WO2010107709A1 - Protein production in microorganisms of the phylum labyrinthulomycota - Google Patents
Protein production in microorganisms of the phylum labyrinthulomycota Download PDFInfo
- Publication number
- WO2010107709A1 WO2010107709A1 PCT/US2010/027352 US2010027352W WO2010107709A1 WO 2010107709 A1 WO2010107709 A1 WO 2010107709A1 US 2010027352 W US2010027352 W US 2010027352W WO 2010107709 A1 WO2010107709 A1 WO 2010107709A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- nucleic acid
- protein
- polynucleotide sequence
- acid molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- AUWIUCSODHMMEX-UHFFFAOYSA-N CC(CC#CC=C)=N Chemical compound CC(CC#CC=C)=N AUWIUCSODHMMEX-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/10—Protozoa; Culture media therefor
- C12N1/105—Protozoal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2431—Beta-fructofuranosidase (3.2.1.26), i.e. invertase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/005—Glycopeptides, glycoproteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01026—Beta-fructofuranosidase (3.2.1.26), i.e. invertase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/90—Protozoa ; Processes using protozoa
Definitions
- the present invention relates to recombinant cells and microorganisms of the phylum Labyrinthulomycota and their use in heterologous protein production. Novel promoter, terminator, and signal sequences for efficient production and, optionally, secretion of polypeptides from recombinant host cells and microorganisms are also encompassed by the present invention.
- microbial fermentation-based processes can offer: (i) rapid production of high concentration of protein; (ii) the ability to use sterile, well-controlled production conditions (such as Good Manufacturing Practice (GMP) conditions); (iii) the ability to use simple, chemically defined growth media allowing for simpler fermentations and fewer impurities; (iv) the absence of contaminating human or animal pathogens; and (v) the ease of recovering the protein (e.g., via isolation from the fermentation media), hi addition, fermentation facilities are typically less costly to construct than cell culture facilities.
- GMP Good Manufacturing Practice
- U.S. Publ. No. 2003/0166207 was the first disclosure of recombinant constructs suitable for transforming thraustochytrids, including members of the genus Schizochytrium.
- This publication disclosed, among other things, Schizochytrium nucleic acid and amino acid sequences for an acetolactate synthase, an acetolactate synthase promoter and terminator region, an ⁇ - tubulin promoter, a promoter from a polyketide synthase (PKS) system, and a fatty acid desaturase promoter.
- PKS polyketide synthase
- the present invention is directed to an isolated nucleic acid molecule comprising the polynucleotide sequence of SEQ ID NO:3.
- the present invention is also directed to an isolated nucleic acid molecule comprising the polynucleotide sequence of SEQ ID NO:4.
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequence encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:1.
- the polynucleotide sequence comprises SEQ ID NO:2.
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequence encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:37.
- the polynucleotide sequence comprises SEQ ID NO:38.
- the present invention is also directed to an isolated nucleic acid molecule comprising the polynucleotide sequence of SEQ ID NO:42. In some embodiments, the polynucleotide sequence comprises SEQ ID NO:43. [0011] The present invention is also directed to an isolated nucleic acid molecule comprising the polynucleotide sequence of SEQ ID NO:44. In some embodiments, the polynucleotide sequence comprises the polynucleotide sequence of SEQ ID NO:45.
- the present invention is also directed to an isolated nucleic acid molecule comprising the polynucleotide sequence of SEQ ID NO:46.
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequence that is fully complementary to any of the polynucleotide sequences described above.
- the present invention is also directed to a recombinant nucleic acid molecule comprising any of the isolated nucleic acid molecules described above.
- the recombinant nucleic acid molecule is a vector.
- the isolated nucleic acid molecule is operably linked to a polynucleotide sequence encoding a protein.
- the protein is operably linked to a secretion signal.
- the present invention is also directed to a host cell comprising any of the isolated nucleic acid molecules or recombinant nucleic acid molecules described above, or combinations thereof.
- the host cell is a member of the order Thraustochytriales.
- the host cell is a Schizochytrium or a Thraustochytrium.
- the present invention is also directed to a method for production of a protein, comprising culturing a recombinant microorganism of the order Thraustochytriales in a medium, wherein the recombinant microorganism comprises any of the isolated nucleic acid molecules described above operably linked to a polynucleotide sequence that encodes the protein, to produce the protein.
- the protein is recovered from an isolated Thraustochytriales biomass.
- the protein accumulates within the microorganism.
- the protein accumulates within a membrane of the microorganism.
- the protein is recovered from the culture medium.
- the protein is secreted.
- the present invention is also directed to an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:1.
- the present invention is also directed to an isolated polypeptide comprising the amino acid sequence of SEQ ID NO: 15.
- the present invention is also directed to a method of transforming a host cell, comprising: (a) pretreating the host cell with an enzyme having protease activity, and (b) introducing a nucleic acid molecule into the host cell by electroporation.
- FIG. 1 shows a Schizochytrium Na/Pi-IIIb2 transporter protein signal peptide amino acid sequence (SEQ ID NO:1).
- FIG. 2 shows the polynucleotide sequence (SEQ ID NO:2) that encodes the signal peptide of SEQ ID NO: 1.
- FIG. 3 shows the Schizochytrium PUFA PKS OrfC promoter region polynucleotide sequence (SEQ ID NO:3).
- FIG. 4 shows the Schizochytrium PUFA PKS OrfC terminator element- 1 polynucleotide sequence (SEQ ID NO:4).
- FIG. 5 shows a plasmid map of pSchizE.
- FIG. 6 shows a plasmid map of pSchiz-sG, also termed pCOOOOl .
- FIG. 7 shows a plasmid map of pSchiz-sGr.
- FIG. 8 shows a plasmid map of pSchiz-cG.
- FIG. 9 shows eGFP expression in the cytoplasm and endoplasmic reticulum
- FIGs. 9A, 9C, and 9E are fluorescent micrographs.
- FIGs. 9B, 9D, and 9F are light micrographs.
- FIGs. 9A and 9B show the same field of cells transformed with pSchiz-sGr.
- FIGs. 9C and 9D show the same field of cells transformed with pSchiz-cG.
- FIGs. 9E and 9F show the same field of cells transformed with pSchiz-E.
- FIG. 1OA shows composite fluorescence localization of ER-targeted eGFP and the nucleic acid-specific stain 4',6-diamidino-2-phenylindole (DAPI) in Schizochytrium cells transformed with pSchiz-sGr.
- FIGs. 1OB and 1OC show the eGFP - ER staining and DAPI - nuclear staining, respectively, used in making the composite micrograph.
- FIG. 1OD shows the light micrograph of the same field.
- ER membranes envelop each nucleus of a cell, and each cell can contain multiple nuclei. The relevant features of one nucleus in one cell are indicated.
- FIG. 11 shows a Western blot and corresponding Coomassie-stained SDS-
- FIG. 12 shows the first 30 amino acids of Schizochytrium Seel protein transporter protein. Amino acids 1 through 20 constitute the signal peptide sequence (SEQ ID NO:37).
- FIG. 13 shows the polynucleotide sequence (SEQ ID NO:38) that encodes the signal peptide of SEQ ID NO:37.
- FIG. 14 shows a plasmid map of pSchiz-Cpt-sleGFP, also termed pCLOOOl.
- FIG. 16 shows a plasmid map of pSchiz-Cpt-slkappabh.
- FIG. 17 shows a Western blot for secretion of a kappa antibody subunit by
- FIG. 18A shows a Western blot for expression of the kappa antibody subunit.
- FIG. 18A The incubation time at which the culture supernatant sample was obtained is indicated at the top of FIG. 18A.
- wt refers to "wild-type” (i.e., non-transformed) Schizochytrium.
- +cptSlkappa refers to Schizochytrium transformed with a vector containing a codon-optimized gene encoding a human kappa antibody fragment, an ORFC promoter and terminator, and a sequence encoding a Seel signal peptide.
- FIG. 18B shows the accumulation of total protein (assayed according to Bradford) and antibody chain kappa (assayed via ELISA) in the culture supernatant of
- FIG. 19 shows the Schizochytrium EFl short promoter polynucleotide sequence (SEQ ID NO:42).
- FIG. 20 shows the Schizochytrium EFl long promoter polynucleotide sequence (SEQ ID NO:43).
- FIG. 21 shows the Schizochytrium 60S short promoter polynucleotide sequence (SEQ ID NO:44).
- FIG. 22 shows the Schizochytrium 60S long promoter polynucleotide sequence (SEQ ID NO:45).
- FIG. 23 shows the Schizochytrium Seel promoter polynucleotide sequence
- FIG. 24 shows a plasmid map of pABOOl 1.
- FIG. 25 shows a plasmid map of pABOOl 8.
- FIG. 26 shows a plasmid map of pAB0022.
- FIG. 27 shows a Western blot for eGFP in cell-free supernatant samples taken from cultures of Schizochytrium transformed with expression vectors containing the eGFP gene driven by the EFl promoter (short version), EFl promoter (long version),
- FIG. 28 shows fluorescence microscopy of transformant cell lines associated with eGFP expression driven by either the OrfC promoter (pCLOOOl-4) or the EFl-L promoter (ABOOl 8-9 and -10).
- FIG. 29 shows N-glycan structures detected on native Schizochytrium secreted proteins as determined by NSI- full MS analysis of permethylated N-glycans.
- FIG. 30 shows N-glycan structures detected on native Schizochytrium secreted proteins as determined by NSI-Total Ion Mapping of permethylated N-glycans.
- FIG. 31 shows a plasmid map of pSchiz-EPCT(+)-slSuc2_CL0076, also termed pCL0076.
- FIG. 32 shows dry weight (g/L) of cell pellets from cultures of
- the transformants are referred to as 1-1, 1-3, 1-24, 3-1, 3-2, 3-5, 3-21, 4-1, 4-
- FIG. 33 shows fat content (expressed as % weight of the dry biomass) in cell pellets from cultures of Schizochytrium sp. ATCC 20888 transformed with pCL0076 grown on sucrose-SSFM. The transformants are referred to as 1-1, 1-3, 1-24, 3-1, 3- 2, 3-5, 3-21, 4-1, 4-24, and 4-31.
- Control refers to wild-type Schizochytrium sp. ATCC 20888 cells grown on glucose-SSFM.
- FIG. 34 shows dry weight (g/L) of cell pellets measured over time for cultures of Schizochytrium sp. ATCC 20888 transformed with pCL0076 grown on sucrose- SSFM. The transformants are referred to as 1-3 and 3-5. "Control" refers to wild- type Schizochytrium sp. ATCC 20888 cells grown on glucose-SSFM.
- FIG. 35 shows fat content (expressed as % weight of the dry biomass) in cell pellets from cultures of two transformants grown on sucrose-SSFM.
- the transformants are referred to as 1-3 and 3-5.
- Control refers to wild-type Schizochytrium sp. ATCC 20888 cells grown on glucose-SSFM.
- FIG. 36 shows dry weight (g/L) of cell pellets from cultures of
- 2118* refers to a sub-isolate of wild- type Schizochytrium sp. ATCC 20888 cells grown on glucose-SSFM.
- B76-32** refers to the B76-32 parent strain grown on glucose-SSFM.
- FIG. 37 shows fat content of cell pellets from cultures of Schizochytrium strain B76-32 transformed with pCL0076 and harvested after either 2 days or 7 days of growth in sucrose-SSFM.
- the rightmost column for each sample shows fat content as % weight of the dry biomass.
- the leftmost column for each sample shows % of total fat composed of acyl groups with 18 or fewer carbons (light grey) or 20 or more carbons (medium grey).
- 2118* refers to a sub-isolate of wild-type Schizochytrium sp. ATCC 20888 cells grown on glucose-SSFM.
- B76-32** refers to the B76-32 parent strain grown on glucose-SSFM.
- FIG. 38A shows a Western blot for invertase protein and FIG. 38B shows a corresponding Coomassie-stained SDS-PAGE gel.
- a S. cerevisiae invertase control and cell-free supernatants of a 3-day culture of pCL0076 transformant 1-3 were loaded in amounts of 5 ⁇ g, 2.5 ⁇ g, 1.25 ⁇ g, and 0.625 ⁇ g, respectively, as indicated at the top of the Western blot.
- FIG. 39A shows an invertase activity assay illustrated by the reaction rate as a function of sucrose concentration.
- FIG. 39B shows a standard Lineweaver-Burk plot used to calculate the Km and Vmax.
- FIG. 4OA shows N-glycan structures detected on Schizochytrium secreted proteins as determined by NSI-Total Ion Mapping of permethylated N-glycans.
- FIG. 4OB shows a table of glycan species obtained by NSI-Total Ion
- FIG. 41A and FIG. 41B show predicted signal sequences native to
- Schizochytrium based on use of the SignalP algorithm. See, e.g., Bendsten et al., J MoI. Biol. 340: 783-795 (2004); Nielsen and Krogh, Proc. Int. Conf. Intell. Syst. MoI. Biol. (5:122-130 (1998); Nielsen et al, Protein Engineering 12:3-9 (1999); Emanuelsson et al., Nature Protocols 2:953-971 (2007).
- FIG. 42 shows a codon usage table for Schizochytrium.
- FIG. 43 shows a plasmid map of pCL0120.
- FIG. 44 shows a codon-optimized nucleic acid sequence (SEQ ID NO:75) encoding the Seel signal peptide from Schizochytrium fused to the mature Sucl invertase from Aspergillus niger (GenBank Accession No. S33920).
- FIG. 45 shows a plasmid map of pCL0137JEPCT(+)-slSucl, also termed pCL0137.
- Labyrinthulomycota such as Schizochytrium
- Thraustochytrium and other thraustochytrids, are eukaryotes that are capable of processing polypeptides through a conventional secretory pathway. It has been recognized that these microorganisms also produce fewer abundantly-secreted proteins than CHO cells, resulting in an advantage of using Schizochytrium over CHO cells.
- members of the phylum Labyrinthulomycota such as Schizochytrium, perform protein glycosylation, such as N-linked glycosylation, which is required for the biological activity of certain proteins. It has been determined that the N-linked glycosylation exhibited by thraustochytrids such as Schizochytrium more closely resembles mammalian glycosylation patterns than does yeast glycosylation.
- Efficient production of recombinant proteins also includes: (i) methods for transforming a selected host cell, (ii) selection markers for selecting transformants, and (iii) expression cassettes comprising regulatory elements that function in the particular host cell.
- regulatory elements include promoter and terminator sequences that are important for controlling expression of a polynucleotide sequence.
- the terms regulatory elements, regulatory control elements, and regulatory sequences can be used interchangeably and include, but are not limited to, sequences and/or molecules that are promoters, enhancers, transcription terminators, signal sequences, ribosomal binding sites, repressor binding sites, stem-loops, and intron splice sites.
- Signal peptides also known as signal sequences, secretion signal peptides, or leader sequences
- signal peptides also known as signal sequences, secretion signal peptides, or leader sequences
- the present invention is directed to production of protein in a host cell that is a microorganism of the phylum Labyrinthulomycota.
- the host cell of the phylum Labyrinthulomycota is used as a biofactory for protein production.
- the recombinant host cell of the phylum is used as a biofactory for protein production.
- Labyrinthulomycota is a thraustochytrid, such as a Schizochytrium or Thraustochytrium.
- thraustochytrid refers to any member of the order Thraustochytriales, which includes the family Thraustochytriaceae
- labyrinthulid refers to any member of the order Labyrinthulales, which includes the family Labyrinthulaceae.
- Labyrinthulaceae are now considered to be a member of the order Labyrinthulales. Both Labyrinthulales and Thraustochytriales are considered to be members of the phylum Labyrinthulomycota. Taxonomic theorists now generally place both of these groups of microorganisms with the algae or algae-like protists of the Stramenopile lineage. The current taxonomic placement of the thraustochytrids and labyrinthulids can be summarized as follows: Realm: Stramenopila (Chromista)
- strains described as thraustochytrids include the following organisms: Order: Thraustochytriales; Family:
- Thraustochytriaceae Genera: Thraustochytrium (Species: sp., arudimentale, aureum, benthicola, globosum, kinnei, motivum, multirudimentale, pachydermum, proliferum, roseum, striatum), Ulkenia (Species: sp., amoeboidea, kerguelensis, minuta, profunda, radiata, sailens, sarkariana, schizochytrops, visurgensis, yorkensis), Schizochytrium (Species: sp., aggregatum, limnaceum, mangrovei, minutum, octosporuni), Japonochytrium (Species: sp., marinum), Aplanochytrium (Species: sp., haliotidis, kerguelensis, profunda, stocchino ⁇ ), Althornia (Species: sp.,
- Labyrinthulids include the following organisms: Order: Labyrinthulales, Family: Labyrinthulaceae, Genera: Labyrinthula (Species: sp., algeriensis, coenocystis, chattonii, macrocystis, macrocystis atlantica, macrocystis macrocystis, marina, minuta, roscoffensis, valkanovii, vitellina, vitellina pacifica, vitellina vitellina, zopfii), Labyrinthuloides (Species: sp., haliotidis, yorkensis), Labyrinthomyxa (Species: sp., marina), Diplophrys (Species: sp., archeri), Pyrrhosorus (Species: sp., marinus), Sorodiplophrys (
- Host cells of the phylum Labyrinthulomycota include, but are not limited to, deposited strains PTA-10212, PTA-10213, PTA-10214, PTA-10215, PTA-9695, PTA-9696, PTA-9697, PTA-9698, PTA-10208, PTA-10209, PTA-10210, PTA- 10211, the microorganism deposited as SAM2179 (named "Ulkenia SAM2179" by the depositor), any Thraustochytrium species (including former Ulkenia species such as U. visurgensis, U. amoeboida, U. sarkariana, U. profunda, U radiata, U.
- Ulkenia species such as U. visurgensis, U. amoeboida, U. sarkariana, U. profunda, U radiata, U.
- Thraustochytriales include, but are not limited to Thraustochytrium sp. (23B) (ATCC 20891); Thraustochytrium striatum (Schneider)(ATCC 24473); Thraustochytrium aureum (Goldstein) (ATCC 34304); Thraustochytrium roseum (Goldstein) (ATCC 28210); and Japonochytrium sp. (Ll) (ATCC 28207).
- Schizochytrium include, but are not limited to Schizochytrium aggregation, Schizochytrium limacinum, Schizochytrium sp. (S31) (ATCC 20888), Schizochytrium sp. (S8) (ATCC 20889), Schizochytrium sp. (LC-RM) (ATCC 18915), Schizochytrium sp. (SR 21), deposited strain ATCC 28209 and deposited Schizochytrium limacinum strain IFO 32693.
- the host cell is a Schizochytrium or a Thraustochytrium. Schizochytrium can replicate both by successive bipartition and by forming sporangia, which ultimately release zoospores.
- the host cell of the invention is a recombinant host cell.
- Effective culture conditions for a host cell of the invention include, but are not limited to, effective media, bioreactor, temperature, pH, and oxygen conditions that permit protein production and/or recombination.
- An effective medium refers to any medium in which a Thraustochytriales cell, e.g., a Schizochytrium host cell, is typically cultured.
- Such medium typically comprises an aqueous medium having assimilable carbon, nitrogen, and phosphate sources, as well as appropriate salts, minerals, metals, and other nutrients, such as vitamins.
- Non-limiting examples of suitable media and culture conditions are disclosed in the Examples section.
- Non-limiting culture conditions suitable for Thraustochytriales microorganisms are also described in U.S. Patent No. 5,340,742, incorporated herein by reference in its entirety.
- Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH, and oxygen content appropriate for a recombinant cell.
- a Labyrinthulomycota host cell of the invention contains a recombinant vector comprising a nucleic acid sequence encoding a selection marker.
- the selection marker allows for the selection of transformed microorganisms.
- dominant selection markers include enzymes that degrade compounds with antibiotic or fungicide activity such as, for example, the Sh ble gene from Steptoalloteichus hindustanus, which encodes a "bleomycin-binding protein" represented by SEQ ID NO:5.
- the nucleic acid sequence encoding a dominant selection marker comprises a thraustochytrid acetolactate synthase sequence such as a mutated version of the polynucleotide sequence of SEQ ID NO:6.
- the acetolactate synthase has been modified, mutated, or otherwise selected to be resistant to inhibition by sulfonylurea compounds, imidazolinone-class inhibitors, and/or pyrimidinyl oxybenzoates.
- the acetolactate synthase is a homologue of a naturally occurring acetolactate synthase.
- a thraustochytrid microorganism that has been transfected with a recombinant vector comprising the acetolactate synthase has a reduced sensitivity to sulfonurea compounds, imidazolinone-class inhibitors, and/or pyrimidinyl oxybezoates.
- the recombinant vector comprises a nucleic acid sequence encoding ah acetolactate synthase protein comprising an amino acid sequence that differs from SEQ ID NO:7 by an amino acid deletion, insertion, or substitution at one or more of the following positions: 116G, 117A, 192P, 200A, 251K, 358M, 383D, 592V, 595W, or 599F.
- a mutated acetolactate synthase protein has an amino acid sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.
- the recombinant vector comprises a polynucleotide sequence at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 9, or SEQ ID NO: 10, wherein said polynucleotide sequence encodes an amino acid sequence that functions as a dominant selection marker, at least in a thraustochytrid.
- the recombinant vector comprises a polynucleotide sequence encoding a functional fragment of SEQ ID NO:7, which functions as a dominant selection marker, at least in a thraustochytrid.
- the recombinant vector comprises a polynucleotide sequence selected from the group consisting of: SEQ ID NO:11, SEQ ID NO:12, and SEQ ID NO:13.
- the term "transformation" is used to refer to any method by which an exogenous nucleic acid molecule (i.e., a recombinant nucleic acid molecule) can be inserted into microbial cells.
- transformation is used to describe an inherited change due to the acquisition of exogenous nucleic acids by the microorganism and is essentially synonymous with the term “transfection.”
- Suitable transformation techniques for introducing exogenous nucleic acid molecules into the Labyrinthulomycota host cells include, but are not limited to, particle bombardment, electroporation, microinjection, lipofection, adsorption, infection, and protoplast fusion.
- exogenous nucleic acid molecules, including recombinant vectors are introduced into a microbial cell that is in a stationary phase.
- exogenous nucleic acid molecules including recombinant vectors
- exogenous nucleic acid molecules, including recombinant vectors are introduced into a microbial cell during the exponential growth phase.
- exogenous nucleic acid molecules, including recombinant vectors are introduced into cells when they reach an optical density of 1.5 to 2 at 600 nm.
- the present invention is also directed to a method of transforming a host cell, comprising: (a) pretreating the host cell with an enzyme having protease activity, and (b) introducing a nucleic acid molecule into the host cell by electroporation.
- the host cell is transformed with higher efficiency following enzyme pretreatment prior to electroporation than without enzyme pretreatment.
- the enzyme includes, but is not limited to, an enzymatic activity associated with snail acetone powder, protease IX, protease XIV, sulfatase, ⁇ -glucuronidase, and combinations thereof.
- the host cell is pretreated with about 0.05 mg/ml, about 0.1 mg/ml, about 0.15 mg/ml, about 0.2 mg/ml, about 0.25 mg/ml, about 0.3 mg/ml, about 0.4 mg/ml, about 0.5 mg/ml, about 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, or about 1 mg/ml of snail acetone powder, protease IX, protease XIV, or combinations thereof.
- the host cell is treated with about 0.05 mg/ml to about 1 mg/ml, about 0.1 mg/ml to about 1 mg/ml, about 0.1 mg/ml to about 0.5 mg/ml, or about 0.05 mg/ml to about 0.5 mg/ml of snail acetone powder, protease IX, protease XIV, or a combination thereof.
- the host cell is treated with 0.05X, 0.1X, 0.2X, 0.3X, 0.4X, 0.5X, 0.6X, 0.7X, 0.8X, 0.9X, or IX of sulfatase, ⁇ -Glucuronidase, or a combination thereof.
- the host cell is treated with about 0.05X to about IX, about 0.1X to about IX, about 0.1 X to about 0.5X, or about 0.05X to about 0.5X of sulfatase, ⁇ -Glucuronidase, or a combination thereof.
- protease pretreatment comprises pretreatment with protease IX, protease XIV, snail acetone powder, sulfatase, ⁇ -Glucuronidase, or a combination thereof at any of the above-described concentrations
- electroporation occurs at a voltage of about 100 V to about 500 V for a 0.1 cm or a 0.2 cm cuvette gap distance. In some embodiments, electroporation occurs at a voltage of about 100 V, 150 V, 200 V, 250 V, 300 V, 350 V, 400 V, 450 V, or 500 V for a 0.1 cm or a 0.2 cm cuvette gap distance.
- a host cell is genetically modified to introduce or delete genes involved in biosynthetic pathways associated with the transport and/or synthesis of carbohydrates, including those involved in glycosylation.
- the host cell can be modified by deleting endogenous glycosylation genes and/or inserting human or animal glycosylation genes to allow for glycosylation patterns that more closely resemble those of humans. Modification of glycosylation in yeast can be found, for example, in U.S. Patent No. 7,029,872 and U.S. Publ. Nos. 2004/0171826, 2004/0230042, 2006/0257399, 2006/0029604, and 2006/0040353.
- a host cell of the present invention also includes a cell in which an RNA viral element is employed to increase or regulate gene expression.
- the expression system of the invention used for expression of a protein in a host cell comprises regulatory control elements that are active in algal cells.
- the expression system of the invention comprises regulatory control elements that are active in Labyrinthulomycota cells.
- the expression system of the invention comprises regulatory control elements that are active in thraustochytrids.
- the expression system of the invention comprises regulatory control elements that are active in Schizochytrium or Thraustochytrium.
- Many algal regulatory control elements, including various promoters, are active in a number of diverse species.
- novel regulatory sequences disclosed as aspects of the invention can be utilized in a cell type that is identical to the cell from which they were isolated or can be utilized in a cell type that is different than the cell from which they were isolated.
- the design and construction of such expression cassettes use standard molecular biology techniques known to persons skilled in the art. See, for example, Sambrook et ah, 2001, Molecular Cloning: A Laboratory Manual, 3 rd edition.
- Labyrinthulomycota cells comprises regulatory elements that are derived from Labyrinthulomycota sequences.
- the expression system used to produce proteins in Labyrinthulomycota cells comprises regulatory elements that are derived from non-Labyrinthulomycota sequences, including sequences derived from non-Labyrinthulomycota algal sequences.
- the expression system of the invention comprises a polynucleotide sequence encoding a protein, wherein the polynucleotide sequence is associated with any promoter sequence, any terminator sequence, and/or any other regulatory sequences that are functional in a Labyrinthulomycota host cell. Inducible or constitutively active sequences can be used. Suitable regulatory control elements also include any of the regulatory control elements associated with the nucleic acid molecules described herein.
- the present invention is also directed to an expression cassette for expression of a protein in a host cell.
- the present invention is also directed to any of the above- described host cells comprising an expression cassette for expression of a protein in the host cell.
- the expression system comprises an expression cassette containing genetic elements, such as at least a promoter, a coding sequence, and a terminator region operably linked in such a way that they are functional in a host cell.
- the expression cassette comprises at least one of the isolated nucleic acid molecules of the invention as described herein.
- all of the genetic elements of the expression cassette are sequences associated with isolated nucleic acid molecules.
- the control sequences are inducible sequences.
- the nucleic acid sequence encoding the protein is integrated into the genome of the host cell.
- the nucleic acid sequence encoding the protein is stably integrated into the genome of the host cell.
- an isolated nucleic acid sequence encoding a protein to be expressed is operably linked to a promoter sequence and/or a terminator sequence, both of which are functional in the host cell.
- the promoter and/or terminator sequence to which the isolated nucleic acid sequence encoding a protein to be expressed is operably linked can include any promoter and/or terminator sequence, including but not limited to the novel nucleic acid sequences of the present invention, the regulatory sequences disclosed in issued U.S. Patent No. 7,001,772, the regulatory sequences disclosed in U.S. Publ. Nos.
- the nucleic acid sequence encoding the protein is codon-optimized for the specific Labyrinthulomycota host cell to maximize translation efficiency.
- the present invention is also directed to recombinant vectors comprising an expression cassette of the present invention.
- Recombinant vectors include, but are not limited to, plasmids, phages, and viruses.
- the recombinant vector is a linearized vector, hi some embodiments, the recombinant vector is an expression vector.
- expression vector refers to a vector that is suitable for production of an encoded product (e.g., a protein of interest), hi some embodiments, a nucleic acid sequence encoding the product to be produced is inserted into the recombinant vector to produce a recombinant nucleic acid molecule.
- the nucleic acid sequence encoding the protein to be produced is inserted into the vector in a manner that operatively links the nucleic acid sequence to regulatory sequences in the vector (e.g., a Thraustochytriales promoter), which enables the transcription and translation of the nucleic acid sequence within the recombinant microorganism.
- a selectable marker including any of the selectable markers described herein, enables the selection of a recombinant microorganism into which a recombinant nucleic acid molecule of the present invention has successfully been introduced.
- proteins produced by a recombinant host cell of the invention include, but are not limited to, therapeutic proteins.
- a "therapeutic protein” as used herein includes proteins that are useful for the treatment or prevention of diseases, conditions, or disorders in animals and humans.
- the terms “treat” and “treatment” refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disease, or disorder, or to obtain beneficial or desired clinical results.
- beneficial or desired clinical results include, but are not limited to, alleviation of the symptoms or signs associated with a condition, disease, or disorder; diminishment of the extent of a condition, disease, or disorder; stabilization of a condition, disease, or disorder, (i.e., where the condition, disease, or disorder is not worsening); delay in onset or progression of the condition, disease, or disorder; amelioration of the condition, disease, or disorder; remission (whether partial or total and whether detectable or undetectable) of the condition, disease, or disorder; or enhancement or improvement of a condition, disease, or disorder.
- Treatment includes eliciting a clinically significant response without excessive side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
- therapeutic proteins include, but are not limited to, biologically active proteins, e.g., enzymes, antibodies, or antigenic proteins.
- therapeutic proteins include, but are not be limited to: protein A, human growth hormone, an interferon, aprotinin, human alpha antitrypsin, lipophilic proteins, human serum albumin, glutamic acid decarboxylase, gastric lipases, lactoferrin/lysozyme, invertase, antibodies (including, but not limited to, VEGF monoclonal antibody (AVASTIN®) and HER2 monoclonal antibody (HERCEPTIN®)), a human vaccine, an animal vaccine, and an animal therapeutic.
- AVASTIN® VEGF monoclonal antibody
- HERCEPTIN® HER2 monoclonal antibody
- proteins produced by a recombinant host cell of the invention include, but are not limited to industrial enzymes.
- Industrial enzymes include, but are not limited to, enzymes that are used in the manufacture, preparation, preservation, nutrient mobilization, or processing of products, including food, medical, chemical, mechanical, and other industrial products.
- Industrial enzymes include, but are not limited to: alpha amylase, alpha- galactosidase, beta-amylase, cellulose, beta-glucanase, dextranase, dextrinase, glucoamylase, hemmicellulase/pentosanase, xylanase, invertase, lactase, naringinase, pectinase, pullulanase, acid proteinase, alkaline protease, bromelain, papain, pepsin, aminopeptidase, endo-peptidases (trypsin, chemotrypsin, pepsin, elastase), rennet/rennin/chymosin, subtilism, thermolysin, aminoacylase, glutaminase, lysozyme, penicillin acylase, triglyceridases, phospholipases, pre
- proteins produced by a recombinant host cell of the invention include an auxotrophic marker, a dominant selection marker (such as, for example, an enzyme that degrades antibiotic activity) or another protein involved in transformation selection, a protein that functions as a reporter, an enzyme involved in protein glycosylation, and an enzyme involved in cell metabolism.
- auxotrophic marker such as, for example, an enzyme that degrades antibiotic activity
- a dominant selection marker such as, for example, an enzyme that degrades antibiotic activity
- a protein produced by a host cell of the invention can be an "output protein” or a "heterologous output protein.”
- An "output protein” or “heterologous output protein” as used herein refers to a heterologous recombinant protein that is not involved in modifying the metabolism of the host cell producing the protein and that is produced by the host cell for subsequent isolation.
- “Output protein” as defined herein does not include proteins encoded by reporter genes.
- Heterologous output proteins produced by a recombinant host cell of the invention do not include selectable markers such as a Zeocin resistance gene (e.g., the ble gene from Steptoalloteichus hindustanus) and E.
- selectable markers such as a Zeocin resistance gene (e.g., the ble gene from Steptoalloteichus hindustanus) and E.
- npt coli Neomycin phosphotransferase
- bsdR blasticidin deaminase
- PUFA synthase ORFA from Thraustochytrium T23B
- PUFA synthase ORFB from Thraustochytrium T23B
- PUFA synthase ORFC from Thraustochytrium T23B
- synthetic eGFP derived from Aequorea victoria
- a protein produced by a host cell of the invention is produced at commercial scale.
- Commercial scale includes production of protein from a microorganism grown in an aerated fermentor of a size >100 L, >l,000 L, >10,000 L or >100,000 L.
- the commercial scale production is done in an aerated fermentor with agitation.
- a protein produced by a host cell of the invention can accumulate within the cell or can be secreted from the cell, e.g., into the culture medium as a soluble protein.
- a protein produced by the invention is recovered from the cell, from the culture medium, or fermentation medium in which the cell is grown.
- the protein is a secreted protein that is recovered from the culture media as a soluble protein, hi some embodiments, the protein is a secreted protein comprising a signal peptide.
- a protein produced by the invention comprises a targeting signal directing its retention in the endoplasmic reticulum, directing its extracellular secretion, or directing it to other organelles or cellular compartments.
- the protein comprises a signal peptide
- the protein comprises a Na/Pi-IIb2 transporter signal peptide or Seel transport protein.
- the signal peptide comprises the amino acid sequence of SEQ ID NO:1 or SEQ ED NO:37.
- the protein comprising a signal peptide having the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:37 is secreted into the culture medium.
- the signal peptide is cleaved from the protein during the secretory process, resulting in a mature form of the protein.
- a protein produced by a host cell of the invention is glycosylated.
- the glycosylation pattern of the protein produced by the invention more closely resembles mammalian glycosylation patterns than proteins produced in yeast or E. coli.
- the protein produced by a Labyrinthulomycota host cell of the invention comprises a N-linked glycosylation pattern. Glycosylated proteins used for therapeutic purposes are less likely to promote anti-glycoform immune responses when their glycosylation patterns are similar to glycosylation patterns found in a subject organism. Conversely, glycosylated proteins having linkages or sugars that are not characteristic of a subject organism are more likely to be antigenic.
- Effector functions can also be modulated by specific glycoforms.
- IgG can mediate pro- or anti-inflammatory reactions in correlation with the absence or presence, respectively, of terminal sialic acids on Fc region glycoforms (Kaneko et al, Science 313(5787):670-3 (2006)).
- the present invention is further directed to a method of producing a recombinant protein, the method comprising culturing a recombinant Labyrinthulomycota host cell of the invention under conditions sufficient to express a polynucleotide sequence encoding the protein.
- the recombinant protein is secreted from the host cell and is recovered from the culture medium.
- a protein that is secreted from the cell comprises a secretion signal peptide.
- recombinant proteins of the present invention can remain within the recombinant cell, can be secreted into the fermentation medium, can be secreted into a space between two cellular membranes, or can be retained on the outer surface of a cell membrane.
- the phrase "recovering the protein” refers to collecting fermentation medium containing the protein and need not imply additional steps of separation or purification.
- Proteins produced by the method of the present invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing, and differential solubilization.
- proteins produced by the method of the present invention are isolated in "substantially pure” form. As used herein, “substantially pure” refers to a purity that allows for the effective use of the protein as a commercial product.
- the recombinant protein accumulates within the cell and is recovered from the cell.
- the host cell of the method is a thraustochytrid. In some embodiments, the host cell of the method is a Schizochytrium or a Thraustochytrium. In some embodiments, the recombinant protein is a therapeutic protein, a food enzyme, or an industrial enzyme. In some embodiments, the recombinant Labyrinthulomycota host cell is a Schizochytrium and the recombinant protein is a therapeutic protein that comprises a secretion signal sequence.
- a recombinant vector of the invention is a targeting vector.
- targeting vector refers to a vector that is used to deliver a particular nucleic acid molecule into a recombinant cell, wherein the nucleic acid molecule is used to delete or inactivate an endogenous gene within the host cell (i.e., used for targeted gene disruption or knock-out technology).
- a vector is also known as a "knock-out" vector.
- a portion of the targeting vector has a nucleic acid sequence that is homologous to a nucleic acid sequence of a target gene in the host cell (i.e., a gene which is targeted to be deleted or inactivated).
- the nucleic acid molecule inserted into the vector is homologous to the target gene.
- the nucleic acid sequence of the vector insert is designed to bind to the target gene such that the target gene and the insert undergo homologous recombination, whereby the endogenous target gene is deleted, inactivated, or attenuated (i.e., by at least a portion of the endogenous target gene being mutated or deleted).
- the present invention is also directed to isolated nucleic acid molecules or polynucleotide sequences that can be used to regulate gene expression and/or direct protein secretion in recombinant host cells.
- the nucleic acid sequences described herein include promoters, termination sequences, and nucleic acid sequences encoding signal peptides, and can be utilized to regulate the transcription and/or secretion of homologous or heterologous proteins.
- an isolated nucleic acid molecule is a nucleic acid molecule that has been removed from its natural milieu (i.e., that has been subject to human manipulation), its natural milieu being the genome or chromosome in which the nucleic acid molecule is found in nature.
- isolated does not necessarily reflect the extent to which the nucleic acid molecule has been purified, but indicates that the molecule does not include an entire genome or an entire chromosome in which the nucleic acid molecule is found in nature.
- An isolated nucleic acid molecule can include DNA, RNA (e.g., mRNA), or derivatives of either DNA or RNA (e.g., cDNA).
- nucleic acid molecule primarily refers to the physical nucleic acid molecule and the phrases “nucleic acid sequence” or “polynucleotide sequence” primarily refers to the sequence of nucleotides on the nucleic acid molecule, the phrases are used interchangeably, especially with respect to a nucleic acid molecule, polynucleotide sequence, or a nucleic acid sequence that is capable of encoding a protein.
- an isolated nucleic acid molecule of the present invention is produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis.
- PCR polymerase chain reaction
- Isolated nucleic acid molecules include natural nucleic acid molecules and homologues thereof, including, but not limited to, natural allelic variants and modified nucleic acid molecules in which nucleotides have been inserted, deleted, substituted, and/or inverted in such a manner that such modifications provide the desired effect on sequence, function, and/or the biological activity of the encoded peptide or protein.
- a nucleic acid sequence complement of a promoter sequence, terminator sequence, signal peptide sequence, or any other sequence of the invention refers to the nucleic acid sequence of the nucleic acid strand that is complementary to the strand with the promoter sequence, terminator sequence, signal peptide sequence, or any other sequence of the invention. It will be appreciated that a double-stranded DNA that contains a sequence of the invention comprises a single-strand DNA and its complementary strand having a sequence that is a complement to the single-strand DNA.
- nucleic acid molecules of the present invention can be either double- stranded or single-stranded, and include those nucleic acid molecules that form stable hybrids under "stringent” hybridization conditions with a sequence of the invention, and/or with a complement of a sequence of the invention. Methods to deduce a complementary sequence are known to those skilled in the art.
- the term "protein” includes single-chain polypeptide molecules as well as multiple-polypeptide complexes where individual constituent polypeptides are linked by covalent or non-covalent means.
- polypeptide includes peptides of two or more amino acids in length, typically having more than 5, 10, or 20 amino acids.
- novel nucleic acid molecules of the present invention can be utilized in any microorganism in which they are functional, hi some embodiments, the nucleic acid molecules are utilized in recombinant microorganisms of the phylum Labyrinthulomycota. In some embodiments, the recombinant nucleic acid molecules are utilized in recombinant microorganisms of the order Thraustochytriales. In some embodiments, the recombinant nucleic acid molecules are utilized in Schizochytrium or Thraustochytrium microorganisms.
- a recombinant microorganism has a genome which is modified (i.e., mutated or changed) from its normal (i.e., wild- type or naturally occurring) form using recombinant technology.
- a recombinant microorganism according to the present invention can include a microorganism in which nucleic acid molecules have been inserted, deleted, or modified (i.e., mutated, e.g., by insertion, deletion, substitution, and/or inversion of nucleotides), in such a manner that such modification or modifications provide the desired effect within the microorganism.
- genetic modifications which result in a decrease in gene expression, in the function of the gene, or in the function of the gene product (i.e., the protein encoded by the gene) can be referred to as inactivation (complete or partial), deletion, interruption, blockage or down-regulation of a gene.
- a genetic modification in a gene which results in a decrease in the function of the protein encoded by such gene can be the result of a complete deletion of the gene (i.e., the gene does not exist in the recombinant microorganism, and therefore the protein does not exist in the recombinant microorganism), a mutation in the gene which results in incomplete or no translation of the protein (e.g., the protein is not expressed), or a mutation in the gene which decreases or abolishes the natural function of the protein (e.g., a protein is expressed which has decreased or no activity (for example, enzymatic activity or action).
- Genetic modifications which result in an increase in gene expression or function can be referred to as amplification, overproduction, overexpression, activation, enhancement, addition, or up-regulation of a gene. Promoters
- the present invention is also directed to novel regulatory control elements that are promoters.
- a promoter of the invention is a region of DNA that directs transcription of an associated coding region.
- the promoter is from a microorganism of the phylum
- the promoter is from a thraustochytrid including, but not limited to: the microorganism deposited as SAM2179 (named "Ulkenia SAM2179" by the depositor), a microorganism of the genus Ulkenia or Thraustochytrium, or a Schizochytrium.
- Schizochytrium include, but are not limited to, Schizochytrium aggregation, Schizochytrium limacinum, Schizochytrium sp. (S31) (ATCC 20888), Schizochytrium sp. (S8) (ATCC 20889), Schizochytrium sp. (LC-RM) (ATCC 18915), Schizochytrium sp. (SR 21), deposited Schizochytrium strain ATCC 28209, and deposited Schizochytrium strain IFO 32693.
- a promoter of the invention can have promoter activity at least in a thraustochytrid, and includes full-length promoter sequences and functional fragments thereof, fusion sequences, and homologues of a naturally occurring promoter. Restriction enzymes can be used to digest the nucleic acid molecules of the invention, followed by the appropriate assay to determine the minimal sequence required for promoter activity. Such fragments themselves individually represent embodiments of the present invention.
- a homologue of a promoter differs from a naturally occurring promoter in that at least one, two, three, or several, nucleotides have been deleted, inserted, inverted, substituted and/or derivatized.
- a homologue of a promoter can retain activity as a promoter, at least in a thraustochytrid, although the activity can be increased, decreased, or made dependant upon certain stimuli.
- the promoters of the invention can comprise one or more sequence elements that confer developmental and tissue-specific regulatory control or expression.
- an isolated nucleic acid molecule of the invention comprises a PUFA PKS OrfC promoter ("PKS OrfC promoter").
- PKS OrfC promoter of the invention is a region of DNA that is naturally located upstream (towards the 5 ! region) of the OrfC coding region and that directs OrfC transcription.
- the PKS OrfC promoter has a polynucleotide sequence represented by SEQ ID NO:3.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence that is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:3, wherein the polynucleotide sequence has promoter activity (i.e., has basal promoter transcriptional activity, at least for a PUFA PKS OrfC sequence), at least in a thraustochytrid.
- promoter activity i.e., has basal promoter transcriptional activity, at least for a PUFA PKS OrfC sequence
- the homology can be found over a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500 nucleotides, or over the entire sequence.
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequences that hybridizes to SEQ ID NO: 3 or that hybridizes to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:3.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to SEQ ID NO: 3 or to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:3.
- a PKS OrfC promoter of the present invention includes a PKS OrfC promoter homologue that is sufficiently similar to a naturally occurring PKS OrfC promoter sequence that the nucleic acid sequence of the homologue is capable of hybridizing under moderate, high, or very high stringency conditions (described below) to the complement of the nucleic acid sequence of the naturally occurring PKS OrfC promoter.
- a PUFA PKS OrfC promoter sequence of the invention hybridizes under moderate, high or very high stringency conditions to the complement of SEQ ID NO:3.
- the promoter of the invention comprises the OrfC promoter of pCLOOOl as deposited in ATCC Accession No. PTA-9615.
- an isolated nucleic acid molecule of the invention comprises an EFl short promoter ("EFl short” or “EFl-S” promoter) or EFl long promoter ("EFl long” or “EFl-L” promoter).
- An EFl short or long promoter of the invention is a region of DNA that is naturally located upstream (towards the 5' region) of the EFl coding region and that directs EFl transcription.
- the EFl short promoter has a polynucleotide sequence represented by SEQ ID NO:42.
- the EFl long promoter has a polynucleotide sequence represented by SEQ ID NO:43.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence that is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:42 or SEQ ID NO:43, wherein the polynucleotide sequence has promoter activity (i.e., has basal promoter transcriptional activity, at least for an EFl short or long promoter sequence, respectively), at least in a thraustochytrid.
- promoter activity i.e., has basal promoter transcriptional activity, at least for an EFl short or long promoter sequence, respectively
- the homology can be found over a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides, or over the entire sequence.
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequence that hybridizes to SEQ ID NO:42 and/or SEQ ID NO:43 or that hybridizes to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:42 and/or SEQ ID NO:43.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to SEQ ID NO:42 or SEQ ID NO:43 or to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:42 or SEQ ID NO:43.
- an EFl short or EFl long promoter of the present invention includes an EFl short or long promoter homologue that is sufficiently similar to a naturally occurring EFl short and/or long promoter sequence, respectively, that the nucleic acid sequence of the homologue is capable of hybridizing under moderate, high, or very high stringency conditions (described below) to the complement of the nucleic acid sequence of the naturally occurring EFl short and/or long promoter, respectively.
- an EFl short and/or long promoter sequence of the invention hybridizes under moderate, high or very high stringency conditions to the complement of SEQ ID NO:42 and/or SEQ ID NO:43, respectively.
- the promoter of the invention comprises the EFl long promoter of pAB0018 as deposited in ATCC Accession No. PTA-9616.
- an isolated nucleic acid molecule of the invention comprises a 60S short promoter ("60S short” or “60S-S” promoter) or 60S long promoter ("60S long” or “60S-L” promoter).
- a 60S short or long promoter of the invention is a region of DNA that is naturally located upstream (towards the 5' region) of the 60S coding region and that directs 60S transcription.
- the 60S short promoter has a polynucleotide sequence represented by SEQ ID NO:44.
- the 60S long promoter has a polynucleotide sequence represented by SEQ ID NO:45.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence that is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:44 or SEQ ID NO:45, wherein the polynucleotide sequence has promoter activity (i.e., has basal promoter transcriptional activity, at least for an 60S short or long promoter sequence, respectively), at least in a thraustochytrid.
- promoter activity i.e., has basal promoter transcriptional activity, at least for an 60S short or long promoter sequence, respectively
- the homology can be found over a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides, or over the entire sequence.
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequence that hybridizes to SEQ ID NO:44 and/or SEQ ID NO:45 or that hybridizes to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:44 and/or SEQ ID NO:45.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to SEQ ID NO:44 and/or SEQ ID NO:45 or to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:44 and/or SEQ ID NO:45.
- a 60S short or 60S long promoter of the present invention includes a 60S short or 60S long promoter homologue that is sufficiently similar to a naturally occurring 60S short or 60S long promoter sequence, respectively, that the nucleic acid sequence of the homologue is capable of hybridizing under moderate, high, or very high stringency conditions (described below) to the complement of the nucleic acid sequence of the naturally occurring 60S short and/or 60S long promoter, respectively.
- a 60S short and/or 60S long promoter sequence of the invention hybridizes under moderate, high or very high stringency conditions to the complement of SEQ ID NO:44 and/or SEQ ID NO:45, respectively.
- the promoter of the invention comprises the 60S long promoter of pABOOl 1 as deposited in ATCC Accession No. PTA-9614.
- an isolated nucleic acid molecule of the invention comprises a Seel promoter ("Seel promoter").
- a Seel promoter of the invention is a region of DNA that is naturally located upstream (towards the 5' region) of the Seel coding region and that directs Seel transcription.
- the Seel promoter has a polynucleotide sequence represented by SEQ ID NO:46.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence that is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:46, wherein the polynucleotide sequence has promoter activity (i.e., has basal promoter transcriptional activity, at least for a Seel sequence), at least in a thraustochytrid.
- promoter activity i.e., has basal promoter transcriptional activity, at least for a Seel sequence
- the homology can be found over a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides, or over the entire sequence.
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequence that hybridizes to SEQ ID NO:46 or that hybridizes to or a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 46.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to SEQ ID NO:46 or to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:46.
- a Seel promoter of the present invention includes a Seel promoter homologue that is sufficiently similar to a naturally occurring Seel promoter sequence that the nucleic acid sequence of the homologue is capable of hybridizing under moderate, high, or very high stringency conditions (described below) to the complement of the nucleic acid sequence of the naturally occurring Seel promoter.
- a Seel promoter sequence of the invention hybridizes under moderate, high or very high stringency conditions to the complement of SEQ ID NO:46.
- the promoter of the invention comprises the Seel promoter of pAB0022 as deposited in ATCC Accession No. PTA-9613.
- the present invention is also directed to novel regulatory control elements that are transcription terminators.
- a terminator region of the invention is a section of genetic sequence that marks the end of a gene sequence in genomic DNA for transcription.
- the terminator region is from a microorganism of the phylum Labyrinthulomycota. In some embodiments, the terminator region is from a thraustochytrid. In some embodiments, the terminator region is from a Schizochytrium or a Thraustochytrium.
- Schizochytrium include, but are not limited to, Schizochytrium aggregatum, Schizochytrium Hmacinum, Schizochytrium sp. (S31) (ATCC 20888), Schizochytrium sp. (S8) (ATCC 20889), Schizochytrium sp. (LC-RM) (ATCC 18915), Schizochytrium sp. (SR 21), deposited strain ATCC 28209, and deposited strain IFO 32693.
- a terminator region of the invention can have terminator activity at least in a thraustochytrid and includes full-length terminator sequences and functional fragments thereof, fusion sequences, and homologues of a naturally occurring terminator region.
- a homologue of a terminator differs from a naturally occurring terminator in that at least one or a few, but not limited to one or a few, nucleotides have been deleted, inserted, inverted, substituted and/or derivatized.
- homologues of a terminator of the invention retain activity as a terminator region at least in a thraustochytrid, although the activity can be increased, decreased, or made dependant upon certain stimuli.
- the present invention comprises an isolated nucleic acid molecule comprising a terminator region of a PUFA PKS OrfC gene ("PKS OrfC terminator region").
- PKS OrfC terminator region of the invention is a section of genetic sequence that marks the end of the OrfC gene sequence in genomic DNA for transcription.
- the terminator region has a polynucleotide sequence represented by SEQ ID NO:4.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence that is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:4, and that functions at least as a PUFA PKS OrfC terminator region at least in a thraustochytrid.
- the homology (or % identity) can be found over a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, or at least 200 nu
- the present invention is also directed to an isolated nucleic acid molecule comprising a polynucleotide sequence that hybridizes to SEQ ID NO:4 or that hybridizes to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:4.
- the isolated nucleic acid molecule comprises an isolated nucleic acid molecule comprising a polynucleotide sequence that is fully complementary to SEQ ID NO:4 or to a polynucleotide sequence that is at least 95% identical to SEQ ID NO:4.
- a PKS OrfC terminator region of the present invention includes a PKS OrfC terminator region homologue that is sufficiently similar to a naturally occurring PUFA PKS OrfC terminator region that the nucleic acid sequence of a homologue is capable of hybridizing under moderate, high, or very high stringency conditions (described below) to the complement of the nucleic acid sequence of the naturally occurring PKS OrfC terminator region, hi some embodiments, a PKS OrfC terminator region sequence hybridizes under moderate, high, or very high stringency conditions to the complement of SEQ ID NO:4.
- the terminator of the invention comprises the OrfC terminator region of pABOOl 1 as deposited in ATCC Accession No. PTA-9614.
- the present invention is also directed to novel nucleic acid molecules that encode signal peptides.
- the invention is directed to an isolated nucleic acid molecule comprising a polynucleotide sequence encoding a signal peptide of a secreted protein from a microorganism of the phylum Labyrinthulomycota.
- the microorganism is a thraustochytrid.
- the microorganism is a Schizochytrium or a Thraustochytrium.
- a signal peptide of the invention can have secretion signal activity in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring signal peptide.
- a homologue of a signal peptide differs from a naturally occurring signal peptide in that at least one or a few, but not limited to one or a few, amino acids have been deleted (e.g., a truncated version of the protein, such as a peptide or fragment), inserted, inverted, substituted and/or derivatized (e.g., by glycosylation, phosphorylation, acetylation, myristoylation, prenylation, palmitation, amidation, and/or addition of glycosylphosphatidyl inositol).
- a truncated version of the protein such as a peptide or fragment
- derivatized e.g., by glycosylation, phosphorylation, acetylation, myristoylation, prenylation, palmitation, amidation, and/or addition of glycosylphosphatidyl inositol.
- homologues of a signal peptide retain activity as a signal at least in a thraustochytrid, although the activity can be increased, decreased, or made dependant upon certain stimuli.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding a Na/Pi-IIb2 transporter protein signal peptide.
- a Na/Pi-IIb2 transporter protein signal peptide can have signal targeting activity at least for a Na/Pi-IIb2 transporter protein at least in a thraustochytrid, and includes full- length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring Na/Pi-IIb2 transporter protein signal peptide.
- the Na/Pi-IIb2 transporter protein signal peptide has an amino acid sequence represented by SEQ ID NO:1.
- the Na/Pi-IIb2 transporter protein signal peptide has an amino acid sequence represented by SEQ ID NO: 15.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:1 or SEQ ID NO: 15, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for a Na/Pi-IIb2 transporter protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO:1 or SEQ ID NO: 15 that functions as a signal peptide, at least for a Na/Pi-IIb2 transporter protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:2.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:2; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:2; (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:1, and (vi) a polynucleotide sequence that
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO:2, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:2, (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:1, and (vi) a polynucleotide sequence that is at least about 60%,
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:1, (ii) SEQ ID NO: 15, and (iii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:1 or SEQ ID NO: 15 that functions as a signal sequence, at least for a Na/Pi- IIb2 transporter, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 amino acid residues of SEQ ID NO: 15 (i.e., SEQ ID NO: 15 wherein the last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 amino acids at the C-terminal end of this sequence are deleted).
- SEQ ID NO: 15 wherein the last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 amino acids at the C-terminal end of this sequence are deleted.
- the 18 amino acids located at the C-terminal end of SEQ ID NO: 15 are predicted to be part of the mature NaM transporter protein and the cleavage site of the signal sequence is predicted to occur between amino acid residues 35 and 36 of SEQ ID NO: 15.
- an isolated polypeptide is a polypeptide that has been removed from its natural milieu (i.e., that has been subject to human manipulation) and can include purified proteins, purified peptides, partially purified proteins, partially purified peptides, recombinantly produced proteins or peptides, and synthetically produced proteins or peptides, for example.
- isolated does not reflect the extent to which the polypeptide has been purified.
- an isolated Na/Pi-IIb2 transporter signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an alpha- 1 ,6-mannosyltransferase (ALG12) signal peptide.
- ALGl 2 signal peptide can have signal targeting activity at least for an ALG 12 protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring ALG12 signal peptide.
- the ALG12 signal peptide has an amino acid sequence represented by SEQ ID NO:59.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:59, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for an ALGl 2 protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO: 59 that functions as a signal peptide at least for an ALG 12 protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:60.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:60; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 60; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:59.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO:60, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:60, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:59.
- the present invention is also directed to an isolated polypeptide comprising a
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:59 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:59 that functions as a signal sequence, at least for an ALGl 2 protein, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 24, 25, 26, 27, 28, 29, 30, 31, or 32 amino acid residues of SEQ ID NO:59.
- an isolated ALG 12 signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding a binding immunoglobulin protein (BiP) signal peptide.
- a BiP signal peptide can have signal targeting activity at least for a BiP protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring BiP signal peptide.
- the BiP signal peptide has an amino acid sequence represented by SEQ ID NO:61.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:61, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for a BiP protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO:61 that functions as a signal peptide at least for a BiP protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:62.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:62; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:62; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:61.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO:62, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 62, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:61.
- the present invention is also directed to an isolated polypeptide
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:61 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:61 that functions as a signal sequence, at least for an BiP protein, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 23, 24, 25, 26, 27, 28, 29, 30, or 31 amino acid residues of SEQ ID NO:61.
- an isolated BiP signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an alpha-l,3-glucosidase (GLS2) signal peptide.
- GLS2 signal peptide can have signal targeting activity at least for a GLS2 protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring GLS2 signal peptide.
- the GLS2 signal peptide has an amino acid sequence represented by SEQ ID NO:63.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:63, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for a GLS2 protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO: 63 that functions as a signal peptide at least for a GLS2 protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO: 64.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:64; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:64; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:63.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO: 64, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:64, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:63.
- the present invention is also directed to an isolated polypeptide comprising a
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO: 63 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:63 that functions as a signal sequence, at least for an GLS2 protein, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 30, 31, 32, 33, 34, 35, 36, 37, or 38 amino acid residues of SEQ ID NO:63.
- an isolated GLS2 signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an alpha-l,3-l,6-mannosidase-like signal peptide.
- a alpha-l,3-l,6-mannosidase-like signal peptide can have signal targeting activity at least for an alpha- 1, 3 -1,6-mannosidase- like protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring alpha-l,3-l,6-mannosidase-like signal peptide.
- the alpha-l,3-l,6-mannosidase-like signal peptide has an amino acid sequence represented by SEQ ID NO:65.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:65, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for an alpha-l,3-l,6-mannosidase-like protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO:65 that functions as a signal peptide at least for an alpha-l,3-l,6-mannosidase- like protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:66.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:66; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:66; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:65.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO: 66, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:66, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:65.
- the present invention is also directed to an isolated polypeptide comprising a alpha-l,3-l,6-mannosidase-like signal peptide amino acid sequence.
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:65 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:65 that functions as a signal sequence, at least for an alpha- 1,3- 1,6- mannosidase-like; at least in a thraustochytrid.
- the isolated polypeptide comprises the first 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 amino acid residues of SEQ ID NO:65.
- an isolated alpha- 1,3- 1,6- mannosidase-like signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an alpha-l,3-l,6-mannosidase-like #1 signal peptide.
- An alpha-l,3-l,6-mannosidase-like #1 signal peptide can have signal targeting activity at least for an alpha- 1, 3 -1,6-mannosidase- like #1 protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring alpha- 1,3-1, 6-mannosidase- like #1 signal peptide.
- the alpha-l,3-l,6-mannosidase-like #1 signal peptide has an amino acid sequence represented by SEQ ID NO: 67.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:67, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for an alpha-l,3-l,6-mannosidase-like #1 polypeptide; at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO: 67 that functions as a signal peptide at least for an alpha-l,3-l,6-mannosidase-like #1 protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:68.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:68; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:68; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:67.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO:68, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:68, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO: 67.
- the present invention is also directed to an isolated polypeptide comprising a alpha-l,3-l,6-mannosidase-like #1 signal peptide amino acid sequence.
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:67 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:67 that functions as a signal sequence, at least for an alpha- 1,3 -1,6- mannosidase-like #1 protein, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 23, 24, 25, 26, 27, 28, or 29 amino acid residues of SEQ ID NO:67.
- an isolated alpha-1,3-1,6- mannosidase-like #1 signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an alpha- 1,2-mannosidase-like signal peptide.
- An alpha- 1 ,2-mannosidase- like signal peptide can have signal targeting activity at least for an alpha- 1,2-mannosidase-like protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring alpha- 1,2-mannosidase-like signal peptide.
- the alpha- 1,2-mannosidase-like signal peptide has an amino acid sequence represented by SEQ ID NO:69.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:69, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for an alpha- 1,2- mannosidase-like protein; at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO:69 that functions as a signal peptide at least for an alpha- 1 ,2-mannosidase-like protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:70.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:70; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:70; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:69.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO: 70, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:70, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:69.
- the present invention is also directed to an isolated polypeptide comprising a alpha- 1 ,2-mannosidase- like signal peptide amino acid sequence.
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO: 69 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 69 that functions as a signal sequence, at least for an alpha- 1,2-mannosidase- like protein, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 amino acid residues of SEQ ID NO:69.
- an isolated alpha-1,2- mannosidase-like signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding a beta-xylosdiase-like signal peptide.
- a beta- xylosdiase-like signal peptide can have signal targeting activity at least for a beta- xylosdiase-like protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring beta-xylosdiase-like signal peptide.
- the beta- xylosdiase-like signal peptide has an amino acid sequence represented by SEQ ID NO:71.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:71, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for a beta-xylosdiase-like protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO:71 that functions as a signal peptide at least for a beta xylosdiase-like protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO: 72.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:72; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:72; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:71.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO:72, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:72, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:71.
- the present invention is also directed to an isolated polypeptide comprising a beta-xylosdiase-like signal peptide amino acid sequence.
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:71 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:71 that functions as a signal sequence, at least for a beta-xylosdiase-like protein, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 24, 25, 26, 27, 28, 29, or 30 amino acid residues of SEQ ID NO:71.
- an isolated beta-xylosdiase-like signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding a carotene synthase signal peptide.
- a carotene synthase signal peptide can have signal targeting activity at least for a carotene synthase protein, at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring carotene synthase signal peptide.
- the carotene synthase signal peptide has an amino acid sequence represented by SEQ ID NO:73.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:73, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide, at least for a carotene synthase protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO:73 that functions as a signal peptide at least for a carotene synthase protein; at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:74.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:74; (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:74; and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:73.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO:74, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:74, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:73.
- the present invention is also directed to an isolated polypeptide comprising a carotene synthase signal peptide amino acid sequence.
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:73 and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:73 that functions as a signal sequence, at least for a carotene synthase protein, at least in a thraustochytrid.
- the isolated polypeptide comprises the first 15, 16, 17, 18, 19, 20, 21, 29, 30, 31, 32, 33 or 34 amino acid residues of SEQ ID NO:73.
- an isolated carotene synthase signal peptide of the present invention is produced recombinantly.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding a Seel protein ("Seel") signal peptide.
- Seel Seel protein
- a Seel signal peptide can have secretion signal activity at least for a Seel protein at least in a thraustochytrid, and includes full-length peptides and functional fragments thereof, fusion peptides, and homologues of a naturally occurring Seel signal peptide.
- the Seel signal peptide is represented by SEQ ID NO:37.
- an isolated nucleic acid molecule of the invention comprises a polynucleotide sequence encoding an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:37, wherein the polynucleotide sequence encodes an amino acid sequence that functions as a signal peptide at least for a Seel protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises a polynucleotide sequence encoding an isolated amino acid sequence comprising a functional fragment of SEQ ID NO:37 that functions as a signal peptide, at least for a Seel protein, at least in a thraustochytrid.
- the isolated nucleic acid molecule comprises SEQ ID NO:38.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that hybridizes to any of: (i) SEQ ID NO:38, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:38, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:37.
- the isolated nucleic acid molecule comprises a polynucleotide sequence that is fully complementary to any of: (i) SEQ ID NO:38, (ii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:38, and (iii) a polynucleotide sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to a nucleic acid sequence that encodes SEQ ID NO:37.
- the present invention is also directed to an isolated polypeptide comprising a
- the isolated polypeptide comprises an amino acid sequence selected from the group consisting of: (i) SEQ ID NO:37, and (ii) an amino acid sequence at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO:37 that functions as a signal sequence, at least for a Seel transporter, at least in a thraustochytrid.
- the isolated polypeptide comprises an amino acid sequence comprising the first 18 or 19 amino acid residues of SEQ ID NO:37 (i.e., SEQ ID NO:37, wherein the last 1 or 2 amino acids at the C-terminal end of this sequence are deleted).
- an isolated Seel signal peptide of the present invention is produced recombinantly.
- an isolated nucleic acid molecule of the present invention comprises an OrfC promoter, EFl short promoter, EFl long promoter, 60S short promoter, 60S long promoter, Seel promoter, PKS OrfC terminator region, sequence encoding a Na/Pi-IIb2 transporter protein signal peptide, or sequence encoding a Seel transport protein signal peptide of the present invention that is operably linked to the 5' end of a nucleic acid sequence encoding a protein.
- the present invention also encompasses recombinant vectors (including, but not limited to, expression vectors), expression cassettes, and host cells comprising an OrfC promoter, EFl short promoter, EFl long promoter, 60S short promoter, 60S long promoter, Seel promoter, PKS OrfC terminator region, sequence encoding a Na/Pi- IIb2 transporter protein signal peptide, or sequence encoding a Seel transport protein signal peptide of the present invention that is operably linked to the 5 ! end of a nucleic acid sequence encoding a protein.
- Recombinant vectors including, but not limited to expression vectors, expression cassettes, host cells, and microorganisms comprising any of the above- described isolated nucleic acid molecules of the present invention (e.g., nucleic acid molecules comprising an OrfC promoter, EFl short promoter, EFl long promoter, 60S short promoter, 60S long promoter, Seel promoter, PKS OrfC terminator region, sequence encoding a Na/Pi-IIb2 transporter protein signal peptide, or sequence encoding a Seel transport protein signal peptide) are also encompassed by the present invention, as are methods of introducing the vectors and/or expression cassettes into the host cells and recombinant microorganisms.
- OrfC promoter e.g., nucleic acid molecules comprising an OrfC promoter, EFl short promoter, EFl long promoter, 60S short promoter, 60S long promoter, Seel promoter, PKS OrfC terminator region,
- Suitable vectors and expression cassettes can be selected or constructed so as to contain appropriate regulatory sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes, and other sequences as appropriate. Additional details regarding the vectors, expression cassettes, and host cells are set forth herein.
- PSI-BLAST provides an automated, easy-to-use version of a "profile" search, which is a sensitive way to look for sequence homologues.
- the program first performs a gapped BLAST database search.
- the PSI-BLAST program uses the information from any significant alignments returned to construct a position-specific score matrix, which replaces the query sequence for the next round of database searching. Therefore, it is to be understood that percent identity can be determined by using any one of these programs.
- BLAST 2 sequence alignment is performed in blastp or blastn using the BLAST 2.0 algorithm to perform a Gapped BLAST search (BLAST 2.0) between the two sequences allowing for the introduction of gaps (deletions and insertions) in the resulting alignment.
- BLAST 2.0 sequence alignment is performed using the standard default parameters as follows.
- hybridization conditions refer to standard hybridization conditions under which nucleic acid molecules are used to identify similar nucleic acid molecules. See, for example, Sambrook J. and Russell D. (2001) Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, incorporated by reference herein in its entirety.
- formulae to calculate the appropriate hybridization and wash conditions to achieve hybridization permitting varying degrees of mismatch of nucleotides are disclosed, for example, in Meinkoth et al, Anal. Biochem. 138, 267-284 (1984), incorporated by reference herein in its entirety.
- moderate stringency hybridization and washing conditions refer to conditions which permit isolation of nucleic acid molecules having at least about 70% nucleic acid sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 30% or less mismatch of nucleotides).
- High stringency hybridization and washing conditions refer to conditions which permit isolation of nucleic acid molecules having at least about 80% nucleic acid sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 20% or less mismatch of nucleotides).
- Very high stringency hybridization and washing conditions refer to conditions which permit isolation of nucleic acid molecules having at least about 90% nucleic acid sequence identity with the nucleic acid molecule being used to probe in the hybridization reaction (i.e., conditions permitting about 10% or less mismatch of nucleotides).
- conditions permitting about 10% or less mismatch of nucleotides i.e., conditions permitting about 10% or less mismatch of nucleotides.
- one of skill in the art can use the formulae in Meinkoth et al., for example, to calculate the appropriate hybridization and wash conditions to achieve these particular levels of nucleotide mismatch. Such conditions will vary, depending on whether DNArRNA or DNA:DNA hybrids are being formed. Calculated melting temperatures for DNA:DNA hybrids are 10 0 C less than for DNA:RNA hybrids.
- stringent hybridization conditions for DNAiDNA hybrids include hybridization at an ionic strength of 6X SSC (0.9 M Na + ) at a temperature of between about 20 0 C and about 35 0 C (lower stringency), between about 28°C and about 40 0 C (more stringent), and between about 35°C and about 45°C (even more stringent), with appropriate wash conditions.
- stringent hybridization conditions for DNAiRNA hybrids include hybridization at an ionic strength of 6X SSC (0.9 M Na + ) at a temperature of between about 30 0 C and about 45°C, between about 38°C and about 50 0 C, and between about 45°C and about 55 0 C, with similarly stringent wash conditions.
- hybridization conditions can include a combination of salt and temperature conditions that are approximately 20-25 0 C below the calculated T m of a particular hybrid, and wash conditions typically include a combination of salt and temperature conditions that are approximately 12-20 0 C below the calculated T m of the particular hybrid.
- hybridization conditions suitable for use with DNA:DNA hybrids includes a 2-24 hour hybridization in 6X SSC (50% formamide) at about 42°C, followed by washing steps that include one or more washes at room temperature in about 2X SSC, followed by additional washes at higher temperatures and lower ionic strength (e.g., at least one wash as about 37°C in about 0.1X - 0.5X SSC, followed by at least one wash at about 68°C in about 0.1X - 0.5X SSC).
- 6X SSC 50% formamide
- washing steps that include one or more washes at room temperature in about 2X SSC, followed by additional washes at higher temperatures and lower ionic strength (e.g., at least one wash as about 37°C in about 0.1X - 0.5X SSC, followed by at least one wash at about 68°C in about 0.1X - 0.5X SSC).
- the pSP73 vector (Promega, acc#X65333) was digested with Xbal and mung bean nuclease, and then purified and ligated to create the vector p070604#3.
- p070604#3 was then further digested with Sphl, Hpal, and mung bean nuclease and then purified and religated to create the vector p070704#6.
- PCR was used to generate an amplicon encoding the
- Primer S4termF 5'-GATCCC47GGCACGTGCTACG (SEQ ID NO:16)
- MCS MCS from pYES2/CT using the following primers designed to add a Smal site
- the resulting vector termed pSchiz3, contained the alpha tubulin promoter, the SV40 terminator, and the pYES2/CT MCS.
- PCR was used with the following primers and pSchiz3 as a template to generate an amplicon encoding the MCS cassette consisting of the ⁇ -tubulin promoter, the pYES2/CT MCS, and the SV40 terminator region.
- Primer 5'tubMCSJBglII 5'-GACT ⁇ GA TCTC AATTTT AGGCCCCCCACTGACCG (SEQ ID NO:20)
- PCR was used to generate a 4776 bp amplicon encoding the ALS gene
- Primer 5'ALSproNde3 5'-GACTG4L4rGGCCCAGGCCTACTTTCAC (SEQ ID NO:22)
- Primer 3'ALStermBglII 5'GACT ⁇ G ⁇ C ⁇ GGGTCAAGGCAGAAGAATTCCGCC (SEQ ID NO:23) [0161]
- the resulting ALS amplicon was then digested with BgIII and Ndel.
- pSchizO.5#4 was likewise digested with BgIII and Ndel and the larger, 3171 bp band was gel purified and ligated to the purified ALS PCR amplicon.
- pSchizE The resulting vector, termed pSchizE, was verified by sequencing and contained the ALS gene (including the promoter and terminator region) followed by an expression cassette that contained the Schizochytrium ⁇ -tubulin promoter, the pYES2/CT MCS, and the SV40 terminator region (see FIG. 5).
- This plasmid is also termed pCOOOOl and was deposited at the American Type Culture Collection, Patent Depository, 10801 University Boulevard, Manassas, VA 20110-2209, on November 18, 2008, and given ATCC Accession No. PTA-9617.
- This vector contains (i) the Schizochytrium ⁇ -tubulin promoter sequence followed by (ii) a sequence encoding the Schizochytrium Na/Pi transporter signal sequence with a fragment of the N-terminal portion of the mature transporter protein attached (SEQ ID NO: 15), fused to the eGFP-encoding sequence followed by (iii) the remainder of the MCS and (iv) the SV40 terminator region.
- This vector also contains the Schizochytrium ALS gene as a selectable marker. The vector was constructed as described below.
- sequence chosen to encode the signal peptide was from a
- Na/Pi transporter isolated from a Schizochytrium EST library The nucleotide sequences encoding the signal peptide and eGFP were fused by PCR using the eGFP- containing plasmid pPha-Tl-eGFP (Apt et al., J. Cell Sci. 7/5:4061-4069 (2002)), and 3 primers designed to add the signal sequence.
- the first PCR reaction employed the eGfp containing plasmid as the template, a small primer at the 3' end of eGfp (primer sec.Gfp3'Spe, which contained a Spel site, shown in italics below), and a 100 bp primer that flanked the 5' end of eGfp and the 3' end of the signal sequence (primer sec.Gfp5'lb, sec).
- the primer sequences were as follows:
- Primer sec.Gf ⁇ 5'lb 5'-TACTGGTTCCTTGTCGGCCTCGCCCTTCTCGGCGAT GGCTTCAAGGTCATCGCCGGTGACTCCGCCGGTACGCTCTTCATGGTGAGC AAGGGCGAGG (SEQ ID NO:24)
- Primer sec.Gfp3'Spe 5'-CGTC ⁇ CTMGTTTACTTGTACAGCTCGTCCATGCC (SEQ ID NO:25)
- the amplicon product of first PCR was used as a template.
- the same 3' primer was used along with a second 100 bp 5' primer (sec.Gfp5'Bam) that incorporated the remainder of the signal sequence.
- the second 5' primer sequence contained a BamHI site (shown in italics below) and was as follows: Primer sec.G ⁇ 5'Bam: 5'-TAATGG ⁇ rCCATGGCCAACATCATGGCC AACGTCACGCCCCAGGGCGTCGCCAAGGGCTTTGGCCTCTTTGTCGGCGT GCTCTTCTTTCTCTACTGGTTCCTTGT (SEQ ID NO:26)
- the resulting PCR product from this second PCR reaction contained BamHI and Spel sites for cloning.
- the pSchiz-sGr vector comprises an ⁇ -tubulin promoter, an eGFP nucleotide sequence with a sequence encoding an ER retention signal, an SV40 terminator region, and a mutated ALS selectable marker.
- the common ER retention signal amino acid sequence HDEL was back- translated and the sequence encoding this retention signal (SEQ ID NO: 14) was fused to eGFP by PCR using pSchiz-sG from Example 2 as a template.
- the oligonucleotide primers were designed to include the HDEL-encoding sequence (reverse complement underlined in the ss.eGfpHELD3'RV primer sequence below) in frame with a stop codon (shown boxed), plus a BamHI site (shown in italics) in one primer and an EcoRV site (italicized) in the other primer.
- the Schizochytrium protein expression vector pSchiz-cG vector was constructed to express eGFP in a fashion such that the fluorescent protein would accumulate in the cell cytoplasm.
- the pSchiz-cG plasmid comprises a Schizochytrium OrfC promoter, a polynucleotide sequence encoding eGFP, an SV40 terminator region, and a mutated
- Schizochytrium ALS selectable marker [0171] First, a 2000 bp sequence upstream of Schizochytrium ORFC was PCR amplified with the following primers from genomic DNA of Schizochytrium sp.
- Primer prREZ15 5'-CGGTMCCCGCGAATCAAGAAGGTAGGC (SEQ ID NO:
- Primer prREZl ⁇ 5'-CGGMrCCCGTCTCTGCCGCTTTTTCTT (SEQ ID NO:
- the prREZ15 and prREZl ⁇ primers contained the Kpnl and the BamHI sequence, respectively (italicized). The resulting amplicon was digested with BamHI and Kpnl and gel purified. [0173] Next, a 1985 bp sequence downstream of Schizochytrium ORFC was PCR amplified with the following primers from genomic DNA of Schizochytrium sp.
- Primer prREZ17 5'-CGGMrCCGAAAGTGAACCTTGTCCTAACCC (SEQ ID NO:
- prREZ18 5'-CTCTAGAC AGATCCGC ACC ATCGGCCG (SEQ ID NO:32) [0174]
- the prREZ17 and prREZ18 primers contained the BamHI sequence and the
- the vector pBluescript SK(+) (Stratagene, acc# X52328) was next digested with Kpnl and Xbal and gel purified. This vector and the two amplicons generated above were all ligated simultaneously to produce the vector pREZ22.
- the vector pSchizE (Example 1) was then digested with BamHI and treated with mung bean nuclease, column purified, digested with Xbal, and then gel-purified.
- Primer 5'eGFPJ ⁇ n 5'-GACTGG ⁇ 4CCATGGTGAAGCAAGGGCGAGGAG (SEQ ID NO:33)
- Primer 3'eGFP_xba 5'-GACT7CX4G,4TTACTTGTACAGCTCGTCCATGCC (SEQ ID NO:34)
- This amplicon was then digested with Xbal and ligated to the fragment of pSchizE described above to create the vector pSchizE-eGFP.
- PCR was then used with pREZ22 as a template to generate an amplicon encoding the promoter of ORFC.
- Primer 3'ORFCproKpn-2 5'- GATCGGTMCCGTCTCTGCCGCTTTTTCTTTA (SEQ ID NO:36)
- This amplicon was then digested with Kpnl.
- the pSchizE-eGFP vector was then also digested with Kpnl, generating two fragments.
- the larger fragment 7554 bp was gel purified and ligated to the Kpnl-digested amplicon above to produce the pSchiz-cG vector, which contained the Schizochytrium ORFC promoter sequence followed by the eGFP sequence and an SV40 terminator region (see FIG. 8).
- PB26 vitamins consisted of 50 mg/niL vitamin B 12, 100 ⁇ g/mL thiamine, and 100 ⁇ g/mL Ca-pantothenate.
- PB26 metals were adjusted to pH 4.5 and consisted of 3 g/L FeSO 4 9 TH 2 O, 1 g/L MnCl 2 « 4H 2 O, 800 mg/mL ZnSO 4 » 7H 2 O, 20 mg/mL CoCl 2 -OH 2 O, 10 mg/mL Na 2 MoO 4 » 2H 2 O, 600 mg/mL CuSO 4 ⁇ SH 2 O, and 800 mg/mL NiSO 4 *6H 2 O.
- PB26 stock solutions were filter-sterilized separately and added to the broth after autoclaving.
- Glucose, KH 2 PO 4 , and CaCl 2 ⁇ 2H 2 O were each autoclaved separately from the remainder of the broth ingredients before mixing to prevent salt precipitation and carbohydrate caramelizing. All medium ingredients were purchased from Sigma Chemical (St. Louis, MO). Cultures of Schizochytrium were grown to log phase and transformed with a BiolisticTM particle bombarder (BioRad, Hercules, CA) using the vectors pSchiz-El (Example 1), pSchiz-sG (Example 2), pSchiz-sGr (Example 3), or pSchiz-cG (Example 4).
- the BiolisticTM transformation procedure was essentially the same as described previously (see Apt et al, J. Cell. ScL 775(Pt 21):4061-9 (1996) and U.S. Patent No. 7,001,772).
- Primary transformants were selected on solid M2B media containing 20 g/L agar (VWR, West Chester, PA), 10 ⁇ g/mL Sulfometuron methyl (SMM) (Chem Service, Westchester, PA) after 2-6 days of incubation at 27°C. All primary transformants were manually transferred to fresh M2B plates with SMM. Primary transformant colonies were analyzed by fluorescence and light microscopy. Primary transformant colonies were also used to inoculate 50 mL of M2B-SMM liquid media.
- Cell pellet mixtures were then lysed by vortexing at 4°C in a multi-tube vortexer (VWR, Westchester, PA) at maximum speed for 3 hours (h). Cell lysates were then centrifuged at 5500 x g for 10 minutes at 4°C. The supernatants were retained and re-centrifuged at 5500 x g for 10 minutes at 4°C. The resulting supernatant is defined herein as "cell-free extract.” Proteins of both cell-free supernatants and cell-free extracts were quantified with a Bradford assay kit (Sigma, St.
- SDS-PAGE gels were either stained with Coomassie dye or transferred to
- PVDF by western blotting. After blotting, PVDF membranes were rinsed with Tris- Buffered saline (TBS) (Sigma, St. Louis, MO) and treated with 5% non-fat dry milk (NFDM) in TBS at room temperature for 2 hours. Primary antibodies specific to the protein of interest were diluted in 5% NFDM-TBS according to the manufacturer's instructions. If needed, this solution was removed and replaced with fresh 5% NFDM-TBS to which a secondary antibody, conjugated to alkaline phosphatase and specific to the first, was added. If a secondary antibody was not used, the primary would have been conjugated to alkaline phosphatase.
- TBS Tris- Buffered saline
- NFDM non-fat dry milk
- Antibody-treated PVDF was then rinsed with TBS and treated with 5-bromo-4-chloro-3-indoyl- phosphate/nitroblue tetrazolium solution (BCIP/NBT) (KPL, Gaithersburg, MD).
- BCIP/NBT 5-bromo-4-chloro-3-indoyl- phosphate/nitroblue tetrazolium solution
- Schizochytrium transformed with pSchiz-sGr contained eGFP in the cell- fee extract and, to a lesser extent, in the cell-free supernatant. Finally, Schizochytrium transformed with pSchizcG contained eGFP almost exclusively in the cell-fee extract.
- the pSchiz-Cpt vector contains the OrfC promoter and terminator and the
- this vector was constructed by first digesting the pSchizE plasmid with Kpnl/Xbal and gel purifying the resulting 6.89 kb fragment. This digestion also resulted in the removal of the tubulin promoter and most of the polylinker from the pSchizE plasmid; the ALS coding sequence remained intact.
- Into the resulting 6.8 kb SchizE backbone was ligated a 4 kb Kpnl/Xbal fragment containing 2 kb sequence upstream of Schizochytrium OrfC plus 2 kb of sequence downstream of Schizochytrium OrfC with a BamHI site separating the upstream and downstream segments.
- the 4 kb Kpnl/Xbal fragment was excised from plasmid pREZ22 (see Example 4).
- the ligation of the 6.8 kb pSchizE backbone and the 4 kb Kpnl/Xbal fragment resulted in pSchiz-Cpt.
- the pSchizCpt-s IeGFP plasmid comprises a Schizochytrium OrfC promoter, a
- Example 8 as described in Example 5.
- Cell lines resistant to SMM were isolated on M2B agar plates and transferred into M2B liquid culture (containing 10 ⁇ g/ml SMM) in shake flasks and incubated at 27.5°C with shaking at 150 rpm. After cultivation for 72-168 h cultures were harvested by centrifugation (5000 x g for 10 min) and the cell- free supernatant concentrated (approximately 250 fold) using Centriprep and Microcon concentrators (MWCO 10000). Samples (1-7 ⁇ l) were run on SDS-PAGE and the separated proteins transferred onto PVDF membrane.
- the blocked and washed membranes were probed with rabbit anti-eGFP IgG (Biovision) and reacting protein bands were visualized by probing with an alkaline phosphatase conjugated goat anti-rabbit IgG (fc) (Promega) and treatment with BCIP/NBT reagent. Cell lines expressing the highest amount of eGFP were selected.
- the inoculum culture was used to inoculate the fermentor containing: 50 g/L glucose, 13.62 g/L Na 2 SO 4 , 0.72 g/L K 2 SO 4 , 0.56 g/L KCl, 2.27 g/L MgSO 4 JH 2 O, 1.8 g/L KH 2 PO 4 , 17.5 g/L (NH 4 ) 2 SO 4 , 0.19 g/L CaCl 2 .2H 2 O, 51.5 mg FeSO 4 .7H 2 O, 3.1 g/L MnCl 2 .4H 2 O, 6.2 g/L ZnSO 4 .7H 2 O, 0.04 mg CoCl 2 .6H 2 O, 0.04 mg Na 2 MoO 4 , 2.07 g/L CuSO 4 .5H 2 O, 2.07 g/L NiSO 4 .6H 2 O, 9.75 mg thiamine, 0.16 mg vitamin B12, and 3.33 mg calcium pantothenate.
- the pSchizCpt-slkappabh plasmid comprises a Schizochytrium OrfC promoter, a Seel signal sequence preceding a polynucleotide sequence encoding an IgG kappa subunit, and OrfC terminator region and a mutated Schizochytrium ALS selectable marker sequence (see FIG. 16).
- the expression vector was made as follows:
- IgG produced from the corresponding amino acid sequence by Blue Heron Biotechnologies using the codon usage table of FIG. 42, with a 5' Seel secretion signal sequence was cloned into the plasmid pSchiz-Cpt between the orfC promoter and the orfC terminator. Briefly, the vector pSchiz-Cpt was digested with BamHI and alkaline phosphatase according the enzyme manufacturer's instruction (New England Biolabs). This was Ii gated to an amplicon digested with BgIII (NEB) and which was created using the following primers:
- Primer 5'ss-X BgI long GACTagatctATGAAGTTCGCGACCTCG (SEQ ID NO:39)
- Primer 3'ritx_kap_bh_Bgl gactagatctTCAGCACTCACCGCGGTTAAAGG (SEQ ID NO: 40) and a template provided by Blue Heron Biotechnologies which harbored a synthetic optimized DNA molecule containing the polynucleotide sequence for the Seel signal peptide followed by the kappa polynucleotide sequence (SEQ ID NO:41). Resulting bacterial transformant colonies were screened for vector inserts, appropriately aligned for expression. One clone (designated pSchizCPT-slkappabh) was picked for further analysis, confirmation of sequence, and for transformation of Schizochytrium.
- Schizochytrium sp. ATCC 20888 was cultivated in 250 ml shake flasks containing 50 ml of M2B medium at 27 0 C for 24 h. The absorbance was measured at 600 nm and a volume equivalent to 1 ml of a culture with an absorbance value of 1 was centrifuged at 8,000 x g for 5 min. The cell pellet was suspended in 100 ⁇ l of M2B and spread on a M2B agar plate in a 2 cm diameter circle.
- the M2B plate was incubated for 16 h at 27 0 C and colonies growing in the center of the Schizochytrium spread plate picked and spread on M2B plates containing 10 ⁇ g/ml SMM. After 24 to 72 h, twenty colonies were picked and inoculated into 5 ml M2B containing 10 mg/ml SMM in a 25 ml culture tube. The culture tubes were incubated at 27 0 C at 135 rpm for 72 h.
- the cell pellet was suspended in 40 ml dH ⁇ O, centrifuged at 5500 x g for 10 min then suspended in twice its wet weight of extraction buffer. Twice the pellet wet weight of glass beads were added and the tubes shaken for 3 hours at 4 0 C. The resulting cell homogenate was centrifuged at 5000 x g for 10 min and the supernatant retained as the cell-free extract.
- the cell-free supernatant was concentrated from approx 50 ml to > 200 ⁇ l using Centriprep and Microcon concentrators (Amicon) with a 10000 MW cut off.
- the inoculum culture was used to inoculate the fermentor containing: 50 g/L glucose, 13.62 g/L Na 2 SO 4 , 0.72 g/L K 2 SO 4 , 0.56 g/L KCl, 2.27 g/L MgSO 4 JH 2 O, 1.8 g/L KH 2 PO 4 , 17.5 g/L (NH 4 ) 2 SO 4 , 0.19 g/L CaCl 2 .2H 2 O, 51.5 mg FeSO 4 JH 2 O, 3.1 g/L MnCl 2 .4H 2 O, 6.2 g/L ZnSO 4 .7H 2 O, 0.04 mg CoCl 2 .6H 2 O, 0.04 mg Na 2 MoO 4 , 2.07 g/L CuSO 4 .5H 2 O, 2.07 g/L NiSO 4 .6H 2 O, 9.75 mg thiamine, 0.16 mg vitamin B12, and 3.33 mg calcium pantothenate.
- PCRs were conducted with the following primers to create an amplicon 2015 bp in length:
- the amplicon was gel purified and used as a template for subsequent PCR with the following primers:
- the resulting 1017 bp amplicon was purified, digested with Kpnl and BamHI, and ligated to pSchiz-CPT(+)-slGFP(6h), which had been previously purified and digested with Kpnl and BamHI. Ligation products were used to transform E. coli, and plasmids were purified and screened by restriction digests from resulting colonies.
- One plasmid clone (#4.1) with the expected restriction digest pattern and including the 60S long promoter, was verified by Sanger sequencing and designated pABOOl l for transformations of Schizochytrium. See FIG. 24.
- the vector pABOOl l was deposited at the American Type Culture Collection, Patent Depository, 10801 University Boulevard, Manassas, VA 20110-2209, on November 18, 2008, and given ATCC Accession No. PTA-9614.
- PCRs were conducted with the following primers to create an amplicon 2268 bp in length:
- the resulting 1060 bp amplicon was purified, digested with Kpnl and BamHI, and ligated to pSchiz-CPT(+)-slGFP(6h), which had been previously purified and digested with Kpnl and BamHI. Ligation products were used to transform E. coli, and plasmids were purified and screened by restriction digests from resulting colonies.
- One plasmid clone (#6.1) with the expected restriction digest pattern and containing the EF-I long promoter, was verified by Sanger sequencing and designated pAB0018 for transformations of Schizochytrium. See FIG. 25.
- the vector pAB0018 was deposited at the American Type Culture Collection, Patent Depository, 10801 University Boulevard, Manassas, VA 20110-2209, on November 18, 2008, and given ATCC Accession No. PTA-9616.
- Seclp for Seel protein
- Seclg for Seel gene
- Putative promoter sequences, upstream of the start ATG were also identified and synthesized (Blue Heron Biotechnologies).
- a vector containing the synthetic Seclg promoter was used as a template for PCR with the following primers:
- Promoters for genes encoding Elongation Factor 1 (EFl) and the 60S ribosomal unit were selected as promoters for the transcription of heterologous genes in Schizochytrium. The genome sequence of Schizochytrium was searched and genes showing homology with published sequences for both genes were identified. Two versions (one short and one long) for each promoter were cloned via PCR. [0213] The promoter driving expression of the SECl gene was also selected as a promoter for transcription of heterologous genes in Schizochytrium. Because the SECl gene encodes the only native secreted and glycosylated protein so far identified in Schizochytrium cultures, this promoter could time expression of heterologous proteins to the growth phase most suitable for the production of secreted glycosylated proteins.
- the vector cpt(+), containing the SIeGFP construct i.e., the eGFP gene with the SECl secretion signal at the N-terminus, expression driven by the OrfC promoter - vector CLOOOl
- EFl promoter EFl-S from vector ABOOl 5
- EFl promoter (long version) EFl-L from vector ABOOl 8
- 60S promoter (short version) 60S-S from vector ABOOlO
- 60S promoter (long version) 60S-L from vector ABOOl 1
- SECl promoter Seel from vector AB0022
- Schizochytrium sp. 20888 was transformed with each of the 5 vectors via particle bombardment as previously described. Ten viable cell lines for each transformation were selected at random for analysis. Transformation with CLOOOl was carried out as a control for each of the 5 vectors. Five viable cells lines for transformation with CLOOOl were selected at random for analysis.
- Transformant cell lines were cultivated in 250 ml shake flasks containing 50 ml M2B for 72 h at 29.5 0 C with continuous shaking at 200 rpm. The biomass was removed by centrifugation at 5000 x g for 10 min, and the cell-free supernatant was concentrated to ⁇ 1 ml using Centriprep concentrators (MWCO 10000). The protein concentration of the cell-free supernatant samples was measured using the method of Bradford.
- eGFP was detected using an AP-conjugated anti-eGFP antibody and visualized using NCIP/NBT Reagent.
- FIG. 29 and FIG. 30 show glycan structures detected by mass spectrometry analysis of Schizochytrium secreted proteins. In particular, characteristic peaks were observed for GlcNAc 2 Man 5 at m/z 1580, GIcNAc 2 MHn 6 at m/z 1785, and GlcNAc 2 Man 7 at m/z 1991.
- Schizochytrium sp. ATCC 20888 cells were grown in M50-20 media ⁇ see U.S.
- Table 2 shows the number of Schizochytrium sp. ATCC 20888 transformants generated after pretreatment with different enzyme combinations (parameters of 300 V and 0.1 cm cuvette gap distance).
- Table 3 shows the number of Schizochytrium sp. ATCC 20888 transformants generated after pretreatment with different enzyme combinations and voltages (0.1 cm cuvette gap distance).
- Table 4 shows the number of Schizochytrium sp. ATCC 20888 transformants generated using different electroporation cuvette gap distances. The cells were pretreated with 0.25 mg/mL Protease XIV.
- Table 5 shows the number of Schizochytrium sp. ATCC 20888 transformants generated using different electroporation voltages. Cells were pretreated with 0.1 mg/mL Snail Acetone Powder + 0.25 mg/mL Protease XIV (0.1 cm cuvette gap distance). Table 2. Schizochytrium transforniants generated after pretreatment with different enzvme combinations
- the vector pAB0018 was digested with Bam ⁇ l and Ndel resulting in two fragments of 838 bp and 9879 bp in length.
- the 9879 bp fragment was fractionated by standard electrophoretic techniques in an agar gel, purified using commercial DNA purification kits, and ligated to a sequence (SEQ ID NO: 57) comprising a polynucleotide sequence encoding the native secretion signal of the Seel protein of Schizochytrium followed by a synthetic sequence encoding the mature invertase protein (SUC2) of Saccharomyces cerevisiae, which was codon-optimized for expression in Schizochytrium (see FIG. 42).
- SEQ ID NO: 57 a sequence comprising a polynucleotide sequence encoding the native secretion signal of the Seel protein of Schizochytrium followed by a synthetic sequence encoding the mature invertase protein (SUC2) of Saccharomyces cerevis
- a fusion sequence containing the sequences encoding the Seel signal peptide and the Saccharomyces cerevisiae invertase protein was inserted into the Schizochytrium vector pSchiz, followed by digestion with BamHl and Ndel to yield SEQ ID NO:57.
- the ligation product was used to transform a commercially supplied strain of competent DH5 ⁇ E. coli cells (Invitrogen) using the manufacturer's protocol. Several of the resulting clones were propagated and their plasmids were extracted and purified. These plasmids were then screened by restriction digests or PCR to confirm that the ligation generated the expected plasmid vectors.
- One such plasmid vector resulting from a ligation with SEQ ID NO:57 was verified by Sanger sequencing and was designated pCL0076 (SEQ ID NO:58). See FIG. 31.
- Schizochytrium derivative designated B76-32 were grown in M2B medium consisting of 10 g/L glucose, 0.8 g/L (NH 4 ) 2 SO 4 , 5 g/L Na 2 SO 4 , 2 g/L MgSOWH 2 O, 0.5 g/L KH 2 PO 4 , 0.5 g/L KCl, 0.1 g/L CaCl 2 « 2H 2 O, 0.1 M MES (pH 6.0) 0.1% PB26 metals, and 0.1% PB26 Vitamins (v/v).
- PB26 vitamins consisted of 50 mg/mL vitamin B12, 100 ⁇ g/mL thiamine, and 100 ⁇ g/mL Ca-pantothenate.
- PB26 metals were adjusted to pH 4.5 and consisted of 3 g/L FeSO 4 °7H 2 O, 1 g/L MnCl 2 ⁇ 4 H 2 O, 800 mg/mL ZnSO 4 » 7H 2 O, 20 mg/mL CoQ 2 « 6H 2 O, 10 mg/mL Na 2 MoO 4 ⁇ H 2 O, 600 mg/mL CuSO 4 *5H 2 O, and 800 mg/mL NiSO 4 °6H 2 O.
- PB26 stock solutions were filter sterilized separately and added to the broth after autoclaving.
- Glucose, KH 2 PO 4 , and CaQ 2 *2H 2 O were each autoclaved separately from the remainder of the broth ingredients before mixing to prevent salt precipitation and carbohydrate caramelizing. All medium ingredients were purchased from Sigma Chemical (St. Louis, MO).
- Strain B76-32 is a derivative of Schizochytrium sp. ATCC 20888 engineered according to U.S. Patent No. 7,211,418 and U.S. Patent Publication Nos. 2008/0022422 and 2008/0026434.
- Electroporation with enzyme pretreatment - Cells were grown in 50 mL of
- M50-20 media ⁇ see U.S. Publ. No. 2008/0022422) on a shaker at 200 rpm for 2 days at 3O 0 C.
- the cells were diluted at 1 :100 into M2B media (see following paragraph) and grown overnight (16-24 h), attempting to reach mid-log phase growth (OD ⁇ oo of 1.5-2.5).
- the cells were centrifuged in a 50 mL conical tube for 5 min at about 3000 x g. The supernatant was removed and the cells were resuspended in 1 M mannitol, pH 5.5, in a suitable volume to reach a final concentration of 2 OD 6O o units.
- the supernatant was removed and the cells were gently resuspended with 5 mL of ice cold 10% glycerol. The cells were re-centrifuged for 5 min at about 2500 x g in round-bottom tubes. The supernatant was removed and the cells were gently resuspended with 500 ⁇ L of ice cold 10% glycerol, using wide -bore pipette tips. 90 ⁇ L of cells were aliquoted into a prechilled electro-cuvette (Gene Pulser® cuvette - 0.1 cm gap or 0.2 cm gap, Bio-Rad, Hercules, CA).
- the cells were centrifuged for 5 min at about 2500 x g in round bottom tubes. The supernatant was removed and the cell pellet was resuspended in 0.5 mL of M50-20 media. Cells were plated onto an appropriate number (2 to 5) of M2B plates with appropriate selection (if needed) and incubated at 3O 0 C.
- Transformants were selected for growth in either M2B + SMM media or directly selected for growth on sucrose by plating onto MSFM + sucrose.
- MSFM + sucrose selection after 1-2 weeks colonies were replated with several passes onto fresh sucrose-containing media. It was determined that expression of invertase can be used as a selectable marker for thraustochytrid colonies grown on sucrose as a sole carbon source.
- ATCC 20888 transformants growing on sucrose were selected for further characterization and were designated as 1-1, 1-3, 1- 24, 3-1, 3-2, 3-5, 3-21, 4-1, 4-24, and 4-31, respectively.
- Nine of the B76-32 transformants growing on sucrose were selected for further characterization and were designated as B76-32 #2, #12, #19, 326, #30, #39, #42, #56, and #61.
- Control flasks of the parental strain Schizochytrium sp. ATCC 20888 were grown the same way but using glucose containing media. Cells were harvested after 7 days. Cells were centrifuged and washed with a 50% isopropanohdistilled water mixture. The pelleted cells were freeze-dried, weighed, and a fatty acid methyl esters (FAME) analysis was performed. Growth and fat content of CL0076 transformants of Schizochytrium sp. ATCC 20888 or B76-32 were assayed gravimetrically and by gas chromatography of derivatized oils as previously described in U.S. Publ. No. 2008/0022422, incorporated herein by reference in its entirety. Results are shown in Tables 6 - 9.
- SSFM media 50 g/L glucose or sucrose, 13.6 g/L Na 2 SO 4 , 0.7 g/L K 2 SO 4 ,
- Vitamins were added at 1 mL/L from a stock consisting of 0.16 g/L vitamin B 12, 9.7 g/L thiamine, and 3.3 g/L Ca-pantothenate.
- Trace metals were added at 2 mL/L from a stock consisting of 1 g/L citric acid, 5.2 g/L FeSO 4 °7H 2 Q, 1.5 g/L MnCl 2 ⁇ 4 H 2 O, 1.5 g/L ZnSO 4 »7H 2 O, 0.02 g/L CoCl 2 » 6H 2 O, 0.02 g/L Na 2 MoO 4 » 2H 2 O, 1.0 g/L CuSO 4 °5H 2 O, and 1.0 g/L NiSO 4 *6H 2 O, adjusted to pH 2.5.
- Modified SFM (MSFM) media 10 g/L glucose or sucrose, 25.0 g/L NaCl, 1.0 g/L KCl, 0.2 g/L (NH 4 ) 2 SO 4 , 5 g/L, 5.0 g/L MgSO 4 » 7H 2 O, 0.1 g/L KH 2 PO 4 , 0.3 g/L CaCl 2 *2H 2 O, 0.1 M HEPES (pH 7.0), 0.1% PB26 metals, and 0.1% PB26 Vitamins (v/v).
- MSFM Modified SFM
- Vitamins were added at 2 mL/L from a stock consisting of 0.16 g/L vitamin B 12, 9.7 g/L thiamine, and 3.3 g/L Ca-pantothenate. Trace metals were added at 2 mL/L from a stock consisting of 1 g/L citric acid, 5.2 g/L FeSO 4 *7H 2 O, 1.5 g/L MnCl 2 ⁇ 4 H 2 O, 1.5 g/L ZnSO 4 °7H 2 O, 0.02 g/L CoCl 2 -OH 2 O, 0.02 g/L Na 2 MoO 4 ⁇ H 2 O, 1.0 g/L CuSO 4 »5H 2 O, and 1.0 g/L NiSO 4 » 6H 2 O, adjusted to pH 2.5.
- Table 6 shows the growth and fat levels of Schizochytrium sp. ATCC 20888 grown in MSFM with glucose, fructose, sucrose, or no added carbon source.
- Table 7 shows the dry weight and % fatty acid for Schizochytrium sp. ATCC
- Table 8 shows the dry weight and % fatty acid for Schizochytrium sp. ATCC
- ATCC 20888 grown in SSFM media with glucose (control) and Schizochytrium sp.
- ATCC 20888 transformed cell lines grown in SSFM media with sucrose.
- Table 9 shows the dry weight and % fatty acid for Schizochytrium B76-32 grown in SSFM media with glucose (control) and Schizochytrium B76-32 transformed cell lines grown in SSFM media with sucrose.
- DW Dry Weight
- FA FaWy Acids Table 7.
- the proteins (0.625 ⁇ g to 5 ⁇ g) were separated by SDS-PAGE on a bis-tris gel (Invitrogen, Carlsbad, CA, USA). The proteins were then stained with Coomassie blue (SimplyBlue Safe Stain, Invitrogen) or transferred onto polyvinylidene fluoride membrane and probed for the presence of invertase protein with an invertase antisera (Open Biosystems) derived from rabbits that had been injected with a pure preparation of Saccharomyces cerevisiae invertase (Sigma). The membrane was subsequently incubated with a mouse anti-rabbit secondary antibody coupled to alkaline phosphatase (Promega).
- Functional Assay - The enzyme EC 3.2.1.26 is an invertase type of sucrase that catalyzes the hydrolysis of sucrose to fructose and glucose. Sucrase activity was measured by the rate of liberation of fructose and glucose from sucrose. The assay was performed crudely by adding sucrose to fermentation broth supernatant and the glucose/fructose content was measured by HPLC.
- OD reached about 4 in 50 mL shake flasks at 29 0 C.
- Cells were spun down for 15 min at 4500 x g and invertase activity was measured in the supernatant.
- Invertase was assayed by adding 0.1 M sucrose to varying volumes of fermentation broth and adjusting the final volume to 1 mL. The reaction was incubated at 55 0 C for 3 min. Termination of the reaction was done at 100 0 C for 10 min, then frozen until analysis which consists of the determination of glucose, fructose, and sucrose by HPLC. HPLC was performed using a modified version of the process described in Liu et al, Food Sd. 25:293-296 (2007).
- the DTT solution was exchanged with 55 mM Iodoacetamide (IAM) and incubated in the dark for 45 min. Incubation was followed by washing alternately with 40 mM AmBic and 100% acetonitrile twice. Dehydrated gel was reswelled with trypsin solution (trypsin in 40 mM AmBic) on ice for 45 min initially, and protein digestion was carried out at 37 0 C overnight. The supernatant was transferred into another tube. Peptides and glycopeptides were extracted from the gel in series with 20% acetonitrile in 5% formic acid, 50% acetonitrile in 5% formic acid, and then 80% acetonitrile in 5% formic acid.
- IAM Iodoacetamide
- the tryptic digest was incubated with PNGase F at 37 0 C overnight to release N-glycans. After digestion, the sample was passed through a Cl 8 sep-pak cartridge and the carbohydrate fraction was eluted with 5% acetic acid and dried by lyophilization. Released N-linked oligosaccharides were permethylated based on the method of Anumula and Taylor, Anal Biochem. 203:101-108 (1992) and profiled by mass spectrometry. Mass spectrometric analysis was performed following the method developed at the Complex Carbohydrates Research Center (Aoki K et al., J. Biol. Chem. 282:9127-42 (2007).
- Mass analysis was determined by using NSI-LTQ/MS n . Briefly, permethylated glycans were dissolved in 1 mM NaOH in 50% methanol and infused directly into the instrument (LTQ, Thermo Finnigan) at a constant flow rate of 0.4 ⁇ L/min. The MS analysis was performed in the positive ion mode. For total ion mapping, automated MS/MS analysis (at 35 collision energy), m/z range from 500 to 2000 was scanned in successive 2.8 mass unit windows that overlapped the preceding window by 2 mass units.
- Total ion mapping was performed to examine the presence of fragment ions indicative of glycans. All MS/MS data from m/z 500 through m/z 2000 were taken and the raw data were analyzed manually. The chromatogram and table of species obtained by NSI-total ion mapping are shown in FIG. 4OA and FIG. 4OB. This chromatograni was processed by the scan filter; a neutral loss of m/z 139 is characteristic of high-mannose type glycans. Total ion mapping revealed that this sample contains a series of high-mannose type glycans with long mannose chains. These results are similar to the N-glycan structures detected on native Schizochytrium secreted proteins, as determined by the same methodology as Example 17 (see FIG. 30).
- Hindlll treated with mung bean nuclease, purified, and then further digested with Kpnl generating four fragments of various sizes.
- a fragment of 2552 bp was isolated by standard electrophoretic techniques in an agar gel and purified using commercial DNA purification kits.
- a second digest of pAB0018 with Pmel and Kpn was then performed.
- a fragment of 6732 bp was isolated and purified from this digest and ligated to the 2552 bp fragment.
- the ligation product was then used to transform commercially supplied strains of competent DH5- ⁇ E. coli cells (Invitrogen) using the manufacturer's protocol.
- Plasmids from ampicillin-resistant clones were propagated, purified, and then screened by restriction digests or PCR to confirm that the ligation generated the expected plasmid structures.
- One verified plasmid was designated pCL0120. See FIG. 43.
- the mature form of the Sucl invertase protein from the fungus Aspergillus niger was codon-optimized for expression in Schizochytrium using the Schizochytrium codon usage table of FIG. 42 (codon optimization performed by Blue Heron Biotechnology, Bothell, WA).
- the codon optimized sequence was synthesized and the resulting polynucleotide sequence was fused to a polynucleotide sequence encoding the Schizochytrium Seel signal peptide ("Seel ss") as an N-terminal leader in place of the endogenous signal peptide.
- FIG. 44 The resulting coding region of the "si Sucl" nucleic acid sequence (SEQ ID NO:75) is shown in FIG. 44.
- This codon-optimized si Sucl polynucleotide was cloned to the vector pCL0120 using the 5' and 3' restriction sites BamHI and Ndel for insertion and ligation according to standard techniques.
- a plasmid map of the resulting vector, pCL0137, is shown in FIG. 45. Wild-type strain Schizochytrium sp. ATCC 20888 was transformed with this vector and the resulting clones were selected on solid SSFM media containing SMM.
- SMM-resistant clones were then re-plated to SSFM solid media containing sucrose as a sole carbon source to assay for growth. Depending on the transformation experiment, between 50% and 90% of the SMM- resistant primary transformants were capable of growth on sucrose media.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10753939.7A EP2408795B1 (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the phylum labyrinthulomycota |
| CN2010800222774A CN102648207A (en) | 2009-03-16 | 2010-03-15 | Protein production in clathromycota |
| EP17156990.8A EP3202906B1 (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the phylum labyrinthulomycota |
| KR1020117024332A KR101786121B1 (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the phylum Labyrinthulomycota |
| KR1020177027988A KR101939014B1 (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the phylum Labyrinthulomycota |
| AU2010225930A AU2010225930B2 (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the phylum Labyrinthulomycota |
| ES10753939.7T ES2627758T3 (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the Labyrinthulomycota phylum |
| CA2755667A CA2755667C (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the phylum labyrinthulomycota |
| JP2012500857A JP2012520676A (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of Labyrinthula |
| AU2017202378A AU2017202378B2 (en) | 2009-03-16 | 2017-04-11 | Protein production in microorganisms of the phylum Labyrinthulomycota |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16061809P | 2009-03-16 | 2009-03-16 | |
| US61/160,618 | 2009-03-16 | ||
| US29044109P | 2009-12-28 | 2009-12-28 | |
| US61/290,441 | 2009-12-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010107709A1 true WO2010107709A1 (en) | 2010-09-23 |
Family
ID=42731038
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/027352 Ceased WO2010107709A1 (en) | 2009-03-16 | 2010-03-15 | Protein production in microorganisms of the phylum labyrinthulomycota |
Country Status (11)
| Country | Link |
|---|---|
| US (5) | US8637651B2 (en) |
| EP (2) | EP3202906B1 (en) |
| JP (3) | JP2012520676A (en) |
| KR (2) | KR101939014B1 (en) |
| CN (2) | CN104263729B (en) |
| AR (1) | AR075860A1 (en) |
| AU (2) | AU2010225930B2 (en) |
| CA (2) | CA2755667C (en) |
| ES (2) | ES2752196T3 (en) |
| TW (2) | TWI504749B (en) |
| WO (1) | WO2010107709A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011090731A1 (en) | 2009-12-28 | 2011-07-28 | Martek Biosciences Corporation | Production of heterologous polypeptides in microalgae, microalgal extracellular bodies, compositions, and methods of making and uses thereof |
| CN109777815A (en) * | 2019-03-28 | 2019-05-21 | 昆明理工大学 | HMG-CoA synthase gene RKHMGCS and its application |
| US10745441B2 (en) | 2013-06-05 | 2020-08-18 | Bausch Health Ireland Limited | Ultra-pure agonists of guanylate cyclase C, method of making and using same |
| EP3762485A4 (en) * | 2018-03-05 | 2021-12-08 | Conagen Inc. | ORGANISMS AND PROCESSES FOR THE PRODUCTION OF LOW SULPHATION GLYCOMOLECULES |
| US11466269B2 (en) | 2016-07-13 | 2022-10-11 | Dsm Ip Assets B.V. | CRISPR-Cas system for an algal host cell |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2651313T3 (en) | 2009-12-28 | 2018-01-25 | Dsm Ip Assets B.V. | Recombinant traustoquids growing in xylose, and compositions, methods of preparation and uses thereof |
| CN103068965A (en) | 2009-12-28 | 2013-04-24 | Dsmip资产公司 | Recombinant Thraustochytrium growing on sucrose and its composition, preparation method and use |
| EP2519636B8 (en) * | 2009-12-28 | 2017-08-09 | DSM IP Assets B.V. | Production of hemagglutinin-neuraminidase protein in microalgae |
| ES2617743T3 (en) | 2010-03-12 | 2017-06-19 | Merial, Inc. | Recombinant vaccines of the bluetongue virus and its uses |
| US20220000141A1 (en) * | 2014-07-25 | 2022-01-06 | Smallfood Inc. | Protein rich food ingredient from biomass and methods of production |
| US11122817B2 (en) * | 2014-07-25 | 2021-09-21 | Smallfood Inc. | Protein rich food ingredient from biomass and methods of production |
| US11213048B2 (en) | 2014-07-25 | 2022-01-04 | Smallfood, Inc. | Protein rich food ingredient from biomass and methods of preparation |
| EP3265567B1 (en) | 2015-03-02 | 2020-07-29 | Conagen Inc. | Regulatory elements from labyrinthulomycetes microorganisms |
| AU2017235543B2 (en) * | 2016-03-16 | 2020-05-14 | Conagen, Inc. | Production of proteins in labyrinthulomycetes |
| CN109477079A (en) | 2016-05-12 | 2019-03-15 | 帝斯曼知识产权资产管理有限公司 | Method for increasing omega-3 polyunsaturated fatty acid production in microalgae |
| US10633454B2 (en) | 2016-11-01 | 2020-04-28 | Conagen Inc. | Expression of modified glycoproteins and glycopeptides |
| US10457970B2 (en) | 2016-11-01 | 2019-10-29 | Conagen Inc. | Expression of modified glycoproteins and glycopeptides |
| EP3788164A4 (en) * | 2018-05-01 | 2022-01-26 | Conagen Inc. | RECOMBINANT ORGANISMS AND METHODS FOR PRODUCING HIGH GLYCAN OCCUPANCY GLYCOMOLECULES |
| WO2022232213A1 (en) * | 2021-04-28 | 2022-11-03 | Conagen Inc. | Methods of producing sars-cov-2 spike protein |
| WO2023144707A1 (en) | 2022-01-25 | 2023-08-03 | Dsm Ip Assets B.V. | Media refinement and nutrient feeding approaches to increase polyunsaturated fatty acid production |
| CN118615188B (en) * | 2024-07-05 | 2025-04-25 | 河南坚久实业有限公司 | Anti-aging composition containing plant polypeptide and preparation method thereof |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5340742A (en) | 1988-09-07 | 1994-08-23 | Omegatech Inc. | Process for growing thraustochytrium and schizochytrium using non-chloride salts to produce a microfloral biomass having omega-3-highly unsaturated fatty acids |
| US20030166207A1 (en) | 2001-04-16 | 2003-09-04 | Roessler Paul G. | Product and process for transformation of thraustochytriales microorganisms |
| US20040171826A1 (en) | 2003-02-20 | 2004-09-02 | Stephen Hamilton | Endomannosidases in the modification of glycoproteins in eukaryotes |
| US20040230042A1 (en) | 2000-06-28 | 2004-11-18 | Stephen Hamilton | Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells |
| US20060029604A1 (en) | 2000-06-28 | 2006-02-09 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GlcNAc2Man3GlcNAc2 glycoform |
| US20060040353A1 (en) | 2000-06-28 | 2006-02-23 | Davidson Robert C | Production of galactosylated glycoproteins in lower eukaryotes |
| US7029872B2 (en) | 2000-06-28 | 2006-04-18 | Glycofi, Inc | Methods for producing modified glycoproteins |
| US20060257399A1 (en) | 2000-06-28 | 2006-11-16 | Glycofi, Inc. | Immunoglobulins comprising predominantly a Man5GIcNAc2 glycoform |
| US20060275904A1 (en) | 2005-04-28 | 2006-12-07 | Fuji Photo Film Co., Ltd. | Method for introducing a gene into Labyrinthulomycota |
| US20060286650A1 (en) | 2005-04-28 | 2006-12-21 | Fuji Photo Film Co., Ltd. | Vector capable for transformation of labyrinthulomycota |
| US20080022422A1 (en) * | 1999-01-14 | 2008-01-24 | Martek Biosciences Corporation | Chimeric pufa polyketide synthase systems and uses thereof |
Family Cites Families (41)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BE545283A (en) | ||||
| LU35839A1 (en) | ||||
| US3223456A (en) | 1963-11-14 | 1965-12-14 | Siemens Ag | Conveying apparatus for fine-granular material |
| US4381897A (en) | 1980-10-06 | 1983-05-03 | Krupp Polysius Ag | Installation for transporting fine-grained material |
| US4626505A (en) | 1984-02-24 | 1986-12-02 | E. I. Du Pont De Nemours And Company | Selectable markers for yeast transformation |
| US5605011A (en) | 1986-08-26 | 1997-02-25 | E. I. Du Pont De Nemours And Company | Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase |
| IL83348A (en) | 1986-08-26 | 1995-12-08 | Du Pont | Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase |
| GB8716899D0 (en) * | 1987-07-17 | 1987-08-26 | Unilever Plc | Detergent compositions |
| US5130242A (en) | 1988-09-07 | 1992-07-14 | Phycotech, Inc. | Process for the heterotrophic production of microbial products with high concentrations of omega-3 highly unsaturated fatty acids |
| US5426040A (en) | 1989-08-17 | 1995-06-20 | Northeastern University | Methods for producing improved strains of seaweed by fusion of spore-protoplasts, and resultant seaweeds and phycocolloids |
| IL100908A0 (en) | 1991-02-22 | 1992-11-15 | Salk Inst Biotech Ind | Invertase genes and their use |
| US5804408A (en) | 1991-03-13 | 1998-09-08 | Yoshihide Hagiwara | Expression of human SOD in blue green algae |
| US5661017A (en) | 1993-09-14 | 1997-08-26 | Dunahay; Terri Goodman | Method to transform algae, materials therefor, and products produced thereby |
| US5853973A (en) | 1995-04-20 | 1998-12-29 | American Cyanamid Company | Structure based designed herbicide resistant products |
| DE19529475A1 (en) | 1995-08-11 | 1997-02-13 | Marcus Weis | Sieve for separating fibre and fibre containing material from mixture - using channel shaped sieves with progressively larger mesh making use of fibre property to form clouds during certain movement patterns |
| US5824309A (en) | 1995-12-05 | 1998-10-20 | University Of Massachusetts | Recombinant gas vesicles and uses thereof |
| WO1997039106A1 (en) | 1996-04-12 | 1997-10-23 | Martek Biosciences Corporation | Methods and tools for transformation of eukaryotic algae |
| CN1190673A (en) | 1996-04-29 | 1998-08-19 | 中国科学院微生物研究所 | Filamentous fungus independently duplicated representation rector and system |
| DE69826596T2 (en) | 1997-02-20 | 2006-02-09 | Bayer Bioscience N.V. | IMPROVED METHOD FOR THE TRANSFORMATION OF PLANTS |
| ES2125195B1 (en) | 1997-04-18 | 1999-10-01 | Antibioticos Sa | INACTIVATION PROCEDURE OF GENES CODING FOR ENZYMES OF PHENYLACETATE CATABOLISM, INTERVENING PLASMIDS AND STRAINS TRANSFORMED WITH THEM. |
| US7211418B2 (en) | 1999-01-14 | 2007-05-01 | Martek Biosciences Corporation | PUFA polyketide synthase systems and uses thereof |
| US7217856B2 (en) * | 1999-01-14 | 2007-05-15 | Martek Biosciences Corporation | PUFA polyketide synthase systems and uses thereof |
| US7247461B2 (en) | 1999-01-14 | 2007-07-24 | Martek Biosciences Corporation | Nucleic acid molecule encoding ORFA of a PUFA polyketide synthase system and uses thereof |
| FR2791699B1 (en) | 1999-03-29 | 2004-10-29 | Meristem Therapeutics | CHIMERIC EXPRESSION PROMOTERS, EXPRESSION CASSETTES, VECTORS, TRANSGENIC PLANTS AND SEEDS CONTAINING THEM, AND METHODS OF OBTAINING THEM |
| KR20000075076A (en) | 1999-05-28 | 2000-12-15 | 최태진 | A method for production of foreign protein using transformed microalgae |
| CN101845446B (en) | 2000-09-28 | 2016-01-20 | 生物源食物及科学公司 | Fatty acid desaturase family member FAD4, FAD5, FAD5-2 and FAD6 and their application |
| US6419425B1 (en) | 2001-02-28 | 2002-07-16 | Neu Transf'air | Granular material distributing apparatus comprising at least two transfer vessels that operate in alternation |
| KR101234199B1 (en) * | 2003-03-26 | 2013-02-20 | 마텍 바이오싸이언스스 코포레이션 | Pufa polyketide synthase systems and uses thereof |
| KR20060017635A (en) | 2003-06-05 | 2006-02-24 | 와이어쓰 홀딩스 코포레이션 | Immunogenic Composition Comprising a Venezuelan Equine Encephalitis Virus Replicon Vector and a Paramyxovirus Protein Antigen |
| PT103331A (en) | 2005-08-05 | 2007-02-28 | Fundacao Da Faculdade De Cienc | EXPRESSION OF AN ACTIVE CONVEYOR OF XYLOSIS IN SACCHAROMYCES CEREVISIAE GENETICALLY MODIFIED |
| KR101524398B1 (en) * | 2006-03-15 | 2015-06-04 | 디에스엠 아이피 어셋츠 비.브이. | Polyunsaturated Fatty Acid Production in Heterologous Organisms Using PUFA Polyketide Synthase Systems |
| US8477593B2 (en) | 2006-07-28 | 2013-07-02 | Qualcomm Incorporated | Method and apparatus for sending signaling for data transmission in a wireless communication system |
| CN101981201A (en) | 2006-08-01 | 2011-02-23 | 加拿大海洋营养食品有限公司 | Oleaginous microorganisms and methods of improving these microorganisms |
| CA2615372A1 (en) | 2007-07-13 | 2009-01-13 | Marc-Andre D'aoust | Influenza virus-like particles (vlps) comprising hemagglutinin |
| CN101874117A (en) | 2007-09-12 | 2010-10-27 | 马太克生物科学公司 | Biological oil and preparation and application thereof |
| EP2090648A1 (en) | 2008-02-12 | 2009-08-19 | Institut Francais de Recherche pour l'Exploitation de la Mere(Ifremer) | Production of glycosylated polypeptides in microalgae |
| CA2720828C (en) | 2008-04-09 | 2017-03-21 | Solazyme, Inc. | Direct chemical modification of microbial biomass and microbial oils |
| CN103068965A (en) | 2009-12-28 | 2013-04-24 | Dsmip资产公司 | Recombinant Thraustochytrium growing on sucrose and its composition, preparation method and use |
| CA3028175C (en) * | 2009-12-28 | 2022-05-24 | Sanofi Vaccine Technologies, S.A.S. | Methods of producing heterologous viral neuraminidase proteins in microalgae |
| EP2519636B8 (en) | 2009-12-28 | 2017-08-09 | DSM IP Assets B.V. | Production of hemagglutinin-neuraminidase protein in microalgae |
| ES2651313T3 (en) | 2009-12-28 | 2018-01-25 | Dsm Ip Assets B.V. | Recombinant traustoquids growing in xylose, and compositions, methods of preparation and uses thereof |
-
2010
- 2010-03-15 CN CN201410383618.0A patent/CN104263729B/en active Active
- 2010-03-15 KR KR1020177027988A patent/KR101939014B1/en active Active
- 2010-03-15 ES ES17156990T patent/ES2752196T3/en active Active
- 2010-03-15 CA CA2755667A patent/CA2755667C/en active Active
- 2010-03-15 JP JP2012500857A patent/JP2012520676A/en active Pending
- 2010-03-15 WO PCT/US2010/027352 patent/WO2010107709A1/en not_active Ceased
- 2010-03-15 TW TW099107452A patent/TWI504749B/en active
- 2010-03-15 CN CN2010800222774A patent/CN102648207A/en active Pending
- 2010-03-15 EP EP17156990.8A patent/EP3202906B1/en active Active
- 2010-03-15 TW TW104129961A patent/TWI548648B/en active
- 2010-03-15 CA CA3003188A patent/CA3003188C/en active Active
- 2010-03-15 EP EP10753939.7A patent/EP2408795B1/en active Active
- 2010-03-15 US US12/724,403 patent/US8637651B2/en active Active
- 2010-03-15 KR KR1020117024332A patent/KR101786121B1/en active Active
- 2010-03-15 ES ES10753939.7T patent/ES2627758T3/en active Active
- 2010-03-15 AU AU2010225930A patent/AU2010225930B2/en active Active
- 2010-03-16 AR ARP100100829 patent/AR075860A1/en active IP Right Grant
-
2013
- 2013-12-17 US US14/108,794 patent/US9012616B2/en active Active
-
2014
- 2014-11-19 US US14/548,054 patent/US9518102B2/en active Active
- 2014-12-18 JP JP2014255732A patent/JP6012698B2/en active Active
-
2016
- 2016-09-20 JP JP2016182541A patent/JP6369952B2/en active Active
- 2016-11-03 US US15/342,623 patent/US20170145461A1/en not_active Abandoned
-
2017
- 2017-04-11 AU AU2017202378A patent/AU2017202378B2/en active Active
-
2019
- 2019-01-16 US US16/249,253 patent/US10829794B2/en active Active
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5340742A (en) | 1988-09-07 | 1994-08-23 | Omegatech Inc. | Process for growing thraustochytrium and schizochytrium using non-chloride salts to produce a microfloral biomass having omega-3-highly unsaturated fatty acids |
| US20080022422A1 (en) * | 1999-01-14 | 2008-01-24 | Martek Biosciences Corporation | Chimeric pufa polyketide synthase systems and uses thereof |
| US20040230042A1 (en) | 2000-06-28 | 2004-11-18 | Stephen Hamilton | Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells |
| US20060029604A1 (en) | 2000-06-28 | 2006-02-09 | Gerngross Tillman U | Immunoglobulins comprising predominantly a GlcNAc2Man3GlcNAc2 glycoform |
| US20060040353A1 (en) | 2000-06-28 | 2006-02-23 | Davidson Robert C | Production of galactosylated glycoproteins in lower eukaryotes |
| US7029872B2 (en) | 2000-06-28 | 2006-04-18 | Glycofi, Inc | Methods for producing modified glycoproteins |
| US20060257399A1 (en) | 2000-06-28 | 2006-11-16 | Glycofi, Inc. | Immunoglobulins comprising predominantly a Man5GIcNAc2 glycoform |
| US20030166207A1 (en) | 2001-04-16 | 2003-09-04 | Roessler Paul G. | Product and process for transformation of thraustochytriales microorganisms |
| US7001772B2 (en) | 2001-04-16 | 2006-02-21 | Martek Biosciences Corporation | Product and process for transformation of Thraustochytriales microorganisms |
| US20040171826A1 (en) | 2003-02-20 | 2004-09-02 | Stephen Hamilton | Endomannosidases in the modification of glycoproteins in eukaryotes |
| US20060275904A1 (en) | 2005-04-28 | 2006-12-07 | Fuji Photo Film Co., Ltd. | Method for introducing a gene into Labyrinthulomycota |
| US20060286650A1 (en) | 2005-04-28 | 2006-12-21 | Fuji Photo Film Co., Ltd. | Vector capable for transformation of labyrinthulomycota |
Non-Patent Citations (11)
| Title |
|---|
| ALTSCHUL, S., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
| BENDSTEN ET AL., J, MOL. BIOI., vol. 340, 2004, pages 783 - 795 |
| EMANUELSSON ET AL., NATURE PROTOCOLS, vol. 2, 2007, pages 953 - 971 |
| KANEKO ET AL., SCIENCE, vol. 313, no. 5787, 2006, pages 670 - 3 |
| MEINKOTH ET AL., ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284 |
| NIELSEN ET AL., PROTEIN ENGINEERING, vol. 12, 1999, pages 3 - 9 |
| NIELSEN; KROGH, PROC. INT. CONF INTEL!. SYST. MOL. BIOL., vol. 6, 1998, pages 122 - 130 |
| SAMBROOK J.; RUSSELL D.: "Molecular cloning: A laboratory manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| SAMBROOK: "Molecular Cloning: A Laboratory Manual", 2001 |
| See also references of EP2408795A4 * |
| TATUSOVA; MADDEN, FEMS MICROBIAL. LETT., vol. 174, 1999, pages 247 - 250 |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011090731A1 (en) | 2009-12-28 | 2011-07-28 | Martek Biosciences Corporation | Production of heterologous polypeptides in microalgae, microalgal extracellular bodies, compositions, and methods of making and uses thereof |
| EP3505632A1 (en) | 2009-12-28 | 2019-07-03 | Sanofi Vaccine Technologies, S.A.S. | Production of heterologous polypeptides in microalgae, microalgal extracellular bodies, compositions, and methods of making and uses thereof |
| EP4130273A1 (en) | 2009-12-28 | 2023-02-08 | Sanofi Vaccine Technologies, S.A.S. | Production of heterologous polypeptides in microalgae, microalgal extracellular bodies, compositions, and methods of making and uses thereof |
| US10745441B2 (en) | 2013-06-05 | 2020-08-18 | Bausch Health Ireland Limited | Ultra-pure agonists of guanylate cyclase C, method of making and using same |
| US11142549B2 (en) | 2013-06-05 | 2021-10-12 | Bausch Health Ireland Limited | Ultra-pure agonists of guanylate cyclase C, method of making and using same |
| US11319346B2 (en) | 2013-06-05 | 2022-05-03 | Bausch Health Ireland Limited | Ultra-pure agonists of guanylate cyclase C, method of making and using same |
| US11834521B2 (en) | 2013-06-05 | 2023-12-05 | Bausch Health Ireland Limited | Ultra-pure agonists of guanylate cyclase C, method of making and using same |
| US12146003B2 (en) | 2013-06-05 | 2024-11-19 | Bausch Health Ireland Limited | Ultra-pure agonists of guanylate cyclase C, method of making and using same |
| US11466269B2 (en) | 2016-07-13 | 2022-10-11 | Dsm Ip Assets B.V. | CRISPR-Cas system for an algal host cell |
| EP3762485A4 (en) * | 2018-03-05 | 2021-12-08 | Conagen Inc. | ORGANISMS AND PROCESSES FOR THE PRODUCTION OF LOW SULPHATION GLYCOMOLECULES |
| CN109777815A (en) * | 2019-03-28 | 2019-05-21 | 昆明理工大学 | HMG-CoA synthase gene RKHMGCS and its application |
| CN109777815B (en) * | 2019-03-28 | 2021-10-29 | 昆明理工大学 | HMG-CoA synthase gene RKHMGCS and its application |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10829794B2 (en) | Protein production in microorganisms of the phylum labyrinthulomycota | |
| JP6666950B2 (en) | Production of heterologous polypeptides, microalgal extracellular bodies, compositions in microalgae, and methods of making and using them | |
| AU2010339544B2 (en) | Production of hemagglutinin-neuraminidase protein in microalgae | |
| JP5662363B2 (en) | Method for clarifying protein fusion factor (TFP) for secretion of difficult-to-express protein, method for producing protein fusion factor (TFP) library, and method for recombinant production of difficult-to-express protein | |
| EP2298923A1 (en) | Method for the production of recombinant proteins by green microalgae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080022277.4 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10753939 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012500857 Country of ref document: JP Ref document number: 2755667 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2010753939 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010753939 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 7902/DELNP/2011 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20117024332 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2010225930 Country of ref document: AU Date of ref document: 20100315 Kind code of ref document: A |








