WO2010107157A1 - Diagnostic marker for breast cancer with peroxiredoxin i as active reagent and diagnostic kit for breast cancer using same - Google Patents

Abstract

The present invention relates to a marker for diagnosis of breast cancer, consisting of Peroxiredoxin I as active ingredient and a kit for diagnosis of breast cancer using the same. According to the present invention, Peroxiredoxin I can be over-expressed in cancerous human breast tissue and can therefore be advantageously used as a marker for diagnosis of breast cancer as it enables both diagnosis and early stage prognosis of breast cancer.

Description

Marker for diagnosing breast cancer using peroxyredoxin I as an active ingredient, and breast cancer diagnostic kit using the same

The present invention relates to a marker for diagnosing breast cancer using peroxyredoxin I as an active ingredient, and a breast cancer diagnostic kit using the same.

Currently, various factors such as female hormones, family history, past history, fertility, and dietary habits have been discussed as the causes of breast cancer, but there is no clear explanation yet. According to a recent survey by the Korea National Statistical Office, breast cancer in Korean women has recently increased rapidly, surpassing cervical cancer in 1998, accounting for 16.1% of Korean cancer patients in 2001, surpassing stomach cancer. In 2002, breast cancer (11.1%) was the most prevalent cancer compared to 2001, and female hormones were stimulated during physiologically active physical changes with factors such as low fertility, short lactation, early menarche and late menopause. The incidence of breast cancer is increasing rapidly due to the increased sensitivity of mammary tissues due to the rapid increase in the number of times of receiving, the westernization of eating habits, and the pollution of living environment.

The increase in the incidence of breast cancer and mortality due to breast cancer is expected to continue for some time in view of the current westernization. Breast cancer usually causes symptoms such as invasion of surrounding tissues or lymph node metastasis due to the growth of cancer cells, but most of them can be diagnosed by self-examination without any symptoms. Therefore, it is very important to diagnose breast cancer effectively early in order to reduce mortality from breast cancer.

Various methods are used to diagnose breast cancer. To date, 70% of breast cancer patients come by self-diagnosis. However, this self-diagnosis method has a disadvantage in that it is very difficult to distinguish between malignant and benign tumors. In addition, X-ray mammography, ultrasonography, fine needle aspiration cytology, magnetic resonance imaging, etc. are diagnosed as breast cancer, and finally, it is important to confirm through histological examination. X-ray mammography is a method of screening the breast with X-rays, which is excellent for discriminating whether a tumor is benign or malignant, and is a method for detecting hidden tumors. It is the most effective way to diagnose breast cancer. However, mammography has a disadvantage in that a lot of mammary glands are developed like young women, or in Korean women with small breasts and a lot of fiber, the diagnosis rate is lowered, and frequent taking may cause breast cancer. Ultrasonography is used as an alternative to mammography, which is effective in distinguishing between water and hard bumps, but lacks the ability to distinguish between malignant and benign tumors.

In order to compensate for the disadvantages of the conventional diagnostic methods, there have been attempts to diagnose breast cancer by measuring the concentration of tumor markers in the blood of the patient. However, although the value of these tumor markers as a diagnostic or prognostic factor has been studied, there are no breast cancer markers that are officially recommended due to their limited use.

On the other hand, peroxiredoxins (Prxs) are thiol-containing proteins with high antioxidant capacity in living cells and are a new type of peroxidase. The main functions of peroxidase include cell protection against oxidative stress, changes in intracellular signals through hydrogen peroxide as the second delivery molecule, and regulation of cell proliferation. Mammalian peroxyredoxin is composed of six Prx I-VI, which are distributed in a number of intracellular locations, including peroxisome and mitochondria, where oxidative stress is most pronounced. Peroxyredoxin can protect cells from reactive oxygen species (ROS) toxicity and cell growth using c-AbI, caspase, nuclear factor-kappaB (NF-kB) and activator protein-1 And signal transduction that affects apoptosis. Reactive oxygen species are involved in carcinogenesis at all stages, including initiation, promotion and progression. The concentration of reactive oxygen species, such as superoxide anions (O ₂ ⁻ ), is known to increase in cancer, and the production of reactive oxygen species is known to accelerate tumor induction. Peroxyredoxin I-VI are overexpressed when the concentration of intracellular hydrogen peroxide increases, some of which are known to affect cell proliferation, cell differentiation and apoptosis. In particular, the cytosolic form of peroxyredoxin I is the most abundant of the mammalian peroxyredoxin family and is known to regulate cell proliferation, cell differentiation and apoptosis by interaction with oncogene products such as c-AbI.

Peroxyredoxin I has been studied in several human cancer samples as potential markers. However, the relationship between peroxyredoxin I and cancer is not yet clear, and elevated expression of peroxyredoxin I has been observed in several human cancers including lung, esophagus, oral cavity and thyroid gland. In oral squamous cell carcinoma, Yanagawa et al. Also found low levels of peroxyredoxin I associated with large tumor masses, lymph node metastases, and incompletely differentiated cancers (Yanagawa T., Iwasa S., Ishii T) ., Tabuchi K., Yusa H., Onizawa K., Omura K., Harada H., Suzuki H., Yoshida H. Peroxiredoxin I expression in oral cancer: a potential new tumor marker. Cancer Lett., 156: 27- 35, 2000.). In contrast, Karitala et al. Found no correlation between peroxyredoxin I and clinical pathologic features in breast cancer (Peeter Karihtala, Anne Mantyniemi, Sang Won Kang, Vuokko L. Kinnula and Ylermi Soini Clinical Cancer Research Vol. 9, 3418-3424, August 2003 Peroxiredoxins in Breast). Instead, the expression levels of peroxyredoxins III, IV and V were significantly higher when breast cancers were incompletely differentiated, suggesting their relationship with breast cancer.

However, little is known about whether peroxyredoxin I acts as a diagnostic marker for breast cancer. Thus, there is a need for a marker for diagnosing breast cancer that can predict the diagnosis or prognosis of breast cancer early.

The present inventors have been studying the marker for diagnosing breast cancer which can predict the diagnosis or prognosis of breast cancer early, and confirmed that peroxyredoxin I was expressed low in normal breast tissue but very high in breast cancer tissue, and completed the present invention. It was.

The present invention is to provide a marker for diagnosing breast cancer using peroxyredoxin I as an active ingredient, and a breast cancer diagnostic kit using the same.

1 is a diagram showing the results of measuring the concentration of peroxyredoxin I transcription in a 96-well HMRT qPCR array in 48 different human normal tissues selected from individuals of different races.

FIG. 2 shows the results of measurement of the transcriptional concentrations of peroxyredoxin I-VI using 96-well HMRT qPCR arrays in eight human normal tissues (breast, colon, kidney, liver, lung, ovary, prostate and thyroid gland). The figure shown.

3 is a diagram showing the results of measuring mRNA levels of peroxyredoxin I-VI using CSRT 96-I array in eight solid cancers (breast, colon, kidney, liver, lung, ovary, prostate, and thyroid gland). .

Figure 4 is a diagram showing the mRNA concentration (A) and the induced fold (B) obtained from the peroxyredoxin I-VI in breast cancer tissue.

5 is a scatter plot showing the induction fold of peroxyredoxin I mRNA expression in human breast cancer tissue (A), showing the relationship between the mRNA expression of peroxyredoxin I and the progression of cancer. mRNA expression of peroxyredoxin I in human breast cancer tissues (B), and further refined cancer progression (I, IIA, IIB, IIIA, IIIB, IIIC, and IV) as indicated by the and-whisker plot) Is a diagram showing an induction multiple (C) of.

Figure 6 is a diagram observing the degree of expression of peroxyredoxin I protein in human breast cancer tissue by Western blot analysis.

7 is a diagram illustrating Western blot expression of peroxyredoxin I protein in samples of 4 normal tissues and 4 cancer tissues from other individuals.

8 shows the expression level of peroxyredoxin I protein in a pair of breast cancer tissues (a pair of normal and primary cancers from the same individual; a pair of primary and metastatic cancers from the same individual) and a pair of other cancer tissues (lung and colon). Figures observed through Western blot.

The present invention provides a marker for diagnosing breast cancer using peroxyredoxin I as an active ingredient.

The present invention also provides a breast cancer diagnostic kit comprising an antibody that specifically binds to peroxyredoxin I.

The present invention also provides a method for detecting peroxyredoxin I in breast tissue through an antigen-antibody binding reaction using an antibody that specifically binds to breast cancer marker peroxyredoxin I.

Hereinafter, the present invention will be described in detail.

As a result of observing the expression level of peroxyredoxin I according to the present invention through qRT-PCR and Western blot in human normal tissue and human cancer tissue, peroxyredoxin I was the lowest in breast tissue among 48 human normal tissues. Expressed in breast cancer tissues. In addition, the higher the cancer progression, the higher the induced fold of the mRNA expression of peroxyredoxin I. The induced fold of the mRNA expression of peroxyredoxin I was associated with metastatic breast cancer of stage II to IV breast cancer, especially stage IV cancer. There is a close connection. In addition, since the induced fold of mRNA expression of peroxyredoxin I increases with the progression of cancer, it can be seen that the induced fold of mRNA expression of peroxyredoxin I is associated with cancer segmentation.

As described above, the peroxyredoxin I according to the present invention can be used as a marker for diagnosing breast cancer since it is overexpressed in human breast cancer tissues and can predict the diagnosis or prognosis of breast cancer early.

In addition, a breast cancer diagnostic kit including an antibody that specifically binds to peroxyredoxin I of the present invention can be easily prepared by a manufacturing method commonly used in the art using the marker.

The breast cancer diagnostic kit includes an antibody that specifically binds to peroxyredoxin I, a secondary antibody conjugate conjugated with a label that develops by reaction with a substrate, a color substrate solution that will react with the label, and a wash solution. And enzymatic stop solutions.

The label of the secondary antibody conjugate is preferably a conventional coloring agent that performs a color reaction. isothiocyanate, fluorescent materials such as rhodamine-B-isothiocyanate (RITC), dyes, and the like.

The chromogenic substrate solution is preferably used according to the label, TMB (3,3 ', 5,5'-tetramethyl bezidine), ABTS [2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid )], OPD (o-phenylenediamine) and the like can be used. At this time, the color development substrate is more preferably provided in a dissolved state in a buffer solution (0.1M NaOAc, pH 5.5).

The wash preferably comprises phosphate buffer, NaCl and Tween 20, more preferably a buffer consisting of 0.02M phosphate buffer, 0.13M NaCl, and 0.05% Tween 20 (PBST). After washing the antigen-antibody binding reaction, the washing solution is reacted with the secondary antibody to the antigen-antibody conjugate, and then washed 3 to 6 times by adding an appropriate amount to the fixed body. As the reaction terminating solution, sulfuric acid solution may be used.

In addition, the present invention detects peroxyredoxin I in breast tissue through an antigen-antibody binding reaction using an antibody that specifically binds to breast cancer marker peroxyredoxin I, thereby predicting the diagnosis or prognosis of breast cancer early. Can be. Specifically, peroxyredoxin I was fractionated by electrophoresis on SDS-PAGE, transferred to immobilized and immobilized, and then antibody-specific binding to immobilized peroxyredoxin I was added to perform antigen-antibody binding reaction. The expression level of peroxyredoxin I is measured. That is, the expression level of peroxyredoxin I in breast cancer tissue is measured by measuring the expression level of peroxyredoxin I in breast cancer tissue and comparing the measured expression level with the expression level of peroxyredoxin I in normal breast tissue. If the level is higher than the expression level of peroxyredoxin I in normal breast tissue, it is either diagnosed as having breast cancer or predicted to have the potential for breast cancer.

The expression level of peroxyredoxin I is higher in stage II to IV breast cancer tissues than in stage I breast cancer tissues or normal breast tissues.

As the fixture for the antigen-antibody coupling reaction, a nitrocellulose membrane, a polyvinylidene difluoride membrane (PVDF) membrane, a 96 well plate synthesized with polyvinyl resin or polystyrene resin, glass slide glass, or the like may be used.

The antigen-antibody binding reaction is conventional enzyme immunoassay (ELISA), radioimmunoassay (RIIA), sandwich assay, Western blot, immunoprecipitation, immunohistochemical staining, fluorescence immunoassay It can be measured using a method such as enzyme substrate coloration, antigen-antibody aggregation.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the examples.

Example 1  : qRT-PCR Analysis

In order to characterize the expression profile of the human target gene, the following reaction was carried out using a quantitative real-time polymerase chain reaction (qRT-PCR) array.

Human major 48 tissue real-time (HMRT) qPCR arrays from OriGene, Cancer Survey real-time (CSRT 96-I) qPCR arrays, and human breast cancer real-time (BCRT IV) qPCR arrays (OriGene Technologies, Inc, Rockville, MD, USA). Simultaneous measurement of target gene expression in 48 different tissues was performed using an HMRT array consisting of a panel of first strand cDNAs from human tissues selected from individuals of different races. CSRT array of 12 samples from each cancer type with cancers from stages I to IV in eight different cancers (breast, colon, kidney, liver, lung, ovary, prostate and thyroid) Measured using. The expression of target genes in breast cancer was measured using 4 different sets of arrays (BCRT I-IV) for 192 samples and CSRT 96-I array for 12 samples. In 204 samples, cancer progression was classified as follows: stage 0 (normal), 19; I, 37; Group II, 76; Group III, 60; And stage IV, 12. Cancer tissue types include ductal, n = 154, lobular, including medullary, mucinous, tubular, recurrent, and papillary. , n = 13), metastatic ( n = 12) and other histological types of cancer ( n = 25). The clinicopathological information of each patient is listed in the OriGene's product table.

Using iCycler (Bio-Rad Laboratories, Hercules, CA, USA) with primers specific for Prx I-VI, β-actin, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and iQ SYBR Green Supermix (Bio-Rad) PCR was performed on 96-well optical plates. Fluorescence proportional to the amount of DNA amplified was measured at the end of each elongation phase at 530 nm. Standard graphs of C _T (points of fluorescence across the incidence) obtained from a series of diluted target genes were constructed for all reactions so that they were amplified and recorded proportionally to the template. The C _T value was converted to the gene copy number of the template cDNA using the equation 2 ^ΔΔCT . ΔC _T is a large amount of cDNA for transcription of each gene normalized to β-actin and GAPDH at each time point. ΔΔC _T is obtained by subtracting each gene transcription measurement value analyzed. Simultaneously with each cDNA sample, a series of dilutions of the target genes were used to correlate the C _T values to form a standard curve. The characteristics of the standard curve were evaluated from slope and correlation coefficient. Quantification was performed by comparing the fluorescence of unknown concentrations of PCR products with the fluorescence of various dilutions. Melting curve analysis was used for product verification. Primers of β-actin and GAPDH were supplied from Origene. The sequences of the different primers are shown in Table 1 below.

Table 1 Sequence of RT-PCR Amplification Primer

primer	direction	Primer Sequence (5 '->3')
Human Peroxyredoxin I (Prx I)	Forward direction	tttggtatcagacccgaagc
	Reverse	tccccatgtttgtcagtgaa
Human Peroxyredoxin II (Prx II)	Forward direction	ccagacgcttgtctgaggat
	Reverse	acgttgggcttaatcgtgtc
Human Peroxyredoxin III (Prx III)	Forward direction	gttgtcgcagtctcagtgga
	Reverse	gacgctcaaatgcttgatga
Human Peroxyredoxin IV (Prx IV)	Forward direction	cagctgtgatcgatggagaa
	Reverse	taatccaggccaaatgggta
Human Peroxyredoxin V (Prx V)	Forward direction	ccctggatgttccaagacac
	Reverse	aagatggacaccagcgaatc
Human Peroxyredoxin VI (Prx VI)	Forward direction	cgtgtggtgtttgtttttgg
	Reverse	tcttcttcagggatggttgg

1-1. Transcriptional Concentrations of Peroxyredoxin I in 48 Different Human Normal Tissues

Transcription concentrations of peroxyredoxin I in 48 different human normal tissues selected from individuals of different races were measured using a 96-well HMRT qPCR array and the results are shown in FIG. 1.

As shown in FIG. 1, the transcription concentration of peroxyredoxin I was the lowest expressed in breast tissue among the 48 human major normal tissues (0.65 × 10 ⁻⁴ pg).

1-2. Transcription levels of peroxyredoxin I-VI in eight human normal tissues (breast, colon, kidney, liver, lung, ovary, prostate, and thyroid gland)

In eight human normal tissues (breast, colon, kidney, liver, lung, ovary, prostate and thyroid gland) to determine whether low expression of peroxyredoxin I in human breast tissue is specific to peroxyredoxin I MRNA concentrations of peroxyredoxin I-VI were measured using the same 96-well HMRT qPCR array.

The results are shown in FIG.

As shown in FIG. 2, the expression profile of peroxyredoxin I-VI is lowest in breast tissue than in other human normal tissues, such that the lower expression of peroxyredoxin I in human breast tissue is It was confirmed that not specific only.

1-3. MRNA Concentrations of Peroxyredoxin I-VI in Human Solid Cancer Tissues

MRNA concentrations of peroxyredoxin I-VI were measured using CSRT 96-I arrays in eight solid cancers (breast, colon, kidney, liver, lung, ovary, prostate and thyroid).

The results are shown in FIG.

As shown in FIG. 3, the expression profile of peroxyredoxin I was the highest in breast cancer tissue among the eight solid cancers (9.12 ± 1.86), and the expression profile of peroxyredoxin II to VI was significantly different from other cancer tissues. There was no difference.

1-4. MRNA Concentrations of Peroxyredoxin I-VI in Human Breast Cancer Tissues

To confirm the expression profile of peroxyredoxin I in breast cancer tissues, mRNA concentrations of peroxyredoxin I-VI were measured in breast cancer tissues using a 48-well BCRT II array. Induced folds were obtained from the mRNA concentrations of peroxyredoxin I-VI.

MRNA concentrations of peroxyredoxin I-VI (A) and induced folds (B) obtained from breast cancer tissues are shown in FIG. 4.

As shown in FIG. 4, mRNA levels of peroxyredoxin I-VI were low in normal breast tissues, but mRNA concentrations of peroxyredoxin I and II were 8.11 ± 1.58 x 10 ^-4 pg in breast cancer tissues, respectively. , 10.53 ± 1.33 x 10 ^-4 pg and mRNA levels of peroxyredoxin III-VI were very low (A). In addition, the induced fold of mRNA in breast cancer tissue was confirmed that the highest expression of peroxyredoxin I (8.64 ± 1.40) (B).

1-5. Relationship between progression of human breast cancer and peroxyredoxin I

To assess the association between breast cancer progression and peroxyredoxin I, mRNA expression levels in five different sets of qRT-PCR [Cancer Survey real-time] were evaluated in 204 samples of normal and malignant breast tissues in the 0-IV range. (CSRT 96-I) qPCR array (n = 9), and human breast cancer real-time (BCRT IV) qPCR arrays I-V (n = 176)], from normal (stage 0) to malignant (I, II). , Ⅲ, Ⅳ) were measured induction fold up to.

Scattered plot of the induction fold of mRNA expression of peroxyredoxin I in human breast cancer tissues (A). Box-and-whisker shows the relationship between peroxyredoxin I mRNA expression and cancer progression. Induced folds of mRNA expression of peroxyredoxin I in human breast cancer tissues (B), and further refined cancer progression (phases I, IIA, IIB, IIIA, IIIB, IIIC, and IV) (C) is shown in FIG.

As shown in FIG. 5, doubling overexpression of peroxyredoxin I occurred in 181 of 185 cases (97.8%) and induced fold was 7.90 ± 0.45 in breast cancer tissues (A). In addition, the higher the cancer progression, the higher the induced fold of the mRNA expression of peroxyredoxin I. The induced fold of the mRNA expression of peroxyredoxin I was higher than that of metastatic cancer of stage II-IV breast cancer, especially stage IV cancer. There is a close correlation (B). In addition, since the induced fold of mRNA expression of peroxyredoxin I increases with the progression of cancer, it can be seen that the induced fold of mRNA expression of peroxyredoxin I is associated with cancer segmentation (P = 0.0181) (C).

Example 2  : Western-Blot Analysis

In order to determine the expression level of peroxyredoxin I protein in human breast cancer tissues, the following experiment was performed through Western blot analysis.

Total membranes and soluble proteins from clinically defined human cancer and normal tissues were obtained from Capital Biosciences (Gaithersburg, MD, USA). For immunological analysis, proteins from other individuals and coordinated pairs (normal tissue and primary cancer; primary and metastatic cancer) were used. The clinicopathological features of cancer tissues are shown in Table 2 below.

Total membranes and soluble protein lysates (15 μg) were loaded from 7 isolated cancer tissues (brain, breast, colon, kidney, liver, lung and ovary) into reductive and non-reducing SDS-PAGE and subjected to Amersham ECL Western blotting system ( Western blot was performed using GE Healthcare, Chalfont St. Giles, United Kingdom. Anti-peroxyredoxin I, anti-peroxyredoxin II and anti-Cu / Zn superoxide dismutase (SOD) rabbit polyclonal antibodies with cross-reactivity with the corresponding human protein are AbFrontier (Seoul). , Korea). Samples were electrophoresed on 4-20% gradient SDS-PAGE (GenScript Corp, Piscataway, NJ, USA) and transferred to PVDF membrane (polyvinylidene difluoride membrane). The membrane was blocked and incubated with antibody (volume ratio 1: 1000) at room temperature for 2 hours in PBS containing 0.1% Tween 20. After washing several times, the membrane was incubated with polyclonal goat anti-rabbit IgG antibody (1: 2000 by volume) bound with horseradish peroxidase (HRP). The membrane was then washed with PBS and a chemiluminescent substrate was added. For validation of loading samples, membranes were stained with Coomassie Blue R-250.

TABLE 2

The results are shown in FIG.

As shown in FIG. 6, peroxyredoxin I protein was highest expressed in human breast cancer tissues (A). Western blot analysis of human breast cancer tissue samples showed a band at approximately 40 kDa (B). The band in the reducing gel has shifted completely to higher molecular weight forms, suggesting that the 40 kDa band represents the dimer form of peroxyredoxin I.

2-1. Determination of Peroxyredoxin I Protein Expression in Human Normal and Cancerous Tissues

The expression level of peroxyredoxin I protein in samples of 4 normal tissues and 4 cancer tissues from other individuals was measured by Western blot.

The results are shown in FIG.

As shown in Figure 7, it was confirmed that the peroxyredoxin I protein is overexpressed in breast cancer tissue.

2-2. Determination of Peroxyredoxin I Protein Expression in Pairs of Breast Cancer Tissues and Pairs of Other Cancer Tissues (Lungs and Colon)

Western blot expression of peroxyredoxin I protein expression in pairs of breast cancer tissues (pairs of normal and primary cancers from the same individual; pairs of primary and metastatic cancers from the same individual) and pairs of other cancer tissues (lung and colon) Measured. Cu / Zn SOD was used as a positive control.

The results are shown in FIG.

As shown in Figure 8, it was confirmed that the peroxyredoxin I protein is overexpressed in breast cancer tissue. Similarly, peroxyredoxin II protein was overexpressed in breast cancer tissues, but the concentration of peroxyredoxin II protein in normal tissues was higher than peroxyredoxin I in normal tissues.

Since peroxyredoxin I according to the present invention is overexpressed in human breast cancer tissue and can predict the diagnosis or prognosis of breast cancer early, it can be usefully used as a marker for diagnosing breast cancer.

Claims (7)

1. A marker for diagnosing breast cancer using peroxyredoxin I as an active ingredient.
2. The marker according to claim 1, wherein the marker is specific for stage II to IV breast cancer.
3. A breast cancer diagnostic kit comprising an antibody that specifically binds to peroxyredoxin I.
4. A method for detecting peroxyredoxin I in breast tissue through an antigen-antibody binding reaction using an antibody that specifically binds to breast cancer marker peroxyredoxin I.
5. 5. The method of claim 4, wherein the peroxyredoxin I is expressed more in stage II to IV breast cancer tissues than in stage I breast cancer tissues or normal breast tissues.
6. 1) measuring the expression level of peroxyredoxin I in breast cancer tissue; And

   2) comparing the measured expression level with the expression level in normal breast tissue, and if the expression level of peroxyredoxin I in breast cancer tissue is higher than the expression level of peroxyredoxin I in normal breast tissue, A method of predicting the diagnosis or prognosis of breast cancer using the marker of claim 1, comprising the step of diagnosing or predicting the likelihood of having breast cancer.
7. 7. The diagnosis or prognosis of breast cancer using the marker of claim 1, wherein the expression level of peroxyredoxin I is higher in stage II to IV breast cancer tissues than in stage I breast cancer tissues or normal breast tissues. Method of prediction.

Images