WO2010096754A1 - Compositions and methods to prevent and/or treat cancer with pa -card - Google Patents
Compositions and methods to prevent and/or treat cancer with pa -card Download PDFInfo
- Publication number
- WO2010096754A1 WO2010096754A1 PCT/US2010/024904 US2010024904W WO2010096754A1 WO 2010096754 A1 WO2010096754 A1 WO 2010096754A1 US 2010024904 W US2010024904 W US 2010024904W WO 2010096754 A1 WO2010096754 A1 WO 2010096754A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- laz
- peptide
- card
- cell
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
- A61K38/4873—Cysteine endopeptidases (3.4.22), e.g. stem bromelain, papain, ficin, cathepsin H
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
Definitions
- Leukemia is a malignant cancer of the bone marrow and blood. Characterized by an uncontrolled accumulation of abnormal blood cells, leukemia leads to the inhibition of normal blood cell function and, in many instances, death. It was estimated that leukemia affected approximately 44,270 new people in the United States in 2008. Leukemia is the fifth most common cause of cancer deaths for men and the sixth most common cause of cancer deaths for women. Leukemia causes more deaths than any other cancer among children under age 20. ("Cancer facts and figures 2008," Atlanta: American Cancer Society (2008); Xie Y et al., Cancer
- APL acute promyelocyte leukemia
- Gleevec® specifically inhibits the Bcr-Abl tyrosine kinase.
- CML chronic myeloid leukemia
- Bcr-Abl tyrosine kinase A chromosome translocation in chronic myeloid leukemia (CML) results in the constitutive activation of the Bcr-Abl tyrosine kinase, which in turn results in the activation of cellular signaling that promotes cancer growth.
- Retinoic acid a hormone involved in cellular differentiation, in conjunction with arsenic trioxide (As2O3), are treatments of choice for APL.
- the present invention relates to compositions and methods of use of cytotoxic peptides to kill cancer, and specifically leukemia and/or ovarian cancer.
- One aspect of the invention is an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain.
- the isolated peptide may be derived from bacteria, and specifically Pseudomonas aeruginosa.
- the isolated peptide is Pa-CARD.
- the isolated peptide comprises or consists of SEQ ID NO: 27.
- the isolated peptide is capable of killing leukemia, fibrosarcoma, ovarian cancer and/or breast cancer cells.
- the isolated peptide is chemically modified to extend or optimize its half-life in the bloodstream.
- the present invention also relates to a method of killing cancer cells by contacting the cells with one or more proteins selected from the group consisting of an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain, Laz, H8-Azu, and Azu-H8.
- the cancer cells are selected from the group consisting of leukemia cells, fibrosarcoma cells, ovarian cancer cells, and breast cancer cells.
- This method may further comprise contacting the cells with one or more cytotoxic agents that are capable of killing cancer cells.
- cytotoxic agents may be, but are not limited to, cisplatin, Gleevec®, Retinoic acid, 5'-aza-2'-deoxycytidine, and arsenic trioxide.
- the method comprises contacting the cancer cells with cisplatin.
- the cancer cells are contacted with the one or more cytotoxic agents at about the same time as the one or more proteins.
- the present invention also relates to a method, comprising administering to a mammalian patient suffering from cancer one or more proteins selected from the group consisting of an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain, Laz, H8-Azu, and Azu-H8.
- the cancer is selected from the group consisting of leukemia, fibrosarcoma, ovarian cancer, and breast cancer.
- one or more cytotoxic agents may that are capable of killing cancer cells may also be administered to the patient.
- the cytotoxic agents may include, but are not limited to, cisplatin, Gleevec®, Retinoic acid, 5'-aza-2'-deoxycytidine, and arsenic trioxide.
- the additional cytotoxic agent administered to the patient is cisplatin.
- the one or more cytotoxic agents are administered at about the same time as the one or more proteins.
- the present invention also relates to a method, comprising killing leukemia cells by contacting the cells with an azurin and a peptide comprising the H.8 region of Laz.
- the leukemia cells are contacted with the azurin and the peptide comprising the H.8 region of Laz at or around the same time.
- the present invention also relates to a method, comprising administering to a mammalian patient suffering from leukemia an azurin and a peptide comprising the H.8 region of Laz.
- azurin and the peptide comprising the H.8 region of Laz are administered to the patient at or around the same time.
- the present invention also relates to a method, comprising inducing cellular differentiation in a leukemia cell by contacting the leukemia cell with one or more proteins selected from the group consisting of Laz, azurin, H.8-Azu, Azu-H.8, and an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain.
- one or more proteins selected from the group consisting of Laz, azurin, H.8-Azu, Azu-H.8, and an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain.
- the present invention also relates to a method, comprising selectively entering cancer cells by contacting the cancer cells with one or more proteins selected from the group consisting of Laz, azurin, H.8-Azu, Azu-H.8, and an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain; wherein the cancer cells are selected from the group consisting of leukemia cells and ovarian cancer cells.
- one or more proteins selected from the group consisting of Laz, azurin, H.8-Azu, Azu-H.8, and an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain; wherein the cancer cells are selected from the group consisting of leukemia cells and ovarian cancer cells.
- the present invention also relates to a method, comprising inducing cell cycle arrest in a cancer cell by contacting the cancer cell with one or more proteins selected from the group consisting of Laz, azurin, H.8-Azu, Azu-H.8, and an isolated peptide of that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain.
- the cancer cell may be selected from a group consisting of a leukemia cell, a fibrosarcoma cell, a breast cancer, and an ovarian cancer cell.
- the protein increases Weel protein levels in the cell.
- the protein causes the depletion of phosphorylated AKT-Ser-473.
- the protein both increases Weel protein levels in the cell and causes the depletion of phosphorylated AKT-Ser-473.
- the present invention also relates to a method, comprising inducing apoptosis in a cancer cell through caspase 3 activation by contacting the cancer cell with an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain.
- the cancer cell is an ovarian cancer cell.
- the present invention also relates to a method, comprising modulating expression of NF-kB signaling pathway genes in a cancer cell by contacting the cancer cell with an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain.
- an isolated peptide that is capable of killing cancer cells which comprises a caspase recruitment (CARD)-like domain.
- the cancer cell is an ovarian cancer cell.
- the present invention also relates to expression vectors encoding isolated peptides capable of killing that is capable of killing cancer cells, which comprise a caspase recruitment (CARD)-like domain.
- the expression vector encodes Pa-CARD.
- the present invention also relates to pharmaceutical composition
- pharmaceutical composition comprising an isolated peptide that is capable of killing cancer cells, which comprises a caspase recruitment (CARD)-like domain.
- the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
- the pharmaceutical composition further comprises a protein selected from the group consisting of Azurin, Laz, H.8-Azu, and Azu-H.8.
- the pharmaceutical composition further comprises one or more cytotoxic agents that are capable of killing cancer cells.
- the pharmaceutical composition comprises a pharmaceutically acceptable carrier that is appropriate for intravenous injection.
- the present invention also relates to a method, comprising administering to a patient suffering from leukemia one or more of the pharmaceutical compositions disclosed in this invention in a therapeutically effective amount.
- the pharmaceutical composition is administered to the patient in a manner selected from the group consisting of intravenously, topically, subcutaneously, intramuscularly, orally, and into a tumor.
- Another aspect of the invention is a nucleic acid molecule, which encodes one or more of the isolated peptides disclosed herein.
- kits comprising one or more of the pharmaceutical compositions described herein.
- SEQ ID NO: 1 is the genomic DNA coding sequence of the Neisseria gonorrhoeae laz gene, Genbank Accession No. Y00530 (ctggcaggct tgacgcttcg atacgctctg tttcggtcag gctggtcccg aaaccggaaa aaccgccgaa aaccaatacc ctgcatttga gtaaggctgc gctggagagt tttcggttcgg cgg cggcggcaaa gttggaaaa cggcatcccg aattggcgga ggcattggca aacttggtta gaaggcatgg cgcataaaat gtatacggga atttgtgtaa acatccgtta atattaagaa gtaaaaaa
- SEQ ID NO: 2 is the genomic DNA coding sequence of the Pseudomonas aeruginosa azurin gene (ctttttcatg cagcggatcg ctcgcgcatc acttcagggt cagggtgccc ttcatcagcg cggagtggcc cgggaaggtg cagaagaaca tgtactgctc gccttccttc agcttggaga cgtcgaaggt caccgagtcc ttctcgcccg agccgatcag cttggtgtgg gcgatgacac ggctgtcgtc gggcttcagg taatccttgt ccaggccgga agccatgccgtgacca ccttgtgtgcat gtcggg
- SEQ ID NO: 3 is the genomic DNA coding sequence of the H.8 region of the Neisseria gonorrhoeae laz gene (tgctctcaag aacctgccgc gcctgctgcc gaggcaactc ctgccggtga agcacccgct tccgaagcgc ctgccgcga agctgctcct gcagatgctg ccgaagccccctgcc).
- SEQ ID NO: 4 is the forward primer to PCR amplify the Laz-encoding gene ⁇ laz) of Neisseria gonorrhoeae (ccggaattcc ggcagggatg ttgtaaatat ccg).
- SEQ ID NO: 5 is the reverse primer to PCR amplify the Laz-encoding gene ⁇ laz) of Neisseria gonorrhoeae (ggggtaccgc cgtggcaggc atacagcatt tcaatcgg).
- SEQ ID NO: 6 is the forward primer to PCR amplify a 3.1 kb fragment of pUC18-/ ⁇ z (ggcagcaggg gcttcggcag catctgc).
- SEQ ID NO: 7 is the reverse primer to PCR amplify a 3.1 kb fragment of pUC18-/ ⁇ z (ctgcaggtcg actctagagg atcccg).
- SEQ ID NO: 8 is the forward primer to PCR amplify a 0.4 kb fragment of pUC 19-paz (gccgagtgct cggtggacat ccagg).
- SEQ ID NO: 9 is the reverse primer to PCR amplify a 0.4 kb fragment of p ⁇ JCl9-paz (tactcgagtc acttcagggt cagggtg).
- SEQ ID NO: 10 is the forward primer to PCR amplify a 3.3 kb fragment of pUCl9-paz (cttcagggtc agggtgccct tcatc).
- SEQ ID NO: 11 is the reverse primer to PCR amplify a 3.3 kb fragment of pUCl9-paz (ctgcaggtcg actctagagg atcccg).
- SEQ ID NO: 12 is the forward primer to PCR amplify a 0.13 kb fragment of pUCl 8 -laz (tgctctcaag aacctgccgc gcctgc).
- SEQ ID NO: 13 is the reverse primer to PCR amplify a 0.13 kb fragment of pUC18-/ ⁇ z (taggatcctt aggcagcagg ggcttcggca gcatctgc).
- SEQ ID NO: 14 is the forward primer to PCR amplify the GST-encoding gene from pGEX-5X-3 (cgagctcatg tcccctatac taggttattg g).
- SEQ ID NO: 15 is the reverse primer to PCR amplify the GST-encoding gene from pGEX-5X-3 (cccaagcttt caggggatcc cacgaccttc gatcagatcc).
- SEQ ID NO: 16 is the forward primer to PCR amplify the signal peptide and H.8-encoding region of laz from pUC 1 %-laz (ggaattcata tgaaagctta tctggc).
- SEQ ID NO: 17 is the reverse primer to PCR amplify the signal peptide and H.8-encoding region of laz from pUC18-/ ⁇ z (ccggaattcg gcagcagggg cttcggc).
- SEQ ID NO: 18 is the forward primer to PCR amplify the H.8-encoding region from pUC18-/ ⁇ z (cgggatcccc tgctctcaag aacctgccgc gee).
- SEQ ID NO: 19 is the reverse primer to PCR amplify the H.8-encoding region from pUC18-/ ⁇ z (cggaattctt aggcagcagg ggcttcggca gcatctgcag g).
- SEQ ID NO: 20 is the forward primer to PCR amplify the GST-H.8 fusion region from pGEX-5X-3-H.8 (cgagctcatg tcccctatac taggttattg g).
- SEQ ID NO: 21 is the reverse primer to PCR amplify the GST-H.8 fusion region from pGEX-5X-3-H.8 (ccgctcgagt caggcagcag gggcttcggc ag).
- SEQ ID NO: 22 is the amino acid sequence of the Neisseria gonorrhoeae strain F62 Laz protein, Genbank Accession No. Y00530 (Cys Ser GIn GIu Pro Ala Ala Pro Ala Ala GIu Ala Thr Pro Ala GIy GIu Ala Pro Ala Ser GIu Ala Pro Ala Ala GIu Ala Ala Pro Ala Asp Ala Ala GIu Ala Pro Ala Ala GIy Asn Cys Ala Ala Thr VaI GIu Ser Asn Asp Asn Met GIn Phe Asn Thr Lys Asp lie GIn VaI Ser Lys Ala Cys Lys GIu Phe Thr He Thr Leu Lys His Thr GIy Thr GIn Pro Lys Ala Ser Met GIy His Asn Leu VaI lie Ala Lys Ala GIu Asp Met Asp GIy VaI Phe Lys Asp GIy VaI GIy Ala Ala Ala
- SEQ ID NO: 23 is the amino acid sequence of the Pseudomonas aeruginosa azurin (Ala GIu Cys Ser VaI Asp He GIn GIy Asn Asp GIn Met GIn Phe Asn Thr Asn Ala He Thr VaI Asp Lys Ser Cys Lys GIn Phe Thr VaI Asn Leu Ser His Pro GIy Asn Leu Pro Lys Asn VaI Met GIy His Asn Trp VaI Leu Ser Thr Ala Ala Asp Met GIn GIy VaI VaI Thr Asp GIy Met Ala Ser GIy Leu Asp Lys Asp Tyr Leu Lys Pro Asp Asp Ser Arg VaI He Ala His Thr Lys Leu lie GIy Ser GIy GIu Lys Asp Ser VaI Thr Phe Asp VaI Ser Lys Leu Lys GIu GIy GIu GIn Tyr Met Phe Phe Cys Thr Phe Pro GIy His Ser
- SEQ ID NO: 24 is the amino acid sequence of the H.8 region from Neisseria gonorrhoeae ⁇ 62 Laz protein (Cys Ser GIn GIu Pro Ala Ala Pro Ala Ala GIu Ala Thr Pro Ala GIy GIu Ala Pro Ala Ser GIu Ala Pro Ala Ala GIu Ala Ala Pro Ala Asp Ala Ala GIu Ala Pro Ala Ala).
- SEQ ID NO: 25 is the amino acid sequence of a peptapeptide motif (Ala Ala GIu Ala Pro).
- SEQ ID NO: 26 is the amino acid sequence of P. aeruginosa Arginine
- ADI Deiminase
- SEQ ID NO: 28 is the nucleotide sequence of a forward primer to PCR amplify the CARD motif of the P. aeruginosa ADI gene (ATGC AC AATC TGCTGACCGA GACCATCCAG).
- SEQ ID NO: 29 is the nucleotide sequence of a reverse primer to PCR amplify the CARD motif of the P. aeruginosa ADI gene (CAGGTCGAGG AGCCGTGGTC CTTGTC).
- Figure 1 depicts a schematic representation of laz from Neisseria gonorrhoeae (A) and paz from Pseudomonas aeruginosa (B).
- the P. aeruginosa azurin gene for cloning and hyperexpression in E. coli consisted of the azurin gene itself (paz) and the signal peptide (psp) sequence that determines its periplasmic location (B).
- the H.8 region of laz was cloned in frame either in the 5'-end of thepaz gene (C) including the Neisserial signal sequence nsp (pUC18-H.8-/> ⁇ z) or at the 3'- end of the paz gene (D) (p ⁇ JC19-paz-H.$).
- C 5'-end of thepaz gene
- D 3'- end of the paz gene
- the detailed procedures for preparing the constructs are given in Example 1.
- mich azurin-like sequence of Neisseria gonorrhoeae present in the laz gene
- nsp Neisseria signal peptide sequence.
- the signal peptide sequence in both cases is cleaved off to produce the mature Paz (periplasmic) and Laz (surface-exposed) proteins.
- Cells were treated with the proteins at 3 different concentrations (10, 20 and 40 ⁇ M) for 6, 12 and 24 h. MTT assay was done to measure the extent of live cells to account for cytotoxicity (percent cell death). To calculate percentage cytotoxicity, the value of non-treated viable cells was taken to be 100% and the number of viable cells was determined in Paz, Laz and H.8-fusion protein-treated samples. The extent of cytotoxicity (%) was then determined from the number of dead cells.
- Figure 3 depicts the entry of various fluorescently labeled azurin- related proteins into glioblastoma LN-229 and breast cancer MCF-7 cells.
- A H.8 peptide, Paz, Paz-H.8, H.8-Paz and Laz (20 ⁇ M each) conjugated with Alexa fluor ® 568 was incubated with LN-229 cells on a coverslip at 37°C for 30 min after which images were taken.
- B Internalization into MCF-7 cells of various proteins conjugated with Alexa fluor 568 as visualized by confocal microscopy and as described for (A).
- C Internalization of Laz was visualized by confocal microscopy.
- FIG. 4 depicts bar graphs indicating the quantification of the fluorescence found in the confocal microscope images in Figure 3 A-D.
- A Quantification of fluorescence in images in Figure 3 A. Quantification of fluorescence in azurin proteins was done by using Adobe ® Photoshop ® . Error bars represent the standard deviation of the fluorescence in three different cells in a single sample.
- B Quantification of fluorescence in images in Figure 3B. Quantification performed as in Figure 4A.
- C Quantification of fluorescence in images in Figure 3C. Quantification performed as in Figure 4 A.
- D Quantification of fluorescence in images in Figure 3D. Quantification performed as in Figure 4A.
- Figure 5 depicts images and a graph of uptake and cytotoxicity, respectively, of labeled fusion proteins in cells.
- Combined treatment with H.8-GST fusion proteins facilitates the uptake of Alexa fluor ® 568-labeled Paz in glioblastoma LN-229 cells.
- Unlabeled 20 ⁇ M (A) H.8, (B) GST, (C) GST-H.8, (D) H.8-GST, (E) PBS buffer and 20 ⁇ M Paz conjugated with Alexa fluor ® 568 were incubated with LN-229 cells for 30 min at 37°C. The internalization was visualized by confocal microscopy.
- Figure 6 depicts images of the brains of mice injected with Paz, H.8-Paz and Laz conjugated with IRdye ® 800CW (LI-COR Biotechnology, Lincoln, Iowa).
- A Brain images from live mice. Five hundred ⁇ g of Paz, H.8-Paz and Laz conjugated with IRdye ® 800CW were injected intraperitoneally in live nude mice. After 24 h, the mice were sacrificed, brains were taken out and the fluorescence was detected and measured with the LI-COR Odyssey ® Infrared Imaging System.
- B Rostral mesencephalon region images of nude mice brains treated as in (A). Mice brains were cut horizontally and images were taken.
- Figure 7 depicts SDS-PAGE, Western blotting and confocal microscope images of localization of H.8-Gst fusion proteins in E. coli.
- A E. coli BL21 (DE3) cells having cloned gst, H.S-gst or gst-H.8 genes were cultured at 37°C with 0.1 mM IPTG. Cell pellets were washed with PBS twice, and whole cell lysates were run on SDS-PAGE. Coomassie blue staining was used for detection of the proteins.
- B Coomassie blue staining was used for detection of the proteins.
- E. coli strain BL21(DE) cells harboring cloned gst, H.8-gst or gst-H.S genes (Table 2) were cultured at 37°C with 0.4 mM IPTG. One ml each of these bacterial cultures were centrifuged and the resultant bacterial pellets were collected.
- aeruginosa azurin pUC19-/ ⁇ z ⁇ Neisseria
- pUC 18-H. %-paz or pUC 1 S-paz-R.8 were cultured at 37°C overnight in presence of 0.1 mM IPTG. 0.5 ml of such cultures were centrifuged and the resultant bacterial pellets were washed with chilled PBS twice.
- Anti-azurin antibody (1 :500) in 1 ml of 1% FBS-PBS was applied and incubated on ice for 1 h. After washing with PBS twice, FITC-conjugated anti-rabbit antibody was applied, incubated on ice for 30 min, washed with PBS twice and fixed with cold ethanol. Bacterial samples were observed by confocal microscopy (xlOO objective).
- Figure 8 depicts graphs showing cell cytotoxicity as determined by MTT assay.
- a and B Cell cytotoxicity was determined by MTT assay of HL60 (A) and K562 (B) cells treated with 10 ⁇ M of Laz, Azurin (Azu), H8-Azu, and Azu-H8 or 5 ⁇ M DAC as a positive control after 24 h, 48 h and 72 h.
- C K562 cells treated with low concentrations: 3.75 nM, 37.5 nM, 75 nM, 2.5 ⁇ M, 5 ⁇ M and 10 ⁇ M of Laz, Azu, H8-Azu, Azu-H8 or 5 ⁇ M DAC as a positive control.
- Figure 9 depicts fluorescent microscopy images of changes in cell morphology induced by Laz and Azurin in HL60 and K562 cells.
- Laz induces morphological changes in HL60 and K562 cells as shown by fluorescent microscopy.
- (A) and (B) represent untreated HL60 and K562 cells.
- HL60 (C) or K562 (D) cells treated with 10 ⁇ M Laz for 48 h undergo differentiation, a process that is linked to subsequent cellular apoptosis. Arrows point to differentiated granulomatous cells. Fewer morphological changes are seen in HL60 cells (E) or K562 cells (F) treated with 10 ⁇ M Azurin for 48 h, even though the cytotoxicity was high.
- Figure 10 depicts images from confocal microscopy showing the selective entry of Laz and Azurin into HL60 and K562 cells.
- Panel 1 Neither Azurin nor Laz enters normal peripheral blood mononuclear cells (PBMCs) after 1 h incubation at 10 ⁇ M concentration (A and B). Azurin enters K562 cells after 1 h incubation (D), as does Laz (C). Azurin enters HL60 cells after 1 h incubation (F), as does Laz (E).
- Panel 2 In comparison with control K562 cells, Azu-H8, H8-Azu enter such K562 cells as well as Laz.
- Figure 11 depicts graphs charting of cell cycle progression in the absence and in the presence of Azurin, Laz and DAC.
- K562 cells were treated for 48 h with 10 ⁇ M Laz, Azurin and 5 ⁇ M DAC, fixed, stained and analyzed for DNA content as described previously.
- Figure 12 depicts images of immunoblots. This figure provides analysis of the status of phosphorylation of AKT (AKT-P-Ser473) and Weel protein levels via immunoblotting of proteins in Laz- and Pa-CARD-treated K562 and HL-60 cells in cytosolic and nuclear extracts. Western blot analysis of cytosolic and nuclear proteins comparing levels of Weel, and phospho-AKT serine 473 from HL60 and K562 cells after 48 h of treatment with 10 ⁇ M Laz or 10 uM Pa-CARD compared to a control of untreated cells is shown.
- Figure 13 depicts a schematic representation of the CARD domain of ADI from P. aeruginosa that has cytotoxic activity against leukemia cells.
- A The presence of the CARD domain in Pa-ADI and Ma-ADI, but its absence in other members of the guanidino-group modifying superfamily enzymes such as DDAH and AGAT, as shown from the structure-based sequence alignments.
- the CARD domain represents that of mammalian caspase-9.
- DDAH dimethylarginine dimethylaminohydrolase
- AGAT arginine: glycine amidinotransferase.
- the ⁇ -strand and ⁇ -helices are shown as arrows and strips, respectively.
- Roman numerals I to V are the five ⁇ subunits.
- the clip moiety ( ⁇ -helical module) is seen in Pa-ADI and in M. arginini ADI (Ma-ADI) which bears structural homology to the six- ⁇ -helical modules that form the CARD domain of the caspase-9 protein molecule. N, N- terminal; C, C-terminal.
- B SDS-PAGE gel migration of purified 46 kDa ADI and 17 kDa CARD proteins from P. aeruginosa.
- C Cytotoxic activity of Pa-ADI and Pa- CARD on fibrosarcoma (HT- 1080), breast cancer (MCF-7) and leukemia (HL60) cells. Cells were incubated with 10 ⁇ M Pa-ADI or Pa-CARD for 48 h, after which cell viability was determined by MTT assays.
- Figure 14 depicts images showing structural characteristics of the arginine deiminase (ADI) enzymes from Mycoplasma arginini and Pseudomonas aeruginosa.
- ADI arginine deiminase
- A Ribbon drawing of P. aeruginosa ADI (1RXX_A) highlighting the two domains (MoIMoI program).
- B A copy of the image shown in Figure 13 A herein.
- C A schematic diagram showing the overall fold and topology of P. aeruginosa ADI (Pa-ADI), as described.
- Figure 15 depicts gel images and a graph showing the purification and arginine deiminase enzymatic activity of Pa-ADI and Pa-CARD.
- A SDS-PAGE gel migration of purified ADI and CARD proteins from P. aeruginosa.
- B The kinetics of ADI activity at 37 0 C and pH 7.2 of the purified Pa-ADI and Pa-CARD. The product of the enzymatic reaction, citrulline, was measured at 490 nm. No arginine deiminase enzymatic activity of Pa-CARD was detected.
- Figure 16 depicts graphs showing that Pa-CARD has higher cytotoxicity than Pa-ADI against a range of cancer cells.
- A Fibrosarcoma (HT- 1080), breast cancer (MCF-7) and ovarian cancer (SKOV-3) cells were incubated with 20 ⁇ M Pa-ADI or Pa-CARD for 48 hours, after which cell viability was determined by MTT assays. The mean ( ⁇ standard error) of the number of viable cells per well was determined from 3 experiments in triplicate cultures. All values are significantly different from controls (p ⁇ 0.05).
- B Dose dependent cytotoxicity exhibited by Pa-CARD towards the ovarian cancer SKOV-3 cells as a function of time (24, 48, and 72 hours).
- C The same experiments were conducted with Pa-ADI. The mean ( ⁇ standard error) of the number of viable cells per well was determined from 3 experiments in triplicate cultures as described in A (p ⁇ 0.05).
- Figure 17 depicts graphs showing the comparative cytotoxicity effect of Pa-CARD, azurin and cisplatin in ovarian cancer SKO V-3 cells.
- A Pa-ADI, Pa-CARD, azurin, and cisplatin, all at 20 ⁇ M, were incubated with either SKOV-3 or the normal ovarian HOSE6-3 cells for 48 hours, after which cell viability was determined by MTT assay.
- B Pa-CARD shows some additive effect with cisplatin compared to individual treatment with SKOV-3 cells.
- Figure 18 depicts photographs showing that Pa-CARD induces apoptosis in SKOV-3 cells but not in HOSE6-3 cells through caspase activation.
- the TUNEL assay was used to detect apotosis-induced DNA strand breaks by measuring the incorporation of flourescein-tagged dUTP using the in situ Cell Death Detection Fluorescein kit (Roche).
- SKOV-3 and HOSE6-3 cells were grown in 8 well Lab Tek chamber slides and incubated with 10 ⁇ M of Pa-CARD, Pa-ADI and azurin for 48 hours. A negative control without treatment or with BSA was also maintained in parallel (bottom row). The nucleus of the cells was stained blue with DAPI. Cells viewed under green (A) and blue (B) channels as well as the superimposed images (C) (Cyan color) are shown.
- Figure 19 depicts a graph showing capsase activation by Pa-
- Caspase activity was measured by Caspase-GloTM 3/7 assay kit purchased from Promega. Pa-ADI and Pa-CARD were used at two different concentrations to evaluate the dose response effect. Increase in caspase activity is expressed as fold increase as compared to a control without a drug treatement.
- the term “cell” includes both the singular or the plural of the term, unless specifically described as a “single cell.”
- cytotoxic peptide means peptides of the present invention that are selectively cytotoxic to cancer cells, and specifically leukemia cells, but not normal cells.
- polypeptide peptide
- peptide and protein are used interchangeably to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid. The terms also apply to naturally occurring amino acid polymers.
- polypeptide is also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. It will be appreciated that polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination and they may be circular (with or without branching), generally as a result of post-translation events, including natural processing event and events brought about by human manipulation which do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods as well. A synthetic peptide is one made without the aid of cellular components.
- the term "condition" includes anatomic and physiological deviations from the normal that constitute an impairment of the normal state of the living animal or one of its parts, that interrupts or modifies the performance of the bodily functions.
- inhibite cell growth means the slowing or ceasing of cell division and/or cell expansion. This term also includes the inhibition of cell development or increases in cell death.
- the term “suffering from” includes presently exhibiting the symptoms of a condition, having a condition even without observable symptoms, in recovery from a condition, and recovered from a condition.
- the term “treatment” includes preventing, lowering, stopping, or reversing the progression or severity of the condition or symptoms associated with a condition being treated.
- the term “treatment” includes medical, therapeutic, and/or prophylactic administration, as appropriate. Treatment may also include preventing or lessening the development of a condition, such as premalignant lesions or cancer.
- a “therapeutically effective amount” is an amount effective to prevent, lower, stop or reverse the development of, or to partially or totally alleviate the existing symptoms of a particular condition for which the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
- substantially pure when used to modify a protein or other cellular product of the invention, refers to, for example, a protein isolated from the growth medium or cellular contents, in a form substantially free of, or unadulterated by, other proteins and/or active inhibitory compounds.
- substantially pure refers to a factor in an amount of at least about 75%, by dry weight, of isolated fraction, or at least "75% substantially pure.” More specifically, the term “substantially pure” refers to a compound of at least about 85%, by dry weight, active compound, or at least "85% substantially pure.” Most specifically, the term “substantially pure” refers to a compound of at least about 95%, by dry weight, active compound, or at least "95% substantially pure.”
- the term “substantially pure” may also be used to modify a synthetically made protein or compound of the invention, where, for example, the synthetic protein is isolated from the reagents and by-products of the synthesis reaction(s).
- a “pharmaceutical grade” peptide when referring to a peptide or compound of the invention, is a peptide or compound that is isolated substantially or essentially from components which normally accompany the material as it is found in its natural state, including synthesis reagents and by-products, and substantially or essentially isolated from components that would impair its use as a pharmaceutical.
- a “pharmaceutical grade” peptide may be a isolated from any carcinogen.
- “pharmaceutical grade” may be modified by the intended method of administration, such as "intravenous pharmaceutical grade,” in order to specify a peptide or compound that is substantially or essentially isolated from any substance that would render the composition unsuitable for intravenous administration to a patient.
- an "intravenous pharmaceutical grade” peptide may be isolated from detergents, such as SDS, and anti-bacterial agents, such as azide.
- isolated refers to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state.
- isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment.
- An “isolated” region refers to a region that does not include the whole sequence of the polypeptide from which the region was derived.
- nucleic acid, protein, or respective fragment thereof has been substantially removed from its in vivo environment so that it may be manipulated by the skilled artisan, such as but not limited to nucleotide sequencing, restriction digestion, site-directed mutagenesis, and subcloning into expression vectors for a nucleic acid fragment as well as obtaining the protein or protein fragment in substantially pure quantities.
- variant refers to amino acid sequence variants which may have amino acids replaced, deleted, or inserted as compared to the wild-type polypeptide. Variants may be truncations of the wild-type peptide.
- a “deletion” is the removal of one or more amino acids from within the wildtype protein, while a “truncation” is the removal of one or more amino acids from one or more ends of the wildtype protein.
- a variant peptide may be made by manipulation of genes encoding the polypeptide.
- a variant may be made by altering the basic composition or characteristics of the polypeptide, but not at least some of its fundamental activities.
- a "variant" of a Neisseria peptide or a Pa- CARD peptide may be a mutated Neisseria peptide or Pa-CARD peptide that retains its ability to kill leukemia cells.
- a variant peptide is synthesized with non-natural amino acids, such as ⁇ -(3,5-dinitrobenzoyl)-Lys residues. (Ghadiri & Fernholz, J. Am. Chem. Soc, 112:9633-9635 (1990)).
- the variant has not more than 20, 19, 18, 17 or 16 amino acids replaced, deleted or inserted compared to wild-type peptide.
- the variant has not more than 15, 14, 13, 12 or 11 amino acids replaced, deleted or inserted compared to wild-type peptide.
- the variant has not more than 10, 9, 8 or 7 amino acids replaced, deleted or inserted compared to wild-type peptide.
- the variant has not more than 6 amino acids replaced, deleted or inserted compared to wild-type peptide. In some embodiments, the variant has not more than 5 or 4 amino acids replaced, deleted or inserted compared to wild-type peptide. In some embodiments, the variant has not more than 3, 2 or 1 amino acids replaced, deleted or inserted compared to wild-type peptide. In some embodiments, the variant has been created using the techniques and methods described in U.S. Patent Application Serial No. 12/389,120, the disclosure of which is incorporated by reference in its entirety herein.
- amino acid means an amino acid moiety that comprises any naturally-occurring or non-naturally occurring or synthetic amino acid residue, i.e., any moiety comprising at least one carboxyl and at least one amino residue directly linked by one, two, three or more carbon atoms, typically one ( ⁇ ) carbon atom.
- amino acid means an amino acid moiety that comprises any naturally-occurring or non-naturally occurring or synthetic amino acid residue, i.e., any moiety comprising at least one carboxyl and at least one amino residue directly linked by one, two, three or more carbon atoms, typically one ( ⁇ ) carbon atom.
- residue is synonymous with “amino acid.”
- a derivative refers to a peptide that is derived from the subject peptide.
- a derivation includes chemical modifications of the peptide such that the peptide still retains some of its fundamental activities.
- a "derivative" of a Neisseria peptide or a Pa-CARD peptide can be a chemically modified Neisseria peptide or Pa-CARD peptide that retains its ability to kill leukemia and/or ovarian cancer cells.
- Chemical modifications of interest include, but are not limited to, amidation, acetylation, sulfation, polyethylene glycol (PEG) modification, phosphorylation or glycosylation of the peptide, hi addition, a derivative peptide maybe a fusion of a polypeptide or fragment thereof to a chemical compound, such as but not limited to, another peptide, drug molecule or other therapeutic or pharmaceutical agent or a detectable probe.
- the derivative has been created using the techniques and methods described in U.S. Patent Application Serial No. 12/389,120, the disclosure of which is incorporated by reference in its entirety herein.
- percent (%) amino acid sequence identity is defined as the percentage of amino acid residues in a polypeptide that are identical with amino acid residues in a candidate sequence when the two sequences are aligned. To determine % amino acid identity, sequences are aligned and if necessary, gaps are introduced to achieve the maximum % sequence identity; conservative substitutions are not considered as part of the sequence identity. Amino acid sequence alignment procedures to determine percent identity are well known to those of skill in the art. Often publicly available computer software such as BLAST, BLAST2, ALIGN2 or Megalign (DNASTAR) software is used to align peptide sequences. In a specific embodiment, Blastp (available from the National Center for Biotechnology
- % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B can be calculated as:
- % amino acid sequence identity X/Y*100 where X is the number of amino acid residues scored as identical matches by the sequence alignment program's or algorithm's alignment of A and B and
- Y is the total number of amino acid residues in B.
- the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A.
- the shorter sequence will be the "B" sequence.
- the truncated peptide will be the "B" sequence.
- compositions comprising bacterial peptides, and variants, derivatives, and structural equivalents of such peptides, that have cytotoxic effects on cancer cells but not normal cells, and methods to prevent the development of cancer in mammals, treat cancer in mammals, and kill mammalian cancer cells.
- the compositions and methods disclosed herein can be used to prevent, treat, and/or kill leukemia and/or ovarian cancer. It has been shown that many cupredoxin proteins, particularly Pseudomonas aeruginosa azurin and truncations thereof, have the ability to preferentially enter and kill many types of solid mammalian cancer cells both in vivo and in vitro. (Yamada et al, Cell. Biol.
- Azurin is produced by a number of pathogenic bacteria and there is significant sequence homology among such genes. (Yamada, et al, Cell. Microbiol. 7:1418-1431 (2005))
- H.8 A protein epitope termed "H.8" is conserved among pathogenic Neisseria species and is detected by the binding of a monoclonal antibody designated H.8.
- the distinct gonococcal gene laz encodes a protein that cross-reacts with the H.8 monoclonal antibody. (Hayashi & Wu, J. Bioenerg. Biomembr. 22:451-471 (1990)).
- Laz is a gonococcal outer surface protein that contains a signal peptide lipoprotein consensus sequence that is recognized by the bacterial enzyme signal peptidase II, which processes the sequence to result in the N-terminal acylation of a cysteine residue with fatty acid and glycerol.
- the Laz lipoprotein about 17 kDa, includes an H.8 region that is a 39 amino acid region at the N-terminus containing imperfect pentapeptide repeats of the motif Ala- Ala-Glu- Ala-Pro (AAEAP (SEQ ID NO: 25)).
- Laz is involved in defense against oxidative stress and copper toxicity and increases survival in an ex vivo primary human ectocervical epithelial assay.
- Laz protein the azurin-like protein from Neisseria gonorrhoeae and other Neisseria species, is able to specifically enter and kill brain cancer cells such as glioblastoma cells, as well as other tumors. See Examples 2 and 7.
- H.8 region of the Laz protein can confer upon P. aeruginosa azurin when fused to either its N-terminal or C-terminal, the ability to enter and kill glioblastoma cells. See Examples 2 and 3.
- H.8 region does not have to be physically attached to a co-administered protein, such as azurin, to confer upon that protein the ability to enter glioblastoma cells.
- a co-administered protein such as azurin
- H.8 and H.8 fused to the N- terminus of GST both increased the entry of physically unattached azurin into glioblastoma cells as compared to azurin alone, however H.8 fused to the C-terminus of GST was ineffective.
- the H.8 and H.8 fused to the N-terminal of GST when coadministered with azurin both enhanced the cytotoxicity of azurin towards glioblastoma cells.
- this AAEAP (SEQ ID NO: 25) repeat unit can be used to design peptides that will kill leukemia cells.
- Azurin and laz are known to target multiple steps in the cancer progression pathway, such as induction of apoptosis by complex formation and stabilization of p53, inhibition of angiogenesis, as well as inhibition of cell signaling mediated by receptor tyrosine kinases such as EphB2/ephrin B2, thereby minimizing the chances of resistance development. See, e.g., U.S. Patent No. 7,381,701, the disclosure of which is incorporated by reference in its entirety herein. Azurin and Laz are known to have entry specificity in melanoma or breast cancer cells, as compared to normal cells.
- the Azurin and Laz proteins are also effective against liquid-borne cancers such as leukemia, as demonstrated by the Examples set forth herein.
- the Examples demonstrate that Azurin and Laz can each enter leukemia cell lines and have cytotoxic effects therein.
- Laz exerts cytotoxic effect on leukemia cell lines while having little effect on normal peripheral blood mononuclear cells (PBMCs), where they have very limited entry.
- PBMCs peripheral blood mononuclear cells
- ADI Asparaginase and Arginine Deiminase
- Ma-ADI Mycoplasma arginini
- Ma-ADI The catalytic triad in Ma-ADI is Cys 398-His 269-Glu213.
- Pseudomonas aeruginosa also produces ADI (Pa-ADI), which has a catalytic triad at Cys406-His278-Aspl66, and which has primary sequence homology with Ma- ADI.
- SSM Secondary Structure Matching
- CARD caspase recruitment domain
- PDB ID code IRXX Protein Data Bank, PDB ID code IRXX
- ADI is unique in harboring the CARD domain.
- CARD like domain in bacterial proteins is known other than a CARD-like domain in M. arginini ADI (PDB ID code ILXY), discussed above.
- the CARD domain in Pa-ADI has strong anticancer activity.
- the CARD domain polypeptide shows significant anticancer activity while exhibiting little cyotoxicity towards normal cells.
- the mammalian CARD-containing proteins are normally composed of approximately 95 amino acid residues and have sequence similarity to death domains (DDs) and death effector domains (DEDs).
- the crystallographic structure of CARD suggests that it consists of about 6 tightly packed alpha-helices surrounding a hydrophobic pocket.
- Pa-CARD consists of 85 amino acid residues forming the 5 packed alpha-helices which take the form of a "clip-on-fan" moiety (Figs. 14 B and 14 C). Since some mammalian CARD domains promote cancer growth, an interesting possibility is that the bacterial CARD contributes to the interference in mammalian CARD activity, thereby contributing to the anticancer activity of the Pa- ADI containing the putative CARD-like domain.
- the Pa- CARD domain may have been recruited from mammalian CARD-carrying proteins, and that Pa-CARD may exert its cytotoxic effects in cancer cells, at least in part, through protein-protein interactions with mammalian CARD proteins that are known to be hyperexpressed in cancer cells. It is further contemplated that this interaction may be a reason for the action of ADI in the modulation of cancer-growth.
- Pa-CARD (SEQ ID NO: 27), demonstrates surprising cytotoxic activity against leukemia cells and ovarian cancer cells.
- the Pa-CARD polypeptide has the ability to inhibit leukemia cell proliferation.
- the anticancer activity of Laz and Pa-CARD is mediated through cell cycle arrest at the G2/M phase involving the Weel protein stabilization and the depletion of phosphorylated AKT-Ser-473, the active form of a serine/threonine kinase that is often dysregulated in many cancer types. See Examples 11 and 12 and Figure 12.
- Pa-CARD and Laz inhibit cell cycle in leukemia cells through upregulation of the Weel protein in K562 cells and downregulation of active AKT P-Ser473 in HL60 cells (Fig. 12).
- Both Weel and phosphorylated AKT-Ser473 are known to be involved in cell cycle arrest at the G2/M phase, which in turn is known to lead to cell death.
- activation of the mitosis-promoting kinase, CDC2, also known as CDKl is required for the transition from G2 to M phase in eukaryotic cells where phosphorylation of CDC2 on Thr- 14 and Tyr- 15 residues is important.
- Inhibitory Tyr- 15 phosphorylation is mediated by the Weel protein kinase and therefore its enhanced levels mediate such inhibition of transition to the M phase.
- Viral proteins are known to mimic the Laz/Pa-CARD-mediated Wee protein kinase level elevation.
- the human papillomavirus type 1 (HPV-I) E4 protein inhibits G2 to M transition of the cell cycle through formation of inactive cyclin B 1 -CDKl complexes through inhibitory Tyr- 15 phosphorylation catalyzed by elevated levels of Weel.
- HPV-I human papillomavirus type 1
- siRNA small interfering RNA
- AKT protein kinase B
- PI3K phosphatidyl inositol 3 -kinase pathway
- Pa-CARD has an effect on SKOV-3 (ovarian cancer) cells via the transcriptional stimulation of the gene encoding GM-CSF.
- GM-CSF and IL-12 whose gene is stimulated by about three fold, are known to be potent inducers of antitumor immunity in many tumor models, triggering infiltration of granulocytes, macrophages and dendritic cells at the tumor site, thereby greatly enhancing tumor antigen presentation. It thus appears that Pa-CARD-induced apoptosis (Fig. 18) may significantly add to the anti-tumor response of any GM-CSF hyperproduced in presence of Pa- CARD.
- CCL2 C-C motif Ligand 2
- MCP-I Monocyte Chemoattractant Protein- 1
- CCL2 has often been shown to promote malignant transformation in breast cancer by increasing monocyte recruitment and deleterious Tumor- Associated Macrophages (TAM) in the tumor.
- TAM Tumor- Associated Macrophages
- CCL2 is also known to promote angiogenesis and metastasis presumably via MCPIP, a novel transcription factor, that activates transcription of the cadherin genes cdhl2 and cdhl9.
- MCPIP Tumor- Associated Macrophages
- bacterial proteins such as Azurin, Laz, and Pa-CARD can enter into leukemia cells and induce cell cycle arrest at the G2/M phase that appears to be triggered by modulation of cell signaling mediated by the CDC2-cyclin B repressive pathway and the cellular PI3K/AKT pathway.
- ADI can have anticancer activity in several ways, including via enzymatic depletion of arginine and through an N-terminal putative
- the Pa-cARD protein exhibits inhibitory role primarily to cancer cells and not to normal cells (Fig. 18). Furthermore, the anticancer activity may be mediated through caspase activity (Fig 19), and can induce apoptosis in ovarian cancer cells.
- the invention provides for cytotoxic peptides and/or variants, derivatives, truncations, or structural equivalents of such peptides, alone or in combination with one or more other cytotoxic agents.
- the cytotoxic peptide is a cupredoxin or a truncation thereof. In some such embodiments, the cytotoxic peptide is an azurin or a truncation thereof. In other such embodiments, the cytotoxic peptide is Laz or a truncation thereof. In other embodiments, the cytotoxic peptide is the H.8 region of Laz. hi some embodiments, the cytotoxic peptide comprises one or more of the amino acid sequences selected from the group consisting of SEQ ID NOS: 22-24.
- the cytotoxic peptide comprises a CARD domain.
- the cytotoxic peptide is a CARD-carrying protein.
- the CARD-carrying protein is derived from a bacteria.
- the bacteria is P. aeruginosa, hi one embodiment, the cytotoxic peptide is Pa-CARD. hi another such embodiment, the cytotoxic peptide comprises SEQ ID NO: 27.
- the cytotoxic peptide is fused, using techniques well known in the art, with another peptide that confers upon it greater cytotoxic effects.
- the other peptide is the H.8 region of Laz.
- the other peptide has a sequence comprising SEQ ID NO: 24.
- the cytotoxic peptide is the fusion protein Azu-H.8.
- the cytotoxic peptide is the fusion protein H.8-Azu.
- Figure 1 1.
- the one or more other cytotoxic agents that may be administered in combination with the cytotoxic peptides described herein may be cancer treatment drugs including, but not limited to cisplatin, Gleevec®, Retinoic acid, 5'-aza-2'- deoxycytidine (“DAC”), and/or Retinoic acid in conjunction with arsenic trioxide.
- cancer treatment drugs including, but not limited to cisplatin, Gleevec®, Retinoic acid, 5'-aza-2'- deoxycytidine (“DAC”), and/or Retinoic acid in conjunction with arsenic trioxide.
- Cancer treatment drugs other than Gleevec®, Retinoic acid, DAC, and/or Retinoic acid in conjunction with arsenic trioxide include: a cell cycle control protein, such as p53; a cyclin-dependent kinase inhibitor, such as pi 6, p21 or p27; a suicide protein such as thymidine kinase or nitroreductase; a cytokine or other immunomodulatory protein such as interleukin 1, interleukin 2 or granulocyte-macrophage colony stimulating factor (GM-CSF); a toxin, such as Pseudomonas aeruginosa exotoxin A; 5-fluorouracil; Interferon ⁇ ; Methotrexate; Tamoxifen; raloxifene; Vincrinstine; alkylating agents such as nitrogen mustards, alkyl sulfonates, nitrosoureas, ethylenimines
- cytotoxic agents also include the following: epothilone derivatives as found in German Patent No. 4138042.8; WO 97/19086, WO 98/22461, WO 98/25929, WO 98/38192, WO 99/01124, WO 99/02224, WO 99/02514, WO 99/03848, WO 99/07692, WO 99/27890, WO 99/28324, WO 99/43653, WO 99/54330, WO 99/54318, WO 99/54319, WO 99/65913, WO 99/67252, WO 99/67253 and WO 00/00485; cyclin dependent kinase inhibitors as found in WO 99/24416 (see also U.S.
- cytotoxic peptides that are variants, derivatives, truncations or structural equivalents of cupredoxins and/or CARD- carrying proteins.
- the cytotoxic peptide is isolated.
- the cytotoxic peptide is substantially pure or pharmaceutical grade.
- the cytotoxic peptide is in a composition that comprises, or consists essentially of, the cytotoxic peptide. In other embodiments, the cytotoxic peptide is in a composition that comprises both the cytotoxic peptide and at least one other cytotoxic agent. In another specific embodiment, the cytotoxic peptide is non- antigenic and does not raise an immune response in a mammal, and more specifically a human. In some embodiments, the cytotoxic peptide is less that a full-length cupredoxin or CARD-carrying protein, and retains some of the pharmacologic activities of the full length protein. Specifically, in some embodiments, the cytotoxic peptide may retain the ability to kill cancer cells, specifically leukemia cells.
- cupredoxin Because of the high structural homology between the cupredoxins, it is contemplated that other cupredoxins will have the same cytotoxic properties as Azurin and Laz, specifically in regard to leukemia.
- the cupredoxin is, but is not limited to, azurin, pseudoazurin, plastocyanin, rusticyanin, auracyanin, stellacyanin, cucumber basic protein or Laz.
- the Azurin or Laz is derived from Pseudomonas aeruginosa, Alcaligenes faecalis, Achromobacter xylosoxidans ssp.denitrificans I, Bordetella bronchiseptica, Methylomonas sp. , Neisseria meningitidis, Neisseria gonorrhea, Pseudomonas fluorescens, Pseudomonas chloror aphis, Xylella fastidiosa, Ulva pertussis or Vibrio parahaemolyticus.
- the azurin is from Pseudomonas aeruginosa.
- the invention provides cytotoxic peptides that are amino acid sequence variants of cupredoxins or CARD-carrying proteins which have amino acids replaced, deleted, or inserted as compared to the wild-type cupredoxin or CARD-carrying protein. Variants of the invention may be truncations of the wild-type protein. In some embodiments, the cytotoxic peptide of the invention comprises a region of a cupredoxin or CARD-carrying protein that is less that the full length wild-type polypeptide. The cytotoxic peptides of the invention may also include peptides made with synthetic amino acids not naturally occurring.
- non-naturally occurring amino acids may be integrated into the chemopreventive agent to extend or optimize the half-life of the composition in the bloodstream.
- chemopreventive agents include, but are not limited to, D,L-peptides (diastereomer), (for example Futaki et ah, J. Biol. Chem. 276(8):5836-40 (2001); Papo et al, Cancer Res. 64(16):5779-86
- the cytotoxic peptide of the invention is a derivative of a cupredoxin or CARD-carrying protein.
- the derivatives of cupredoxin or CARD- carrying protein are chemical modifications of the peptide such that the peptide still retains some of its fundamental activities.
- a "derivative" of azurin, Laz, or Pa-CARD can be a chemically modified protein that retains its ability to kill cancer cells, specifically leukemia and/or ovarian cancer cells.
- Another derivative may be one that has increased or optimized half-life in the bloodstream.
- the chemical modifications may include, but are not limited to, those disclosed in U.S. Patent Application Serial No. 12/389,120, the disclosure of which is incorporated by reference in its entirety herein.
- the cytotoxic peptide may be modified using methods that include, but are not limited to, those which decrease the hydrolysis of the peptide, decrease the deamidation of the peptide, decrease the oxidation, decrease the immunogenicity and/or increase the structural stability of the peptide. It is contemplated that two or more of the modifications described or incorporated by reference herein may be combined in one modified cupredoxin derived peptide, as well as combinations of one or more modifications described herein with other modification to improve pharmacokinetic properties that are well known to those in the art. Many methods to design such variants and derivatives are well known in the art.
- the invention provides methods of killing cancer cells, specifically leukemia and/or ovarian cancer cells, in mammals, specifically humans.
- the methods include contacting cancer cells with an isolated peptide that has a cytotoxic effect on cancer cells, or a variant, derivative, truncation, or structural equivalent thereof.
- the isolated peptide may be a cupredoxin or a CARD-carrying protein described herein.
- the isolated peptide is an azurin.
- the isolated peptide is Laz.
- the isolated peptide is Pa-CARD.
- the isolated peptide is a fusion protein comprising the H.8 region of Laz. In one such embodiment, the fusion protein is H.8-Azu.
- the fusion protein is Azu-H.8.
- the cytotoxic peptide may be administered to the cancer cells alone or in combination with another cytotoxic agent, as described herein, or in combination with the H.8 region of Laz. In some embodiments, the cytotoxic peptide is administered at or around the same time as the H.8 region of Laz. In other embodiments, the cytotoxic peptide is administered at or around the same time as a sequence comprising SEQ ID NO: 24.
- the invention also provides methods of treating mammalian patients with cancer, or otherwise killing cancer cells in mammalian patients, by administering to the patient an isolated peptide that has a cytotoxic effect on cancer cells or a variant, derivative, truncation, or structural equivalent thereof.
- the isolated peptide may be a cupredoxin or a CARD-carrying protein described herein.
- the isolated peptide is an azurin.
- the isolated peptide is Laz.
- the isolated peptide is Pa-CARD.
- the isolated peptide is a fusion protein comprising the H.8 region of Laz. In one such embodiment, the fusion protein is H.8-Azu.
- the fusion protein is Azu-H.8.
- the cytotoxic peptide may be administered alone or in combination with another cytotoxic agent, as described herein, or in combination with the H.8 region of Laz. In some embodiments, the cytotoxic peptide is administered at or around the same time as the H.8 region of Laz. In other embodiments, the cytotoxic peptide is administered at or around the same time as a sequence comprising SEQ ID NO: 24.
- the invention also provides methods of inducing the death of leukemia and/or ovarian cancer cells through cellular differentiation, by administering to leukemia and/or ovarian cancer cells one or more cytotoxic peptides.
- the cytotoxic peptide may be a cupredoxin or a CARD-carrying protein described herein.
- the cytotoxic peptide is Azurin.
- the cytotoxic peptide is Laz.
- the cytotoxic peptide is the fusion protein H.8-Azu.
- the cytotoxic peptide is the fusion protein Azu- H.8.
- the invention also provides methods of selectively entering leukemia and/or ovarian cancer cells and having cytotoxic effects therein, by administering to leukemia and/or ovarian cancer cells one or more cytotoxic peptides.
- the cytotoxic peptide may be a cupredoxin or a CARD-carrying protein described herein.
- the cytotoxic peptide is Azurin.
- the cytotoxic peptide is Laz.
- the cytotoxic peptide is Pa-CARD.
- the cytotoxic peptide is a fusion protein comprising the H.8 region of Laz.
- the fusion protein is H.8-Azu.
- the fusion protein is Azu-H.8.
- the invention further includes methods of killing leukemia and/or ovarian cancer cells by causing cell cycle arrest at the G2/M phase, comprising administering one or more cytotoxic peptides.
- the cytotoxic peptide stabilizes the Weel protein and/or increases the levels of Wee 1 protein in the cell, including but not limited to in the cytoplasm and/or nucleus of the cell.
- the cytotoxic peptide depletes phosphorylated AKT-Ser-473.
- the cytotoxic peptide both stabilizes/increases levels of the Weel protein and depletes phosphorylated AKT-Ser-473.
- the cytotoxic peptide is Azurin.
- the cytotoxic peptide is Laz. In yet another embodiment, the cytotoxic peptide is Pa-CARD. hi yet another embodiment, the cytotoxic peptide is one or more of the fusion proteins H.8-Azu and Azu-H.8.
- nucleic Acids Coding for a Cytotoxic Peptide and Expression Vectors provides nucleic acid molecules encoding the cytotoxic peptides and variants, derivatives, and/or structural equivalents thereof described herein.
- the nucleic acid molecule according to the invention can be prepared by a combination of known techniques in the art.
- the coding sequences used in these nucleic acids may be those found in the native genomic DNA encoding the particular peptide, or may be designed from known codons. These coding sequences may also be designed to take into account alternate codon usage and preferred codon usage of the organism in which the peptide is to be expressed.
- the nucleic acid sequences for the cytotoxic peptides may individually be prepared by chemical synthesis or cloning. The nucleic acid sequences may be then ligated together with ligase in order to give a nucleic acid molecule of interest.
- Vectors used to shuttle genetic material from organism to organism, can be divided into two general classes: cloning vectors are replicating plasmid or phage with regions that are essential for propagation in an appropriate host cell and into which foreign DNA can be inserted; the foreign DNA is replicated and propagated as if it were a component of the vector.
- An expression vector (such as a plasmid, yeast, or animal virus genome) is used to introduce foreign genetic material into a host cell or tissue in order to transcribe and translate the foreign DNA, such as the DNA of a cytotoxic peptide like Laz, Azurin, Pa-CARD, H.8-Azu, or Azu-H.8.
- the introduced DNA is operably-linked to elements such as promoters that signal to the host cell to highly transcribe the inserted DNA.
- Some promoters are exceptionally useful, such as inducible promoters that control gene transcription in response to specific factors. Operably-linking a cytotoxic peptide and variants and derivatives thereof to an inducible promoter can control the expression of the cytotoxic peptide and variants and derivatives thereof in response to specific factors.
- classic inducible promoters include those that are responsive to alpha- interferon, heat shock, heavy metal ions, and steroids such as glucocorticoids (Kaufman, Methods Enzymol. 185:487-511(1990)) and tetracycline.
- desirable inducible promoters include those that are not endogenous to the cells in which the construct is being introduced, but are responsive in those cells when the induction agent is exogenously supplied, hi general, useful expression vectors are often plasmids.
- useful expression vectors are often plasmids.
- other forms of expression vectors such as viral vectors (e.g., replication defective retroviruses, adenoviruses, and adeno-associated viruses) are contemplated.
- Vector choice is dictated by the organism or cells being used and the desired fate of the vector.
- vectors comprise signal sequences, origins of replication, marker genes, polylinker sites, enhancer elements, promoters, and transcription termination sequences.
- compositions comprising a Cytotoxic Peptide
- compositions comprising at least one cytotoxic peptide that is a cupredoxin or CARD-carrying protein, or variant, derivative, truncation, or structural equivalent of a cupredoxin or CARD-carrying protein, specifically in a pharmaceutical composition, alone or in combination with at least one other cytotoxic agent, hi specific embodiments, the pharmaceutical composition is designed for a particular mode of administration, for example, but not limited to, oral, intraperitoneal, or intravenous.
- Such compositions may be hydrated in water, or may be dried (such as by lyophilization) for later hydration.
- Such compositions may be in solvents other than water, such as but not limited to, alcohol.
- compositions of the invention containing a cytotoxic peptide can be manufactured in any conventional manner, e.g., by conventional mixing, dissolving, granulating, dragee-making, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- the cytotoxic peptide can be readily combined with a pharmaceutically acceptable carrier well-known in the art.
- a pharmaceutically acceptable carrier well-known in the art.
- Such carriers enable the preparation to be formulated as a tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, and the like.
- Suitable excipients may also include, for example, fillers and cellulose preparations.
- Other excipients can include, for example, flavoring agents, coloring agents, detackifiers, thickeners, and other acceptable additives, adjuvants, or binders.
- the composition includes carriers and excipients
- compositions of this invention including but not limited to buffers, carbohydrates, mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents, suspending agents, thickening agents and/or preservatives), water, oils, saline solutions, aqueous dextrose and glycerol solutions, other pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as buffering agents, tonicity adjusting agents, wetting agents and the like.
- suitable carrier known to those of ordinary skill in the art may be employed to administer the compositions of this invention, the type of carrier will vary depending on the mode of administration.
- Compounds may also be encapsulated within liposomes using well-known technology.
- Biodegradable microspheres may also be employed as carriers for the compositions of this invention. Suitable biodegradable microspheres are shown, for example, in U.S. Patent Nos. 4,897,268, 5,075,109, 5,928,647, 5,811,128, 5,820,883, 5,853,763, 5,814,344 and 5,942,252.
- "Compounds" as used herein, include the peptides, amino acid sequences, cargo compounds and complexes, and nucleic acids of the present invention.
- Intravenous fluids for use in preparing pharmaceutical compositions to administer the cytotoxic peptides and nucleic acids disclosed herein may be composed of crystalloids or colloids.
- Crystalloids as used herein are aqueous solutions of mineral salts or other water-soluble molecules.
- Colloids as used herein contain larger insoluble molecules, such as gelatin.
- Intravenous fluids may be sterile.
- Crystalloid fluids that may be used for intravenous administration include but are not limited to, normal saline (a solution of sodium chloride at 0.9% concentration), Ringer's lactate or Ringer's solution, and a solution of 5% dextrose in water sometimes called D5W, as described in Table 1.
- Table 1 Composition of Common Crystalloid Solutions
- compositions of the invention can be extended or optimized by several methods well known to those in the art, including but not limited to, circularized peptides (Monk et al, BioDrugs 19(4):261-78, (2005); DeFreest et al., J. Pept. Res. 63(5):409-19 (2004)), D,L-peptides (diastereomer), (Futaki et al, J. Biol. Chem. Feb 23;276(8):5836-40 (2001); Papo et al, Cancer Res. 64(16):5779-86 (2004); Miller et al, Biochem. Pharmacol.
- composition When administration is by injection, composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks solution, Ringer's solution, or physiological saline buffer.
- the solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the composition may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the proteins and a suitable powder base such as lactose or starch.
- composition When administration is by topical administration, the composition may be formulated as solutions, gels, ointments, creams, suspensions, and the like, as are well known in the art. In some embodiments, administration is by means of a transdermal patch. When administration is by suppository (e.g., rectal or vaginal), composition may also be formulated in compositions containing conventional suppository bases. When administration is oral, the composition can be readily formulated in combination with pharmaceutically acceptable carriers well known in the art.
- suppository e.g., rectal or vaginal
- composition When administration is oral, the composition can be readily formulated in combination with pharmaceutically acceptable carriers well known in the art.
- a solid carrier such as mannitol, lactose, magnesium stearate, and the like may be employed; such carriers enable the chemotaxin to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
- suitable excipients include fillers such as sugars, cellulose preparation, granulating agents, and binding agents.
- sustained-release formulations that include the composition allow for the release of the composition over extended periods of time, such that without the sustained release formulation, composition would be cleared from a subject's system, and/or degraded by, for example, proteases and simple hydrolysis before eliciting or enhancing an therapeutic effect.
- kits containing one or more of the following in a package or container: (1) a reagent comprising one or more cytotoxic peptides described herein; (2) a reagent containing a pharmaceutically acceptable adjuvant or excipient; (3) a vehicle for administration, such as a syringe; (4) instructions for administration.
- a reagent comprising one or more cytotoxic peptides described herein
- a vehicle for administration such as a syringe
- the kit components may also include one or more additional cytotoxic agents.
- the reagents are formulated for intravenous administration, and/or the vehicle of administration is appropriate for intravenous administration.
- the different components of the composition may be packaged in separate containers and admixed immediately before use. Such packaging of the components separately may permit long-term storage without losing the active components' functions.
- the reagents included in the kit can be supplied in containers of any sort such that the life of the different components are preserved and are not adsorbed or altered by the materials of the container.
- sealed glass ampules may contain lyophilized polypeptide or polynucleotide, or buffers that have been packaged under a neutral, non-reacting gas, such as nitrogen.
- Ampules may consist of any suitable material, such as glass, organic polymers, such as polycarbonate, polystyrene, etc., ceramic, metal or any other material typically employed to hold similar reagents.
- suitable containers include simple bottles that may be fabricated from similar substances as ampules, and envelopes, that may comprise foil-lined interiors, such as aluminum or an alloy.
- Containers include test tubes, vials, flasks, bottles, syringes, or the like.
- Containers may have a sterile access port, such as a bottle having a stopper that can be pierced by a hypodermic injection needle.
- Other containers may have two compartments that are separated by a readily removable membrane that upon removal permits the components to be mixed.
- Removable membranes may be glass, plastic, rubber, etc.
- Kits may also be supplied with instructional materials. Instructions may be printed on paper or other substrate, and/or may be supplied as an electronic-readable medium, such as a floppy disc, CD-ROM, DVD-ROM, Zip disc, videotape, audiotape, flash memory device, etc. Detailed instructions may not be physically -
- the laz gene from Neisseria gonorrhoeae was cloned (Fig. IA) based on its known sequence (SEQ ID NO: 1).
- the P. aeruginosa azurin gene (SEQ ID NO: 2), termed paz (Fig. IB), and the sequence of the H.8 epitope of laz from N. gonnerrhoeae (SEQ ID NO: 3), were used to clone in frame the H.8 epitope gene in the 5'-end of paz to produce K.8-paz (Fig. 1 C) or in the 3'-end of paz to generate paz- H.8 (Fig. ID), as described below.
- Human cancer cells, bacterial strains and plasmids are listed in Table 2.
- the human breast cancer MCF-7 cells and brain tumor LN-229 cells are from the stock culture collection of the Department of Surgical Oncology, University of Illinois at Chicago (UIC).
- the cells were cultured in MEM with Eagle's salt containing 2 mM L-glutamine, 0.1 mM MEM essential amino acids and supplemented with 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin and 100 ⁇ g/ml streptomycin. All cells were grown at 37°C in 5% CO 2 . (Yamada, et al., Proc. Natl. Acad. Sci. USA 99:14098-14103 (2002); Punj, et al, Oncogene 23:2367-2378 (2004)).
- the forward and reverse primers used were 5'-CCGGAATTCCGGCAGGGATGTTGTAAATATCCG-S' (SEQ ID NO: 4) and 5'-GGGGTACCGCCGTGGCAGGCATACAGCATTTCAATCGG-S' (SEQ ID NO: 5) where the additionally introduced restriction sites of EcoRI and Kpnl sites are underlined respectively.
- the plasmids expressing fusion H.8 of N. gonorrhoeae Laz and azurin of P. aeruginosa were constructed by PCR with pUC ⁇ 9-paz and pUC18-/ ⁇ z as templates.
- a 3.1 kb fragment was amplified with pUC18-/ ⁇ z as a template and primers, 5'-(phosphorylated)GGCAGCAGGGGCTTCGGCAGCATCTGC-3' (SEQ ID NO: 6) and 5'-CTGCAGGTCGACTCTAGAGGATCCCG-S' (SEQ ID NO: 7) where a Sail site is underlined.
- a PCR amplified a 0.4 kb fragment was obtained from p ⁇ JC19-paz as a template and primers,
- a 3.3 kb fragment was amplified with pUC19-paz as a template and primers , 5'-CTTCAGGGTCAGGGTGCCCTTCATC-S' (SEQ ID NO: 10) and 5'-CTGCAGGTCGACTCTAGAGGATCCCG-S' (SEQ ID NO: 11) where a BamHI site is underlined.
- a 0.13 kb fragment was amplified with pUC 1 %-laz as a template and primers,
- E. coli JMl 09 was used as a host strain for expression of azurin and its derivative genes.
- Recombinant E. coli strains were cultivated in 2 X YT medium containing 100 ⁇ g/ml ampicillin, 0.1 mM IPTG and 0.5 mM CuSO 4 for 16 h at 37°C to produce the azurin proteins.
- GST glutathione S- transferase
- the signal peptide and H.8-encoding region of laz was amplified by PCR with pUCl S-laz as template DNA.
- the forward and reverse primers used were 5'-GGAATTCATATGAAAGCTTATCTGGC-S' (SEQ ID NO: 16) and 5'-CCGGAATTCGGCAGCAGGGGCTTCGGC-B' (SEQ ID NO: 17) where the additionally introduced restriction sites of Ndel and EcoRI sites are underlined respectively.
- the H.8-encoding region was amplified by PCR with pUC18-/ ⁇ z as template DNA.
- the forward and reverse primers used were 5'-CGGGATCCCCTGCTCTCAAGAACCTGCCGCGCC-S' (SEQ ID NO: 18) and 5'-CGGAATTCTT ⁇ GGCAGCAGGGGCTTCGGCAGCATCTGCAGG -3' (SEQ ID NO: 19) where the additionally introduced restriction sites of B ⁇ mHIand EcoRI axe underlined and the introduced bacterial gene stop codon TTA is italicized.
- the GST-H.8 fusion region was then amplified by PCR with pGEX-5X-3-H.8 as a template DNA.
- the forward and reverse primers used were 5'-CGAGCTCATGTCCCCTATACTAGGTTATTGG-S' (SEQ ID NO: 20) and
- E. coli BL21 (DE3) was used as a host strain for expression of the gst and its fusions derivatives. When E. coli strains harboring these plasmids were grown in - -
- Example 2 Enhances the Cytotoxicity of P. aeruginosa Azurin Towards Glioblastoma Cells But Not Breast Cancer Cells The preferential entry of Paz towards cancer cells (Yamada, et al, Cell.
- the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl) tetrazolium bromide (MTT) assay was performed to determine the cytotoxicity toward cancer cells.
- Cells (5x10 3 per well) were seeded into 96-well culture plates in 100:1 of the medium at 37°C with 5% CO 2 - After overnight incubation, the supernatant was removed and fresh media containing proteins at various concentrations as specified were added to the attached cells. These cells were incubated for various time periods as specified before the number of live cells was determined by MTT assay by adding 10 ⁇ l of 5 mg/ml MTT (Sigma- Aldrich, St.
- the synthetic H.8 peptide had very little cytotoxicity towards either glioblastoma LN-229 (Fig. 2A) or breast cancer MCF-7 (Fig. 2B) cells.
- the effect of azurin (Paz) was dose dependent, albeit low, in glioblastoma (Fig. 2A) but not in breast cancer (Fig. 2B) cells with increasing cytotoxicity as the azurin concentration was raised from 10 ⁇ M to 40 ⁇ M.
- the cytotoxicity increased only marginally beyond a 6 h incubation period. Most notable was the difference in the cytotoxicity of Paz, Paz-H.8, H.8-Paz and Laz in glioblastoma and breast cancer cells.
- Paz, Paz- H.8, H.8-Paz and Laz had essentially identical cytotoxicities at all doses in MCF-7 cells for different periods of incubation (Fig. 2B), Paz had much lower cytotoxicity than Paz-H.8, H.8-Paz or Laz for glioblastoma cells, particularly at shorter periods of incubation (6 h).
- the H.8 moiety while itself lacking cytotoxicity, appeared to enhance the cytotoxicity of Paz, but only towards glioblastoma and not towards breast cancer cells.
- Example 4 H.8 moiety promotes Paz entry in glioblastoma but not in breast cancer cells
- H.8 fusion proteins in addition to H.8 alone where used. Since small peptides such as the 39-amino acid synthetic H.8 moiety have low stability in solution, we constructed glutathione S-transferase (GST) fusions with the H.8 moiety, similar to Paz-H.8 or H.8-Paz, such that H.8 was incorporated in the N-terminal of GST (H.8-GST) or in - - -
- GST-H.8 the C-terminal of GST (GST-H.8).
- GST fusion peptides The construction of the GST fusion peptides is described under Example 1.
- Alexa fluor 568-conjugated Paz, fluorescing red was incubated with unlabeled synthetic H.8 peptide, GST, GST-H.8 and H.8-GST fusion proteins separately, along with phosphate-buffered saline (PBS) as a control, and determined the internalization of 20 ⁇ M Paz mixture in LN-229 cells after incubation at 37°C for 30 min.
- the synthetic H.8 peptide when introduced separately along with Paz, did enhance Paz internalization (Fig. 5A) as compared to PBS (Fig. 5E), GST (Fig. 5B) or GST-H.8 (Fig. 5C).
- Example 5 Enhanced internalization of Paz in presence of H.8-GST in glioblastoma cells lead to higher cytotoxicity in such cells.
- H.8 epitope to allow enhanced internalization of a fusion or individual protein in glioblastoma LN-229 cells (Figs. 3 A, 4A and 5D) raised the question of whether H.8 as part of the N-terminal of H.8-Paz or Laz promoted crossing of the BBB and allow transport of these proteins from peripheral circulation to brain venules.
- Quantification of fluorescence was measured by using Adobe ® Photoshop ® as follows: one cell was selected by Lasso Tool of Photoshop , and the mean value was taken from red histogram of image menu. At least three different cells were measured for one sample and the standard deviation was calculated. Five hundred ⁇ g of Paz, H.8-Paz and Laz proteins, labeled with the infrared dye IRdye ® 800 CW (LI-COR Bioscience), was injected intraperitoneally into live nude mice. After 24 h, the mice were sacrificed, the brains were isolated and images were taken, using the LI-COR Odyssey ® Infrared Imaging system.
- Example 7 The H.8 Epitope, When Present in the N-Terminal, Allows Bacterial Surface Display of the Periplasmic Proteins.
- H.8 fusion derivatives were constructed in the N- and C-terminals of GST (Fig. 5) and Paz (Fig. 2 and Figs. 3A/B and 4AfB), as described in Example 1.
- E. coli strain BL21 (DE3) harboring pET29a-gst, pET29a-H.8.g ⁇ t or pET29a-g.rt-H.8 and E. coli strain JM109 harboring pUC19-p ⁇ z, pUC19-p ⁇ z-H.8, pUC18-H.8-/r ⁇ z or pUC18-/ ⁇ z were cultured at 37°C with 0.4 mM Isopropyl ⁇ -D-thiogalactoside (IPTG). One ml each of these bacterial cultures was centrifuged and the resultant pellets were collected.
- IPTG Isopropyl ⁇ -D-thiogalactoside
- the H.8 fusion proteins were purified (Fig. IE and Fig. 7A).
- the cellular localizations of GST, as well as the two H.8 fusions in the N- and C-terminals (H.8- GST and GST-H.8) are shown in Fig. 7B.
- All three proteins were hyper-expressed in E. coli and present in the whole cell lysates of E. coli, when detected by Western blotting using anti-GST antibodies (Fig. 7B).
- Fig. 7B When the periplasmic fractions were isolated from E. coli and the presence of the three proteins checked, GST and GST- H.8 proteins were detected in significant amounts (Fig. 7B, lanes 1 and 3 under periplasmic fraction) but only small amounts of the H.8-GST (Fig.
- Wildtype (wt) Azurin and mutant Azurin were purified as described in Yamada T et al., Proc Natl Acad Sci USA 99:14098-103 (2002) and Punj V et al., Oncogene 23:2367-78 (2004).
- Laz was purified using the same protocol as described in Hong CS et al., Cell Cycle 5:1633 ⁇ 41 (2006). In brief, Laz was expressed using a pUC18 vector in Escherichia coli. Cells were incubated for 24 h, spun down, and washed twice in PBS before being lysed for isolation of the periplasmic fraction. The periplasmic fraction is collected for Q sepharose exchange for protein purification.
- the fraction is concentrated and run on FPLC for isolation of the purified protein.
- the pET-SUMO expression vector which has SUMO fusion protein at its N82 terminal region was used for high level expression of soluble Arginine Deiminase and the caspase recruitment domain (CARD)-containing domain from P. aeruginosa ADI.
- CARD caspase recruitment domain
- aeruginosa with the following primer pair: F, fwd: 5'-ATGCACAATCTGCTGACCGAGACCATCCAG- 3' (SEQ ID NO: 28) and R, rev: 5'-TCAGGTCGAGGAGCCGTGGTCCTTGTC-S' (SEQ ID NO: 29).
- F fwd: 5'-ATGCACAATCTGCTGACCGAGACCATCCAG- 3'
- R rev: 5'-TCAGGTCGAGGAGCCGTGGTCCTTGTC-S' (SEQ ID NO: 29).
- the PCR product was directly ligated into a pET-SUMO TA cloning vector.
- the resulting expression vector was sequence confirmed and transformed into E. coli 90 strain BL21 (DE3).
- Triton X-100 [final concentration 0.01% (v/v)] was added and incubated for 5 min. 100 ⁇ l DNase and RNase were added per 500ml culture and incubated for 30 min at 37 °C. The cell suspension was centrifuged at 15,000 rpm for 35 min at 4 °C. The supernatant was loaded on pre-equilibrated 1 ml Ni-NTA column. After loading, the column was washed with buffer (50 mM Tris-Cl, 300 mM NaCl, 10% glycerol, 10 mM imidazole).
- SUMO-CARD was eluted with 25 ml step gradient of 50— 500 mM imidazole in elution buffer (100 mM Tris-Cl, 500 mM NaCl, 20 mM imidazole, pH, 8.9).
- the purified SUMO-CARD fractions were pooled and exchanged with a buffer (20 mM Tris— Cl, 150 mM NaCl, pH, 8.0) for SUMO protease digestion.
- the SUMO-CARD protein was then concentrated up to 1.5-2 ml. Then DTT was added to a final concentration of 1 mM.
- the digestion mixture was incubated at 30 °C for 2-3 h and the CARD polypeptide, called Pa-CARD, was purified by using nickel resin.
- the final protein concentration was measured with protein reagent (Pierce) using BSA as a standard.
- Cytotoxicity assay The MTT [3 -(4,5 dimethylthiazol-2-yl-2,5 tetrazolium bromide)] assay was used for the measurement of the cytotoxicity of wt and mutant Azurin as described Yamada T et al., Proc Natl Acad Sci USA 99:14098-103 (2002) and Punj V et al., Oncogene 23:2367-78 (2004).
- the water soluble tetrazolium salt, [3-(4,5 dimethylthiazol-2-yl-2,5 tetrazolium bromide)] is metabolized to the water insoluble formazan by intact mitochondrial dehydrogenases.
- the formazan is then solubilized by adding 2-propanol + 40 mM HCl for a 1-h incubation.
- 3 xlO 4 cells were treated with varying concentrations of Azurin, Laz or Pa-CARD, as well as 5-aza-2-deoxycytidine (DAC) as a positive control.
- DAC 5-aza-2-deoxycytidine
- the viability of the cells was estimated on the basis of formazan formed, which was detected spectrophotometrically by optical density at 570 nm.
- Cell cycle analysis HL60 and K562 cells (3 x 10 5 cells seeded per well in 24- well plates) were treated with wild type Azurin, Pa-CARD, or Laz (5 and 10 ⁇ M) for 48 h.
- the cells were washed twice with PBS and fixed with 70% ethanol for 24 h at -20°C. Fixed cells were washed twice with PBS and stained with 50 ⁇ g/ml of propidium iodide in PBS containing 20 ⁇ g/ml RNase A for 30 min in the dark and analyzed by flow cytometry (Becton Dickinson). The percentage of cells in different phases of the cell cycle was determined by MODFIT LT software.
- cytoplasmic and nuclear fractions were isolated using the NE-PER extraction reagent (Pierce) according to the manufacturer's protocol, with complete protease and phosphatase inhibitors (Sigma). Protein concentrations of the cell lysates were measured using the Bradford Bio-Rad assay. Cell lysate proteins were separated via SDS-PAGE and transferred to a PVDF membrane for immunoblotting.
- Membranes were blocked in Tris-buffered saline (0.15 M NaCl, 0.05 M Tris-HCl [pH 8.0], 0.05% Tween 20) containing 5% nonfat dry milk (Difco) and incubated overnight at 4°C with primary antibody (at recommended dilutions in TBST, 5% nonfat dry milk) with gentle agitation. After three washes for 5 min each with TBST, the membranes were probed with horseradish peroxidase-labeled goat anti-rabbit or rabbit anti-mouse antibody from Zymed Laboratories (San Francisco, CA) (1 :3000 in TBST, 5% nonfat dry milk) for 1 h at room temperature.
- membranes were incubated with a chemiluminescent substrate for 1 min at room temperature. To remove bound antibody between each antibody incubation, membranes were incubated in Restore Western blot stripping buffer (Pierce) according to the manufacturer's protocol and reprobed.
- Anti-B-actin was from Sigma.
- AKT, Wee 1, and anti-phospho- AKT-S 473 antibodies were from Cell Signaling Technology (Beverly, MA).
- the secondary antibodies, horseradish peroxidase-labeled goat anti-rabbit and rabbit anti-mouse was from Zymed Laboratories (San Francisco, CA). Confocal microscopy.
- Azurin and Laz proteins were conjugated with the fluorescent chemical AlexaFluor 568 (Molecular Probes) and incubated with HL60, K562, or normal peripheral blood mononuclear cells for 1 h. Entry of fluorescent chemically labeled peptide or protein into the cells was observed by confocal microscopy (model LC510, Carl Zeiss), as described in Yamada T et al., Cell Microbiol. 7:1418-31 (2005).
- AML cell line and K562 a CML cell line. Viability of cell lines HL60 and K562 were measured by their ability to metabolically reduce MTT to a purple formazan product after 24 h, 48 h and 72 h of treatment with Laz or Azurin at 10 ⁇ M (Fig. IA and B). 10 ⁇ M of protein turned out to be highly cytotoxic, reducing cell viability by more than 90%.
- Laz is a Neisserial protein with an Azurin component, which has substantial sequence identity with P. aeruginosa Azurin, but with an additional 39 amino acid peptide called an H8 epitope.
- H8 epitope modulates anticancer activity of Azurin
- the H.8 epitope was cloned in the N- and C-terminus of P. aeruginosa Azurin, giving rise to H8-Azurin (H8-Azu) and Azu-H8. Hong CS et al., Cell Cycle 5:1633-41 (2006). These two Laz-like proteins were also tested against the leukemia cell lines.
- K562 cells were treated with varying concentrations of protein, with final concentrations at 3.75 nM and upwards, while HL60 cells were treated with 1-10 ⁇ M final concentrations.
- Example 10 The entry of Laz and Azurin into HL60 and K562 cells
- Laz, Azurin and or 5-aza-2-deoxycytidine (DAC) were evaluated using flow cytometric analysis in K562 cells, which seemed to be highly susceptible.
- the effect of Laz, Azurin and DAC on K562 cell cycle arrest was observed (Fig. 11).
- Laz, Azurin and DAC are able to arrest K562 cells at G2/M.
- Cell cycle arrest at G2/M phase often leads to induction of apoptosis and cell death, as has been observed for Azurin and Laz. It is possible that proteins such as Laz and Azurin can influence the levels and or activity of G2 cell cycle regulators in leukemia cells.
- Weel protein is known to be a mediator of cell cycle arrest at G2/M phase. Many viral proteins have been shown to be able to arrest cell cycle at the G2 phase by interacting with and influencing Weel activity in vivo.
- the HL60 cells showed a significantly reduced level of Weel protein.
- Inhibiting phosphorylation of AKT at serine 473 and hence AKT activity is also associated with G2/M cell cycle arrest .
- Laz treatment also led to a significant decrease in AKT activity in HL60 cells as evidenced by a decrease in the levels of phosphorylated AKT serine 473 (Fig. 12).
- the decrease in AKT-P-Ser 473 levels were more pronounced in HL60 cells than in K562 cells, while the changes in nuclear Weel protein levels by Laz were more pronounced in K562 cells.
- Pa-CARD an anticancer bacterial protein, has activity against leukemia cells.
- arginini ADI has been reported to inhibit the proliferation of cultured human lymphatic leukemia cells by causing growth arrest in the Gl /S phase, leading to apoptosis. Gong H et al., Leukemia 14:826-9 (2000). ADI is believed to exert its action by depleting arginine, converting arginine to citrulline and ammonia. Arginine is a non-essential amino acid since mammalian cells can resynthesize it back from citrulline.
- argininini ADI is the discernible structural similarity of its N-terminal part to mammalian CARD proteins.
- the eukaryotic, primarily mammalian, CARD proteins carry a domain called caspase recruiment domain which is a protein-protein interaction motif.
- CARD-carrying proteins such as caspases are not only involved in the induction of apoptosis but also in proinflammatory cytokine production.
- a caspase such as caspase 1 is involved in the proteolytic processing of a cytokine such as IL-IB to allow its release from the cell in the activated form. Since IL-IB promotes angiogenesis and is hyperproduced in many tumors, CARD-carrying proteins such as caspase 1 are considered major targets for inhibitor development as anticancer agents.
- ADI guanidine-modifying enzyme
- DDAH dimethylarginine dimethylaminohydrolase
- AGAT arginine:glycine amidinotransferase
- This fusion protein was purified using Ni-NTA column and the CARD polypeptide was isolated as a homogeneous 17 kDa protein (Fig. 13 B).
- the activity of this protein called Pa- CARD because of its origin from P. aeruginosa ADI N-terminal CARD domain, as well as the ADI from P. aeruginosa (Pa-ADI, 46 kDa, Fig. 13 B), was then determined using solid tumor cell lines, fibrosarcoma HT- 1080, breast cancer MCF-7 and the leukemia cell line HL-60.
- Pa-CARD had significant cytotoxic activity against HT- 1080, MCF-7 and leukemia HL60 (Fig. 13 C) as well as other cancers, but less so for normal fibroblasts and normal breast cells such as MCF-IOA (data not shown). Since M. arginini ADI has been reported to inhibit human leukemia cell proliferation by inducing cell cycle arrest, the ability of Pa-CARD to induce cell cycle arrest in the cancer cells was also measured. Pa-CARD demonstrated significant arrest of the cell cycle (data not shown), as previously reported for Laz and Azurin (Fig. 11). Similar to Laz, Pa- CARD enhanced Weel protein level in the nuclear fraction of K562 cells but did not demonstrate such an activity in the HL60 cells (Fig. 12).
- MTTr3-(4.5-Dimethvlthiazol-2-vlV 2,5-diphenyltetrazoliumbromide) and propidium iodide were purchased from Sigma. Prestained gels were obtained from Biorad. pET SUMO kit and SUMO Protease were purchased from Invitrogen.
- the human cancer and normal cell lines SK-O V3, HOSE6-3, MCF-7, and HTl 080 cells are all from the stock culture collection of the Department of Surgical Oncology, University of Illinois at Chicago (UIC), Chicago.
- the cells were cultured in MEM with Eagle's salt containing 2 mM L-glutamine, 0.1 mM MEM essential amino acids and supplemented with 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin and 100 ⁇ g/ml streptomycin. All cells were grown at 37 °C in 5% CO2.
- MTT-C vtotoxicity Assay The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl) tetrazolium bromide (MTT) assay was performed as described in Example 8 to determine the cytotoxicity toward cancer cells.
- Caspase-3/7 Activity Assay Tests were performed in 96-well plates using caspase- GIo 3/7 (Promega) reagent as described in Yamada, T. et al. Proc. Natl. Acad. Sci. U.S.A, 2002, 99, 14098-14103.
- SKOV3 cells were seeded in 6 well plate at 10 6 cells per well in a volume of 2 ml per well.
- Cell pellets (>1 x 10 6 cells), were harvested and were fixed in 1 mL of 70% ethanol at 4°C for 60 min, washed in 1 mL of PBS and resuspended in 400 DL of PBS containing 0.5 mg of RNAse A (Sigma).
- a 100- ⁇ L aliquot of propidium iodide (1 g/L PBS) (Sigma) was added. The cells were incubated in the dark at room temperature for 15 min and then held at 4 0 C in the dark for flow cytometric analysis.
- At least 1 x 10 4 cells were analyzed for DNA content using a Becton-Dickinson FACS Calibur Flow Cytometer.
- the distribution of cells in sub-Gl, Gl, S and G2-M was determined using Multi Cycle AV software.
- Microarrav of TLR Pathway and NF-kB Signaling Genes SKOV3 cells (100,000 cells per well in a volume of 2 ml per well) were seeded on 6 well plate. Following treatment with proteins, cells were harvested with lysis buffer. The samples were sent to Superarray Biosciences for microarray of toll like receptor genes and NF- kB signaling genes.
- TUNEL Assay This technique identifies nuclei containing fragmented DNA by enzymatically incorporating fluoresceine-dUTP at the 3' end of DNA fragments using terminal deoxynucleotidyl transferase as described in Yamada, T. et al. Proc. Natl. Acad. Sci. U.S.A, 2002, 99, 14098-14103. - -
- Example 14 ADI has a Putative CARD-Like Domain
- Pa-ADI and Ma-ADI has the characteristic five ⁇ -subunits present in all the proteins of the guanidine-modifying enzyme superfamily of which Dimethylarginine dimethylaminohydrolase (DDAH) and Arginine:glycine amidinotransferase (AGAT) proteins are members (Fig. 14 B).
- DDAH Dimethylarginine dimethylaminohydrolase
- AGAT Arginine:glycine amidinotransferase
- both Pa-ADI and Ma-ADI have a unique 85 residue 5 -alpha helical bundle domain inserted precisely between the first and the second ⁇ -subunits giving the typical "Clip-on- fan" moiety (Fig. 14 B and 14 C). It is this region which exhibits structural similarity to the mammalian CARD-containing proteins. Since the CARD-like domain is present only in the Pa-ADI and Ma-ADI but not in the other members (Fig. 14 B), the recruitment of the CARD domain by ADI but not by other members of the family likely gives ADI its unique anticancer property.
- Pa-CARD has Anticancer Activity
- the CARD containing mammalian proteins have diverse functions, such as helicase, kinase and caspase activity.
- the CARD domain by itself is not known to have any other activity besides mediating formation of larger protein complexes via CARD-CARD interactions.
- bacteria compete with cancer cells for the same nutrition inside the body as a source of its survival and proliferation, it is possible that bacteria acquired the CARD domain from a mammalian source, presumably to interfere in cancer growth.
- the putative CARD domain with the hydrophobic pocket from Pa-ADI was cloned and purified, and its function as an anticancer agent as well as for any potential ADI- like activity was examined.
- the gene sequences of Pa-ADI encompassing amino acids 75-225 as well as the full-length ADI protein were cloned in frame with SUMO moiety from plasmid pET-SUMO (Invitrogen), giving rise to SUMOCARD fusion and SUMO-ADI proteins, as described in Example 8. These recombinant proteins were purified in a single step using a Ni-NTA column, followed by cleavage with SUMO protease. The homogeneity and SDS-PAGE migration patterns of these two bacterial proteins are shown in Fig. 15 A. As expected, the purified Pa-ADI migrated as a single band of Mw 46 JkDa, while the Pa-CARD migrated as a 17 kDa protein.
- Pa-ADI showed strong enzymatic activity while Pa-CARD had no such activity (Fig. 15 B), since the critical amino acids Cys-406 and His-278 of the catalytic triad of Pa-ADI are missing in Pa-CARD.
- M. arginini ADI (Ma-ADI) is known to have anticancer activity, although the presence of such activity has not been assessed in Pa-ADI or Pa-CARD.
- the growth inhibitory activities of Pa-ADI and Pa- CARD were checked against a range of human cancer cells such as fibrosarcoma HT- 1080, breast cancer MCF-7 and ovarian cancer SKO V-3 (Fig. 16 A).
- Pa-ADI and Pa-CARD demonstrated significant inhibitory activities against all the cancer cell types. Most interestingly, Pa-CARD had higher growth inhibitory activities than Pa- ADI against these cancer cells (Fig. 16 A). Since Pa-ADI and Pa-CARD demonstrated somewhat higher activity against the ovarian cancer SKOV-3 cells, the cytotoxicity of various concentrations of Pa-CARD (Fig. 16 B) and Pa-ADI (Fig. 16 C) as was determined a function of timeof incubation with these cells. While the cytotoxic activities were apparent during 24 hours of incubation, the activities were elevated significantly at higher concentrations (10 to 20 ⁇ M) during 48 hours of incubation. Once again Pa-CARD showed higher cytotoxicity compared to Pa-ADI in a concentration and time dependent manner.
- Fig. 17 A cancer cells are shown in Fig. 17 A. Both Pa-ADI and Pa-CARD have significant cytotoxic activity against SKOV-3 but very little cytotoxicity towards the normal ovarian cells. Azurin also demonstrated a similar cell death profile. Both Pa-CARD and azurin demonstrated lower cytotoxicity to the normal HOSE6-3 cells than cisplatin, a commonly used drug. Moreover, SKOV-3 cells treated with both Pa- CARD and cisplatin show somewhat higher cytotoxic effect as compared to when treated individually (Fig. 17 B), showing some additive effects.
- Example 17 Pa-CARD Induces Apoptosis in Cancer Cells Through Caspase Activation
- HOSE6-3 cells showed only a few cells fluorescing green (Fig. 18) under all conditions, confirming that Pa-CARD induces apoptotic cell death primarily in the cancer cells and not in the normal cells.
- Treatment with bovine serum albumin (BSA) or no protein treatment (control) showed very few green fluorescing cells and many blue (non apoptotic cells) in the field (Fig. 18, bottom row), demonstrating that the cancer or normal cells do not spontaneously undergo much apoptosis, unless treated by Pa-CARD, Pa-ADI or azurin.
- SKO V-3 and HOSE6-3 cells were measured in absence or in presence of Pa-ADI, Pa- CARD, Cisplatin and azurin.
- the caspase enzyme activity was determined by the Caspase-GloTM 3/7 assay kit (Promega).
- Pa-ADI and Pa-CARD were used in two different concentrations, 10 and 20 ⁇ M. Both Pa-ADI and Pa-CARD induced caspase 3/7 activation in a dose dependent manner, but only in the ovarian cancer SKO V-3 cells. Very little activation was seen in normal ovarian cells HOSE6-3 (Fig. 19).
- Mycoplasma arginini ADI (Ma-ADI) has previously been shown to inhibit the growth of hepatocellular carcinomas and to induce cell cycle arrest and apoptosis in leukemia cells.
- the induction of apoptosis through caspase activation is often known to be mediated by cell cycle arrest at the G2/M phase including in hepatoma, leukemia and other cancers.
- Example 19 Pa-CARD Modulates Expression of NF-kB Signaling Pathway Genes
- the effect of Pa-CARD in SKOV-3 cells was examined by measuring the expression of several genes involved in NF-kB signaling pathway. The goal was to identify candidate genes that may play a vital role in determining the fate of the SKOV-3 cells following treatment with Pa-CARD protein.
- SKOV-3 cells were incubated for 48 hours with 10 ⁇ M each of Pa-CARD and azurin and a control without any treatment. The total RNA was isolated to perform quantitative real time PCR microarray. The fold regulation was calculated by normalizing with the _ -
- GM-CSF colony stimulating factor 2
- GM-CSF granulocyte-macrophage colony-stimulating factor
- SKOV-3 cells were incubated for 48 hours with 10 ⁇ M each of CARD and azurin. As a control, one sample of SKOV-3 cells was left untreated. After incubation, cells were harvested and total RNA was extracted. The samples were analyzed using real-time PCR microarray analysis (Superarray Bioscience). Results were normalized to housekeeping genes. Values in bold indicate fold up regulation and numbers marked with asterisk (*) indicate down regulation relative to untreated control samples. Decreased expression is indicated with a minus sign. -
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA2753121A CA2753121A1 (en) | 2009-02-20 | 2010-02-22 | Compositions and methods to prevent and/or treat cancer with pa-card |
JP2011551270A JP2012518417A (en) | 2009-02-20 | 2010-02-22 | Compositions and methods for preventing and / or treating cancer using PA-CARD |
CN2010800160848A CN102387809A (en) | 2009-02-20 | 2010-02-22 | Compositions and methods to prevent and/or treat cancer with PA -CARD |
EP10744428A EP2398486A4 (en) | 2009-02-20 | 2010-02-22 | Compositions and methods to prevent and/or treat cancer with pa -card |
SG2011059458A SG174136A1 (en) | 2009-02-20 | 2010-02-22 | Compositions and methods to prevent and/or treat cancer with pa -card |
AU2010215858A AU2010215858A1 (en) | 2009-02-20 | 2010-02-22 | Compositions and methods to prevent and/or treat cancer with Pa -CARD |
IL214757A IL214757A0 (en) | 2009-02-20 | 2011-08-18 | Compositions and methods to prevent and/or treat cancer with pa-card |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US15423609P | 2009-02-20 | 2009-02-20 | |
US61/154,236 | 2009-02-20 | ||
US17943509P | 2009-05-19 | 2009-05-19 | |
US61/179,435 | 2009-05-19 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2010096754A1 true WO2010096754A1 (en) | 2010-08-26 |
WO2010096754A8 WO2010096754A8 (en) | 2011-04-28 |
Family
ID=42634238
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2010/024904 WO2010096754A1 (en) | 2009-02-20 | 2010-02-22 | Compositions and methods to prevent and/or treat cancer with pa -card |
Country Status (9)
Country | Link |
---|---|
EP (1) | EP2398486A4 (en) |
JP (1) | JP2012518417A (en) |
KR (1) | KR20120000062A (en) |
CN (1) | CN102387809A (en) |
AU (1) | AU2010215858A1 (en) |
CA (1) | CA2753121A1 (en) |
IL (1) | IL214757A0 (en) |
SG (1) | SG174136A1 (en) |
WO (1) | WO2010096754A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014049604A2 (en) * | 2012-09-05 | 2014-04-03 | Amrita Therapeutics Limited | A novel biomedical device for cancer therapy |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1959986B1 (en) | 2005-11-07 | 2014-07-23 | Indiana University Research and Technology Corporation | Glucagon analogs exhibiting physiological solubility and stability |
KR101764750B1 (en) * | 2013-02-05 | 2017-08-03 | 애그리컬쳐럴 테크놀로지 리서치 인스티튜트 | Anti-Mycoplasma Spp. Subunit Vaccine |
CN103554187B (en) * | 2013-09-18 | 2016-03-30 | 中国科学技术大学 | Platinum complexes, protein complex of being obtained by this platinum compound and preparation method thereof |
USD844857S1 (en) * | 2017-10-05 | 2019-04-02 | Western Interlock, Inc. | Retaining wall corner block |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000044888A2 (en) * | 1999-01-26 | 2000-08-03 | University College London | Dimethylarginine dimethylaminohydrolases |
US20060149037A1 (en) * | 2004-10-07 | 2006-07-06 | Ananda Chakrabarty | Cupredoxin derived transport agents and methods of use thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20020164703A1 (en) * | 2000-12-21 | 2002-11-07 | Krzysztof Pawlowski | Card-domain containing polypeptides, encoding nucleic acids, and methods of use |
GB0211295D0 (en) * | 2002-05-16 | 2002-06-26 | Univ London | Treatment of pain |
-
2010
- 2010-02-22 CA CA2753121A patent/CA2753121A1/en not_active Abandoned
- 2010-02-22 CN CN2010800160848A patent/CN102387809A/en active Pending
- 2010-02-22 EP EP10744428A patent/EP2398486A4/en not_active Withdrawn
- 2010-02-22 WO PCT/US2010/024904 patent/WO2010096754A1/en active Application Filing
- 2010-02-22 JP JP2011551270A patent/JP2012518417A/en active Pending
- 2010-02-22 KR KR1020117021883A patent/KR20120000062A/en not_active Application Discontinuation
- 2010-02-22 AU AU2010215858A patent/AU2010215858A1/en not_active Abandoned
- 2010-02-22 SG SG2011059458A patent/SG174136A1/en unknown
-
2011
- 2011-08-18 IL IL214757A patent/IL214757A0/en unknown
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000044888A2 (en) * | 1999-01-26 | 2000-08-03 | University College London | Dimethylarginine dimethylaminohydrolases |
US20060149037A1 (en) * | 2004-10-07 | 2006-07-06 | Ananda Chakrabarty | Cupredoxin derived transport agents and methods of use thereof |
Non-Patent Citations (7)
Title |
---|
"Cell-based tools for interrogating the PI3K/AkUmTor pathway.", BIOPROBES 56, June 2008 (2008-06-01), Retrieved from the Internet <URL:http:/Iwww.invitrogen.com/etdmedialib/en/filelibrary/cell_tissue_analysis/pdfs.Par.0390.File.dat/BioProbes56-Akt.pdf> [retrieved on 20100601] * |
"Human Apoptosis PCR Array.", SABIOSCIENCES, 22 August 2008 (2008-08-22), Retrieved from the Internet <URL:http://web.archive.org/web/20080822094730/http://www.sabiosciences.com/rt_product/HTML/PAHS-012A.html> [retrieved on 20100601] * |
"Human NF-B Signaling Pathway Microarray.", SUPER ARRAY, 16 March 2006 (2006-03-16), Retrieved from the Internet <URL:http://web.archive.org/web/20060316093545/www.superarray.com/gene_array_product/HTML/OHS.025.html> [retrieved on 20100601] * |
"Oligo GEArray Mouse Cell Cycle Microarray: OMM-020.", SUPER ARRAY, 16 March 2006 (2006-03-16), Retrieved from the Internet <URL:http://web.archive.org/web/20060316093333/www.superarray.com/gene_array_product/HTML/OMM-020.html> [retrieved on 20100601] * |
DRACH ET AL.: "Induction of differentiation in myeloid leukemia cell lines and acute promyelocytic leukemia cells by liposomal all-trans-retinoic acid.", CANCER RES, vol. 53, no. 9, 1 May 1993 (1993-05-01), pages 2100 - 2104, XP055097286 * |
ENSOR ET AL.: "Pegylated arginine deiminase (ADI-SS PEG20,000 mw) inhibits human melanomas and hepatocellular carcinomas in vitro and in vivo.", CANCER RES, vol. 62, no. 19, 1 October 2002 (2002-10-01), pages 5443 - 5450, XP002230768 * |
See also references of EP2398486A4 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2014049604A2 (en) * | 2012-09-05 | 2014-04-03 | Amrita Therapeutics Limited | A novel biomedical device for cancer therapy |
WO2014049604A3 (en) * | 2012-09-05 | 2014-09-25 | Amrita Therapeutics Limited | A novel biomedical device for cancer therapy |
Also Published As
Publication number | Publication date |
---|---|
EP2398486A1 (en) | 2011-12-28 |
CA2753121A1 (en) | 2010-08-26 |
IL214757A0 (en) | 2011-11-30 |
SG174136A1 (en) | 2011-10-28 |
CN102387809A (en) | 2012-03-21 |
AU2010215858A1 (en) | 2011-09-22 |
WO2010096754A8 (en) | 2011-04-28 |
JP2012518417A (en) | 2012-08-16 |
KR20120000062A (en) | 2012-01-03 |
EP2398486A4 (en) | 2012-11-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US8545812B2 (en) | Transport agents for crossing the blood-brain barrier and into brain cancer cells and methods of use thereof | |
US10889621B2 (en) | Compositions and methods for treating conditions related to ephrin signaling with Cupredoxins | |
WO2007018671A2 (en) | Compositions and methods for treating conditions related to ephrin signaling with cupredoxins | |
US10058585B2 (en) | Compositions and methods for treating conditions related to ephrin signaling with cupredoxins and mutants thereof | |
WO2010096754A1 (en) | Compositions and methods to prevent and/or treat cancer with pa -card | |
US9968685B2 (en) | Methods to treat cancer with cupredoxins | |
KR20110128878A (en) | Modifications of cupredoxin derived peptides and methods of use thereof | |
US10072049B2 (en) | Transport agents for crossing the blood-brain barrier and into brain cancer cells, and methods of use thereof | |
US20100278937A1 (en) | Compositions and methods to prevent and/or treat cancer with pa-card | |
US10675326B2 (en) | Compositions comprising cupredoxins for treating cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 201080016084.8 Country of ref document: CN |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10744428 Country of ref document: EP Kind code of ref document: A1 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 214757 Country of ref document: IL Ref document number: 2011551270 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2753121 Country of ref document: CA |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2010215858 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 7121/DELNP/2011 Country of ref document: IN Ref document number: 2010744428 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 20117021883 Country of ref document: KR Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2010215858 Country of ref document: AU Date of ref document: 20100222 Kind code of ref document: A |