a portion of the ssrA gene or its corresponding tRNA. The kit may comprise a primer for amplification of at least a portion of the ssrA gene.

Description

Title
Nucleic acid sequences based on the bacterial ssrA gene and its tmRNA transcript for the molecular detection of S. aureus. Field of the Invention The invention relates to the identification of Staphylococcus aureus (S. aureus) and Staphylococcus species in mammals, in particular in humans for the diagnosis of infection, and in ruminants for the diagnosis of mastitis. In particular, the invention relates to nucleic acid primers and probes to detect S. aureus species. More specifically the invention relates to the ssrA gene sequences, the corresponding RNA, specific probes, primers and oligonucleotides related thereto and their use in diagnostic assays to detect and/ or discriminate S. aureus and Staphylococcus species. Background to the Invention
S. aureus is an important pathogen in dairy cattle causing mastitis, an inflammation of the mammary gland reducing milk yield and quality. The disease is significant and results in losses of $200 approximately per cow per case and billions of dollars worldwide. S. aureus is a leading cause of contagious mastitis, a form of mastitis that is easily spread between animals which can result in sub-clinical mastitis. Diagnosis of the microbial agent causing mastitis is important to allow effective treatment and control of the infection. Current identification of infecting agent is by a combination of culture and biochemical tests which can take up to 3 days and have variable sensitivity.
Nucleic acid-based tests enable rapid and specific identification of microbial pathogens. PCR- based assays for the identification of pathogens in milk have been described. Cremonesi et al. (2006) developed PCR assays based on the 23s rRNA gene for gram positive bacterial causes of mastitis including S. aureus. They tested the performance of the PCR assays on 30 bovine and caprine milk samples and achieved 100% correlation with the bacteriology results obtained for these samples. Recently, Lee et al. (2008) reported the development of a biochip involving PCR for the identification of 7 microbial causes of mastitis based on detection of RNA and/or other specific genes. All but one of 82 random samples tested correlated with the bacteriology results. Finnzymes Diagnostics recently released the "Pathproof ™ Mastitis PCR" assay which identifies and quantifies important microbial causes of mastitis by real-time PCR.
In humans, S. aureus is a major cause of community acquired and nosocomial infections (Stamper et al., 2003). S. aureus bacteremia increases the risk of patient mortality particularly when the infecting agent is methicillin resistant S. aureus (Wisplinghoff et al., 2004). Nosocomial infections cost the US healthcare system between approximately $4.5 billion and $5.7 billion annually. Infections due to MRSA are increasing as are the number of deaths arising from infection by this pathogen. Survelliance for MRSA is recommended as part of clinical practice in Europe and the US (Verbrugh, 2005).
Traditionally testing for S. aureus is by microbiological culture which takes 24 hours while determination of antimicrobial susceptibility requires a further 24 hours. Nucleic acid based tests provide the potential for rapid identification of S. aureus. Nucleic acid tests can combine both species identification and determination of resistance to methicillin by including a genetic marker, MecA in addition to species-specific genetic marker in the nucleic acid test. Nucleic acid tests can be applied to patient screening, screening prior to admission to hospital and also for environmental monitoring. Rapid identification of MRSA enables the implementation of treatment and targeted control measures to reduce the spread of this pathogen.
A number of nucleic acid tests for MRSA have been described in which the mecA gene, a determinant of methicillin resistance is identified in combination with S. aureus species-specific genes. Zhang et al. (2004) developed a quadriplex PCR assay for discrimination of S. aureus from coagulase negative staphylococci (CoNS) based on the thermonuclease nuc gene and detection of methicillin and muprocin resistance. They reported a sensitivity, specificity and accuracy of 100% for the tests applied to cultured S. aureus. Real-time PCR assays have been developed for the rapid and sensitive detection of MRSA (Paule et al., 2005; Francois et al., 2003). Hogg et al. (2008) developed a biplex real-time PCR assay to detect S. aureus and methicillin resistance based on the nuc and mecA genes respectively within 3 hours from positive blood cultures. Ornskov et al. (2008) developed a high-throughput real-time PCR method for screening swabs that were culture enriched overnight enabling colonised individuals to be identified within 24 hours. The analytical sensitivity of the test was 97% and they reported it to be a cost-effective method for screening for S. aureus. Deiman et al. (2008) recently described a modification of the NASBA method to include a restriction enzyme digestion step that increased the sensitivity of detection of mecA. A detection limit of <10 cell equivalents for S. aureus was achieved with this method. There are some commercial nucleic acid tests available for identification of MRSA. These include; EVIGENE MRSA detection kit (Statens Serum Institut, Copenhagen, Denmark) which detects and discriminates S. aureus and CoNS and identifies methicillin resistance based on hybridisation of probes specific for the mecA, nuc and 16sRNA genes. The IDI MRSA assay currently marketed as BD GeneOhm MRSA assay (Becton Dickinson) is a rapid PCR based test for identification of MRSA and S. aureus by targeting a unique S. aureus gene sequence and a region of the SCCmec cassette. The GeneXpert MRSA assay (Cepheid) is run on an automated real-time PCR platform that allows integrated sample preparation and real-time PCR with a result obtained in approximately 1 hour. This invention describes nucleic acid sequences based on the bacterial ssrA gene and its tmRNA transcript that can be applied in nucleic acid tests for the specific identification of S. aureus. In particular, the nucleic acid sequences described may be suitable for detection of S. aureus in a direct probe hybridisation assay or in in-vitro amplification based assays for example real-time PCR or real-time nucleic sequence based amplification (NASBA). NASBA is an isothermal in vitro amplification method that uses RNA for its amplification template. The nucleic acid sequences described here for S. aureus could be combined with nucleic acid sequences for methicillin resistance in a nucleic acid test to detect MRSA.
One advantage of using sequences based on the ssrA gene is that as it is universally present in eubacteria, nucleic acid sequences (primers and probes) for other clinically relevant staphylococci based on the ssrA gene can be combined with the sequences for S. aureus in a single nucleic acid test. In such a test it may be possible to have a single primer set to amplify all relevant staphylococci species combined with a range of relevant species-specific probes. miRNA is a labile RNA molecule and may be an indicator of viability in bacteria. Using miRNA as the nucleic acid target in a nucleic acid based test may provide a more accurate detection of viable bacteria compared to PCR which can amplify DNA from both viable and non- viable organisms. Additionally, tmRNA is present at approximately 1000 copies per cell in S. aureus (Glynn et al., 2007). This natural amplification of the target has the potential to enable more sensitive detection of the pathogen in nucleic acid tests involving in-vitro amplification or signal amplification direct detection assays. Definitions "Synthetic oligonucleotide" refers to molecules of nucleic acid polymers of 2 or more nucleotide bases that are not derived directly from genomic DNA or live organisms. The term synthetic oligonucleotide is intended to encompass DNA, RNA, and DNA/RNA hybrid molecules that have been manufactured chemically, or synthesized enzymatically in vitro. An "oligonucleotide" is a nucleotide polymer having two or more nucleotide subunits covalently joined together. Oligonucleotides are generally about 10 to about 100 nucleotides. The sugar groups of the nucleotide subunits may be ribose, deoxyribose, or modified derivatives thereof such as OMe. The nucleotide subunits may be joined by linkages such as phosphodiester linkages, modified linkages or by non-nucleotide moieties that do not prevent hybridization of the oligonucleotide to its complementary target nucleotide sequence. Modified linkages include those in which a standard phosphodiester linkage is replaced with a different linkage, such as a phosphorothioate linkage, a methylphosphonate linkage, or a neutral peptide linkage. Nitrogenous base analogs also may be components of oligonucleotides in accordance with the invention. A "target nucleic acid" is a nucleic acid comprising a target nucleic acid sequence. A "target nucleic acid sequence," "target nucleotide sequence" or "target sequence" is a specific deoxyribonucleotide or ribonucleotide sequence that can be hybridized to a complementary oligonucleotide.
An "oligonucleotide probe" is an oligonucleotide having a nucleotide sequence sufficiently complementary to its target nucleic acid sequence to be able to form a detectable hybrid probe:target duplex under high stringency hybridization conditions. An oligonucleotide probe is an isolated chemical species and may include additional nucleotides outside of the targeted region as long as such nucleotides do not prevent hybridization under high stringency hybridization conditions. Non-complementary sequences, such as promoter sequences, restriction endonuclease recognition sites, or sequences that confer a desired secondary or tertiary structure such as a catalytic active site can be used to facilitate detection using the invented probes. An oligonucleotide probe optionally may be labelled with a detectable moiety such as a radioisotope, a fluorescent moiety, a chemiluminescent, a nanoparticle moiety, an enzyme or a ligand, which can be used to detect or confirm probe hybridization to its target sequence. Oligonucleotide probes are preferred to be in the size range of from about 10 to about 100 nucleotides in length, although it is possible for probes to be as much as and above about 500 nucleotides in length, or below 10 nucleotides in length.
A "hybrid" or a "duplex" is a complex formed between two single-stranded nucleic acid sequences by Watson-Crick base pairings or non-canonical base pairings between the complementary bases. "Hybridization" is the process by which two complementary strands of nucleic acid combine to form a double-stranded structure ("hybrid" or "duplex").
"Complementarity" is a property conferred by the base sequence of a single strand of DNA or RNA which may form a hybrid or double-stranded DNA:DNA, RNA:RNA or DNA:RNA through hydrogen bonding between Watson-Crick base pairs on the respective strands. Adenine (A) ordinarily complements thymine (T) or uracil (U), while guanine (G) ordinarily complements cytosine (C).
The term "stringency" is used to describe the temperature, ionic strength and solvent composition existing during hybridization and the subsequent processing steps. Those skilled in the art will recognize that "stringency" conditions may be altered by varying those parameters either individually or together. Under high stringency conditions only highly complementary nucleic acid hybrids will form; hybrids without a sufficient degree of complementarity will not form. Accordingly, the stringency of the assay conditions determines the amount of complementarity needed between two nucleic acid strands forming a hybrid. Stringency conditions are chosen to maximize the difference in stability between the hybrid formed with the target and the non-target nucleic acid. With "high stringency" conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences (for example, hybridization under "high stringency" conditions, may occur between homologs with about 85- 100% identity, preferably about 70-100% identity). With medium stringency conditions, nucleic acid base pairing will occur between nucleic acids with an intermediate frequency of complementary base sequences (for example, hybridization under "medium stringency" conditions may occur between homologs with about 50-70% identity). Thus, conditions of "weak" or "low" stringency are often required with nucleic acids that are derived from organisms that are genetically diverse, as the frequency of complementary sequences is usually less. 'High stringency' conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of 5xSSPE (43.8g/l NaCl, 6.9 g/1 NaH2PO4H2O and 1.85 g/1 EDTA, ph adjusted to 7.4 with NaOH), 0.5% SDS, 5xDenhardt's reagent and lOOμg/ml denatured salmon sperm DNA followed by washing in a solution comprising 0. IxSSPE, 1.0%SDS at 42° C. when a probe of about 500 nucleotides in length is used. For shorter nucleotide probe lengths the hybridisation temperature is determined by the melting temp of the probe-based on its nucleotide composition, so the hybridisation would be carried out at the melting temperature +/- 10°C of the sequence in question.
"Medium stringency' conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of 5XSSPE (43.8 g/1 NaCl, 6.9 g/1 NaH2PO4H2O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5xDenhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.OxSSPE, 1.0% SDS at 42° C, when a probe of about 500 nucleotides in length is used.
'Low stringency' conditions are those equivalent to binding or hybridization at 42° C. in a solution consisting of 5xSSPE (43.8 g/1 NaCl, 6.9 g/1 NaH2PO4H2O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5xDenhardt's reagent [50xDenhardt's contains per 500ml: 5g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 5xSSPE, 0.1% SDS at 42° C, when a probe of about 500 nucleotides in length is used.
In the context of nucleic acid in-vitro amplification based technologies, "stringency" is achieved by applying temperature conditions and ionic buffer conditions that are particular to that in-vitro amplification technology. For example, in the context of PCR and real-time PCR, "stringency" is achieved by applying specific temperatures and ionic buffer strength for hybridisation of the oligonucleotide primers and, with regards to real-time PCR hybridisation of the probe/s, to the target nucleic acid for in-vitro amplification of the target nucleic acid. One skilled in the art will understand that substantially corresponding probes of the invention can vary from the referred-to sequence and still hybridize to the same target nucleic acid sequence. This variation from the nucleic acid may be stated in terms of a percentage of identical bases within the sequence or the percentage of perfectly complementary bases between the probe and its target sequence. Probes of the present invention substantially correspond to a nucleic acid sequence if these percentages are from about 100% to about 80% or from 0 base mismatches in about 10 nucleotide target sequence to about 2 bases mismatched in an about 10 nucleotide target sequence. In preferred embodiments, the percentage is from about 100% to about 85%. In more preferred embodiments, this percentage is from about 90% to about 100%; in other preferred embodiments, this percentage is from about 95% to about 100% By "sufficiently complementary" or "substantially complementary" is meant nucleic acids having a sufficient amount of contiguous complementary nucleotides to form, under high stringency hybridization conditions, a hybrid that is stable for detection.
By "nucleic acid hybrid" or "probe:target duplex" is meant a structure that is a double-stranded, hydrogen-bonded structure, preferably about 10 to about 100 nucleotides in length, more preferably 14 to 50 nucleotides in length, although this will depend to an extent on the overall length of the oligonucleotide probe. The structure is sufficiently stable to be detected by means such as chemiluminescent or fluorescent light detection, autoradiography, electrochemical analysis or gel electrophoresis. Such hybrids include RNA:RNA, RNA:DNA, or DNA:DNA duplex molecules.
"RNA and DNA equivalents" refer to RNA and DNA molecules having the same complementary base pair hybridization properties. RNA and DNA equivalents have different sugar groups (i.e., ribose versus deoxyribose), and may differ by the presence of uracil in RNA and thymine in DNA. The difference between RNA and DNA equivalents do not contribute to differences in substantially corresponding nucleic acid sequences because the equivalents have the same degree of complementarity to a particular sequence. By "preferentially hybridize" is meant that under high stringency hybridization conditions oligonucleotide probes can hybridize their target nucleic acids to form stable probe:target hybrids (thereby indicating the presence of the target nucleic acids) without forming stable probe :non-target hybrids (that would indicate the presence of non-target nucleic acids from other organisms). Thus, the probe hybridizes to target nucleic acid to a sufficiently greater extent than to non-target nucleic acid to enable one skilled in the art to accurately detect the presence of (for example Candida) and distinguish these species from other organisms.
Preferential hybridization can be measured using techniques known in the art and described herein.
By "theranostics" is meant the use of diagnostic testing to diagnose the disease, choose the correct treatment regime and monitor the patient response to therapy. The theranostics of the invention may be based on the use of an NAD assay of this invention on samples, swabs or specimens collected from the mammal. Object of the Invention
It is an object of the current invention to provide sequences and/or diagnostic assays to detect and identify one or more Staphylococcus species. The current inventors have made use of the ssrA gene sequences to design nucleic acid-based tests specific to S. aureus. Summary of the Invention
The present invention provides for a diagnostic kit for detection and identification of Staphylococcal species, comprising an oligonucleotide probe capable of binding to at least a portion of the ssrA or its corresponding tmRNA. The oligonucleotide probe may have a sequence substantially homologous to or substantially complementary to a portion of the ssrA gene or its corresponding tmRNA. It will thus be capable of binding or hybridizing with a complementary DNA or RNA molecule. The ssrA gene may be a bacterial ssrA gene. The nucleic acid molecule may be synthetic. The oligonucleotide probe may have a sequence of SEQ ID NO 9 to SEQ ID NO 37, or a sequence substantially homologous to or substantially complementary to those sequences, which can also act as a probe for the ssrA gene. The kit may comprise more than one such probe. In particular the kit may comprise a plurality of such probes. In addition, the kit may comprise additional probes for other Staphylococci, fungal, yeast species or viruses.
The identified sequences are suitable not only for in vitro DNA/RNA amplification based detection systems but also for signal amplification based detection systems. Furthermore, the sequences of the invention identified as suitable targets provide the advantages of having significant intragenic sequence heterogeneity in some regions, which is advantageous and enables aspects of the invention to be directed towards group or species-specific targets, and also having significant sequence homogeneity in some regions, which enables aspects of the invention to be directed towards genus or group-specific primers and probes for use in direct nucleic acid detection technologies, signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies. The sequences allow for multi-test capability and automation in diagnostic assays.
The ssrA nucleotide sequences, both DNA and RNA can be used with direct detection, signal amplification detection and in vitro amplification technologies in diagnostics assays. The ssrA sequences allow for multi-test capability and automation in diagnostic assays.
The kit may further comprise a primer for amplification of at least a portion of the ssrA gene. Suitably, the kit comprises a forward and a reverse primer for a portion of the ssrA gene. The primer may have a sequence selected from the group SEQ ID NO 1 through to SEQ ID NO 8 or a sequence substantially homologous to or substantially complementary to those sequences, which can also act as a primer for the ssrA gene. The kit may comprise at least one forward in vitro amplification primer and at least one reverse in vitro amplification primer, the forward amplification primer having a sequence selected from the group consisting of SEQ ID NO 1, 3, 5 and 7, or a sequence being substantially homologous or complementary thereto which can also act as a forward amplification primer for the ssrA gene, and the reverse amplification primer having a sequence selected from the group consisting of SEQ ID NO 2, 4, 6 and 8, or a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer for the ssrA gene. The diagnostic kit may be based on direct nucleic acid detection technologies, signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies is selected from one or more of Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR), Nucleic Acids Sequence Based Amplification (NASBA), Strand Displacement Amplification (SDA), Transcription Mediated Amplification (TMA), Branched DNA technology (bDNA) and Rolling Circle Amplification Technology (RCAT) ), or other in vitro enzymatic amplification technologies. The invention also provides a nucleic acid molecule selected from the group consisting of SEQ ID NO.l to SEQ ID NO. 48 and sequences substantially homologous thereto, or substantially complementary to a portion thereof and having a function in diagnostics based on the ssrA gene. The nucleic acid molecule may comprise an oligonucleotide having a sequence substantially homologous to or substantially complementary to a portion of a nucleic acid molecule of SEQ ID NO.l to SEQ ID NO. 48. The invention also provides a method of detecting a target organism in a test sample comprising the steps of:
(i) Mixing the test sample with at least one oligonucleotide probe as defined above under appropriate conditions; and (ii) hybridizing under high stringency conditions any nucleic acid that may be present in the test sample with the oligonucleotide to form a probe:target duplex; and
(iii) determining whether a probe:target duplex is present; the presence of the duplex positively identifying the presence of the target organism in the test sample. The nucleic acid molecule and kits of the present invention may be used in a diagnostic assay to detect the presence of one or more bacterial species, to measure bacterial titres in a patient or in a method of assessing the efficacy of a treatment regime designed to reduce bacterial titre in a patient or to measure bacterial contamination in an environment. The environment may be a hospital, or it may be a food sample, an environmental sample e.g. water, an industrial sample such as an in-process sample or an end product requiring bioburden or quality assessment. The kits and the nucleic acid molecule of the invention may be used in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the ssrA gene function. The disruptive agent may be selected from the group consisting of antisense RNA, PNA, and siRNA.
In some embodiments of the invention, a nucleic acid molecule comprising a species-specific probe can be used to discriminate between species of the same genus. The oligonucleotides of the invention may be provided in a composition for detecting the nucleic acids of target organisms. Such a composition may also comprise buffers, enzymes, detergents, salts and so on, as appropriate to the intended use of the compositions. It is also envisioned that the compositions, kits and methods of the invention, while described herein as comprising at least one synthetic oligonucleotide, may also comprise natural oligonucleotides with substantially the same sequences as the synthetic nucleotide fragments in place of, or alongside synthetic oligonucleotides.
The invention also provides for an in vitro amplification diagnostic kit for a target bacterium comprising at least one forward in vitro amplification primer and at least one reverse in vitro amplification primer, the forward amplification primer being selected from the group consisting of one or more of a sequence being substantially homologous or complementary thereto which can also act as a forward amplification primer, and the reverse amplification primer being selected from the group consisting of one or more of or a sequence being substantially homologous or complementary thereto which can also act as a reverse amplification primer. The invention also provides for a diagnostic kit for detecting the presence of candidate bacterial species, comprising one or more DNA probes comprising a sequence substantially complementary to, or substantially homologous to the sequence of the ssrA gene of the candidate species. The present invention also provides for one or more synthetic oligonucleotides having a nucleotide sequence substantially homologous to or substantially complementary to one or more of the group consisting of the ssrA gene or tRNA transcripts thereof, one or more of SEQ ID NO 1 -SEQ ID NO 48.
The nucleotide may comprise DNA. The nucleotide may comprise RNA. The nucleotide may comprise a mixture of DNA, RNA and PNA. The nucleotide may comprise synthetic nucleotides. The sequences of the invention (and the sequences relating to the methods, kits compositions and assays of the invention) may be selected to be substantially homologous to a portion of the coding region of the ssrA gene. The gene may be a gene from a target bacterium. The sequences of the invention are preferably sufficient so as to be able form a probe:target duplex to the portion of the sequence.
The invention also provides for a diagnostic kit for a target bacterium comprising an oligonucleotide probe substantially homologous to or substantially complementary to an oligonucleotide of the invention (which may be synthetic). It will be appreciated that sequences suitable for use as in vitro amplification primers may also be suitable for use as oligonucleotide probes: while it is preferable that amplification primers may have a complementary portion of between about 15 nucleotides and about 30 nucleotides (more preferably about 15-about 23, most preferably about 20 to about 23), oligonucleotide probes of the invention may be any suitable length. The skilled person will appreciate that different hybridization and or annealing conditions will be required depending on the length, nature and structure (eg. Hybridization probe pairs for LightCycler, Taqman 5' exonuc lease probes, hairpin loop structures etc. and sequence of the oligonucleotide probe selected.
Kits and assays of the invention may also be provided wherein the oligonucleotide probe is immobilized on a surface. Such a surface may be a bead, a membrane, a column, dipstick, a nanoparticle, the interior surface of a reaction chamber such as the well of a diagnostic plate or inside of a reaction tube, capillary or vessel or the like.
The target bacterium may be selected from the group consisting of S. aureus, S. capitis, S. chromogenes, S. cohnii, S. epidermidis, S. lactis, S. warneri, S. xylosus Under these circumstances, the amplification primers and oligonucleotide probes of the invention may be designed to a gene specific or genus specific region so as to be able to identify one or more, or most, or substantially all of the desired organisms of the target organism grouping. The test sample may comprise cells of the target organism. The method may also comprise a step for releasing nucleic acid from any cells of the target organism that may be present in said test sample. Ideally, the test sample is a lysate of an obtained sample from a patient (such as a swab, or blood, urine, saliva, a bronchial lavage, dental specimen, skin specimen, scalp specimen, transplant organ biopsy, stool, mucus, or discharge sample). The test samples may be a food sample, a milk sample, a water sample, an environmental sample, an end product, end product or in-process industrial sample. The invention also provides for the use of any one of SEQ ID NO.l to SEQ ID NO.48 in a diagnostic assay for the presence of one or more bacterial species. The species may be selected from the group consisting of S. aureus.
The invention also provides for kits for use in clinical diagnostics, theranostics, food safety diagnostics, industrial microbiology diagnostics, environmental monitoring, veterinary diagnostics, bio-terrorism diagnostics comprising one or more of the synthetic oligonucleotides of the invention. The kits may also comprise one or more articles selected from the group consisting of appropriate sample collecting instruments, reagent containers, buffers, labelling moieties, solutions, detergents and supplementary solutions. The invention also provides for use of the sequences, compositions, nucleotide fragments, assays, and kits of the invention in theranostics, Food safety diagnostics, Industrial microbiology diagnostics, Environmental monitoring, Veterinary diagnostics, Bio-terrorism diagnostics. The nucleic acid molecules, composition, kits or methods may be used in a diagnostic nucleic acid based assay for the detection of bacterial species.
The nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure bacterial titres in a patient. The titres may be measured in vitro. The nucleic acid molecules, composition, kits or methods may be used in a method of assessing the efficacy of a treatment regime designed to reduce bacterial titre in a patient comprising assessing the bacterial titre in the patient (by in vivo methods or in vitro methods) at one or more key stages of the treatment regime. Suitable key stages may include before treatment, during treatment and after treatment. The treatment regime may comprise an antifungal agent, such as a pharmaceutical drug.
The nucleic acid molecules, composition, kits or methods may be used in a diagnostic assay to measure potential bacterial contamination, for example, in a hospital.
The nucleic acid molecules, composition, kits or methods may be used in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the ssrA gene function. Suitable disruptive agents may be selected from the group consisting of antisense
RNA, PNA, siRNA.
Brief Description of the Drawings
Figure 1: S. aureus cRNA microarray sandwich assay with Sa20 reporter probe (Sal 9 capture probe circled) showing the detection of S. aureus cRNA. Figure 2: Real-time NASBA of dilutions of S. aureus total RNA (10~2 = 100,000 cells; 10-4 =
10,000 cells; 10 -5 = 1,000 cells; 10 -6 = 100 cells; 10 -7 = 10 cells; 10 -9 = <1 cell equivalents).
Limit of detection is < 1 cell equivalent.
Figure 3: Detection of S. aureus in spiked milk samples using the S. aureus NASBA assay.
Milk samples were spiked with S. aureus cells (108, 105-10 cells) and RNA extracted and included in the NASBA assay. Limit of detection is 10 cells/ml of milk. Controls including an S. aureus positive control (RNA), a blank broth sample, a UHT milk sample and a NASBA negative control were also included. S. aureus was not detected in the blank broth and UHT milk controls.
Figure 4: Detection of S. aureus strains in a S. aureus real-time PCR assay based on the ssrA gene. 10 of 10 S. aureus strains were detected.
Figure 5: Real-time amplification of S. aureus total DNA (10 -1 = 180,000 cells; 10-2 = 18,000 cells; 10-3 = 1,800 cells; 10-4 = 180 cells; 10-5 = 18 cells; 10-6 = 1.8 cell equivalents) in the ssrA based real-time PCR. Limit of detection is 18 cells.
Detailed Description of the Invention Materials and Methods
Bacterial species and strains: S. aureus strains used for DNA sequencing, for probe evaluation and inclusivity testing of the NASBA assay and real-time PCR assay along with other Staphylococcus species strains and other bacterial species related to staphylococci or found in milk samples included in this study are listed in table 1. Table 1 : Strains and species included in the study
Figure imgf000013_0001
Figure imgf000014_0001
DNA sequencing:
DNA sequencing of the ssrA gene in 6 S. aureus strains, S. epidermidis (n=2), S. capitis (n=l),
S. caseofyticus(n=\) and S. chromogenes (n=l) was performed using DNA extracted using Edge BioSystems 'Bacterial Genomic DNA Extraction Kit' from cultures of these strains according to manufacturers instructions. Conventional PCR amplification of the ssrA gene from position 4- 356 bp (353 bp fragment) was performed using primer set S aureus F/R (Table 2). Following PCR amplification DNA sequencing of the ssrA gene products from these strains was performed using primer S. aureus F following clean-up of the PCR products using ExoSAP-IT by an external sequence service provider (Sequiserve, Germany). DNA sequence information was obtained for all strains sequenced.
PCR, NASBA primer and DNA probe design ssrA gene DNA sequence information obtained for S. aureus and other staphylococci species strains was aligned using Clustal W with available ssrA gene sequence information for other closely related species and for species that may be present in the milk sample environment. The sequences were analysed and a selection of candidate primers and probes for the detection of S. aureus and staphylococci were designed from the sequence information. DNA probe Design:
Twenty-six DNA probes (Table 3) were designed and evaluated for their specificity for the detection of S. aureus and staphylococci by applying them on a DNA probe microarray (Asper Biotech) and hybridising them with in-vitro transcribed cRNA from S. aureus, staphylococci species and a range of other bacterial species. The ssrA gene was amplified in S. aureus, staphylococci and selected other species and cloned into plasmid vector (Invitrogen). Plasmids were sequenced (Sequiserve, Germany) to confirm presence of correct insert and to identify insert orientation. In vitro transcription reactions were performed using MAXIscript™ in vitro transcription kit (Ambion). Following transcription, the RNA products were purified using NUCaway spin columns (Ambion). Following transcription and purification, in vitro transcribed RNA was vacuum dried to a pellet (Eppendorf concentrator 5301) and labelled with cye-3 dye (Amersham) using standard methods (t Hoen et al. 2003). Following labelling, RNA was purified using NUCaway columns and vacuum dried as before. Labelled RNA was resuspended in 20 μl microarray hybridisation buffer (6X SSC, 0.1% SDS, 5X Denhardts). Evaluation of probe specificity was performed on microarrays using fluorescently labelled in vitro transcribed cRNAs (t Hoen et al. 2003). Overnight hybridisations were performed in a Genetix slide chamber (Hampshire, England) at 55ºC under glass coverslips. Total hybridisation volume was 20μl. Post-hybridisation washes were 2X SSC, 0.1% SDS for 5 minutes at room temperature followed by 0.2X SSC, 0.1% SDS for 5 minutes also at room temperature. Slides were rinsed once in distilled water and dried by centrifugation using an Eppendorf centrifuge fitted with a microarray slide adaptor. Washed microarray slides were scanned immediately using ScanArray Express Microarray Analysis System (Perkin Elmer). NASBA assay design: NASBA primers and a molecular beacon probe (Table 4) were designed from this sequence information and evaluated for the detection of S. aureus in a real-time NASBA assay. NASBA reactions were performed using Nuclisens basic kit reagents (bioMerieux, France) according to manufacturer's instructions with the primers and molecular beacon probe included at a final concentration of 0.2 μM. The assay was optimised as a real-time NASBA assay performed on the LightCycler 1.2. These primers and probe (Table 4) could be modified for application in other in-vitro amplification assays for example real-time PCR. IAC development:
An internal amplification control was designed for inclusion in the S. aureus NASBA assay. Candida albicans alsl gene was PCR amplified with Composite F/R primers (Table 5)and then with NASBA 6F/6R (Table 5) producing a 239 bp PCR product from which a 217 base cRNA fragment was synthesized to serve as the IAC for the S. aureus NASBA. 20, 000 copies of IAC cRNA were included in the S. aureus real-time NASBA reaction. Real-time PCR assay design:
Real-time PCR primers and a TaqMan probe (Table 6) were designed from the sequence information and evaluated for the specific detection of S. aureus. The assay was configured on the LightCycler® 2.0 thermocycler. Master mix for real-time PCR was prepared according to manufactuers instructions using the Roche LightCycler® FastStart DNA Master HybProbe Kit with primers F2/R2 included at a final concentration of 0.5mM and probe SA included at a final concentration of 0.2mM.
Table 2: PCR primers for PCR amplification and sequencing
Figure imgf000016_0001
Table 3: List of probes designed for S. aureus and staphylococci species
OLIGO NAME PROBE SEQUENCE TM
Sal ACCCTCCGACACG 53.6
Sa2 CTGTTAGGCGATGCA 53.8
Sa3 CACATAGGAAATGCTGTT 53.8
Sa4 CTATTAAGGTTGAATCGC 51.8
Sa5 CTAGTTTGATTAAGTTTCTTCT 53.5
Sa6 GCATCATGAAAAGTGATAA 52.5
Sa7 ACACGCTTAATGAGCT 53.8
Sa8 CTCCGACACGCTTAAT 54.4
Sa9 TGTGTGTTGATGACGA 53.6
SaIO TTTGCCAGTTATTATAAACTG 53.7
Sai l ACTGCGAAATTATTGTTTG 53.8
Sal2 TTAGGCAGCTACTGC 52.9
Sal3 AGAGTGCGATTAGGC 53.0
Sal4 AATGCTGTTAGGCGAT 53.8
Sal5 GAAATGCTGTTAGGCG 53.8
Sal6 GAATCGCGTTAACAGC 54.4
Sal7 TAAGGTTGAATCGCGT 53.8
Sal8 TCCTATTAAGGTTGAATCG 53.1
Sal9 ACGGCAGTGTTTAGC 54.5
Sa20 AAGTTTCTTCTAAACAGACT 53.5
Sa21 CCAACATGATGCTAGC 53.0
Sa22 GGTTTCGCATCATGAAA 54.0
Sa23 CGTGTGTAGTTTATCGAA 53.4
Sa24 ACACATCTTTCTACGTGT 54.7
Sa25 AGGTCCTGATACACATC 53.2
Sa26 GGCGGGATTTGAACC 55.4
Table 4: NASBA primers and probes
Figure imgf000017_0001
Note: NASBA probes are molecular beacons and include a stem sequence not part of the target tmRNA sequence (highlighted in bold).
Table 5: Primers and probes for the IAC for the S. aureus NASBA.
Figure imgf000017_0002
Note: NASBA probes are molecular beacons and include a stem sequence not part of the target tmRNA sequence (highlighted in bold). Table 6: Primers and robe for the S. aureus real-time PCR assa :
Figure imgf000018_0001
Results
Selection of S. aureus-specific and staphylococci probes: DNA probes listed in table 3 were tested for their specificity for S. aureus and/or staphylococci species by hybridising in-vitro transcribed cRNA from S. aureus, staphylococci and selected other species listed in table 1 to the microarray as described. Seven S. aureus species specific probes Sa3, Sa4, Sa6, Sa7, Sal 8, Sa20 and Sa22 were identified and 4 staphylococci genus probes Sa8, Sal 2, Sa24 and Sa25 were identified. The potential to use these probes for the detection of S. aureus was demonstrated in a sandwich hybridisation assay where unlabelled S. aureus cRNA was hybridised to the microarray and detected using Sa20 which was labelled with Cy-3 as a reporter probe. One microgram cRNA plus 20pmol Sa20 reporter in a 20ul volume were hybridised to the microarray at 55C overnight and washed in 2X SSC, 0.1% SDS for 5 minutes at room temperature. Figure 1 demonstrates the microarray sandwich assay. Strongest signal was obtained from Sal 9 capture probe with the S. aureus specific Sa20 reporter probe.
NASBA assay evaluation:
RNA template for NASBA evaluation was extracted from overnight cultures of the species listed in table 1 using the Ambion Ribopure yeast kit according to manufacturer's instructions. The S. aureus real-time NASBA assay was tested for sensitivity by performing NASBA amplifications of serial dilutions of S. aureus RNA. A detection limit equivalent to 1-10 cells was determined (Figure 2). Evaluation of the specificity was performed using a panel of RNA for species listed in table 1. Sixty-three S. aureus strains were all detected in the assay while 35 other strains (27 species) including closely related staphylococci species were not detected. This assay was sensitive and specific for the detection of S. aureus. The assay has been evaluated for the application to the detection of S. aureus in spiked milk samples. Milk samples (ImI) were spiked with known concentrations of S. aureus cells (108, 105-10 cells). Five hundred microlitres of milk clearing solution (EDTA, IGEPAL and latex beads) was mixed with the milk and centrifuged. The milk fat pellet and the supernatant were removed and the remaining cell pellet was resuspended and RNA was extracted using the Ambion Ribopure Yeast kit according to manufacturer's instructions. A detection limit of 10 spiked S. aureus cells/ml was achieved when the S. aureus NASBA assay was applied to the RNA extracted from the spiked milk samples (Figure 3). Additionally, the NASBA assay detected S. aureus in a naturally infected milk samples contaminated with approximately 2000 cells/ml and did not detect S. aureus in 20 milk samples which were negative for S. aureus by microbiological culture. In samples where the IAC was included it was detected. Real-Time PCR evaluation: Bacterial genomic DNA for evaluation of the real-time PCR assay for S. aureus was extracted according to manufacturers instructions using the EdgeBioSystems Purelute bacterial genomic purification kit. Evaluation of the specificity of the S. aureus real-time PCR assay was performed by testing 10 strains of S. aureus and 3 closely related Staphylococci species (S. epidermidis, S. chromogenes, S. haemolyticus) and 7 other bacterial species (K. oxytoca, A. hydrophilia, C. freundii, K. pneumoniae, M. caseolyticus, S. agalactiae, B. cereus). All S. aureus strains (Figure 4) were detected in the assay and none of the other staphylococcal or other species tested were detected. The sensitivity of the real-time PCR assay was established at 18 cells (Figure 5). In so far as any sequence disclosed herein differs from its counterpart in the attached sequence listing in Patentln3.3 software, the sequences within this body of text are to be considered as the correct version.
The words "comprises/comprising" and the words "having/including" when used herein with reference to the present invention are used to specify the presence of stated features, integers, steps or components but does not preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. SEQ IDs
Sites of probes, oligonucleotides etc. are shown in bold and underlined. N or x= any nucleotide; w=a/t, m=a/c, r=a/g, k=g/t, s=c/g, y=c/t, h=a/t/c, v=a/g/c, d=a/g/t, b=g/t/c. In some cases, specific degeneracy options are indicated in parenthesis: e.g.: (a/g) is either A or G. SEQ ID NO 1:
5'-GACGTTCATGGATTCGACA-S' SEQ ID NO 2:
5'-AGACGGCGGGATTTGAA-S'
SEQ ID NO 3: 5'AATTGTAATACGACTCACTATAGGGAGTTCGTCATCAACACACA-S' SEQ ID NO 4: 5'-CAGAGGTCCTGATACACA-S' SEQ ID NO 5:
5' - TTCGTCATCAACACACAATACCCAACTTGGAATG - 3' v v x
x
x x v w x
o x
Figure imgf000020_0001
SEQ ID NO 33:
AGGTCCTGATACACATC SEQ ID NO 34:
GGCGGGATTTGAACC SEQ ID NO 35:
CCAGCAAGTTTCTTCTAAACAGACTGCTGG-
SEQ ID NO 36:
5' - CCGAGTGAATGTATCCCCTGGACTCGG - 3'
SEQ ID NO 37: 5'TAACAGCATTTCCTATGTGCTGT'3
SEQ ID NO 38:
>S. aureus (DSM346) GGGGGTCCCSGAGCTCATTAAGCGTGTCGGAGGGTTGTCTTCGTCATCAACACACACAGTTTATAATAAC GTGCTGTTAACGCGATTCAACCTTAATAGGATATGCTAAACACTGCCGTTTGAAGTCTGTTTAGAAGAAA ACGTAGAAAGATGTGTATCAGGACCTCTGGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 39:
>S.aureus(DSM6236) GGGGGTCCCSGAGCTCATTAAGCGTGTCGGAGGGTTGTCTTCGTCATCAACACACACAGTTTATAATAAC TGGCAAATCAAACAATAATTTCGCAGTAGCTGCCTAATCGCACTCTGCATCGCCTAACAGCATTTCCTAT
CTTAATCAAACTAGCATCATGTTGGTTGTTTATCACTTTTCATGATGCGAAACCTATCGATAAACTACAC ACGTAGAAAGATGTGTATCAGGACCTTTGGACGCGGGTTCAAATCCCGCCGTCT SEQ ID NO 40:
>S . aureus (DSM6732) TGGCAAATCAAACAATAATTTCGCAGTAGCTGCCTAATCGCACTCTGCATCGCCTAACAGCATTTCCTAT
ACGTAGAAAGATGTGTATCAGGACCTCTGGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 41:
>S. aureus (DSM12463) GGAGGGTTGTCTTCGTCATCAACACACACAGTTTATAATAACTGGCAAAACAAACAATAATTTCGCAGTA
GGATATGCTAAACACTGCCGTTTGAAGTCTGTTTAGAAGAAACTTAATCAAGCTAGCATCATGTTGGTTG GGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 42: >S. aureus (DSM15676)
GGGGGTCCCSGAGCTCATTAAGCGTGTCGGAGGGTTGTCTTCGTCATCAACACACACAGTTTATAATAAC TGGCAAAACAAACAATAATTTCGCAGTAGCTGCCTAATCGCACTCTGCATCGCCTAACAGCATTTCCTAT
CTTAATCAAGCTAGCATCATGTTGGTTGTTTATCACTTTTCATGATGCGAAACCTTTCGATAAACTACAC ACGTAGAAAGATGTGTATCAGGACCTCTGGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 43:
>S. aureus (DSM20231)
TGGCAAATCAAACAATAATTTCGCAGTAGCTGCCTAATCGCACTCTGCATCGCCTAACAGCATTTCCTAT GTGCTGTTAACGCGATTCAACCTTAATAGGATATGCTAAACACTGCCGTTTGAAGTCTGTTTAGAAGAAA
ACGTAGAAAGATGTGTATCAGGACCTTTGGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 44:
>S. capitis (DSM20326) AAGCGTGTCGGAGGGTTGTCTCCGATATCAACACATTTCAGTAAATATAACTGACAAATCAAACAATAAT
ACCCTAGTAGGATATGCTAAACACTGCCGTTTGAAGTCTGTTTAGATGAATACTAATCAAACTAGCATAA TACTGGTTGTCTATTGCTTACTATTATGCGAAATGAATCAATAGACTACACACGTAGAAAGGTGTGTATC AGGACCTCTGGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 45:
>S.caseolyticus (DSM20597)
GTAGGATACGCTGTACACCTCCGCTTGGGGTCTGTACAGAAGAGATTAATCGAGCTAGTTATTAACCAGG CCTTGGACSYGGTTCGAYTCCC SEQ ID NO 46:
>S. chromogenes (DSM20454) GGGGGTCCSAGAGCTTATGAAGCGTGTCGGAGGGTTGTCTCCGCAAAAACACATCAGTTTATAATAACTG
AATCAAACTCGCATAATGTCGGTTGTCTGTTTCTAAACATTATGCTAAATTTCTAAACAGACTACACACG TAGAAACATTTGTATCAGGACCTTTGGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 47:
>S . epidermidis (DSM1798 ) CTGACAAATCAAACAATAATTTCGCAGTAGCTGCGTAATAGCCACTGCATCGCCTAACAGCATCTCCTAC
TATAATCAAGCTAGTATCATGTTGGTTGTTTATTGCTTAGCATGATGCGAAAATTATCAATAAACTACAC ACGTAGAAAGATTTGTATCAGGAC CTCTGGACGCGGGTTCAAATCCCGCCGTCT
SEQ ID NO 48: >S. epidermidis (DSM20044)
GGGGGTCCCSGAGCTTATTAAGCGTGTCGGAGGGTTGGCTCCGTCATCAACACATTTCGGTTAAATATAA
GTGCTGTTAACGCGATTCAACCCTAGTAGGATATGCTAAACACTGCCGCTTGAAGTCTGTTTAGATGAAA ACGTAGAAAGATTTGTATCAGGACCTCTGGACGCGGGTTCAAATCCCGCCGTCT
References:
T Hoen P. A., F. De Kort, G. J. Van Ommen, and J. T. Den Dunnen, 2003. Fluorescent labelling of cRNA for microarray applications. NAR. 31:e20. Ornskov, D., B. Kolmos, P. Bendix Horn, J, Nederby Nielsen, I Brandslund, and P. Schouenborg. 2008. Screening for methicillin resistant Staphylococcus aureus in clinical swabs using a high-through-put real-time PCR based method. Clin. Microbiol. Infect. 14: 22-28.
Hogg, G.M., J. P. McKenna, and G. Ong. 2008. Rapid detection of methicillin-susceptible and methicillin resistant Staphylococcus aureus directly from positive BacT/Alert blood culture bottles using real- time polymerase chain reaction: evaluation and comparison of 4 DNA extraction methods. Diagn. Microbiol. Infect. Dis. 61: 446-452.
Deiman, B., C. Jay, C. Zintilini, S. Vermeer, D. van Strijp, F. Venema, and P. van de Wiel. 2008. Efficient amplification with NASBA of hepatitis B virus, herpes simplex virus and methicillin resistant Staphylococcus aureus DNA. J. Virol. Methods 151; 283-293.
T Hoen P. A., F. De Kort, G. J. Van Ommen, and J. T. Den Dunnen, 2003. Fluorescent labelling of cRNA for microarray applications. NAR. 31:e20.
Ornskov, D., B. Kolmos, P. Bendix Horn, J, Nederby Nielsen, I Brandslund, and P. Schouenborg. 2008. Screening for methicillin resistant Staphylococcus aureus in clinical swabs using a high-through-put real-time PCR based method. Clin. Microbiol. Infect. 14: 22-28. Hogg, G.M., J. P. McKenna, and G. Ong. 2008. Rapid detection of methicillin-susceptible and methicillin resistant Staphylococcus aureus directly from positive BacT/Alert blood culture bottles using real- time polymerase chain reaction: evaluation and comparison of 4 DNA extraction methods. Diagn. Microbiol. Infect. Dis. 61: 446-452. Deiman, B., C. Jay, C. Zintilini, S. Vermeer, D. van Strijp, F. Venema, and P. van de Wiel. 2008. Efficient amplification with NASBA of hepatitis B virus, herpes simplex virus and methicillin resistant Staphylococcus aureus DNA. J. Virol. Methods 151; 283-293.
Glynn, B., Lacey, K., Reilly, J., Barry, T., Smith, T. J. and Maher, M. (2007). Quantification of Bacterial tmRNA using in vitro Transcribed RNA Standards and Two-Step qRT-PCR Res. J. Biol. ScL 5, 564-570.

Claims

Claims
1. A diagnostic kit for a bacterial species comprising an oligonucleotide probe capable of binding to at least a portion of the ssrA gene or its corresponding tRNA.
2. A kit as claimed in claim 1 further comprising a primer for amplification of at least a portion of the ssrA gene.
3. A kit as claimed in claim 2 comprising a forward and a reverse primer for a portion of the ssrA gene.
4. A kit as claimed in any of claims 1 to 3 wherein the portion of the ssrA gene is a portion of the region of the gene from base pair position 1 to base pair position 356 of the ssrA gene.
5. A kit as claimed in claim 4 wherein the portion of the ssrA gene is a portion of the region of the gene from base pair position 4 to base pair position 356 of the ssrA gene.
6. A diagnostic kit as claimed in any preceding claim wherein the probe is selected from SEQ IDs NOs 9 to 37, or sequences substantially similar or complementary thereto which can also act as a probe.
7. A kit as claimed in any preceding claim comprising at least one forward in vitro amplification primer and at least one reverse in vitro amplification primer, the forward amplification primer being selected from the group consisting of SEQ ID NO 1, 3, 5, 7, or sequences substantially similar or complementary thereto which can also act as a forward amplification primer and the reverse amplification primer being selected from the group consisting of SEQ ID NO 2, 4, 6, 8 or sequences substantially similar or complementary thereto which can also act as a reverse amplification primer.
8. A diagnostic kit as claimed in claim 7, based on direct nucleic acid detection technologies, signal amplification nucleic acid detection technologies, and nucleic acid in vitro amplification technologies is selected from one or more of Polymerase Chain Reaction (PCR), Ligase Chain Reaction (LCR), Nucleic Acids Sequence Based Amplification (NASBA), Strand Displacement Amplification (SDA), Transcription Mediated Amplification (TMA), Branched DNA technology (bDNA) and Rolling Circle Amplification Technology (RCAT) or other enzymatic in vitro amplification based technologies.
9. A nucleic acid molecule selected from the group consisting of: SEQ ID NO 1 through SEQ ID NO 48 and sequences substantially homologous or substantially complementary thereto or to a portion thereof and having a function in diagnostics based on the ssrA gene.
10. A nucleic acid molecule comprising an oligonucleotide having a sequence substantially homologous to or substantially complementary to a portion of a nucleic acid molecule as claimed in claim 9.
11. A method of detecting a target organism in a test sample comprising the steps of: (i) Mixing the test sample with at least one oligonucleotide probe capable of binding to at least a portion of the ssrA gene or its corresponding mRNA under appropriate conditions; (ii) hybridizing under a high stringency conditions any nucleic acid that may be present in the test sample with the oligonucleotide to form a probe :target duplex; and (iii) determining whether a probe :target duplex is present; the presence of the duplex positively identifying the presence of the target organism in the test sample.
12. A method as claimed in claim 11 wherein the probe is selected from the group consisting of SEQ IDs NOs 9 to 37 or sequences substantially homologous or substantially complementary thereto also capable of acting as a probe for the ssrA gene.
13. Use of a nucleic acid molecule as claimed in any one of claims 9 or 10 in a diagnostic assay to detect the presence of one or more staphylococcus species.
14. Use of a kit as claimed in any one of claims 1 to 8 or a nucleic acid molecule as claimed in any one of claims 9 or 10, in a diagnostic assay to measure bacterial titres in a patient.
15. A method of assessing the efficacy of a treatment regime designed to reduce bacterial titre in a patient comprising use of a kit as claimed in any one of claims 1 to 8 or a nucleic acid molecule as claimed in any one of claims 9 or 10 at one or more stages of the treatment regime.
16. Use of a kit as claimed in any one of claims 1 to 8 or a nucleic acid molecule as claimed in any one of claims 9 or 10, in a diagnostic assay to measure bacterial contamination in an environment.
17. Use as claimed in claim 16, wherein the environment is a hospital, a food sample, a milk sample, an environmental sample e.g. water, an industrial sample such as an in-process sample or an end product requiring bioburden or quality assessment.
18. Use of a kit as claimed in any one of claims 1 to 8 or a nucleic acid molecule as claimed in any one of claims 9 or 10, in the identification and/or characterization of one or more disruptive agents that can be used to disrupt the ssrA gene function.
19. Use as claimed in claim 18, wherein the disruptive agent is selected from the group consisting of antisense RNA, PNA, siRNA.
20. A kit substantially as described herein with reference to the accompanying figures.
21. A nucleic acid substantially as described herein with reference to the accompanying figures.
22. A method substantially as described herein with reference to the accompanying figures.
PCT/EP2010/054570 2009-04-09 2010-04-07 Nucleic acid sequences based on the bacterial ssra gene and its tmrna transcript for the molecular detection of s.aureus Ceased WO2010115912A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IE20090288 2009-04-09
IE2009/0288 2009-04-09

Publications (2)

Publication Number Publication Date
WO2010115912A2 true WO2010115912A2 (en) 2010-10-14
WO2010115912A3 WO2010115912A3 (en) 2010-12-02

Family

ID=42224103

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/054570 Ceased WO2010115912A2 (en) 2009-04-09 2010-04-07 Nucleic acid sequences based on the bacterial ssra gene and its tmrna transcript for the molecular detection of s.aureus

Country Status (1)

Country Link
WO (1) WO2010115912A2 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000059918A1 (en) * 1999-04-07 2000-10-12 University Of Utah Research Foundation EUBACTERIAL tmRNA SEQUENCES AND USES THEREOF
AU4427100A (en) * 1999-05-14 2000-12-05 Enterprise Ireland Trading As Bioresearch Ireland Nucleic acid probe-based diagnostic assays for prokaryotic and eukaryotic organisms

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DEIMAN, B.; C. JAY; C. ZINTILINI; S. VERMEER; D. VAN STRIJP; F. VENEMA; P. VAN DE WIEL.: "Efficient amplification with NASBA of hepatitis B virus, herpes simplex virus and methicillin resistant Staphylococcus aureus DNA", J. VIROL. METHODS, vol. 151, 2008, pages 283 - 293
DEIMAN, B.; C. JAY; C. ZINTILINI; S. VERMEER; D. VAN STRIJP; F. VENEMA; P. VAN DE WIEL: "Efficient amplification with NASBA of hepatitis B virus, herpes simplex virus and methicillin resistant Staphylococcus aureus DNA", J. VIROL. METHODS, vol. 151, 2008, pages 283 - 293
GLYNN, B.; LACEY, K.; REILLY, J.; BARRY, T.; SMITH, T. J.; MAHER, M.: "Quantification of Bacterial tmRNA using in vitro Transcribed RNA Standards and Two-Step qRT-PCR Res", J. BIOL. SCI., vol. 5, 2007, pages 564 - 570
HOGG, G.M.; J. P. MCKENNA; G. ONG: "Rapid detection of methicillin-susceptible and methicillin resistant Staphylococcus aureus directly from positive BacT/Alert blood culture bottles using real- time polymerase chain reaction: evaluation and comparison of 4 DNA extraction methods", DIAGN. MICROBIOL. INFECT. DIS., vol. 61, 2008, pages 446 - 452
ORNSKOV, D.; B. KOLMOS; BENDIX HORN; J, NEDERBY NIELSEN; I BRANDSLUND; P. SCHOUENBORG: "Screening for methicillin resistant Staphylococcus aureus in clinical swabs using a high-through-put real-time PCR based method", CLIN. MICROBIOL. INFECT., vol. 14, 2008, pages 22 - 28
ORNSKOV, D.; B. KOLMOS; P. BENDIX HORN; J, NEDERBY NIELSEN; I BRANDSLUND; P. SCHOUENBORG: "Screening for methicillin resistant Staphylococcus aureus in clinical swabs using a high-through-put real-time PCR based method", CLIN. MICROBIOL. INFECT., vol. 14, 2008, pages 22 - 28
T HOEN P. A.; F. DE KORT; G. J. VAN OMMEN; J. T. DEN DUNNEN: "Fluorescent labelling of cRNA for microarray applications", NAR, vol. 31, 2003, pages 20
THOEN P. A.; F. DE KORT; G. J. VAN OMMEN; J. T. DEN DUNNEN: "Fluorescent labelling of cRNA for microarray applications", NAR, vol. 31, 2003, pages 20

Also Published As

Publication number Publication date
WO2010115912A3 (en) 2010-12-02

Similar Documents

Publication Publication Date Title
AU2009256588B2 (en) SWI5 gene as a diagnostic target for the identification of fungal and yeast species
GB2549799A (en) A multiplex assay for the sensitive and specific detection and differentiation of Clostridium difficile
AU2009256585B2 (en) EIF2 gamma gene as a diagnostic target for the identification of fungal and yeast species
EP3438280B1 (en) Haemoplasma detection method
EP2300620B1 (en) Lepa / guf1 gene sequences as a diagnostic target for the identification of bacterial species
EP3523447B1 (en) A method for the detection of legionella
IE20060925A1 (en) Nucleic acids probes for detection of yeast and fungal species
WO2010115912A2 (en) Nucleic acid sequences based on the bacterial ssra gene and its tmrna transcript for the molecular detection of s.aureus
AU2009256587B2 (en) Ace2 as a target gene for the molecular identification of yeast and fungal species
US20110311969A1 (en) Diagnostic Kit for Aspergillus Fumigatus Species
EP2294220B1 (en) P2/p2a/p2b gene sequences as diagnostic targets for the identification of fungal and yeast species
IES85514Y1 (en) Ace2 as a target gene for the molecular identification of yeast and fungal species.
IE20090466U1 (en) P2/P2A/P2B gene sequences as diagnostic targets for the identification of fungal and yeast species.
IE20090470U1 (en) LepA/Guf1 gene sequences as a diagnostic target for the identification of bacterial species.
IES85505Y1 (en) SWI5 gene as a diagnostic target for the identification of fungal and yeast species
IES85513Y1 (en) LepA/Guf1 gene sequences as a diagnostic target for the identification of bacterial species.
IE20090464U1 (en) SWI5 gene as a diagnostic target for the identification of fungal and yeast species
IES85506Y1 (en) P2/P2A/P2B gene sequences as diagnostic targets for the identification of fungal and yeast species.
IE20090467U1 (en) Ace2 as a target gene for the molecular identification of yeast and fungal species.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10713190

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10713190

Country of ref document: EP

Kind code of ref document: A2