WO2010097419A1

WO2010097419A1 - Conditionally replicating adenovirus effective in the treatment of tumors

Info

Publication number: WO2010097419A1
Application number: PCT/EP2010/052358
Authority: WO
Inventors: Cristina Fillat Fonts; Meritxell Huch Ortega
Original assignee: Fundació Privada Centre De Regulació Genòmica (Crg)
Priority date: 2009-02-25
Filing date: 2010-02-24
Publication date: 2010-09-02

Abstract

The conditionally replicating adenovirus contains a promoter of the urokinase- type plasminogen activator receptor (uPAR) or a fragment thereof, said promoter or fragment regulating the expression of a gene responsible for viral replication. Said adenovirus may be used in the treatment of cancer and, in particular, pancreatic cancer.

Description

Conditionally replicating adenovirus effective in the treatment of tumors

The present invention relates to molecular biology, tumor biology and medicine. In particular, the present invention relates to a conditionally replicating adenovirus that is tumor-cell selective.

BACKGROUND ART

Cancer is a disease in which the body produces an excess of malignant cells (known as carcinogenic or cancerous), with growth and division beyond normal limits, invasion of adjoining tissues and, sometimes, metastasis. Metastasis is the spreading of cells that cause cancer, mainly via lymphatic or blood vessels, and the growth of new tumors in the destination sites of said metastasis.

Cancer can affect any age group, including foetuses, but the risk of suffering the most common types increases with age. Cancer causes approximately 13% of all deaths. According to the American Cancer Society, 7.6 million people died of cancer worldwide in 2007.

Many cancers can be treated and some cured, depending on the type, location and stage or phase of development. Once detected, it is treated with the appropriate combination of surgery, chemotherapy and radiotherapy. Based on latest research, treatments are specified according to the type of cancer, and recently, also to the type of patient.

Pancreatic cancer is one of the most aggressive and devastating types of cancer in developed countries. The overall survival rate is less than 4%, and most patients die within the first year after diagnosis, due to the tumor's rapid spreading and metastatic dissemination.

Located above the abdomen, in the retroperitoneum, the pancreas is closely related to many of the body's main structures, including the portal vein, the stomach, the duodenum, the bile duct and the superior mesenteric artery.

As the tumor grows, the patient's symptoms are the result of the tumor's infiltration in the surrounding structure, causing pain, nausea, vomiting, weight loss and jaundice. Once the tumor's infiltration has taken place, other structures such as the portal vein are affected.

Since a pancreatic carcinoma is asymptomatic in its initial stage, it is usually diagnosed (in most cases with the appearance of any of the symptoms indicated above) in an advanced stage of the disease. A late diagnosis has serious consequences, since an expansion to metastasis of the liver or lymph nodes has been observed in 60% of the diagnosed patients, this factor reducing the patient's mean life expectancy.

Effective treatments for pancreatic cancer must achieve two goals: to control the primary tumor mass, both initially and subsequently, and to treat the metastatic tumor cells.

Current therapies for this d ifficu It-to-treat disease include surgery and/or chemotherapy and radiotherapy. Often the tumor cannot be surgically removed, either because it has invaded vital structures that cannot be extracted or because it has spread to separate organs.

Patients with advanced pancreatic cancer are mainly treated using chemotherapy. The aim of said chemotherapy is to prolong the patient's survival. Surgery and irradiation are used to relieve pain, as well as to reduce the obstruction of the organs.

Another aspect limiting the effectiveness of current therapies is that the tumor cells of the pancreas are highly resistant to both chemotherapy and radiotherapy treatments.

At present, the main objective is to develop a safe and effective treatment for pancreatic cancer, based on the identification of selective therapeutic agents with a potent effect, on both primary tumors and metastatic tumors, and which exhibit low toxicity when systemically administered.

Recently, therapy using conditionally replicating adenoviruses based on viral replication restricted to carcinogenic cells has emerged as a promising candidate for cancer treatment. Adenoviruses are non-enveloped viruses having an icosahedral shape. The capsid comprises of 252 capsomeres of which 240 are hexons and 12 are pentons. The replicating cycle of the adenovirus is divided into the early phase (E) and the late phase (L). The late phase defines the onset of viral DNA replication. Following infection, the DNA and the protein synthesis of the host are inhibited in the infected cells. The lytic cycle of the adenovirus is effective, especially for those of serotypes 2 and 5, and results in the production of approximately 10,000 virions per cell and in the excessive synthesis of viral protein and DNA that are not incorporated in the virion.

Clinical studies in phases l/ll studying the oncolytic efficicacy of ONYX-015 (modified adenovirus) have not shown significant toxicity following intravenous infusion (cf., Nemunaitis J. et al., 2007) but have shown a partial therapeutic benefit when the virus is administered intratumorally to pancreatic tumors (cf. Hecht J. R. et al., 2003).

In order to achieve tumor selectivity, several specific promoters of pancreatic cancer have been assessed.

In this regard, US 2005/0260643 lists a series of promoters candidate to be specific for pancreatic cancer. From those tested promoters, the research group from said application chose the CCKAR promoter since it was the only one that demonstrated optimum activity and specificity.

Despite efforts to develop new therapies, pancreatic cancer continues to be difficult to treat effectively. Consequently, there is still a need for improved therapies that are effective in treating primary and metastatic pancreatic cancer. SUMMARY OF THE INVENTION

The inventors of the present invention have developed a conditionally replicating adenovirus that includes, as promoter for the expression of an autologous gene of the adenovirus, the promoter of the gene encoding for the urokinase-type plasminogen activator receptor (hereinafter referred to as "uPAR") or a fragment thereof.

Surprisingly, the inventors have confirmed that when the adenovirus of the invention is administered intravenously, the promoter, or promoter fragment, of the uPAR gene selectively targets the conditionally replicating adenovirus towards primary pancreatic tumors or their metastases. As it is shown below, the inclusion of uPAR promoter (or fragment thereof) confers high tumor- selectivity to a replication-defective adenovirus which includes, as reporter gene, the luciferase gene (this construction, i.e., the replication-defective adenovirus plus the uPAR promoter plus the luciferase gene is referred hereinafter as "AduPARLuc"). In said assay the uPAR fragment promoter is included into the adenovirus in such a way that it regulates the expression of the luciferase gene. Performing said assay, the inventors of the present application have found that whereas luciferase activity is almost not detected in normal tissues(which means that the uPAR promoter is almost inactivated in normal tissues), in models of pancreatic tumor and liver metastases resulting from pancreatic tumors the luciferase activity is very high (which means that uPAR promoter is highly activated). Therefore, the results obtained are indicative of that uPAR promoter is activated by pancreatic cancer primary and metastatic cells and not by normal cells, which, consequently, is indicative of the selectivity of uPAR promoter for cancer cells.

Additional evidences of the selectivity of the uPAR promoter are shown in FIG 8, where elevated luciferase expression is detected in pancreatic tumors receiving AduPARLuc adenovirus through the common bile duct using the technique of Taniguchi et al. (Taniguchi, H et al., 2003) whereas negligible expression is detected in normal pancreas.

Advantageously, the fact that the adenovirus carrying the uPAR promoter shows a very limited replication in non-tumoral tissues allows it to be systemically administered with minimal side effects in the recipient. Furthermore, the researchers of the present invention have verified that the presence of the uPAR promoter in the adenoviral genome does not negatively affect the oncolytic activity of the adenovirus. As it is explained in more detail below, the inventors compared the anti-tumoral effect of a conditionally replicating adenovirus expressing E1 A under the control of a uPAR promoter fragment (said construct hereinafter also referred as "AduPAREI A") with the one achieved by the serotype 5 wild-type adenovirus (hereinafter also referred as "Adwt"). From the results shown in FIG. 4B, it can be concluded that the adenovirus bearing the uPAR promoter is as potent as Adwt in vivo. Therefore, it can be concluded that when uPAR promoter is included in the adenoviral genome, it does not negatively affect to the oncolytic activity of the adenovirus.

Thus, a first aspect of the present invention relates to a conditionally replicating adenovirus which contains a promoter, or promoter fragment, of the gene encoding the urokinase-type plasminogen activator receptor (uPAR), said promoter, or fragment, regulating the expression of a gene responsible for the viral replication.

Patent application US2005/0260643 disclosed, among others, uPAR as a pancreas-specific candidate promoter. In order to analyse how specific and effective the various candidate promoters were, liposomal complexes containing the candidate promoter and the luciferase gene were formulated. The results obtained are summarised in Figure 9A of said application. Said Figure shows that the activity/expression of the liposomal complex that included the uPAR promoter presented the worst profile of all the tested promoters, being the signal due to luciferase practically null. From the results obtained, the researchers concluded that the CCKAR promoter was the appropriate promoter to effectively carry out the specific expression of a therapeutic gene (the Bik gene) in pancreatic cancer cells. However, in order to achieve said promoter giving similar activity results to those achieved with the CMV promoter, they had to make changes to the sequence of said promoter.

It is known by the person skilled in the art that tissue-specific promoters must fulfil two requirements: to be specific and to be sufficiently potent to promote the expression of the desired gene. On the other hand, the state of the art has clearly established that when the skilled person in the art considers the possibility of using an adenovirus that includes a tissue-specific promoter for therapy, tumoral tissue-selectivity and activity of said promoter are altered (i.e. diminish) due to the effect of the autologous regulatory sequences present in the adenoviral genome.

Despite the teachings of application US2005/0260643 and of existing knowledge in the state of the art, the inventors of the present invention have found that an adenovirus that includes the uPAR promoter, or a fragment thereof, manages to reach and act specifically on the cells of pancreatic cancer (see, for example, the results of FIG. 1 (C) below). It is remarkable that the activity achieved using uPAR as promoter is similar to that achieved with the cytomegalovirus promoter (the latter being used as a reference for being a very potent promoter and ubiquitously active), not requiring additional modifications in the sequence of the uPAR promoter.

As it is illustrated below, the adenovirus of the invention administered intravenously shows a specificity for the tumor 100 times greater than for normal tissue and, in consequence, also lower toxicity". Other noteworthy aspects of the adenovirus of the present invention are: (a) that the regulation of the autologous genes of the adenovirus by the action of uPAR promoter does not affect the oncolytic activity of the virus; (b) that the anti-tumoral activity is significant; (c) that it prolongs the survival time of pancreatic tumor xenograft models (p<0.0001 ); and (d) that it eradicates liver metastasis in 33% of the cases studied (p=5.43x10^"5).

The results included in the present application show that pancreatic tumor cells activate the uPAR promoter, giving rise to the oncolytic activity of the adenovirus. As it is well-known in the state of the art, pancreatic cancer, but not only, has been related to the over-expression of uPAR. Without being bound to the theory, the inventors believed that the adenovirus of the invention including the uPAR promoter, can be useful in the treatment of other types of tumors associated to the over expression of uPAR such as, for example, glyomas and breast cancer, among others.

In order to support the use of conditionally replicating adenovirus carrying the uPAR promoter (or a fragment thereof) in other types of cancer, the inventors performed an assay with an hypoxia model. Hypoxia, a reduction in partial pressure of O2, is an integral component of the tumor microenvironment that develops in most solid tumors regardless of their origin, location or genetic alterations (cf. Brown J. M., 2000). The results shown in FIG. 8 are indicative of uPAR promoter activation under hypoxia conditions. Said results support the generalized antitumor activity of the uPAR-controlled adenovirus of the first aspect of the invention.

The adenovirus including the uPAR promoter, or a fragment thereof, of the present invention represents therefore, an enormous progress in the treatment of cancer, and in particular, of pancreatic cancer and its resulting metastases.

Thus, a second aspect of the present invention relates to an adenovirus as defined in the first aspect of the invention, for use as a medicament. This aspect can be reformulated as a method for treating a disease which comprises the administration of an adenovirus as defined in the first aspect of the invention.

As it has been discussed above and it is illustrated below, the construct of the invention is effective both in the treatment of primary pancreatic cancer and in a metastatic stage. With regards to the latter, the fact that the construct of the invention treats liver metastases resulting from a pancreatic cancer should be highlighted. The presence of the uPAR promoter confers to the adenovirus high selectivity to tumoral cells without negatively affecting the adenoviral oncolytic activity.

Therefore, in a third aspect the present invention provides the use of uPAR promoter, or a fragment thereof, for targeting a conditionally replicating adenovirus to a cancer cell.

In a fourth aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of the adenovirus as defined in the first aspect of the invention, together with pharmaceutically acceptable carriers and/or diluents.

Throughout this description and the claims, the word "comprises" and its variants do not intend to exclude other technical characteristics, additives, components or steps. For the skilled in the art, other objects, benefits and characteristics of the invention may be inferred partly from the description and partly from the practice of the invention. The following examples and drawings are provided by way of illustration and are not intended to limit the present invention in any way.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the activity of the uPAR promoter on pancreatic cancer cell lines and tumors. (A) shows the expression of uPAR in pancreatic cancer cells and in non-tumoral cells. Using a semi-quantitative RT-PCR analysis, the expression of the uPAR gene was analysed on 5 pancreatic cancer lines, and on HPDE cells derived from the epithelium of a normal pancreas. Two different transcripts were detected corresponding to the entire form (534 bp fragment) and to a variant that is lacking one of the L6/uPAR/α-neurotoxin domains of the receptor (400 bp fragment); (B) A total of 20,000 cells/well of the pancreatic cancer cell lines (RWP1 , BxPC-3, NP-31 , NP-9, A549, MCF-7 and U-2 OS) and of normal HPDE and IMR-90 cell lines were plated in triplicate. Then they were infected with AduPARLuc o AdCMVGFPLuc at 10⁴ vp/cell. Luciferase activity was quantified 72 h after viral transduction and quantified by total protein levels. From the results obtained the uPAR/CMV ratio to RWP- 1 cells was determined. The values represent the mean ± SEM of 3 or 4 independent experiments. ^*p<0.05. (C) 3x10⁶ BxPC-3 cells were injected subcutaneously (hereinafter "SC") into the posterior flanks of nude mice. When tumors reached 100 mm³ they were randomised and injected intratumorally with a single dose of 2.5x10¹⁰ vp AdCMVGFPLuc (n=9) (white bar) or AduPARLuc (n=10) (grey bar). It is shown the quantification of bioluminescent emission from mice treated with AdCMVGFPLuc or AduPARLuc at days 3, 6 and 10 after viral injection. The results are expressed as photons per second. The values represent the mean ± SEM. ^*p=0.03.

FIG. 2 shows uPAR promoter activity based on the tumor-to-liver ratio. 3x10⁶ BxPC-3 cells (A and C) or 2.5x10⁶ PANC-1 cells (B and D) were inoculated SC into the posterior flanks of nude mice. Once tumors were established 5 x 10¹⁰ vp of AdCMVGFPLuc (n=4 mice; n=8 tumors) or AduPARLuc (n=4 mice; n=8 tumors) or 0.9 % NaCI saline solution (n=2 mice; n=4 tumors) were injected IV. The mice were killed 5 days after viral injection and tumor and liver cell extracts were obtained wherein luciferase activity was determined in the liver (white bar) and in the tumor (black bar) (panels (A) and (B)). Luciferase activity from the saline group was used as reaction blank. The results are expressed in RLU (RLU= light units per milligram of tissue (LU/mg)). Values represent the mean ± SEM. ^** p<0.01 ; ^***p<0.001. (C and D) show the tumor-to-liver ratio. Values represent the mean ± SEM of tumor RLU relative to liver RLU, when AdCMVGFPLuc (white bar) is administered and when AduPARLuc (grey bar) is administered. ^** p<0.01

FIG. 3 shows the results of AduPARLuc biodisthbution studies. BALB/c nude mice (i.e., immunodepressed mice, Charles River) were injected intravenously (hereinafter also referred as "IV") with 0.9 % NaCI saline solution (n=3), 2x10¹⁰ vp AdCMVGFPLuc (n=4) (white bar) or 2x10¹⁰ vp AduPARLuc (n=5) (dark bar). At day 50 the animals were killed and the different organs were collected. Luciferase activity was determined and the concentration of total protein was quantified (BCA Protein Assay kit (Pierce)). The luciferase value from the saline group was used as reaction blank. The results are expressed in RLU. Values correspond to the mean ± SEM. ^** p<0.01

FIG. 4 shows the anti-tumoral effect of AduPAREIA in pancreatic tumor cells RWP1 , PANC-1 , NP-18, BxPC-3 and in BxPC-3 xenografts. (A) A total of 3x10³ cells/well were plated in triplicate and infected with a dose range from 0 to 10 MOI ("Multiplicity of Infection" defined as the number of viral particles/cell) of Adwt or AduPAREIA. 4 days later, cell viability was determined by MTT (USB) assay, following the manufacturer's instructions, and the data were expressed as the percentage of absorbance of treated cells against those not treated. Dose-response curves were represented ((i), (ii), (iii) and (iv)) and the value of ID₅₀ was calculated by a nonlinear model based on the Hill equation. Values are presented as the mean ± SEM of 3 independent experiments. -•-, Adwt ; -Δ-, AduPAREIA. (i) results obtained with the RWP1 cell line; (ii) results obtained with the PANC-1 cell line, (iii) results obtained with the BxPC-3 line, (iv) results obtained with the NP-18 cell line. (B) Animals with BxPC-3 SC tumors were randomised to four groups: 2 control groups: saline (n=11 tumors) and AdV (n=11 tumors) and 2 treated groups: Adwt (n=12 tumors) and AduPAREIA (n=12 tumors). An intratumoral injection of 10⁷ pfu /tumor was given at days 6 and 14 after tumor inoculation. Tumor growth curves are represented as the tumor volume mean ± SEM. ^***p<0.0001. (C) Kaplan-Meier survival curves (log-rank test < 0.0001 ) obtained using SPSS software (SYSTAT Software, Inc., Chicago, IL). (A = saline; ■= Adv; •= Adwt; and *= AduPAREIA).

FIG. 5 corresponds to representative images of luciferase expression in liver parenchyma (upper panel, (a), (b), (c)) and in tumor areas (d,e,f) (lower panel) of animals injected with AdCMVGFPLuc, AduPARLuc or saline. Upper panel at a scale of 200 μm, enlargements at 100 μm. Lower panel at a scale of 50 μm, magnifications at 20 μm.

FIG. 6 shows the anti-tumoral effect of AduPAREIA in PANC-1 -Luc tumor metastases. PANC-1 -Luc cells were intrasplenically injected into BALB/c mice. Six days after tumor implantation luciferase activity was measured (day 0). At the following day, the animals were injected with a single dose of 0.9 % NaCI saline solution (n=10), AduPAREIA at 10¹⁰ vp/animal (n=8) or AduPAREIA at 5x10¹⁰ vp/ animal (n=10) in a Vfinal= 0.2 ml_. (A) Quantification of bioluminescence at day 7 relative to day 0. ^** p=0.005; ^* p= 0.02. White bar = AduPAREIA 10¹⁰ vp/animal; black bar = saline; and grey bar = AduPAREIA 5x10¹⁰ vp/animal; (B) Representative images of livers obtained 21 days after treatment. Tumor nodules and obstruction of the bile duct can be observed in the group injected with 0.9 % NaCI saline solution (arrows, left panel). Normal bile ducts in animals treated with AduPAREIA 5x10¹⁰ (arrow, right panel). Scale 1.7 cm. (C) Kaplan-Meier survival curves. AduPAREIA 10¹⁰ vp versus saline log-rank test = 0.003; AduPAREIA 5x10¹⁰ vp versus saline log-rank test = 5.43x10^"5. (•= saline; ^*= AduPAREIA 5x10¹⁰; ■= AduPAREIA 10¹⁰).

FIG. 7 shows the results of AduPAREIA toxicity studies. BALB/c immunocompetent mice (Charles-River) received an IV injection of 0.9 % NaCI saline solution (n=6) or 5x10¹⁰ vp of Adwt (n=6) or 5x10¹⁰ vp of

AduPAREIA. Five days later blood samples were collected. Next, the animals were killed, and the liver excised and frozen in a specific medium for freezing tissues, OCT (Tissue Tek4583, Bayer SA) or fixed and embedded in paraffin moulds. (A) E1A expression in the liver. The nuclei were stained with Hoescht dye. Scale 100 μm. (B) Staining with H&E. Areas of necrosis and swollen hepatocytes (arrows). Scale 1.3 cm. (C) Determination of aspartate transaminase (AST) and bilirubin.^* p<0.05. (white bar = results obtained with Adwt; grey bar = results obtained with AduPAREIA; black bar = results obtained with saline solution).

FIG.8 illustrates uPAR promoter activity in RWP1 and MIAPaCa-2 pancreatic cancer cells in response to hypoxia. (A) Scheme of the uPARpLuc and uPARpLucmut415 constructs. (B) Western blot showing HIF-1 α induction in RWP-1 cells exposed to hypoxia (1 % O2) for 16h. Tubulin was included as a control of equal loading, in order to confirm that the assay was correctly performed (C) RWP1 cells were transfected with the uPARpLuc (black bar) construct or the uPARpmut415 (white bar) construct and exposed to hypoxic (1 % O2) or normoxic (21 % O2) conditions for 16h. Luciferase activity was measured 36h post-transfection. Values were normalized to luciferase activity under normoxic conditions and expressed as fold change. Results are expressed as the mean ± SEM of two independent experiments. (D) MIAPaCa-2 cells were transduced with the adenovirus AduPARLuc and exposed to hypoxia (1 % O2) (-0-) or normoxia (21 % O2) (-■-) at different times. At the indicated times luciferase activity was measured in the cultures. Results are expressed as the mean ± SEM of four independent experiments. Data shows that uPAR promoter was more active under hypoxic conditions. The maximal effect was achieved 38 h post-transduction and was maintained at later time-points.

FIG. 9 shows the immunohistochemical staining of luciferase (Luc) in the pancreas of wild type mice (WT) or in the pancreatic tumors of transgenic mice overexpressing c-myc (TgEla-myc) after retrograde delivery of 1 x10¹⁰ vp AduPARLuc adenoviruses into the common bile duct. Haematoxilin and eosin staining of the pancreas and tumor sections is also presented (H+E). WT mice did not show luciferase expression in the pancreas. These results are in agreement with a very low activity of the uPAR promoter in the normal pancreas. Strong immunoreactivity against luciferase was detected in pancreatic tumors, developed in TgEla-myc mice. These data are indicative of a very high activity of the uPAR promoter in pancreatic tumors. These experiments highlight the selectivity of the uPAR promoter in pancreatic tumors.

FIG. 10 shows the nucleic acid sequence of the uPAR promoter available in the GenBank database with access number S78532. DETAILED DESCRIPTION OF PARTICULAR EMBODIMENTS

In accordance with the above, the present invention relates to a conditionally replicating adenovirus that comprises the uPAR gene promoter, or a fragment thereof, said promoter or fragment regulating the expression of an autologous gene involved in viral replication of said adenovirus.

In the present invention, the expression "conditionally replicating" regarding an adenovirus, relates to a vector which when introduced in a tissue does not replicate unless a transcription regulating sequence in the target tissue is activated. The adenoviruses of the present invention are conditionally replicating because they have been modified as follows: one gene that is essential for replication has been modified, replacing the transcription- regulating sequence, on which the gene's normal transcription depends, with a heterologous transcription-regulating sequence. This transcription-regulating sequence depends on the presence of transcription-regulating factors or on the absence of transcription regulating inhibitors. The presence of these factors or the absence of inhibitors in a particular tissue gives the adenovirus its conditionally replicating character. According to the above, the transcription-regulating sequence may be replaced by a heterologous transcription-regulating sequence.

Conditionally replicating adenovirus are well-known in the state of the art. Said adenovirus are known as having oncolytic activity (cf. Toth K. et al., 2010). Therefore, in the present invention the expressions "conditionally replicating adenovirus" and "oncolytic adenovirus" have the same meaning and are interchangeably used. As it has been explained above, what it is of relevance in the first aspect of the invention is the inclusion of the uPAR promoter (or a fragment thereof) within the adenoviral genome.

The person skilled in the art, using well-known techniques is able to introduce the uPAR sequence within the adenoviral genome. There are several ways to manipulate the adenoviral genome. The methods of construction of genetically modified adenoviruses are well established in the field of gene therapy and virotherapy with adenovirus.

The "urokinase-type plasminogen activator receptor (uPAR)" is a protein anchored by glycosylphosphatidylinositol (GPI) with a high affinity for uPA, pro-uPA, ATF, and other cell receptors. The sequence of said gene is available in GenBank with access number S78532, where the sequence of the uPAR gene promoter is listed (FIG. 10). The human uPAR, urokinase-type plasminogen activator receptor 5'region (GeneBank:S78532) corresponds to the uPAR promoter sequence characterized in the article by Soravia et al. (cf. Soravia et al., 1995) and described in FIG. 1 of said publication. To identify the 5' flanking region of the uPAR gene the authors defined first the initiation of transcription (position +1 ) that corresponds to the "A" nucleotide at position 1553 of the GeneBank sequence. Upstream sequences from position +1 (1553, GeneBank:S78532) are defined as promoter region.

In a preferred embodiment, the adenovirus contains a fragment of the uPAR promoter. In this regard, and as it is illustrated below, the inventors have found that under hypoxic conditions the adenovirus carrying the uPAR promoter is activated. From these results, the inventors believed that uPAR promoter selectivity can be (in whole or in part) due to the consensus sequence ACGTGC (also known as HRE sequence) which specifically binds to the transcriptional factor HIF-1 α (already known as being involved in cancer). From the results obtained, it is believed that the cancer selectivity of uPAR promoter can be due to the presence of consensus sequences which binds to transcriptional factors involved in cancer. Therefore, in the present application the expression "or a fragment thereof means any fragment of uPAR promoter sequence including a consense sequence which has already being disclosed in the state of the art as being able to identify a transcriptional factor associated to cancer or tumor (such as HRE consensus sequence). The identification and generation of uPAR promoter fragments including consensus sequences can be made using the general knowledge.

In a preferred embodiment, the promoter sequence fragment is one having the sequence SEQ. ID NO: 1. This sequence, which corresponds to region -402/+48 of the promoter, shows two modifications with regards to the sequence in Genbank: one in position 152, where a thymine is substituted for a cytosine; and another in position 242, where a cytosine has been inserted. SEQ ID NO: 1 was obtained from the vector pCAT-Basic-uPAR(C2) disclosed by Soravia et al., (cf. Soravia et al., 1995). As it is illustrated below, said fragment, once inserted in the adenoviral genome, confers cancer-specificity and oncolytic activity to the adenovirus. SEQ ID NO: 1 includes the HRE consense sequence. Considering what it has been stated above, starting from SEQ ID NO:1 the skilled person in the art could obtain fragments including consensus sequences which have already been disclosed as being associated with transcriptional factors associated to cancer. Therefore, the present invention also encompasses the use of SEQ ID NO: 1 or fragments thereof, with the proviso that said fragment includes a consense sequence already associated to cancer.

It is obvious for a skilled in the art that the sequence of the promoter, or fragment thereof, may undergo conservative-type modifications in the sequence when its insertion has to be carried out in the adenoviral genome. These modifications, which may be deletions, substitutions or insertions, do not negatively affect the specificity and activity that characterise the uPAR sequence. Therefore, the "sequence of the promoter, or fragment thereof may be a sequence with a sequence identity to the sequence available in Genbank with number S78532, of at least 85%, preferably of at least 90%, more preferably of at least 99%.

In the present invention the terms "promoter of the gene encoding uPAR" and "uPAR promoter" have the same meaning and are interchangeably used.

The organisation of the adenoviral genome is similar in all adenovirus groups. Each cytoplasmatic early messenger RNA is complementary to four non- continuous regions of the viral DNA. These regions are designated as (E1 - E4). Early transcripts have been classified in a set of the regions: immediate early (E1A), delayed early (E1 b, E2a, E2b, E3 and E4), and immediate (IVa2.IX).

In an embodiment of the first aspect of the invention, the promoter or promoter fragment regulates the expression of an early adenoviral gene. Preferably, it regulates the expression of the adenoviral gene E1A.

Gene E1 A (whose sequence is described in GenBank with number AC000008) is an activator of multiple products of adenoviral genes through activation of the promoters of E1 b, E2, E3 and E4. Region E1A is involved in the transcriptional transactivation of viral and cell genes, as well as in the transcriptional repression of other sequences. Gene E1A exerts an important control function on the other early messenger RNAs of the adenovirus. In normal tissues, an active E1 A product is necessary for the purpose of efficiently transcribing regions E1 b, E2a, E2b, E3, or E4.

In another preferred embodiment of the first aspect of the invention the adenovirus contains, additionally, a sequence derived from the myotonic dystrophy locus which is located upstream of the promoter or promoter fragment.

The nucleotide sequence derived from the myotonic dystrophy locus is an isolating sequence which preserves the promoter regulation and avoids the effect of adenoviral genome regulatory sequences. The myotonic dystrophy locus is located in human chromosome 13 in the position 19q13.3. By way of an illustrative but not limiting example, the sequence described in PCT application WO 2007/088229 can be used.

In another embodiment of the first aspect of the invention, the adenovirus contains, additionally, a Kozak sequence located between the promoter, or fragment thereof, and the adenoviral gene whose expression is regulated.

The Kozak sequence (CCATGCC nucleotide sequence described for the first time by Kozak et al., 1986) which is located in front of the first translated ATG codon, is a sequence optimised for protein translation which increases the produced levels of adenoviral protein regulated by the uPAR promoter or fragment thereof.

Although the person skilled in the art knows a large number of adenoviruses that can be used in accordance with the aspects of the present invention, preferably the conditionally replicating adenovirus is of human origin and, more preferably, of serotype 5.

In an embodiment of the second aspect of the invention, the adenovirus of the invention is used in the treatment of pancreatic cancer, either in a primary, or advanced stage, or metastatic pancreas cancer. This embodiment can be reformulated as a method for treating pancreatic cancer either in a primary, or advanced stage, or metastatic pancreatic cancer which comprises the administration of an effective therapeutic amount of the adenovirus as defined in the first aspect of the invention.

The term "therapeutically effective amount" refers to the amount of the adenovirus of the invention that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the disease. The term "therapeutically effective amount" also refers to the amount of adenovirus of the invention that is sufficient to elicit the biological or medical response of a cell, tissue, system, animal or human that is being sought by a researcher, veterinarian, medical, doctor or clinician.

In another embodiment of the second aspect of the invention, the adenovirus is used in the treatment of a liver cancer caused by a metastasis of pancreatic cancer.

The present invention provides a pharmaceutical composition comprising the adenovirus of the present invention and a carrier, especially a pharmaceutically acceptable (e.g., a physiologically or pharmacologically acceptable) carrier (e.g., excipient or diluent). Pharmaceutically acceptable carriers are well-known to those who are skilled in the art and are readily available. The choice of carrier will be determined in part by the particular method used to administer the pharmaceutical composition.

In one embodiment, the pharmaceutical composition is administered systematically, preferably it is administered intratumorally, intravenously or to the common bile duct.

There is a wide variety of suitable formulations of the pharmaceutical composition of the present invention. The following formulations and methods are merely exemplary and are in no way limiting. However, injectable formulations are preferred.

Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the compound dissolved in diluents, such as water, saline, or orange juice; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as solids or granules; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, mannitol, corn starch, potato starch, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, moistening agents, preservatives, flavoring agents, and pharmacologically compatible excipients. Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to the active ingredient, such excipients as are known in the art.

The adenovirus of the present invention, alone or in combination with other suitable components, can be made into aerosol formulations to be administered via inhalation. These aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also can be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer.

Formulations suitable for parenteral administration include aqueous and nonaqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that refider the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dhed (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.

The dose administered to an animal, particularly a human, in the context of the present invention will vary with the adenovirus of the inventon, the composition containing the adenovirus, the method of administration, and the particular site and organism being treated. The dose should be sufficient to effect a desirable response, e.g., therapeutic or prophylactic response, within a desirable time frame.

The dose and dosage regimen will depend upon the nature of the cancer (primary or metastatic) and its population, its therapeutic index, the patient, the patient's history and other factors.

EXAMPLES

Constructs

A fragment of 450 pairs of bases (bp) having the region -402/+48 of the uPAR promoter was obtained from the vector pCAT-Basic-uPAR(C2) (cf. Soravia et al., 1995) by Xbal digestion and was subcloned and was subcloned in the Xbal restriction site of the pAdTrack vector (Stratagene) in order to generate pAdTrack-uPARp. The cDNA of the luciferase gene was obtained from the pGL3-Enhancer vector (Promega, Madison, Wl) by means of enzyme restriction and was subcloned in the Hindlll-Sall locus of the pAdTrackuPARp plasmid in order to generate pAdTrackuPARLuc.

The retroviral vector pLHCLuc was obtained by cloning the luciferase gene in the Hindlll and CIaI sites of the plasmid pLHCX (Clontech, Palo Alto, CA).

uPARLuc and the uPARLuc mutant were cloned in the pGEM-T vector (Promega, Madison, Wl) designated as uPARpLuc and uPARpmut425Luc and used for further studies.

uPARpLucmut415 was obtained by carrying out a site directed mutagenesis in the pAdTrackuPARLuc to introduce an A/C mutation in the +15 position and a T/C mutation in the + 18 position of the uPAR promoter. These mutations were made in the HiF Responsive Element (HRE) of uPAR promoter, to prevent HIF-1 transcription factor binding. The mutation415 corresponds to two nucleotide exchange in the HiF Responsive Element (HRE) of the promoter, to prevent HIF-1 transcription factor binding.

Cell Lines

The PANC-1 , BxPC-3, RWP1 , NP-31 , NP-9 and NP-18 pancreas adenocarcinoma lines were obtained and cultured as described in Huch et al. (cf. Huch et al., , 2006). The following cell lines from the American Type Culture Collection (ATCC; Rockville, MD) were used: human osteosarcoma U2OS (ATCC HTB-96); breast carcinoma MCF-7 (ATCC HTB-22); human lung fibroblasts IMR-90 (ATCC CCL-186); HEK293 cells (ATCC CRL-1573), MIAPaCa-2 pancreatic cancer cells (JCRB0070). A549 lung carcinoma cells (ECACC86012804) were obtained from the European Collection of Cell Cultures (Wiltshire, UK). HPDE cells derived from human pancreatic ductal epithelium were provided by Dr. Francesc Xavier Real (IMIM, Barcelona, Spain) and cultured as described in Liu et al. (cf. Liu et al., 1998). PANC-1 - Luc cells were obtained in the laboratory by retroviral transduction of PANC-1 parental cells. For this purpose, the retroviral vector pLHCLuc was transfected to the Phoenix Ampho packaging line (ATCC SD 3443)). After 48 hours the supernatant was collected and the PANC-1 cells were transduced. 24 hours later, the selection with hygromycin started (the commercial plasmid used contains the gene encoding for hygromycin) and different clones that were tested for their luciferase activity were isolated.

Adenoviruses

Replication-defective adenoviruses AdCMVGFPLuc and AduPARLuc express the luciferase gene under the control of the CMV or uPAR promoters, respectively. AdCMVGFPLuc has already been described (cf. Alemany R. et al., 2001 ).

AduPARLuc was generated by homologous recombination of the pAdTrackuPARLuc plasmid (obtained as indicated above) with the genome of the serotype 5 wild-type adenovirus (Adwt) in E. CoIi BJ5183 cells (Stratagene 200154). The resulting adenovirus (AduPARLuc) was transfected to HEK293 cells and following several cycles of infection the viruses were purified by cesium chloride gradient (cf. He et ai, 1998).

AduPAREIA was obtained by insertion of the 450 bp fragment of the uPAR promoter of sequence SEQ ID NO: 1 in 5' region of the E1 A adenoviral gene, in which the translation start site had been previously modified with a Kozak sequence. The DM-1 isolation sequence was cloned upstream of the uPAR promoter. The inclusion of the Kozak and DM-1 sequence was carried out following the protocol described by Cascallό et al (cf. Cascallό et al., 2007).

The Adwt adenovirus was obtained from the ATCC with reference VR5 (Manassas, VA).

The control virus AdCYP2B1 , which is a replication defective adenovirus (hereinafter also referred as "AdV"), has been previously described (cf. Huch et al., supra).

With the aim of determining the exact concentration of the viral material to be administered in the biological activity tests, AduPAREIA was amplified in RWP-1 cells and purified by cesium chloride gradient. The concentration of physical viral particles (vp/mL) was determined by means of optical density analysis (OD₂6o) and that of infectious particles (pfu/mL) by means of a TCID50 test in HEK293 cells. The same protocol was carried out with the AdCMVGFPLuc and AduPARLuc adenoviruses on HEK293 cells. In this last case both viruses presented the same vp and pfu ratio.

Tumor growth studies

A total of 2x10⁶ PANC-1 cells or 2.5x10⁶ BxPC-3 cells were inoculated SC in the posterior flanks of BALB/c nude mice (Charles River France, Lyon, France). Tumors were measured 3 times a week and the volumes were calculated according to the formula: V (mm³) = larger diameter (mm) x smaller diameter 2 (mm²) 12.

Treatment was initiated when the tumors achieved a mean volume of 50 mm³. Once tumors were established 5 x 10¹⁰ vp of AdCMVGFPLuc (n=4 mice; n=8 tumors) or AduPARLuc (n=4 mice; n=8 tumors) or 0.9 % NaCI saline solution (n=2 mice; n=4 tumors) were injected IV All experimental groups received a single dose of virus administered as described above except for the BxPC3 tumors carrier animals, which received one injection at day 6 and another at day 14 after tumor implantation. All procedures followed in handling the laboratory animals were approved by the animal experimentation committee of the Regional Government of Catalonia and were developed following the guidelines of the European Community Directive 86/609/EEC. Bioluminescence assay and quantification

Mice were anaesthetised and the substrate D-Firefly-Luciferin (Xenogen, Alameda,C.A.) was administered intraperitoneal^ at a dose of 32 mg/kg. Luciferase activity was visualised and quantified using the bioluminescent system IVIS50 (Xenogen) and with the aid of the software Living Image 2.20.1 Igor Pro4.06A (Wavemathcs, Seattle, WA) as described in Huch et al. (cf. Huch et al., supra). Luciferase activity was quantified always from non- saturated images measuring the total emitted light and recording with a CCD camera (Xenogen).

lmmunohistochemistry and stereological analysis

5 μm sections of samples of pancreatic tumor and liver from healthy mice (to which the onset of the disease was caused as explained above) were deparaffinized, rehydrated and treated with 10 mM citrate buffer (pH 6.0) in order to detect the presence of the adenovirus, by means of luciferase immunodetection. Sections were incubated overnight with a polyclonal anti- luciferase antibody (1/500) (Sigma, Poole, UK). The universal antibody detection system LSAB+ (DAKO Diagnostics, Denmark) was used. The sections were counter-stained with Mayer's Hematoxylin and examined under a Leica DMR microscope.

For the stereological analysis, the dissector method was used to estimate the number of luciferase-positive cells per mm² in both the liver and tumoral areas, with the aid of the CAST-GRID (Olympus, Denmark) software package adapted to an OLYMPUS BX51 microscope. At least 3 independent nonsequential randomly-chosen sections of liver or tumor were counted for each animal. A mean of 25 dissectors (dis) from an area of 17110 μm² (Sdis), were analysed per liver area, while for the tumoral area a mean of 160 dissectors of 57043 μm²were analysed. The final surface of the analysed area was similar for each of the viral groups. The number of cells/mm² was calculated according to the formula: [N (cell/mm²) = N cells / Ndis x Sdis] where "Ndis" is the number of dissectors and "Sdis" is the area of the dissectors. With this protocol it was possible to quantify the results obtained in the immunohistochemistry. For the assays performed with the transgenic mice TgEla-1 -myc (results are shown in FIG. 9), paraffin sections from pancreas and pancreatic tumors obtained from TgEla-1-myc mice (cf. Sandgren E. P. et al., 1991 ) and from wild-type mice injected with 1x10¹⁰vp AduPARLuc were deparaffinized, dehydrated and stained with hematoxylin/eosin or treated with citrate buffer 1 OmM (pH6.0) for luciferase immunodetection.

Hepatic toxicity studies and determination of the viral DNA content in liver

For hepatic toxicity studies, immunocompetent BALB/c mice were used which received IV, in the tail vein, a single viral dose of 2x10¹⁰ vp (AduPARLuc) or 5x10¹⁰ vp (AduPAREIA) in a final volume of 0.2 ml_. The weight of the animals was monitored daily. Blood samples were obtained by cardiac puncture under anaesthesia. Aspartate aminotransferase enzyme and total bilirubin were determined in an Olympus AU400 Analyser.

Liver portions from the killed animals were frozen, or fixed, for subsequent embedding in paraffin blocks, or were cryopreserved in a specific medium for freezing tissues OCT (Tissue Tek4583, Bayer SA).

E1A immunodetection was performed by incubating liver sections with a polyclonal anti-adenovirus-2 E1A antibody (clone 13 S-5, Santa Cruz Biotechnology). A goat AlexaFluor 488 which recognises rabbit IgG (Molecular Probes, Eugene, OR) was used as a secondary antibody. Nuclei were counter-stained with 5 μg/mL bis-benzimide (Hoechst 33342, Sigma) and visualised under a fluorescence microscope (Zeiss Observer/Z1 ). Images were captured using a digital camera (AxioCamMRm - Zeiss).

DNA was obtained from the hepatic tissue of the animals injected with saline, AduPARLuc or AdCMVLuc virus following incubation of the frozen tissue in a buffer solution containing RNasaA 0.2 mg/mL and protease 0.1 mg/m overnight at 55⁰C. Viral DNA content was determined by real-time PCR assay (100 ng of DNA) with SYBER Green (Roche Diagnostics). The following primers of the adenoviral L3 gene (AC000008) (which is known for expressing in the late phase) were used in order to quantify the amount of Hexon protein and, thereby quantify the amount of produced viral particles: 5' GCCGCAGTGGTCTTACATGCACATC 3' (SEQ ID NO: 2) and 5' CAGCACGCCGCGGATGTCAAAG 3' (SEQ ID NO: 3).

The number of adenovirus copies was quantified by interpolation on a standard curve consisting of viral DNA dilutions (10-10⁷ copies) in the presence of liver genomic DNA. Samples and standard concentrations were amplified in triplicate. The mean value of the number of copies was related to the total per cell, taking into account that the amount of DNA in a cell genome has a ratio of 6x10⁹ bp/cell. Results are expressed as vp/100 cells.

Statistical analysis

The statistical analysis was carried out using the SPSS software package (SYSTAT software, Inc, Chicago, IL). Results are expressed as the mean ± SEM. The Mann-Whitney nonparamethc test was applied for the (2-tailed) in vitro and in vivo studies. P< 0.05 was taken as indicative of significance.

Tumor growth and survival analyses were performed using S-PLUS functions. General linear -mixed models were used in order to estimate the effects of the treatments on tumor growth, taking repeated measures design into account (cf. Heitzan et al., 1993). A value of p < 0.05 (Bonferroni correction) was considered significant after performing multiple comparisons of the treated groups. In the survival analyses, the log-rank test was used in order to calculate statistical significance. A value of p lower than or equal to 0.05 was considered significant.

Determination of uPAR gene promoter mRNA

One microgram of total RNA obtained from semiconfluent cultures using the RNeasy Mini RNA Extraction Kit (Qiagen) was reverse transcribed using Moloney Murine Leukemia Virus reverse transcriptase (Ambion, Austin, TX) and 1/10 of the reaction was used as a template for the PCR amplification reaction. 23 cycles were carried out comprising: denaturation for 30 seconds at 95°C, hybridization for 30 seconds at 60⁰C, and an extension for 30 seconds at 72°C, in the thermal cycler (GeneAmp PCR System 9700, Applied Biosystems). The primers used were: 5' CAGGACCTCTGCAGGACCAC 3' (SEQ ID NO: 4), and 5¹ CCTTGCAGCTGTAACACTGG 3¹ (SEQ ID NO: 5).

Total RNA was quantified using the Quantum RNA system which uses 18S RNA as internal standard and at a ratio of 1 :4 of the standards, following the manufacturer's instructions (Ambion).

Biodistribution Studies

BALB/c nude male mice (Charles River France, Lyon, France) were injected with 2x10¹⁰ vp of AdCMVGFPLuc, AduPARLuc or 0.9 % NaCI saline solution, via the tail vein in a final volume of 200 μl_. At days 3, 5, 11 , 20, 31 and 50 after viral transduction, luciferase activity was detected and quantified using the in vivo bioluminescence analysis system (IVIS, Xenogen, Alameda, CA). At day 50, the mice were killed and different organs were collected and cryopreserved until their subsequent processing. Frozen tissues were mechanically homogenised and 100 mg were used for obtaining the protein extracts. The samples were incubated at 25 ⁰C for 15 min with the cell lysis reagent and luciferase activity was measured (Promega Corporation, Madison, Wl).

Metastasis model based on the intrasplenic injection of tumor cells

Metastasis models of pancreatic tumor cells were developed following the protocol described by (cf. Tseng et al., 2002). Briefly, a 1 cm incision was made in the left subcostal area and the spleen exposed. 4x10⁶ PANC-I or PANC-1 -Luc in 50 μl_ of 0.9 % NaCI saline solution was injected into the splenic capsule with a 29G needle. To maintain haemostasis and prevent leakage of tumor cells a fine cotton was applied to the puncture site applying pressure for 1 minute. After surgery, the state of health of the animals was monitored.

Hypoxia assay

To induce experimental hypoxia RWP- 1 or MIAPaCa-2 cells were cultured in an incubator flushed with a gas mixture containing 1 % O2 and 5% CO2 balanced with nitrogen at the indicated times. Western blot analysis

Confluent cultures were resuspended in a lysis buffer (5OmM Tris.CI pH 6.8, 2% SDS, 10% glicerol) containing 1 % Complete Mini Protease Inhibitor (Roche Diagnostics GMBH) and phosphatase inhibitors (20 mM Na^O₇ and 10OmM NaF) and boiled for 10 min at 98°C. Cell lysates were centrifuged for 10 min. at 16000xg and the cell debris discarded. Protein concentration was determined by BCA™ Protein Assay Kit (Pierce,Thermo Fischer Scientific Inc, IL, USA), and 100 μg of total protein were resolved by electrophoresis on 8% gels and transferred to nitrocellulose membranes by standard methods. Membranes were immunoblotted with an anti-HIF1 α (610958; BD Transduction Laboratories; San Jose, CA, USA), or anti-α-tubulin (T9026; Sigma) overnight at 4⁰C. Then the blots were rinsed with TBS-T and incubated for 1 hour at room temperature with either HRP-conjugated goat anti-rabbit IgG or rabbit anti-mouse IgG antibodies (DakoCytomation; Glostrup, Denmark). Antibody labelling was detected by the Enhanced ChemoLuminescent Method (Amersham Biosciences Inc.).

Results

A) The uPAR promoter targets the adenoviral transgene expression to pancreatic tumor cells in vitro and in vivo.

The researchers of the present invention studied by semi-quantitative RT-PCR analysis, the expression of the uPAR gene in a panel of pancreatic tumor lines, and in the HPDE cells derived from pancreatic ductal epithelium. Thus, the presence of at least one transcript in all analysed cells was observed. The expression was weaker in the HPDE cells, derived from normal ductal epithelium, than in any of the tumor lines (FIG. 1A). In order to study the capacity of the uPAR promoter to efficiently and selectively target pancreatic tumor cells, a replication-defective adenovirus was generated, AduPARLuc, which expressed the luciferase reporter gene under the regulation of a 450 bp fragment of the uPAR promoter. The AdCMVGFPLuc adenovirus, which expressed the luciferase gene under the CMV viral promoter, was used as a control. All pancreatic tumor lines infected with AduPARLuc showed high levels of luciferase activity, indicating that the uPAR promoter was active in said cells (FIG 1 B). Interestingly, the 450 bp-fragment of the uPAR promoter showed higher luciferase activity in tumor cells than in normal ductal HPDE cells, in agreement with the endogenous uPAR gene expression (FIG.1A). This indicates that the uPAR promoter retains its specificity for tumor cells in the context of an adenovirus.

In order to identify the activity of the uPAR promoter in pancreatic tumors, xenografts derived from BxPC-3 cells were generated in the subcutaneous tissue of mice, which were injected with AduPARLuc or AdCMVGFPLuc at a dose of 2.5x10¹⁰vp/tumor. The levels and persistance of luciferase activity were analysed over time. The bioluminescence analysis showed that both viruses gave rise to high levels of luciferase expression. In the mice injected with the AdCMVGFPLuc virus a luciferase peak was observed at 3 days, which decreased, in some cases, up to 4-fold at day 6 after injection. Surprisingly, bioluminescence of the tumors injected with AduPARLuc remained constant for at least up to 10 days after injection, at which point they presented similar levels of activity to those of the control virus (AdCMVGFPLuc). Similar results were obtained with a xenograft model of NP- 18 cells (data not shown).

These findings indicate that the uPAR promoter would have a similar activity in tumors to that of the CMV constitutive promoter (FIG. 1 C).

B) The uPAR promoter selectively targets pancreatic tumor cells.

Animals with BxPC-3 and PANC-1 cells xenografts were challenged with a intravenous injection of 5x10¹⁰ vp of AduPARLuc or AdCMVGFPLuc and luciferase activity was analysed in the liver, since this is the main organ where adenoviruses accumulates, as well as in the tumors.

The results showed that the uPAR promoter had a similar level of activity to that of CMV in the tumors, however luciferase expression in the liver was significantly lower in the animals injected with AduPARLuc (FIG. 2 (A) and (B)). The calculated tumor specificity index (established as the ratio of adenovirus activity in the tumor in relation to its activity in a healthy tissue (i.e. liver)) was significantly higher in the animals injected with AduPARLuc, both in those having tumors caused by BxPC-3 (122-fold, p=0.001 ) as well as in tumors caused by PANC-1 (23-fold, p=0.006) (FIG. 2 (C) and 2(D)), indicating that the uPAR promoter was more selective for pancreatic tumors in vivo.

These data are consistent with the results obtained from the biodistribution study of the virus, which shows that the AduPARLuc virus has significantly lower activity compared to the activity of AdCMVGFPLuc in samples of healthy tissue from liver, spleen, kidney, heart and lung, and very low activity in pancreas, intestine, stomach and testes (FIG. 3).

Additionally, in vivo models were used in order to determine the selectivity of uPAR promoter. Wild type mice (from Charles River France) and Tg-Ela-myc mice, the last being used as a close model to in vivo pancreas tumor (obtained as described by Sandgren E. P. et al., 1991 ) were injected with AduPARLuc 1x10¹⁰ vp/animal. Four days later luciferase expression was examined by immunohistochemistry analysis in the pancreas or the pancreatic tumors of wild type and Tg-Ela-myc mice respectively. As shown in FIG. 9, almost no luciferase was detected in the pancreas of wild type mice, whereas strong anti-luciferase immunoreactivity was detected in the pacreatic tumors of Tg-EIa. myc mice. These data confirms the selectivity of the uPAR promoter, driving transgene expression more efficiently in tumors with respect to normal pancreatic tissue.

C) AduPAREI A induces cytotoxicity in pancreatic tumor cells.

In order to evaluate whether the uPAR promoter could be a candidate for targeting therapies against pancreatic adenocarcinoma in an efficient, selective and safe manner, an oncolytic adenovirus was constructed in which control of the E1 A gene was under the control of the uPAR promoter. A Kozak sequence was included flanking the start of translation of E1A, in order to increase the potency of replication (cf. Cascallό et al., 2007), as well as a DNA fragment from the myotonic dystrophy locus DM-1 , intended to isolate the uPAR promoter from the other transcriptional units or enhancers of the adenoviral genome (cf. Majem et al., 2006).

The cytotoxic effect of AduPAREI A was studied on 4 pancreatic tumor lines (RWP-1 , PANC-1 , BxPC-3 and NP-18) infected with the different doses of AduPAREI A indicated on the X-axis of (i)-(iv) of FIG. 4A. This effect was compared to the effect caused by the Adwt, wild-type adenovirus. It was observed that the viral dose of AduPAREI A required to cause a reduction in culture viability (ID₅₀) was equivalent to that of the Adwt wild-type virus, indicating that AduPAREI A has an important cytotoxic effect (FIG. 4A). The ID₅₀ results are summarised in Table 1 :

Table 1

No cytotoxicity was observed when using a non-replicating adenovirus at the same viral doses indicating, therefore, that the observed cytotoxic effect was a result of viral replication.

D) AduPAREI A represses tumor growth and prolongs mouse survival in xenografts of BxPC-3 tumors.

The anti-tumoral effect of the AduPAREI A oncolytic virus on pancreatic tumors was assessed. BxPC-3 tumors received two intratumoral injections, one a week, of 10⁷ pfu/tumor of AduPAREI A, Adwt, the non-replicating virus AdV or 0.9 % NaCI saline solution. As shown in FIG. 4B, a significant reduction in tumor growth was observed in the treated groups (AduPAREI A and Adwt), when compared with the saline or the non-replicating virus (AdV) groups (p<0.0001 ). Importantly, 3 of the 12 tumors (25%) of the AduPAREI A group and 2 of the 12 (16%) of the Adwt group were eradicated, and no tumor was detected when the animals were killed. Therefore, the results obtained in vivo indicate that AduPAREI A is as potent as Adwt.

The median survival time of the animals treated with the AdV control adenovirus was 32 days, however the one of the group treated with AduPAREI A extended up to 51 days (p<0.01 ) (FIG. 4C). One out of the six animals treated with AduPAREI Adid not show any recurrence of the tumor after six 6 months of treatment, indicating that the tumors had been eradicated.

E) AduPAREI A represses tumor growth and prolongs survival in a metastasis tumor model.

A metastasis model was established following the injection of PANC-1 cells in the spleen of immunodepressed mice. Ten days after the injection, metastatic nodules were observed in the liver, where upon an IV injection of 5x10¹⁰ vp of AduPARLuc or AdCMVGFPLuc was administered. The immunohistochemical analysis of the liver sections revealed strong immunoreactivity in the PANC-1 tumor metastases that had received one virus or the other (FIG. 5). The proportion of Luc-positive cells was significantly higher in the animals treated with AduPARLuc, as shown in Table 2:

Table 2

In the hepatic parenchyma of theanimals treated with AduPARLuc a very limited number of luciferase-positive cells was observed, whereas it was very high in the animals treated with AdCMVGFPLuc (FIG. 5) reflecting, once more, the selectivity of the uPAR promoter for the tumor cells.

In order to evaluate the effectiveness of AduPAREI A on the metastasis model, PANC-1 -Luc cells were injected in the spleen and 6 days after the injection, once metastases had already formed, the mice were injected intravenously with either 0.9 % NaCI saline solution (control group), or a single dose of 10¹⁰vp or 5x10¹⁰ vp of AduPAREI A. Seven days later, the animals that had been injected with the virus presented lower luciferase activity than the control group. In the group of animals that received the highest dose, luciferase activity decreased by 50% in respect of the initial value. (p=0.005) (FIG. 6A). Representative animals from each group were killed 21 days after treatment, and no tumor nodules were found in the hepatic parenchyma of the mice treated with 5x10¹⁰ vp of AduPAREIA (FIG. 6B).

The survival time (i.e., the time that it takes the tumor to reach a size that endangers the animal's life) was calculated, being for the control group 35 days, and significantly longer for the treated groups: 60 days for the 10¹⁰ vp viral dose and 70 days for the dose of 5x10¹⁰ vp (FIG. 6C). 33 % of the treated mice exceeded 5 months without presenting any sign of the disease. When they were killed no tumors were observed in any organ of the abdominal region.

F) The uPAR promoter presents low liver toxicity on systemic administration.

Intravascular administration of adenoviruses results in the accumulation of the virus in the liver, which tends to cause hepatic toxicity as a result of the expression of both viral proteins and the transgenes that they carry.

First, the potential toxicity of the AduPARLuc virus was assessed, in immunocompetent BALB/c mice (Charles River) which had been injected IV with 2x10¹⁰ vp of said virus. Minimal histopathologic changes were found in contrast to the hepatotoxicity found in the mice injected with the

AdCMVGFPLuc virus. The transaminase analysis showed AST values within normal ranges. In order to rule out these differences being due to a lower viral transduction, the number of viral particles present in the liver of the animals was determined, and similar values of viral particles were found in both groups (AdCMVGFPLuc 13.14 ± 1.33 vp/100 cells and AduPARLuc 10.82 ± 0.92 vp/100 cells).

These data indicate that the toxicity derived from the expression of a transgene in the liver, as a consequence of an adenoviral injection could be minimised by using the uPAR promoter.

Next, the potential cytotoxicity of the AduPAREIA oncolytic virus was studied and compared to that of Adwt. E1A staining in liver sections of animals treated with Adwt showed strong immunoreactivity against E1A, whereas E1A expression was barely observed in the livers of AduPAREIA mice (FIG. 7A). Consistent with these results, very limited areas of hepatic damage were observed with AduPAREIA, whereas the Adwt virus caused extensive areas of necrosis (FIG. 7B).

The analysis of serum parameters revealed reduced values of total AST and bilirubin in the AduPAREI A mice compared to those obtained with Adwt (FIG. 7C). It is worthy of note that the injection of 5x10¹⁰ vp of Adwt gave rise to a mortality rate of 50% of animals, whereas all survived the injection of the same dose of AduPAREI A.

Therefore, the use of the uPAR promoter limits the hepatic toxicity of replicating adenoviruses.

G) Hypoxia effects uPAR activity

The hypoxia inducible transcription factor (HIF-1 ) is a transcription factor that mediates responses to hypoxia by binding to HIF responsive elements (HRE) in target genes. The uPAR promoter fragment SEQ ID NO: 1 presents a consensus HRE sequence ACGTGC for HIF-1 recognition. To study the effect of HIF-1 on the uPAR promoter we generated two constructs in which the uPAR SEQ ID NO: 1 carried the luciferase gene (UPARp) and a mutant construct in which the putative HIF binding site ACGTGC was mutagenized to CCGCGC (uPARpmut415) (FIG.8A). We demonstrate that under hypoxia, the HIF-1 α subunit is induced in RWP1 cells (FIG.8B). Under these hypoxic conditions increased activity in cells transfected with the uPARp was observed but not in cells transfected with the mutant construct. (FIG.8C). These results are indicative of the fact that uPAR promoter activation might be mediated by the binding of HIF-1 to the HRE element. The increased effect of hypoxia on the uPAR promoter activity was also observed in MIAPaCa-2 cells transduced with the AduPARLuc adenovirus at different time points (FIG. 8D).

BIBLIOGRAPHIC REFERENCES

1 . US 2005/0260643

2. Nemunaitis J. et al., "A phase I trial of intravenous infusion of ONYX-015 and enbrel in solid tumor patients", Cancer Gene Ther., 2007, v. 14(11 ), p.

885-93 3. Hecht J. R. et al., "A phase l/ll trial of intratumoral endoscopic ultrasound injection of ONYX-015 with intravenous gemcitabine in unresectable pancreatic carcinoma", Clin. Cancer Res., 2003, v. 9(2), p. 555-61

4. Taniguchi, H et al., "Beta-cell neogenesis induced by adenovirus-mediated gene delivery of transcription factor pdx-1 into mouse pancreas", Gene Ther., 2003, v. 10, p. 15-23

5. Brown J. M., "Exploiting the hypoxic cancer cell:mechanisms and therapeutic strategies", MoI. Med. Today, 2000, v. 6, p. 157-162

6. Toth K. et al., "Oncolytic (replication-competent)adenoviruses as anticancer agents", Expert Qpin. Biol. Ther., 2010, v. 10(3), p. 353-68

7. Soravia et al., "A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene", Blood, 1995, v. 86, p. 624-635

8. Kozak et al., "Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic hbosomes", Cell, 1986, v. 44, p. 283-292

9. Huch et al., "Targeting the CYP2B1/Cyclophosphamide Suicide System to Fibroblast Growth Factor Receptors Results in a Potent Antitumoral Response in Pancreatic Cancer Models", Hum. Gene Ther., 2006, v. 17, p. 1187-1200

10. Liu et al., "Comparative phenotypic studies of duct epithelial cell lines derived from normal human pancreas and pancreatic carcinoma", Am. J. Pathol., 1998, v. 153(1 ), p. 263-269

11. Alemany R. et al., "CAR-binding ablation does not change biodistribution and toxicity of adenoviral vectors", Gene Ther., 2001 , v. 8(17), p. 1347-53

12. He et al., "A simplified system for generating recombinant adenoviruses", Proc. Natl. Acad. Sci. USA, 1998, v. 95, p. 2509-14

13. Cascallό et al., "Systemic toxicity-efficacy profile of ICOVIR-5, a potent and selective oncolytic adenovirus based on the pRB pathway", MoI. Ther., 2007, v. 9, p. 1607-15

14. Heitzan et al., "Statistical analysis of in vivo tumor growth experiments", Cancer Res., 1993, v. 53, p. 6042-6050)

15. Tseng et al. "Adenovirus-mediated delivery of a soluble form of the VEGF receptor FIkI delays the growth of murine and human pancreatic adenocarcinoma in mice", Surgery, 2002, v. 132, p. 857-865

16. Majem et al., "Control of E1 A Ander an E2F-1 promoter insulated with the myotonic dystrophy locus insulator reduces the toxicity of oncolytic adenovirus Ad-delta24RGD", Cancer Gene Ther., 2006, v. 13, p. 696-705

17. Sandgren E. P. et al., "Pancreatic tumor pathogenesis reflects the causative genetic lesion", Proc. Natl. Acad. Sci., 1991 , v. 88, p. 93-97

Claims

1. Conditionally replicating adenovirus containing a promoter of the urokinase-type plasminogen activator receptor (uPAR) or a fragment thereof, said promoter or fragment regulating the expression of a gene responsible for viral replication.

2. Adenovirus according to claim 1 , which contains a fragment of the promoter of the urokinase-type plasminogen activator receptor (uPAR).

3. Adenovirus according to claim 2, wherein the fragment of the promoter has the sequence SEQ ID NO: 1.

4. Adenovirus according to any one of the preceding claims, wherein the promoter or fragment regulates the expression of an early adenoviral gene.

5. Adenovirus according to claim 4, wherein the promoter or fragment regulates the expression of the E1A adenoviral gene.

6. Adenovirus according to any one of the preceding claims, wherein the adenovirus is a human adenovirus.

7. Adenovirus according to claim 6, wherein the human adenovirus is of serotype 5.

8. Adenovirus as defined in any one of claims 1 -7 for use as a medicament.

9. Adenovirus as defined in any of claims 1 to 8, for use in the treatment of cancer.

10. Adenovirus according to claim 9, for use in the treatment of pancreatic cancer in a primary or advanced state, or metastatic pancreatic cancer.

11. Adenovirus according to claim 9, for use in the treatment of a liver cancer caused by metastasis of a pancreatic cancer.

12. Use of uPAR promoter or a fragment thereof for the targeting of a conditionally replicating adenovirus to a cancer cell.

13. A pharmaceutical composition comprising a therapeutically effective amount of the conditionally replicating adenovirus as defined in any one of the claims 1 -7 together with pharmaceutically acceptable carriers and/or diluents.

14. The conditionally replicating adenovirus according to any one of the claims 1 -7 or the pharmaceutical composition according to claim 13 which is administered systematically.

15. The conditionally replicating adenovirus according to claim 14, which is administered intratumorally, intravenously or to the common bile duct .