WO2010094740A1 - Fibrosis susceptibility gene and uses thereof - Google Patents
Fibrosis susceptibility gene and uses thereof Download PDFInfo
- Publication number
- WO2010094740A1 WO2010094740A1 PCT/EP2010/052048 EP2010052048W WO2010094740A1 WO 2010094740 A1 WO2010094740 A1 WO 2010094740A1 EP 2010052048 W EP2010052048 W EP 2010052048W WO 2010094740 A1 WO2010094740 A1 WO 2010094740A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fibrosis
- ctgf
- snp
- hepatic
- alteration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates generally to the fields of genetics and medicine.
- the present invention discloses in particular the identification of a human fibrosis susceptibility gene, which can be used for the diagnosis or prognosis of fibrosis or for the detection of predisposition to fibrosis, occurring in hepatic diseases, in cirrhosis, cutaneous keloid, obesity and any fibrotic disease.
- the invention more particularly discloses certain alleles of the CTGF gene on chromosome 6 related to susceptibility to fibrosis and representing novel targets for the screening of therapeutically active drugs.
- the present invention relates more specifically to particular mutations in the CTGF gene and expression products, as well as to diagnostic tools and kits based on these mutations.
- the invention can be also used for the prevention and/or treatment of fibrosis occurring in all the fibrotic human diseases.
- Fibrosis is an excessive growth of fibrous connective tissue in an organ, any part, or tissue thereof, for example in a liver, any part or tissue thereof, especially in response to an injury.
- Abnormal fibrosis occurs in chronic hepatic inflammations of various aetiologies such as in Hepatitis Virus and Schistosome infections. It was shown previously that certain subjects infected by Schistosomes are slow fibrosers whereas others are rapid fibrosers and that this depends in part on a major gene located on Chr 6q22-q23 (Dessein et al., 1999; Mohamed-Ali et al., 1999).
- Schistosomiasis is caused by helminths that develop in the vascular system of their hosts and lay eggs that are for some of them carried over to the liver where they trigger inflammation in the periportal space. Since worms live for years in their human host, chronic liver inflammation associated with much tissue destruction is common in infected subjects. Tissue repair requires the deposit of extracellular matrix protein (ECMP) in the damaged tissues that are later on turned over and replaced by normal hepatocytes. In some patients ECMP accumulate in the periportal space forming fibrosis deposits that reduce blood flow causing varicose veins, ascites. After months or years of chronic or repeated injury, fibrosis becomes permanent and irreversible. Subjects die of the consequences of fibrosis. In South countries, it is estimated that 5 to 10% of the 350 millions of infected subjects may develop severe hepatic fibrosis. There is no good marker allowing to predict and follow hepatic fibrosis progression in Schistosome infected subjects.
- ECMP extracellular
- Diagnosis of hepatic fibrosis is mostly based on liver biopsy, elastometry (Boursier et al, 2008; Macias et al., 2008) and ultrasound analysis (Richter et al., 2001; Lambertucci et al., 2004; King et al., 2003).
- Biopsies are obtained via percutanous, transjugular, radiographically-guided fine-needle or laparoscopic route, depending upon the clinical setting. Histopathological examination enables the clinician to grade the severity of necroinflammation and stage the extent of fibrosis.
- liver biopsy is associated with significant morbidity of 3% and a mortality rate of 0.03% (Garcia-Tsao et al., 1993).
- Potential complications include local hematoma, infection and pain related to the biopsy.
- Noninvasive tests i.e., serologic markers, elastometry, ultrasound analysis
- Panels of blood markers have been tested mostly in patients with chronic hepatitis C or cirrhosis due to viral hepatitis C.
- a more recent study incorporated three panels of serum markers to devise an algorithmic approach that improved diagnostic accuracy (Parkes et al., 2006). The three panels evaluated were the APRI (aspartate transaminase to platelet ratio index), the Forns' index (platelets, gammaglutamyltranspeptidase, cholesterol) and the Fibrotest (GGT, haptoglobin, bilirubin, apo lipoprotein A, alpha-2-macroglobulin).
- Fibroscan is another innovative approach to staging hepatic fibrosis, which is based on elastography, which provides rapid measurement of mean hepatic tissue stiffness (Ziol et al, 2005). A probe is employed to transmit a vibration of low frequency and amplitude into the liver.
- This vibration wave triggers an elastic shear wave, whose velocity through the liver is directly proportional to tissuestiffness measured in kilopascals (kPa).
- Sensitivity of the Fibroscan technique ranged from 79 to 95%, and specificity from 78 to 95%, compared to the liver biopsy.
- the limitations of this technique are associated with attenuation of elastic waves in fluid or adipose tissue, which would impair assessment of fibrosis in patients.
- Fibroscan is an extremely expensive instrument. However, no efficient method exists to prognose the fibrosis progression and the treatment efficiency.
- hepatic fibrosis A large number of molecules have been tested for treatment of hepatic fibrosis. For example, corticosteroids have been used to suppress hepatic inflammation in autoimmune and alcoholic hepatitis (Czaja et al., 2003). Ursodeoxycholic acid has been proven to increase survival in PBC patients by binding bile acids, and thus also decreasing hepatic inflammation (Poupon et al., 1997). Neutralizing inflammatory cytokines with specific receptor antagonists (TNFalpha, IL-I receptor antagonists) and prostaglandin E have been tested in murine models, but not yet in humans (Bruck et al., 1997).
- Another attractive target in curtailing hepatic fibrosis is the downregulation of hepatic stellate cell activation.
- Interferon gamma is used in combination with ribavirin for therapy of hepatitis C infection. It is postulated that the antifibrotic effects of the interferons may be partially related to downregulation of stellate cell activation. This mechanism could explain the improvement in fibrosis described in patients with viral hepatitis C who do not have a virologic response to interferon alpha (Poynard et al., 1998). Trials of antioxidants (nacetylcysteine, alpha-tocopherol) are currently underway in humans.
- Angiotensin II receptors are upregulated in stellate cell activation, thus angiotensin converting enzyme inhibitors and angiotensin receptor blockers have demonstrated antifibrotic activity in vitro and in animals. This has yet to be replicated in humans (Jonsson et al., 2001). Promoting matrix degradation through matrix metalloproteinases is an antifibrotic strategy shown to be beneficial in a murine model (Iimuro et al., 2003). Specific apoptosis of hepatic stellate cells is another interesting theoretical idea, but has not yet been investigated (Gressner et al., 1998).
- Treatments aimed at reversing the fibrosis are usually too toxic for long-term use (i.e., corticosteroids, penicillamine) or have no proven efficacy (i.e., colchicine).
- corticosteroids i.e., penicillamine
- colchicine i.e., colchicine
- CTGF gene contributes to increasing fibrosis by synergizing with various pro-fibrogenic growth factors (Leask et al., 2006) including PGDF, VEGF and the master fibrogenic molecule TGF- ⁇ . More specifically CTGF acts as a TGF- ⁇ downstream modulator (Leask et al., 2006; Leask et al., 2003).
- TGF- ⁇ increases TGF- ⁇ binding to its receptor, interferes with the negative Smad-7 feedback loop on TGF- ⁇ (Wahab et al., 2005); it inhibits receptor binding of the principal TGF- ⁇ antagonist BPM-7 (Abreu et al., 2002).
- BPM-7 the principal TGF- ⁇ antagonist BPM-7
- An important consequence of CTGF action on TGF- ⁇ is the stimulation of the trans-differentiation of hepatic stellate cells and other parenchymal cells into ECMP producing myofibroblasts which is involved in progressive fibrotic process (Kalluri et al., 2003; Neilson et al., 2005).
- CTGF is also thought to increase ECMP networking trough its binding capacities to f ⁇ bronectin domains on ECMP (Gressner et al., 2007; Yoshida et al., 2007).
- CTGF is produced by a variety of cells including hepatocytes (Kobayashi et al., 2005; Gressner et al., 2007), hepatic stellate cells, myofibroblasts and endothelial cells (Gressnet et al., 2008).
- An overexpression of CTGF transcripts have been reported in different tissues including liver (Rachfal et al., 2003) affected by fibrosis of different aetiological origin. Experimental work in rats has shown that inhibiting CTGF by siRNAs prevents or reduces tissue fibrosis (Li et al., 2006; George et al., 2007).
- the purpose of the present invention is to provide a new genetic approach for fibrosis prognosis and treatment.
- the present invention now discloses the identification of a human fibrosis susceptibility gene locus, the CTGF gene locus (CCN2), which can be used for detecting predisposition to, diagnosis and prognosis of fibrosis, especially of hepatic fibrosis, as well as for the screening of therapeutically active drugs.
- the invention resides, in particular, in a method which comprises detecting in a sample from the subject the presence of an alteration in the CTGF gene locus (CCN2), the presence of said alteration being indicative of the presence or predisposition to fibrosis.
- a particular object of this invention resides in an in vitro method of detecting predisposition to or diagnosis and/or prognosis of fibrosis occurring in a subject, the method comprising detecting the presence of an alteration in the CTGF gene or polypeptide in a sample from the subject, the presence of said alteration being indicative of the presence of fibrosis or the predisposition to fibrosis.
- a particular object of this invention resides in a method for assessment (prediction) of the progression of fibrosis.
- said alteration is located within 20 kb, upstream the start codon of the CTGF gene and 20 kb, downstream the 3 'UTR of the CTGF gene.
- the alteration lies in the surrounding sequences of 15.3 kb region, upstream the starting codon of the CTGF gene and 14.1 kb region, downstream the untranslated region (3'UTR).
- said alteration is a mutation, an insertion or a deletion of one or more bases.
- said alteration is one or several single nucleotide polymorphism(s) SNP(s) or a haplotype of SNPs associated with fibrosis.
- said single nucleotide polymorphisms are SNPs flanking CTGF gene, which are allelic variants lying close to the CTGF gene.
- the method of the invention allows for detection and prognosis of fibrosis which occurs in a human fibrotic disease selected from hepatic diseases fibrosis, cirrhosis, cutaneous keloid, hypertrophic scars and obesity.
- a human fibrotic disease selected from hepatic diseases fibrosis, cirrhosis, cutaneous keloid, hypertrophic scars and obesity.
- the hepatic fibrosis may be caused by hepatic A virus, hepatic B virus, hepatic C virus (HCV), Schistosoma japonicum (S. japonicum) or Schistosoma mansoni (S. mansoni) infection.
- the method comprises detecting the presence of SNP rs9402373 and/or rs6918698 in the CTGF gene locus in a biological sample of a subject infected with HCV, wherein the presence of an allele C at position rs9402373 and/or allele G at position rs6918698 is indicative of a risk of developing a hepatic fibrosis or of the development of a hepatic fibrosis, or of a poor prognostic of hepatic fibrosis in the subject.
- the alteration in the CTGF gene locus is determined by performing a selective hydridization assay, a sequencing assay, a microsequencing assay, and/or an allele-specific amplification assay.
- said alteration in the CTGF gene is determined by restriction enzyme digestion, the detection of at least one said SNP being an indication of fibrosis.
- This invention also relates to a method for selecting a therapeutic compound for a subject that has or is predisposed to develop fibrosis, said method comprising contacting a test compound with a CTGF polypeptide or gene or a fragment thereof and determining the ability of said test compound to enhance or reduce biological activity or function of a pathway related to the CTGF gene.
- Correlation bins (r2>0.05) were as follows SNPs rs9321314, rs6940184, rsl2523697, rs9493149 and rsl2529636 were in bin 1 ;
- SNPs rsl2527705 and rsl2526196 in bin 2 SNPs rs9399005, rs6918698, and deletion/insertion (D/I) rs3037970 in bin 3; SNP rs2151532 and SNP rsl931002 in bin 4;
- SNPs rs9321314, rs6940184, rsl2523697, rs9493149 and rsl2529636 were in bin 1; SNPs rsl2527705 and rsl2526196 in bin 2; SNPs rs9399005, rs6918698 and D/I rs3037970 in bin 3; SNP rs2151532 and SNP rsl931002 in bin 4; SNPs rs9493150, rs928501, rsl 1966728, rsl2198610 and a new insertion / deletion (132319925 -/GAAA) were in bin 5; SNPs rs7747601, rs7768619 and rs9402373 in bin 6; SNPs rsl2527379 and rs2095252 in bin 7.
- the analysis was adjusted on gender (p ⁇ 0.001) exposure (fishing years: p ⁇ 0.001, born on boat: p ⁇ 0.01) and
- D/I rs3037970 excluded rs6918698 in a multivariate analysis testing simultaneously both SNPs.
- SNP rsl 931002 excluded SNP rs2151532;
- SNP rsl256196 excluded SNP rsl2527705 and SNP rs9399005.
- SNPs or deletions rsl2526196, rs30337970, rsl931002, rs9402373 had the strongest association with hepatic fibrosis (HF).
- EMSA were performed according to Materials and Methods using nuclear extracts of a stimulated human hepatocyte cell line (HEPG2).
- HEPG2 stimulated human hepatocyte cell line
- SNP rs9402373C allele bound nuclear factors (complex 2) that were not bound by the G allele. No allele specific binding was observed with SNP rsl2527705 and SNP rsl931002.
- Figure 2B Competitive electrophoretic mobility shift assay for rs9402373 polymorphism.
- Competitive reactions were done with 100 or 200 fmol of unbiotinylated rs9402373G and C probe.
- Figure 3 shows the meta analysis of the association of SNP rs9402373 with hepatic fibrosis in HCV or Schistosome infected subjects.
- This invention identifies the most critical steps in fibrosis development and provides valuable genetic markers to predict disease progression in fibrosis, especially in hepatic fibrosis.
- the inventors have now identified the major gene associated with human fibrosis. They have shown that fibrosis in two Chinese, one Sudanese and one Brazilian cohort infected with Schistosoma japonicum and with Schistosoma mansoni respectively is markedly dependent on allelic variants lying in the CTGF gene. Two of these variants affect nuclear factor binding.
- nucleic acid samples from individuals with fibrosis were submitted to a particular analysis process.
- Four populations with hepatic fibrosis were examined, inter alia a population of fishermen of the Dong Ting lake in central China infected with Schistosoma japonicum, a population of farmers living in Hunan province also infected with Schistosoma japonicum.
- the inventors first examined fibrosis in Fishermen of the Dong Ting lake in central China near Yueyang city. Analysis of the various factors that influence the development of fibrosis in the fishermen population has shown that gender, exposure to infected waters and anti- schistosome treatments with Praziquantel were significantly associated with the risk of fibrosis. The testing of several covariates has shown that the "the number of years fishing" and “being born on a fishing boat" were the best covariates to measure exposure. The "treatment” covariate is the number of Praziquantel treatments over the last twenty years.
- a particular object of this invention resides in a method of detecting predisposition to and/or prognosis of fibrosis, the method comprising detecting the presence of one or several SNPs or alteration selected in the group consisting of rsl2527705, rsl2526196, rs9399005, rs6918698, rs3037970, 1931002, rs2151532 and rs9402373.
- C allele of rs9402373 or T allele of rsl2526196 specifically binds nuclear factors SRY, Lyf- 1 , CdxA, CP2, Ik-2, or Nkx-2.
- SNPs rs6918698 and rs9402373 were shown to be associated with hepatis fibrosis in HCV infected subjects.
- allele C of rs9402373 was shown to be deleterious, i.e. it is strongly correlated with severe hepatic fibrosis.
- the present invention is not limited to the particular SNPs that were found significantly correlated with fibrosis in all tested populations. Indeed, several reasons could account for the failure in confirming significant correlation in some populations, including an insufficient cohort, the incomplete assessment of confounding variables, a lower frequency of the SNPs in said populations, etc.
- fibrosis designates all types of human fibrosis occurring in all the fibrotic human diseases, for example in hepatic diseases, cirrhosis, cutaneous keloid, hypertrophic scars, sclerodermia, obesity and any fibrotic disease.
- hepatic fibrosis or “HF” designates all types of fibrosis occurring in a liver, tissue thereof or any part of tissue thereof. Hepatic fibrosis occurs especially in response to an injury. Hepatic fibrosis can be the common response to chronic liver injury, ultimately leading to cirrhosis and its complications, portal hypertension, liver failure, and hepatocellular carcinoma.
- Hepatic fibrosis is overly exuberant wound healing in which excessive connective tissue builds up in the liver.
- the extracellular matrix is either overproduced, degraded deficiently, or both.
- the trigger is chronic injury, especially if there is an inflammatory component.
- Various types of chronic liver injury can cause fibrosis, such as chemical fibrosis (CCU), bacterial (i.e., brucellosis), parasitic (i.e., bilharziosis / schistosomiasis caused by Schistosoma species; or echinococcosis infections) or viral (i.e., hepatitis caused by hepatic A virus (HAV), hepatic B virus (HBC) or hepatic C virus (HCV) infections).
- CCU chemical fibrosis
- HAV hepatic A virus
- HBC hepatic B virus
- HCV hepatic C virus
- cutaneous keloid is an excessive growth of scar tissue on the skin. More particularly, keloids and hypertrophic scars (HSc) are dermal fibroproliferative disorders unique to humans that occur following trauma, inflammation, surgery, burns and sometimes spontaneously. These are characterized by excessive deposition of collagen in the dermis and the subcutaneous tissues. Contrary to the fine line scar characteristics of normal wound repair, the exuberant scarring of keloid and HSc results typically in disfigurement, contractures, pruritis and pain. Keloids occur in individuals with a familial disposition among the Blacks, Hispanics and Orientals. Unlike HSc, the keloid scars enlarge and extend beyond the margins of the original wound and rarely regress.
- HSc hypertrophic scars
- keloids are fibrotic tissue characterized by a collection of atypical fibroblasts with excessive deposition of extracellular matrix components, especially collagen, fibronectin, elastin, and proteoglycans. Generally, keloids contain relatively acellular centers and thick, abundant collagen bundles that form nodules in the deep dermal portion of the lesion.
- the release and activation of growth factors during the inflammatory phase of healing are pre-requisites for the scar processes, including angiogenesis, reepithelialization, recruitment and proliferation of fibroblasts and matrix deposition. Then, abnormal production of activity of the regulating cytokine including CTGF, could contribute to the development of keloids.
- the CTGF gene locus (Connection Tissue Growth Factor), also called CCN2 gene locus, designates all sequences or products in a cell or organism, including CTGF coding sequences, CTGF non-coding sequences (e.g., introns), CTGF regulatory sequences controlling transcription and/or translation (e.g., promoter, enhancer, terminator, etc.), all corresponding expression products, such as CTGF RNAs (e.g., mRNAs) and CTGF polypeptides (e.g., a pre-protein and a mature protein); as well as surrounding sequences of 20 kb region, preferably 15.3 kb region, upstream the starting codon of the CTGF gene and 20 kb region, preferably 14.1 kb region, downstream the untranslated region (3'UTR).
- CTGF locus comprises surrounding sequences comprising the 61 SNPs identified by sequencing ( Figure 1) and in particular 8 SNPs of Table 1.
- Figure 1 the starting codon of the CTGF gene locus
- prognosis includes the detection, monitoring, dosing, comparison, etc., at various stages, including early, pre-symptomatic stages, and late stages, in adults, children and pre-birth.
- Prognosis typically includes the assessment (prediction) of the progression of fibrosis and the characterization of a subject to define most appropriate treatment (pharmaco-genetics), etc.
- the present invention provides prognostic methods to determine the speed of the progression of fibrosis or an associated disorder resulting from a mutation or a polymorphism in the CTGF gene locus.
- Prognosis which analyzes and predicts response to a treatment or drug, or side effects to a treatment or drug, aims at determining whether an individual should be treated with a particular treatment drug. For example, if the prognosis indicates a likelihood that an individual will respond positively to treatment with a particular drug, the drug may be administered to the individual. Conversely, if the prognostic indicates that an individual is likely to respond negatively to treatment with a particular drug, an alternative course of treatment may be prescribed. A negative response may be defined as either the absence of an efficacious response or the presence of toxic side effects. Clinical drug trials represent another application for the CTGF gene locus SNPs.
- CTGF SNPs indicative of response to a drug or to side effects to a drug may be identified using the methods described above. Thereafter, potential participants in clinical trials of such an agent may be screened to identify those individuals most likely to respond favourably to the drug and exclude those likely to experience side effects. In that way, the effectiveness of drug treatment may be measured in individuals who respond positively to the drug, without lowering the measurement as a result of the inclusion of individuals who are unlikely to respond positively in the study and without risking undesirable safety problems.
- the alteration may be determined at the level of the CTGF DNA, RNA or polypeptide.
- the detection is performed by sequencing all or part of the CTGF gene locus or by selective hybridization or amplification of all or part of the CTGF gene locus. More preferably a CTGF gene locus specific amplification is carried out before the alteration identification step.
- An alteration in the CTGF gene locus may be any form of mutation(s), deletion(s), rearrangement(s) and/or insertions in the coding and/or non-coding region of the locus, alone or in various combination(s). Mutations more specifically include point mutations.
- Deletions may encompass any region of two or more residues in a coding or non- coding portion of the gene locus, such as from two residues up to the entire gene or locus. Typical deletions affect smaller regions, such as domains (introns) or repeated sequences or fragments of less than about 50 consecutive base pairs, although larger deletions may occur as well. Insertions may encompass the addition of one or several residues in a coding or non- coding portion of the gene locus. Insertions may typically comprise an addition of between 1 and 50 base pairs in the gene locus. Rearrangement includes inversion of sequences.
- the CTGF gene locus alteration may result in the creation of stop codons, frameshift mutations, amino acid substitutions, particular RNA splicing or processing, product instability, truncated polypeptide production, etc.
- the alteration may result in the production of a CTGF polypeptide with altered function, stability, targeting or structure.
- the alteration may also cause a reduction in protein expression or, alternatively, an increase in said production.
- said alteration is a mutation, an insertion or a deletion of one or more bases.
- the alteration in the CTGF gene locus is selected from a point mutation, a deletion and an insertion in the CTGF gene or corresponding expression product, more preferably a point mutation and a deletion.
- the alteration may be determined at the level of the CTGF DNA, RNA or polypeptide.
- a particular object of this invention is a method of detecting predisposition to and/or prognosis of fibrosis, the method comprising detecting the presence of one or several alterations or SNPs selected in the group consisting of rs9402373, rsl931002, rsl2526196, rsl257379, rsl2527705, rs9399005, rs6918698, rs3037970, rs2151532, rs9321314, rs9321315, rs6910279, rs6940184, rsl2523697, rs9493149, rsl2529636, rs6917644, rs9493150, rs928501, rsl 1966728, rs7747601, rsl2198610, 132319925 D/I, rs9483364, rs2095252, rs6926879, rs34118837
- the 132319925 D/I (deletion/insertion) polymorphism is a new polymorphism that was never described before. To be able to identify this polymorphism the inventors gave as name the position according to the coordinate system and D/I to indicate that this polymorphism induces a deletion or an insertion. This polymorphism can be also written 132319925- /GAAA.
- said alteration(s) or SNP(s) associated with fibrosis is(are) selected from the group consisting of rsl2527705, rsl2526196, rs9399005, rs6918698, rs3037970, rsl931002, rs2151532 and rs9402373. More preferably, said rs9402373C and rsl2526196T alleles preferentially bind nuclear factors.
- Alterations in the CTGF gene may be detected by determining the presence of an altered CTGF RNA expression.
- Altered RNA expression includes the presence of an altered RNA sequence, the presence of an altered RNA splicing or processing, the presence of an altered quantity of RNA, etc. These may be detected by various techniques known in the art, including by sequencing all or part of the CTGF RNA or by selective hybridisation or selective amplification of all or part of said RNA, for instance.
- the method comprises detecting the presence of an altered CTGF polypeptide expression.
- Altered CTGF polypeptide expression includes the presence of an altered polypeptide sequence, the presence of an altered quantity of CTGF polypeptide, the presence of an altered tissue distribution, etc. These may be detected by various techniques known in the art, including by sequencing and/or binding to specific ligands (such as antibodies), for instance.
- CTGF gene or RNA expression or sequence may be used to detect or quantify altered CTGF gene or RNA expression or sequence, including sequencing, hybridisation, amplification and/or binding to specific ligands (such as antibodies).
- Other suitable methods include allele-specific oligonucleotide (ASO), allele-specific amplification, Southern blot (for DNAs), Northern blot (for RNAs), single-stranded conformation analysis (SSCA), PFGE, fluorescent in situ hybridization (FISH), gel migration, clamped denaturing gel electrophoresis, heteroduplex analysis, RNase protection, chemical mismatch cleavage, ELISA, radio-immunoassays (RIA) and immuno-enzymatic assays (IEMA).
- ASO allele-specific oligonucleotide
- SSCA single-stranded conformation analysis
- FISH fluorescent in situ hybridization
- gel migration clamped denaturing gel electrophoresis, heteroduplex analysis, RNase protection, chemical mis
- Some of these approaches are based on a change in electrophoretic mobility of the nucleic acids, as a result of the presence of an altered sequence. According to these techniques, the altered sequence is visualized by a shift in mobility on gels. The fragments may then be sequenced to confirm the alteration. Some others are based on specific hybridization between nucleic acids from the subject and a probe specific for wild-type or altered CTGF gene or RNA. The probe may be in suspension or immobilized on a substrate. The probe is typically labelled to facilitate detection of hybrids. Some of these approaches are particularly suited for assessing a polypeptide sequence or expression level, such as Northern blot, ELISA and RIA. These latter require the use of a ligand specific for the polypeptide, more preferably of a specific antibody.
- the method comprises detecting the presence of an altered CTGF gene expression profile in a sample from the subject. As indicated above, this can be accomplished more preferably by sequencing, selective hybridisation and/or selective amplification of nucleic acids present in said sample.
- Sequencing Sequencing can be carried out using techniques well known in the art, using automatic sequencers.
- the sequencing may be performed on the complete CTGF gene locus or, more preferably, on specific domains thereof, typically those known or suspected to carry deleterious mutations or other alterations.
- Amplification is based on the formation of specific hybrids between complementary nucleic acid sequences that serve to initiate nucleic acid reproduction.
- Amplification may be performed according to various techniques known in the art, such as by polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). These techniques can be performed using commercially available reagents and protocols. Preferred techniques use allele-specific PCR or PCR-SSCP. Amplification usually requires the use of specific nucleic acid primers, to initiate the reaction.
- Nucleic acid primers useful for amplifying sequences from the CTGF gene locus are able to specifically hybridize with a portion of the CTGF gene locus that flank a target region of said locus, said target region being altered in certain subjects having fibrosis or associated disorders. Examples of such target regions are provided in Table 2.
- Another particular object of this invention resides in a nucleic acid primer useful for amplifying sequences from the CTGF gene or locus including surrounding regions. Such primers are preferably complementary to, and hybridize specifically to nucleic acid sequences in the CTGF gene locus.
- Particular primers are able to specifically hybridize with a portion of the CTGF gene locus that flank a target region of said locus, said target region being altered in certain subjects having fibrosis or associated disorders.
- Primers that can be used to amplify CTGF target region comprising SNPs as identified in Table 2 may be designed based on their sequence or on the genomic sequence of CTGF.
- the invention also relates to a nucleic acid primer, said primer being complementary to and hybridizing specifically to a portion of a CTGF gene locus coding sequence (e.g., gene or RNA) altered in certain subjects having fibrosis or associated disorders.
- a CTGF gene locus coding sequence e.g., gene or RNA
- particular primers of this invention are specific for altered sequences in a CTGF gene locus or RNA.
- the invention also concerns the use of a nucleic acid primer or a pair of nucleic acid primers as described above in a method of detecting the presence of or predisposition to fibrosis or an associated disorder in a subject or in a method of assessing the response of a subject to a treatment of fibrosis or an associated disorder.
- Selective hybridization Hybridization detection methods are based on the formation of specific hybrids between complementary nucleic acid sequences that serve to detect nucleic acid sequence alteration(s).
- a particular detection technique involves the use of a nucleic acid probe specific for wild-type or altered CTGF gene or RNA, followed by the detection of the presence of a hybrid.
- the probe may be in suspension or immobilized on a substrate or support (as in nucleic acid array or chips technologies).
- the probe is typically labeled to facilitate detection of hybrids.
- a particular embodiment of this invention comprises contacting the sample from the subject with a nucleic acid probe specific for an altered CTGF gene locus, and assessing the formation of an hybrid.
- the method comprises contacting simultaneously the sample with a set of probes that are specific, respectively, for wild type CTGF gene locus and for various altered forms thereof.
- a probe refers to a polynucleotide sequence which is complementary to and capable of specific hybridization with a (target portion of a) CTGF gene or RNA, and which is suitable for detecting polynucleotide polymorphisms associated with CTGF alleles which predispose to or are associated with fibrosis.
- Probes are preferably perfectly complementary to the CTGF gene, RNA, or target portion thereof. Probes typically comprise single-stranded nucleic acids of between 8 to 1000 nucleotides in length, for instance of between 10 and 800, more preferably of between 15 and 700, typically of between 20 and 500. It should be understood that longer probes may be used as well.
- a preferred probe of this invention is a single stranded nucleic acid molecule of between 8 to 500 nucleotides in length, which can specifically hybridize to a region of a CTGF gene locus or RNA that carries an alteration.
- the method of the invention employs a nucleic acid probe specific for an altered (e.g., a mutated) CTGF gene or RNA, i.e., a nucleic acid probe that specifically hybridizes to said altered CTGF gene or RNA and essentially does not hybridize to a CTGF gene or RNA lacking said alteration.
- Specificity indicates that hybridization to the target sequence generates a specific signal which can be distinguished from the signal generated through non-specific hybridization. Perfectly complementary sequences are preferred to design probes according to this invention. It should be understood, however, that certain mismatch may be tolerated, as long as the specific signal may be distinguished from non-specific hybridization.
- probes are nucleic acid sequences complementary to a target portion of the genomic region including the CTGF gene locus or RNA carrying a point mutation as listed in Table 1 above. More particularly, the probes can comprise a sequence selected from the group consisting of SEQ ID NO 1 to 8 or a fragment thereof comprising the SNP or a complementary sequence thereof.
- the sequence of the probes can be derived from the sequences of the CTGF gene and RNA as provided in the present application. Nucleotide substitutions may be performed, as well as chemical modifications of the probe. Such chemical modifications may be accomplished to increase the stability of hybrids (e.g., intercalating groups) or to label the probe.
- Typical examples of labels include, without limitation, radioactivity, fluorescence, luminescence, enzymatic labelling, etc.
- the invention also concerns the use of a nucleic acid probe as described above in a method of detecting the presence of or predisposition to fibrosis or an associated disorder in a subject or in a method of assessing the response of a subject to a treatment of fibrosis or an associated disorder.
- alteration in the CTGF gene locus may also be detected by screening for alteration(s) in CTGF polypeptide sequence or expression levels.
- contacting the sample with a ligand specific for a CTGF polypeptide and determining the formation of a complex is also described.
- Different types of ligands may be used, such as specific antibodies.
- the sample is contacted with an antibody specific for a CTGF polypeptide and the formation of an immune complex is determined.
- Various methods for detecting an immune complex can be used, such as ELISA, radio-immunoassays (RIA) and immuno-enzymatic assays (IEMA).
- an antibody designates a polyclonal antibody, a monoclonal antibody, as well as fragments or derivatives thereof having substantially the same antigen specificity. Fragments include Fab, Fab'2, CDR regions, etc. Derivatives include single-chain antibodies, humanized antibodies, poly- functional antibodies, etc.
- An antibody specific for a CTGF polypeptide designates an antibody that selectively binds a CTGF polypeptide, i.e., an antibody raised against a CTGF polypeptide or an epitope-containing fragment thereof. Although non-specific binding towards other antigens may occur, binding to the target CTGF polypeptide occurs with a higher affinity and can be reliably discriminated from non-specific binding.
- a diagnostic kit comprising products and reagents for detecting in a sample from a subject the presence of an alteration in the CTGF gene locus or polypeptide, in the CTGF gene or polypeptide expression, and/or in CTGF activity.
- Said diagnostic kit comprises any primer, any pair of primers, any nucleic acid probe and/or any ligand, preferably antibody, described in the present invention.
- Said diagnostic kit can further comprise reagents and/or protocols for performing a hybridization, amplification or antigen-antibody immune reaction.
- any SNP in linkage disequilibrium with a first SNP associated with fibrosis or an associated disorder will be associated with this trait. Therefore, once the association has been demonstrated between a given SNP and fibrosis, the discovery of additional SNPs associated with this trait can be of great interest in order to increase the density of SNPs in this particular region.
- Identification of additional SNPs in linkage disequilibrium with a given SNP involves: (a) amplifying a fragment from the genomic region comprising or surrounding a first SNP from a plurality of individuals; (b) identifying of second SNP in the genomic region harboring or surrounding said first SNP; (c) conducting a linkage disequilibrium analysis between said first SNP and second SNP; and (d) selecting said second SNP as being in linkage disequilibrium with said first marker. Sub-combinations comprising steps (b) and (c) are also contemplated. These SNPs in linkage disequilibrium can also be used in the methods according to the present invention, and more particularly in the diagnosic methods according to the present invention. Causal Mutation
- Mutations in the CTGF gene locus which are responsible for fibrosis may be identified by comparing the sequences of the CTGF gene locus from patients presenting fibrosis or an associated disorder and control individuals. Based on the identified association of SNPs of CTGF, the identified locus can be scanned for mutations. In a preferred embodiment, functional regions such as exons and splice sites, promoters and other regulatory regions of the CTGF gene locus are scanned for mutations.
- patients presenting fibrosis carry the mutation shown to be associated with fibrosis and control individuals do not carry the mutation or allele associated with fibrosis. It might also be possible that patients presenting fibrosis carry the mutation shown to be associated with fibrosis with a higher frequency than control individuals.
- the method used to detect such mutations generally comprises the following steps: amplification of a region of the CTGF gene locus comprising a SNP or a group of SNPs associated with fibrosis from DNA samples of the CTGF gene locus from patients presenting fibrosis and control individuals; sequencing of the amplified region; comparison of DNA sequences of the CTGF gene from patients presenting fibrosis or an associated disorder and control individuals; determination of mutations specific to patients presenting fibrosis.
- Drug screening New methods for the screening of drug candidates or leads are also described. These methods include binding assays and/or functional assays, and may be performed in vitro, in cell systems, in animals, etc.
- a particular object of this invention resides in a method of selecting biologically active compounds, said method comprising contacting in vitro a test compound with a CTGF gene or polypeptide according to the present invention and determining the ability of said test compound to bind said CTGF gene or polypeptide. Binding to said gene or polypeptide provides an indication as to the ability of the compound to modulate the activity of said target, and thus to affect a pathway leading to fibrosis in a subject.
- the method comprises contacting in vitro a test compound with a CTGF polypeptide or a fragment thereof according to the present invention and determining the ability of said test compound to bind said CTGF polypeptide or fragment.
- the fragment preferably comprises a binding site of the CTGF polypeptide.
- said CTGF gene or polypeptide or a fragment thereof is an altered or mutated CTGF gene or polypeptide or a fragment thereof comprising the alteration or mutation.
- a particular object of this invention resides in a method of selecting compounds active on fibrosis, said method comprising contacting in vitro a test compound with a CTGF polypeptide according to the present invention or binding site-containing fragment thereof and determining the ability of said test compound to bind said CTGF polypeptide or fragment thereof.
- said CTGF polypeptide or a fragment thereof is an altered or mutated CTGF polypeptide or a fragment thereof comprising the alteration or mutation.
- the method for the screening of drug candidates comprises contacting a recombinant host cell expressing a CTGF polypeptide according to the present invention with a test compound, and determining the ability of said test compound to bind said CTGF and to modulate the activity of CTGF polypeptide.
- said CTGF polypeptide or a fragment thereof is an altered or mutated CTGF polypeptide or a fragment thereof comprising the alteration or mutation.
- the determination of binding may be performed by various techniques, such as by labelling of the test compound, by competition with a labelled reference ligand, etc.
- the method of selecting biologically active compounds also comprises contacting in vitro a test compound with a CTGF polypeptide and determining the ability of said test compound to modulate the activity of said
- CTGF polypeptide is an altered or mutated CTGF polypeptide or a fragment thereof comprising the alteration or mutation.
- the method of selecting biologically active compounds for a subject that has or is predisposed to develop fibrosis also comprises contacting in vitro a test compound with a CTGF gene according to the present invention and determining the ability of said test compound to modulate the expression of said CTGF gene.
- said CTGF gene or a fragment thereof is an altered or mutated CTGF gene or a fragment thereof comprising the alteration or mutation.
- the method of screening, selecting or identifying active compounds, particularly compounds active on fibrosis also comprises contacting a test compound with a recombinant host cell comprising a reporter construct, said reporter construct comprising a reporter gene under the control of a CTGF gene promoter, and selecting the test compounds that modulate (e.g. activate or inhibit) expression of the reporter gene.
- said CTGF gene promoter or a fragment thereof is an altered or mutated CTGF gene promoter or a fragment thereof comprising the alteration or mutation.
- test compounds may be assayed in parallel.
- the test compound may be of various origin, nature and composition. It may be any organic or inorganic substance, such as a lipid, peptide, polypeptide, nucleic acid, small molecule, etc., in isolated or in mixture with other substances.
- the compounds may be all or part of a combinatorial library of products, for instance.
- composition comprising (i) a CTGF polypeptide or a fragment thereof, a nucleic acid encoding a CTGF polypeptide or a fragment thereof, a vector or a recombinant host cell as described above and (ii) a pharmaceutically acceptable carrier or vehicle.
- the invention also relates to a method of treating or preventing fibrosis or an associated disorder in a subject, the method comprising administering to said subject a functional (e.g., wild-type) CTGF polypeptide or a nucleic acid encoding the CTGF gene locus.
- a method of treating or preventing fibrosis in a subject comprising administering to said subject a compound that modulates, preferably that activates or mimics, expression or activity of a CTGF gene locus or protein according to the present invention.
- Said compound can be an agonist or an antagonist of CTGF, an antisense or a RNAi of CTGF, an antibody or a fragment or a derivative thereof specific to a CTGF polypeptide.
- the modulation is an inhibition.
- the modulation is an activation.
- a functional CTGF polypeptide a nucleic acid encoding the CTGF gene locus, or a compound that modulates expression or activity of a CTGF gene or protein according to the present invention, in the manufacture of a pharmaceutical composition for treating or preventing fibrosis in a subject.
- Said compound can be an agonist or an antagonist of CTGF, an antisense or an RNAi of CTGF, an antibody or a fragment or a derivative thereof specific to a CTGF polypeptide.
- the modulation is an inhibition.
- the modulation is an activation.
- the present invention demonstrates the correlation between fibrosis and the CTGF gene locus.
- the invention thus provides a novel target of therapeutic intervention.
- Various approaches can be contemplated to restore or modulate the CTGF activity or function in a subject, particularly those carrying an altered CTGF gene locus. Supplying wild-type function to such subjects is expected to suppress phenotypic expression of fibrosis in a pathological cell or organism. The supply of such function can be accomplished through gene or protein therapy, or by administering compounds that modulate or mimic CTGF polypeptide activity
- the wild-type CTGF gene or a functional part thereof may be introduced into the cells of the subject in need thereof using a vector as described above.
- the vector may be a viral vector or a plasmid.
- the gene may also be introduced as naked DNA.
- the gene may be provided so as to integrate into the genome of the recipient host' cells, or to remain extra-chromosomal.
- Integration may occur randomly or at precisely defined sites, such as through homologous recombination.
- a functional copy of the CTGF gene may be inserted in replacement of an altered version in a cell, through homologous recombination.
- Further techniques include gene gun, liposome-mediated transfection, cationic lipid-mediated transfection, etc.
- Gene therapy may be accomplished by direct gene injection, or by administering ex vivo prepared genetically modified cells expressing a functional CTGF polypeptide.
- CTGF activity e.g., peptides, drugs, CTGF agonists, or organic compounds
- peptides, drugs, CTGF agonists, or organic compounds may also be used to restore functional CTGF activity in a subject or to suppress the deleterious phenotype in a cell.
- Restoration of functional CTGF gene locus function in a cell may be used to prevent the development of fibrosis or to reduce progression of said disease.
- Multivariate logistic regression was used to analyse the relationship between the probability of an individual developing fibrosis and genetic variants including the main covariates known to affect disease progression in subjects infected with schistosomes.
- the statistical SPSS software version 10.0 was used for this analysis.
- Age and gender were tested in the regression models and kept when they showed an association (p ⁇ 0.05) with disease. Since the cohorts were matched for gender and age, these covariates had little effects on the association between genetic variants and disease.
- the number of Praziquantel treatments, infection with HBV and exposure to infection were included in the regression models when these covariates could be evaluated accurately as in the Chinese fishermen (exposure, number of treatments) or in the Chinese farmers (HBV infection, place of birth).
- FTA card All the DNA purified from FTA card were pre amplified before genotyping.
- Polymerase chain reactions (whole genome amplifications) were conducted in 50 ⁇ l reactions containing one punch of biological sample (FTAl -bound buccal cell DNA) or 100 ng of genomic DNA, 1.5 OD of 15-base totally degenerate random primer (Genetix, Paris, France), 200 mM dNTPs, 5 mM MgCl 2 , 5 ml of 10x PCR buffer and 0.5 unit of high fidelity Taq DNA polymerase (BIOTAQ DNA Polymerase, Bio line London, England).
- Samples were amplified in a multiblock thermocycler as follows: a pre-denaturation step of 3 min at 94°C, 50 cycles consisting of 1 min at 94°C, 2 min at 37°C, 1 min of ramp (37-55°C), and 4 min at 55°C. Final extension step of 5 min at 72°C. Sequencing
- Polymorphism genotyping by PCR and restriction enzyme digestion Polymorphisms (rs6926879, rs34118837, rsl931003, 12191459, rsl2206863, 7768619, rsl 0872386 and rs2327184) were genotyped by restriction enzyme analysis under standard conditions described by the enzyme manufacturers (Euromedex, Mundolsheim, France or New England Biolabs, Beverly, USA). Polymerase chain reaction (PCR) amplifications were carried out on a robocycler gradient 96 (Stratagene, La Jo 11a, U.S.A.) according to standard protocol. Each digestion was resolved on either agarose or acrylamide gels, stained with ethidium bromide and visualized by UV.Primers are described in Table 2. Nuclear extract preparation
- Nuclear extracts were prepared from human hepatocyte cell line (HEPG2) stimulated for one hour with dexamethasone (ImM) since hepatocytes produce CTGF in hepatic fibrosis (HF) Kobayashi et al., 2005, Gressner et al., 2007) together with hepatic stellate cells, and endothelial cells and myo-f ⁇ broblasts (Gressner et al., 2008).
- the extracts were prepared with the nuclear and cytoplasmic extraction reagents from Pierce (NE-PER; Pierce, Rockford, IL, USA).
- ESA Electrophoretic mobility shift assay
- oligonucleotides were commercially synthetised to span approximately lObp on either side of the variant nucleotide, as follows: rs9402373C GCTCTCAAAACTAAGCCCAACTC (SEQ ID NO: 33) rs9402373G GAGTTGGGCTTAGTTTTGAGAGC (SEQ ID NO: 34)
- Complementary strands were annealed by placing reactions (oligonucleotide sens and oligonucleotide antisens) in boiling water for 10 min and allowing to cool to room temperature. Binding reactions were set up with LightShift Chemiluminescent EMSA Kit (Pierce, Rockford, IL, USA). Aliquots of 20 fmol of complementary DNA were incubated at room temperature for 20 min with 4 mg of nuclear extract in 10 mM Tris, 50 mM KCl, 1 mM DTT, 2.5% glycerol, 5 mM MgCl 2 , 50 ng/ ⁇ l poly d(I-C), 0.05% NP-40, pH 7.5.
- Analysis of the various factors that influence the development of fibrosis in the fishermen population has shown that gender, exposure to infected waters and anti- schistosome treatments with Praziquantel were significantly associated with the risk of fibrosis.
- the testing of several covariates has shown that "the number of years fishing" and "being born on a fishing boat” were the best covariates to measure exposure.
- the "treatment” covariate is the number of Praziquantel treatments over the last twenty years.
- the fisherman sample comprised 300 subjects (201 controls, 99 cases). Cases exhibited either severe CentF (central fibrosis: CLH, D, E or F) or severe ParF (parenchymal fibrosis: GNH or GW) or both CLM and GNM. Controls had milder disease: CentFib ⁇ CLL and ParF ⁇ GNL. Covariates that could affect hepatic fibrosis in fishermen were exposure and the number of Praziquantel treatments. Exposure included two covariates: the number of years fishing and being born on a boat. The Chinese farmer sample included 294 subjects (113 controls and 181 cases). Cases had severe HF (as defined for the fishermen cases) and ascites and/or varicose veins.
- HBV and HCV infections could be evaluated in this sample; 3 subjects were infected with HCV and were not included, whereas > 60% had an active or cured HBV infection. HBV infection was a significant covariate in the analysis (p ⁇ 0.03), exposure and the number of treatments could not be evaluated accurately in Chinese farmers.
- the inventors selected several SNPs for genotyping, two SNPs per bin and any SNPs in or outside the bins that could have a functional effect as determined by in silico analysis (see figure 1). These SNPs were then genotyped in a larger cohort of 450 individuals of the Chinese Fisherman cohort.
- the correction factor to be applied to these data is ⁇ 20 (see Materials and Methods). Since treatments could not be recorded accurately for all subjects, we show separately the data obtained with the 450 subjects for whom we knew exposure and with the 380 subjects for whom both exposure and treatments were known.
- the SNPs that had showed some evidence of an association with HF in the fisherman sample were genotyped in the farmer sample (113 controls, 181 cases).
- CTGF allelic variants that were associated with HF in Chinese fishermen (Table 4) were genotyped in both samples. The phenotypes were either severe HF associated with portal hypertension in Sudanese or significant secondary portal branch thickening in Brazilians who were much less affected than Sudanese since transmission was lower in the Brazilians than in the Sudanese sample.
- genotypes and HF phenotypes (described in Materials and Methods) have been tested first using univariate analysis (upper part of Table 5) and second by multivariate analysis (lower part of Table 5) including SNPs rs 12526196, rs 12527705 and rs9402373.
- Genotype is the aggravating genotype
- OR Odd ratios
- CI Confidence interval of OR.
- the Sudanese sample (314 subjects, 95 cases and 219 controls) was recruited among farmers living in villages of the Wad Medani region of Sudan (Dessein et al, 1999). Severe phenotypes associated HF (grade > C) with evidence of portal hypertension as in ( Dessein et al., 1999). All subjects were much exposed to infection with S. mansoni and had received no or few Praziquantel treatments. However, exposure and the number of treatments could not be accurately evaluated on this sample.
- the Brazilian sample (133 subjects, 73 controls and 60 cases) was recruited in a village of North East Brazil among adult subjects with frequent contacts with a river populated with S. mansoni infested snails.
- the inventors have investigated whether hepatic fibrosis in Brazilians infected with S. mansoni is also affected by CTGF allelic variants.
- the Brazilian cohort has been recruited for this study and has never been genotyped before.
- In this association study cases were subjects with evidence of thickening of the wall of the secondary branches of the portal vein. The only confounding variable was age of the patients. All subjects with evidence of exposure to infection for many years were selected.
- CTGF allelic variants CTGF polymorphisms associated with HF in Chinese fishermen were genotyped in both samples. The phenotypes were either severe HF associated with portal hypertension in Sudanese or significant secondary portal branch thickening in Brazilians who were much less affected than Sudanese.
- SNP rs9402373 was associated with HF in all four samples tested. This association was obtained in Chinese and Sudanese, using a strict fibrosis phenotype or a more severe phenotype (HF + evidence of portal blood hypertension). SNP rsl256196 was also independently associated with HF in Chinese and Sudanese. Our EMSA data indicate that allelic variants of SNP rsl256196 and SNP rs9402373 bind differently nuclear factor suggesting that they could affect the regulation of gene transcription or the stability of transcripts.
- HBV infection was a significant covariate in the analysis of Chinese farmers indicating that HBV likely contributed significantly to severe disease. This also suggests that SNP rsl256196 and SNP rs9402373 might also modulate HF caused by HBV.
- EXAMPLE 3 Association between SNPs in the CTGF gene locus with hepatic fibrosis (HF) in HCV infected subjects
- Example 1 describes SNP correlation bins (r2>0.8) in the CTGF encoding gene in a sample of Chinese population. These were defined over the entire gene and 10Kb of the 3 ' and 5 ' flanking region. Only SNPs with a minor allele frequency > 20% had been analyzed. There were seven bins of which four (groups II, III, IV and VI) showed some association with hepatic fibrosis caused by schistosome eggs in Chinese fishermen infected by Schistosoma japonicum.
- SNP rs9402373 SNP rs6918698 still showed a trend for an association with hepatic disease suggesting that SNP rs9402373 could not account for the full association of SNP rs6918698 with disease.
- CTGF genetic variants are also associated with hepatic fibrosis in Brazilians infected with HCV.
- the inventors then performed a Meta analysis of the data obtained with SNP rs9402373 in French and Brazilians infected with HCV.
- Gressner AM The cell biology of liver fibrogenesis - an imbalance of proliferation, growth arrest and apoptosis of myofibroblasts. Cell Tissue Res 1998; 292:447. Dessein, A. J., D. Hillaire, N. E. Elwali, S. Marquet, Q. Mohamed-Ali, A. Mirghani, S.
- CTGF Connective- tissue growth factor
- Connective tissue growth factor binds to fibronectin through the type I repeat modules and enhances the affinity of fibronectin to fibrin. Biochim Biophys Acta 1770:672. Rachfal, A. W., and D. R. Brigstock. 2003. Connective tissue growth factor
- CGF/CCN2 hepatic fibrosis
- CTGF connective tissue growth factor
- CYR61 cysteine-rich 61
- CTGF/CCN2 connective tissue growth factor
- IFN-gamma polymorphisms IFN-gamma +2109 and IFN-gamma +3810 are associated with severe hepatic fibrosis in human hepatic schistosomiasis (Schistosoma mansoni). J Immunol 171 :5596.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Hematology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2752802A CA2752802C (en) | 2009-02-19 | 2010-02-18 | Ctgf gene alterations related to hepatic fibroid susceptibility |
| BRPI1008936A BRPI1008936B8 (en) | 2009-02-19 | 2010-02-18 | in vitro method for detecting predisposition for or diagnosis and/or prognosis of liver fibrosis or cirrhosis occurring in a human subject |
| US13/201,520 US9297044B2 (en) | 2009-02-19 | 2010-02-18 | Fibrosis susceptibility gene and uses thereof |
| JP2011550565A JP5837825B2 (en) | 2009-02-19 | 2010-02-18 | Fibrosis susceptibility genes and uses thereof |
| EP10703912.5A EP2398911B1 (en) | 2009-02-19 | 2010-02-18 | Fibrosis susceptibility gene and uses thereof |
| KR1020117021902A KR101748679B1 (en) | 2009-02-19 | 2010-02-18 | Fibrosis susceptibility gene and uses thereof |
| CN201080008683.5A CN102325904B (en) | 2009-02-19 | 2010-02-18 | Fibrosis susceptibility gene and its application |
| US15/045,107 US20160230232A1 (en) | 2009-02-19 | 2016-02-16 | Fibrosis susceptibility gene and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP09305159A EP2221387A1 (en) | 2009-02-19 | 2009-02-19 | Fibrosis susceptibility gene and uses thereof |
| EP09305159.7 | 2009-02-19 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/201,520 A-371-Of-International US9297044B2 (en) | 2009-02-19 | 2010-02-18 | Fibrosis susceptibility gene and uses thereof |
| US15/045,107 Continuation US20160230232A1 (en) | 2009-02-19 | 2016-02-16 | Fibrosis susceptibility gene and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010094740A1 true WO2010094740A1 (en) | 2010-08-26 |
Family
ID=40568438
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2010/052048 Ceased WO2010094740A1 (en) | 2009-02-19 | 2010-02-18 | Fibrosis susceptibility gene and uses thereof |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US9297044B2 (en) |
| EP (2) | EP2221387A1 (en) |
| JP (2) | JP5837825B2 (en) |
| KR (1) | KR101748679B1 (en) |
| CN (2) | CN105907843A (en) |
| BR (1) | BRPI1008936B8 (en) |
| CA (1) | CA2752802C (en) |
| WO (1) | WO2010094740A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013020904A1 (en) | 2011-08-05 | 2013-02-14 | Universite D'aix-Marseille | Fibrosis susceptibility il22ra2 gene and uses thereof |
| ES2422874A1 (en) * | 2012-03-12 | 2013-09-16 | Universidad Autónoma de Madrid | In vitro method of prognosis of severe hepatic fibrosis |
| EP3425056A1 (en) | 2017-07-07 | 2019-01-09 | Genepred Biotechnologies | Method for prognosing fibrosis progression |
| WO2020074727A1 (en) | 2018-10-11 | 2020-04-16 | Genepred Biotechnologies | Method for detecting fibrosis especially keloid |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012085217A1 (en) * | 2010-12-22 | 2012-06-28 | Universite De La Mediterranee (Aix-Marseille Ii) | A diagnostic method for dementias |
| FI3607065T3 (en) * | 2017-04-06 | 2023-06-16 | Qing Wang | Method and kit for constructing nucleic acid library |
| EP4053659A1 (en) * | 2018-10-02 | 2022-09-07 | Tetra Laval Holdings & Finance S.A. | A system for controlling a manufacturing process for packaging units |
| CN111073884A (en) * | 2020-02-14 | 2020-04-28 | 昆明理工大学 | A method for improving the detection accuracy of SNP loci with functional effects in SNPs with a distance of less than 50 bp in the non-coding region |
| WO2025114508A1 (en) * | 2023-11-30 | 2025-06-05 | Universität Heidelberg | Method for predicting the risk of a cancer subject for developing radiation-induced skin fibrosis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003024308A2 (en) * | 2001-09-18 | 2003-03-27 | Fibrogen, Inc. | Methods of assaying connective tissue growth factor |
| WO2008070117A1 (en) * | 2006-12-04 | 2008-06-12 | Promedior, Inc. | Conjoint therapy for treating fibrotic diseases |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5770209A (en) | 1991-08-30 | 1998-06-23 | University Of South Florida | Acceleration of wound healing using connective tissue growth factor |
| WO1995011995A1 (en) | 1993-10-26 | 1995-05-04 | Affymax Technologies N.V. | Arrays of nucleic acid probes on biological chips |
| US20030092019A1 (en) * | 2001-01-09 | 2003-05-15 | Millennium Pharmaceuticals, Inc. | Methods and compositions for diagnosing and treating neuropsychiatric disorders such as schizophrenia |
| US7405274B2 (en) * | 2003-06-04 | 2008-07-29 | Fibrogen, Inc. | Connective tissue growth factor antibodies |
| GB0326780D0 (en) | 2003-11-18 | 2003-12-24 | Imp College Innovations Ltd | Biological materials and uses thereof |
| US20130203054A1 (en) | 2010-05-04 | 2013-08-08 | Universite D'aix-Marseille | Antiviral treatment susceptibility gene and uses thereof |
| CN104302780B (en) | 2011-08-05 | 2017-04-12 | 艾克斯-马赛大学 | Fibrosis susceptibility IL22RA2 gene and use thereof |
-
2009
- 2009-02-19 EP EP09305159A patent/EP2221387A1/en not_active Withdrawn
-
2010
- 2010-02-18 JP JP2011550565A patent/JP5837825B2/en not_active Expired - Fee Related
- 2010-02-18 BR BRPI1008936A patent/BRPI1008936B8/en not_active IP Right Cessation
- 2010-02-18 CN CN201610204906.4A patent/CN105907843A/en active Pending
- 2010-02-18 WO PCT/EP2010/052048 patent/WO2010094740A1/en not_active Ceased
- 2010-02-18 EP EP10703912.5A patent/EP2398911B1/en active Active
- 2010-02-18 CN CN201080008683.5A patent/CN102325904B/en not_active Expired - Fee Related
- 2010-02-18 US US13/201,520 patent/US9297044B2/en active Active
- 2010-02-18 CA CA2752802A patent/CA2752802C/en active Active
- 2010-02-18 KR KR1020117021902A patent/KR101748679B1/en not_active Expired - Fee Related
-
2015
- 2015-08-21 JP JP2015164050A patent/JP2016047045A/en active Pending
-
2016
- 2016-02-16 US US15/045,107 patent/US20160230232A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003024308A2 (en) * | 2001-09-18 | 2003-03-27 | Fibrogen, Inc. | Methods of assaying connective tissue growth factor |
| WO2008070117A1 (en) * | 2006-12-04 | 2008-06-12 | Promedior, Inc. | Conjoint therapy for treating fibrotic diseases |
Non-Patent Citations (52)
| Title |
|---|
| ABREU, J. G.; N. I. KETPURA; B. REVERSADE; E. M. DE ROBERTIS: "Connective- tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta", NAT CELL BIOL, vol. 4, 2002, pages 599 |
| ARNAUD, V.; J. LI; Y. WANG; X. FU; S. MENGZHI; X. LUO; X. HOU; H. DESSEIN; Z. JIE; Y. XIN-LING: "Regulatory role of interleukin-10 and interferon-gamma in severe hepatic central and peripheral fibrosis in humans infected with Schistosomajaponicum", J INFECT DIS, vol. 198, 2008, pages 418 |
| BEDOSSA P.; POYNARD, T.: "The METAVIR cooperative study group. An algorithm for the grading of activity in chronic hepatitis C", HEPATOLOGY, vol. 24, 1996, pages 289 - 293 |
| BLANTON RONALD E ET AL: "Schistosomal hepatic fibrosis and the interferon gamma receptor: a linkage analysis using single-nucleotide polymorphic markers", EUROPEAN JOURNAL OF HUMAN GENETICS, vol. 13, no. 5, May 2005 (2005-05-01), pages 660 - 668, XP002526202, ISSN: 1018-4813 * |
| BLOM I E ET AL: "Identification of human ccn2 (connective tissue growth factor) promoter polymorphisms.", MOLECULAR PATHOLOGY : MP JUN 2001, vol. 54, no. 3, June 2001 (2001-06-01), pages 192 - 196, XP002526205, ISSN: 1366-8714 * |
| BOURSIER J; KONATE A; GOREA G; REAUD S; QUEMENER E; OBERTI F; HUBERT-FOUCHARD I; DIB N; CALES P.: "Reproducibility of liver stiffness measurement by ultrasonographic elastometry", CLIN GASTROENTEROL HEPATOL., vol. 6, no. 11, November 2008 (2008-11-01), pages 1263 - 9, XP025684528, DOI: doi:10.1016/j.cgh.2008.07.006 |
| BRIGSTOCK, D. R.: "Regulation of angiogenesis and endothelial cell function by connective tissue growth factor (CTGF) and cysteine-rich 61 (CYR61)", ANGIOGENESIS, vol. 5, 2002, pages 153 |
| BRUCK R; SHIRIN H; HERSHKOVIZ R ET AL.: "Analysis of Arg-Gly-Asp mimetics and soluble receptor of tumour necrosis factor as therapeutic modalities for concanavalin A induced hepatitis in mice", GUT, vol. 40, 1997, pages 133 |
| CHEVILLARD, C.; C. E. MOUKOKO; N. E. ELWALI; J. H. BREAM; B. KOURIBA; L. ARGIRO; S. RAHOUD; A. MERGANI; S. HENRI; J. GAUDART: "IFN-gamma polymorphisms (IFN-gamma +2109 and IFN-gamma +3810) are associated with severe hepatic fibrosis in human hepatic schistosomiasis (Schistosoma mansoni)", J IMMUNOL, vol. 171, 2003, pages 5596 |
| CROCI, S.; L. LANDUZZI; A. ASTOLFI; G. NICOLETTI; A. ROSOLEN; F. SARTORI; M. Y. FOLLO; N. OLIVER; C. DE GIOVANNI; P. NANNI: "Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells", CANCER RES, vol. 64, 2004, pages 1730, XP002379761, DOI: doi:10.1158/0008-5472.CAN-3502-02 |
| CZAJA A; FREESE DK.: "Diagnosis and Treatment of Autoimmune hepatitis", HEPATOLOGY, 2003, pages 473 - 496 |
| DESSEIN A J ET AL: "Severe hepatic fibrosis in Schistosoma mansoni infection is controlled by a major locus that is closely linked to the interferon-gamma receptor gene.", AMERICAN JOURNAL OF HUMAN GENETICS SEP 1999, vol. 65, no. 3, September 1999 (1999-09-01), pages 709 - 721, XP002526206, ISSN: 0002-9297 * |
| DESSEIN, A. J.; D. HILLAIRE; N. E. ELWALI; S. MARQUET; Q. MOHAMED-ALI; A. MIRGHANI; S. HENRI; A. A. ABDELHAMEED; O. K. SAEED; M. M: "Severe hepatic fibrosis in Schistosoma mansoni infection is controlled by a major locus that is closely linked to the interferon-gamma receptor gene", AM J HUM GENET, vol. 65, 1999, pages 709, XP002526206, DOI: doi:10.1086/302526 |
| FITZNER, B.; P. BROCK; H. NECHUTOVA; A. GLASS; T. KAROPKA; D. KOCZAN; H. J. THIESEN; G. SPARMANN; J. EMMRICH; S. LIEBE: "Inhibitory effects of interferon-gamma on activation of rat pancreatic stellate cells are mediated by STAT1 and involve down-regulation Of CTGF expression", CELL SIGNAL, vol. 19, 2007, pages 782, XP005897568, DOI: doi:10.1016/j.cellsig.2006.10.002 |
| FONSECA CARMEN ET AL: "A polymorphism in the CTGF promoter region associated with systemic sclerosis.", THE NEW ENGLAND JOURNAL OF MEDICINE 20 SEP 2007, vol. 357, no. 12, 20 September 2007 (2007-09-20), pages 1210 - 1220, XP002526201, ISSN: 1533-4406 * |
| FONSECA, C.; G. E. LINDAHL; M. PONTICOS; P. SESTINI; E. A. RENZONI; A. M. HOLMES; P. SPAGNOLO; P. PANTELIDIS; P. LEONI; N. MCHUGH: "A polymorphism in the CTGF promoter region associated with systemic sclerosis", N ENGL J MED, vol. 357, 2007, pages 1210, XP002526201, DOI: doi:10.1056/NEJMoa067655 |
| GAO, R.; D. K. BALL; B. PERBAL; D. R. BRIGSTOCK: "Connective tissue growth factor induces c-fos gene activation and cell proliferation through p44/42 MAP kinase in primary rat hepatic stellate cells", J HEPATOL, vol. 40, 2004, pages 431 |
| GARCIA-TSAO G.; BOYER JL.: "Outpatient liver biopsy: how safe is it?", ANN INTERN MED, vol. 118, 1993, pages 150 - 3 |
| GEORGE, J.; M. TSUTSUMI: "siRNA-mediated knockdown of connective tissue growth factor prevents N-nitrosodimethylamine-induced hepatic fibrosis in rats", GENE THER, vol. 14, 2007, pages 790, XP055232130, DOI: doi:10.1038/sj.gt.3302929 |
| GOURH, P.; M. D. MAYES; F. C. ARNETT: "CTGF polymorphism associated with systemic sclerosis", N ENGL J MED, vol. 358, 2008, pages 308 |
| GRESSNER AM.: "The cell biology of liver fibrogenesis - an imbalance of proliferation, growth arrest and apoptosis of myofibroblasts", CELL TISSUE RES, vol. 292, 1998, pages 447 |
| GRESSNER OLAV A ET AL: "Connective tissue growth factor: a fibrogenic master switch in fibrotic liver diseases", LIVER INTERNATIONAL, vol. 28, no. 8, September 2008 (2008-09-01), pages 1065 - 1079, XP009115888 * |
| GRESSNER, O. A.; A. M. GRESSNER: "Connective tissue growth factor: a fibrogenic master switch in fibrotic liver diseases", LIVER INT, vol. 28, 2008, pages 1065, XP009115888, DOI: doi:10.1111/j.1478-3231.2008.01826.x |
| GRESSNER, O. A.; B. LAHME; I. DEMIRCI; A. M. GRESSNER; R. WEISKIRCHEN: "Differential effects of TGF-beta on connective tissue growth factor (CTGF/CCN2) expression in hepatic stellate cells and hepatocytes", J HEPATOL, vol. 47, 2007, pages 699, XP022285805, DOI: doi:10.1016/j.jhep.2007.05.015 |
| HENRI, S.; C. CHEVILLARD; A. MERGANI; P. PARIS; J. GAUDART; C. CAMILLA; H. DESSEIN; F. MONTERO; N. E. ELWALI; O. K. SAEED: "Cytokine regulation of periportal fibrosis in humans infected with Schistosoma mansoni: IFN-gamma is associated with protection against fibrosis and TNF-alpha with aggravation of disease", J IMMUNOL, vol. 169, 2002, pages 929 |
| IVKOVIC, S.; B. S. YOON; S. N. POPOFF; F. F. SAFADI; D. E. LIBUDA; R. C. STEPHENSON; A. DALUISKI; K. M. LYONS: "Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development", DEVELOPMENT, vol. 130, 2003, pages 2779, XP002313821, DOI: doi:10.1242/dev.00505 |
| JONSSON JR; CLOUSTONAD; ANDO Y ET AL.: "Angiotensin-converting enzyme inhibition attenuates the progression of rat hepatic fibrosis", GASTROENTEROLOGY, vol. 121, 2001, pages 148 |
| KALLURI, R.; E. G. NEILSON: "Epithelial-mesenchymal transition and its implications for fibrosis", J CLIN INVEST, vol. 112, 2003, pages 1776, XP002988689, DOI: doi:10.1172/JCI200320530 |
| KING CH; MAGAK P; SALAM EA; OUMA JH; KARIUKI HC; BLANTON RE: "World Health Organization. Measuring morbidity in schistosomiasis mansoni: relationship between image pattern, portal vein diameter and portal branch thickness in large-scale surveys using new WHO coding guidelines for ultrasound in schistosomiasis", TROP MED INT HEALTH, vol. 8, no. 2, February 2003 (2003-02-01), pages 109 - 17 |
| KOBAYASHI, H.; N. HAYASHI; K. HAYASHI; A. YAMATAKA; G. J. LANE; T. MIYANO: "Connective tissue growth factor and progressive fibrosis in biliary atresia", PEDIATR SURG INT, vol. 21, 2005, pages 12, XP019339807, DOI: doi:10.1007/s00383-004-1254-z |
| LAMBERTUCCI JR; SILVA LC; ANDRADE LM; DE QUEIROZ LC; PINTO-SILVA RA.: "Magnetic resonance imaging and ultrasound in hepatosplenic schistosomiasis mansoni", REV SOC BRAS MED TROP., vol. 37, no. 4, July 2004 (2004-07-01), pages 333 - 7 |
| LEASK, A.; D. J. ABRAHAM: "All in the CCN family: essential matricellular signaling modulators emerge from the bunker", J CELL SCI, vol. 119, 2006, pages 4803 |
| LEASK, A.; D. J. ABRAHAM: "The role of connective tissue growth factor, a multifunctional matricellular protein, in fibroblast biology", BIOCHEM CELL BIOL, vol. 81, 2003, pages 355, XP008158066, DOI: doi:10.1139/o03-069 |
| LI GUANGMING ET AL: "Inhibition of connective tissue growth factor by siRNA prevents liver fibrosis in rats.", THE JOURNAL OF GENE MEDICINE JUL 2006, vol. 8, no. 7, July 2006 (2006-07-01), pages 889 - 900, XP002526204, ISSN: 1099-498X * |
| LI, G.; Q. XIE; Y. SHI; D. LI; M. ZHANG; S. JIANG; H. ZHOU; H. LU; Y. JIN.: "Inhibition of connective tissue growth factor by siRNA prevents liver fibrosis in rats", J GENE MED, vol. 8, 2006, pages 889, XP002526204, DOI: doi:10.1002/JGM.894 |
| LI, J.; L. JI.: "Adjusting multiple testing in multilocus analyses using the eigenvalues of a correlation matrix", HEREDITY, vol. 95, 2005, pages 221 |
| MACIAS J; RECIO E; VISPO E; RIVERO A; LOPEZ-CORTES LF; RIOS MJ; MERINO D; GONZALEZ M; BARREIRO P; DE LEDINGHEN V: "Application of transient elastometry to differentiate mild from moderate to severe liver fibrosis in HIV/HCV co-infected patients", J HEPATOL., vol. 49, no. 6, December 2008 (2008-12-01), pages 916 - 22, XP025760441, DOI: doi:10.1016/j.jhep.2008.07.031 |
| MOHAMED-ALI Q; ELWALI NE; ABDELHAMEED AA; MERGANI A; RAHOUD S; ELAGIB KE; SAEED OK; ABEL L; MAGZOUB MM; DESSEIN AJ.: "Susceptibility to periportal (Symmers) fibrosis in human schistosoma mansoni infections: evidence that intensity and duration of infection, gender, and inherited factors are critical in disease progression", J INFECT DIS., vol. 180, no. 4, October 1999 (1999-10-01), pages 1298 - 306 |
| MORITA, H.; D. HAYASHI; R. NAGAI: "CTGF polymorphism associated with systemic sclerosis", N ENGL J MED, vol. 358, 2008, pages 308 |
| NEILSON, E. G.: "Setting a trap for tissue fibrosis", NAT MED, vol. 11, 2005, pages 373 |
| NYHOLT, D. R.: "A simple correction for multiple testing for single-nucleotide polymorphisms in linkage disequilibrium with each other", AM J HUM GENET, vol. 74, 2004, pages 765, XP002999648 |
| PARKES J; GUHA IN; RODERICK P ET AL.: "Performance of serum marker panels for liver fibrosis in hepatitis C.", J HEPATOL, vol. 44, 2006, pages 462 - 474, XP025054459, DOI: doi:10.1016/j.jhep.2005.10.019 |
| POUPON RE; LINDOR KD; CAUCH-DUDEK K ET AL.: "Combined analysis of randomized controlled trials of ursodeoxycholic acid in primary biliary cirrhosis", GASTROENTEROLOGY, vol. 113, 1997, pages 884, XP005688575, DOI: doi:10.1016/S0016-5085(97)70183-5 |
| POYNARD T; MARCELLIN P; LEE SS ET AL.: "Randomised trial of interferon alpha2b plus ribavirin for 48 weeks or for 24 weeks versus interferon alpha2b plus placebo for 48 weeks for treatment of chronic infection with hepatitis C virus. International Hepatitis Interventional Therapy Group (IHIT)", LANCET, vol. 352, 1998, pages 1426 |
| RACHFAL, A. W.; D. R. BRIGSTOCK.: "Connective tissue growth factor (CTGF/CCN2) in hepatic fibrosis", HEPATOL RES, vol. 26, 2003, pages 1, XP002335977, DOI: doi:10.1016/S1386-6346(03)00115-3 |
| RICHTER J; DOMINGUES AL; BARATA CH; PRATA AR; LAMBERTUCCI JR.: "Report of the second satellite symposium on ultrasound in schistosomiasis", MEM INST OSWALDO CRUZ., vol. 96, 2001, pages 151 - 6 |
| SA-NGUANMOO PATTARATIDA ET AL: "Analysis of connective tissue growth factor promoter polymorphism in Thai children with biliary atresia", CHOT MAI HET THANG PHAET - JOURNAL OF THE MEDICAL ASSOCIATION OF THAILAND, MEDICAL ASSOCIATION OF THAILAND, TH, vol. 90, no. 2, 1 February 2007 (2007-02-01), pages 251 - 257, XP009115886, ISSN: 0125-2208 * |
| SEBASTIANI G; VARIO A; GUIDO M ET AL.: "Stepwise combination algorithms of non-invasive markers to diagnose significant fibrosis in chronic hepatitis C.", J HEPATOL, vol. 44, 2006, pages 686 - 693, XP025054421, DOI: doi:10.1016/j.jhep.2006.01.007 |
| SHIMO, T.; T. NAKANISHI; T. NISHIDA; M. ASANO; A. SASAKI; M. KANYAMA; T. KUBOKI; T. MATSUMURA; M. TAKIGAWA: "Involvement of CTGF, a hypertrophic chondrocyte-specific gene product, in tumor angiogenesis", ONCOLOGY, vol. 61, 2001, pages 315 |
| WAHAB, N. A.; B. S. WESTON; R. M. MASON: "Modulation of the TGFbeta/Smad signaling pathway in mesangial cells by CTGF/CCN2", EXP CELL RES, vol. 307, 2005, pages 305, XP004927162, DOI: doi:10.1016/j.yexcr.2005.03.022 |
| YOSHIDA, K.; H. MUNAKATA: "Connective tissue growth factor binds to fibronectin through the type I repeat modules and enhances the affinity of fibronectin to fibrin", BIOCHIM BIOPHYS ACTA, vol. 1770, 2007, pages 672, XP005900243, DOI: doi:10.1016/j.bbagen.2006.11.010 |
| ZIOL M ET AL.: "Noninvasive assessment of liver fibrosis by measurement of stiffness in patients with chronic hepatitis C.", HEPATOLOGY, vol. 41, 2005, pages 48 - 54 |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013020904A1 (en) | 2011-08-05 | 2013-02-14 | Universite D'aix-Marseille | Fibrosis susceptibility il22ra2 gene and uses thereof |
| KR20140058611A (en) * | 2011-08-05 | 2014-05-14 | 엑스-마르세이유 위니베르시테 | Fibrosis-susceptible IL22RA2 gene and uses thereof |
| JP2014524236A (en) * | 2011-08-05 | 2014-09-22 | ユニヴェルシテ デクス−マルセイユ | Fibrosis-sensitive IL22RA2 gene and use thereof |
| CN104302780A (en) * | 2011-08-05 | 2015-01-21 | 艾克斯-马赛大学 | Fibrosis susceptibility IL22RA2 gene and use thereof |
| CN104302780B (en) * | 2011-08-05 | 2017-04-12 | 艾克斯-马赛大学 | Fibrosis susceptibility IL22RA2 gene and use thereof |
| JP2017176186A (en) * | 2011-08-05 | 2017-10-05 | ユニヴェルシテ デクス−マルセイユUniversite D’Aix−Marseille | Fibrosis-sensitive IL22RA2 gene and use thereof |
| US10150989B2 (en) | 2011-08-05 | 2018-12-11 | Universite D'aix Marseille | Fibrosis susceptibility IL22RA2 gene and uses thereof |
| KR102003835B1 (en) * | 2011-08-05 | 2019-07-25 | 엑스-마르세이유 위니베르시테 | Fibrosis susceptibility il22ra2 gene and uses thereof |
| ES2422874A1 (en) * | 2012-03-12 | 2013-09-16 | Universidad Autónoma de Madrid | In vitro method of prognosis of severe hepatic fibrosis |
| EP3425056A1 (en) | 2017-07-07 | 2019-01-09 | Genepred Biotechnologies | Method for prognosing fibrosis progression |
| WO2019008137A1 (en) | 2017-07-07 | 2019-01-10 | Genepred Biotechnologies | Method for prognosing fibrosis progression |
| WO2020074727A1 (en) | 2018-10-11 | 2020-04-16 | Genepred Biotechnologies | Method for detecting fibrosis especially keloid |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20120004971A (en) | 2012-01-13 |
| JP2012524520A (en) | 2012-10-18 |
| BRPI1008936B1 (en) | 2021-04-06 |
| JP2016047045A (en) | 2016-04-07 |
| CN102325904B (en) | 2016-03-30 |
| US20160230232A1 (en) | 2016-08-11 |
| EP2398911A1 (en) | 2011-12-28 |
| JP5837825B2 (en) | 2015-12-24 |
| BRPI1008936B8 (en) | 2021-07-27 |
| CN102325904A (en) | 2012-01-18 |
| CA2752802A1 (en) | 2010-08-26 |
| EP2398911B1 (en) | 2017-10-18 |
| US9297044B2 (en) | 2016-03-29 |
| CN105907843A (en) | 2016-08-31 |
| EP2221387A1 (en) | 2010-08-25 |
| KR101748679B1 (en) | 2017-07-03 |
| BRPI1008936A2 (en) | 2016-10-11 |
| US20120135403A1 (en) | 2012-05-31 |
| CA2752802C (en) | 2018-04-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2752802C (en) | Ctgf gene alterations related to hepatic fibroid susceptibility | |
| KR20190057305A (en) | MicroRNAs as biomarkers for endometriosis | |
| CA2819378A1 (en) | Irak-related interventions and diagnosis | |
| CN101501194A (en) | Protection against and treatment of age related macular degeneration | |
| US20190323060A1 (en) | Fibrosis susceptibility il22ra2 gene and uses thereof | |
| KR101359851B1 (en) | Single nucleotide polymorphism for prognosis of hepatocellular carcinoma | |
| EP3649254A1 (en) | Method for prognosing fibrosis progression | |
| Suzuki et al. | A novel genetic marker for coronary spasm in women from a genome-wide single nucleotide polymorphism analysis | |
| KR20110106245A (en) | Single Base Polymorphism for Recurrence Diagnosis of Hepatocellular Carcinoma | |
| WO2019194534A1 (en) | Method for predicting onset of kawasaki disease by using ebf2 gene polymorphism | |
| KR101255565B1 (en) | Single Nucleotide Polymorphisms Associated with Coronary Heart Disease and Uses Thereof | |
| JP2007274986A (en) | Method for determining sensitivity to type 2 diabetes | |
| JP2007530028A (en) | Human obesity susceptibility gene encoding peptide hormone and use thereof | |
| Class et al. | Patent application title: FIBROSIS SUSCEPTIBILITY IL22RA2 GENE AND USES THEREOF Inventors: Alain Dessein (Marseille, FR) Mathieu Sertorio (Saint Ismier, FR) Laurent Argiro (Marseille, FR) Assignees: UNIVERSITE D'AIX-MARSEILLE | |
| WO2006073183A1 (en) | Method of judging inflammatory disease by using single nucleotdie polymorphism | |
| JPWO2003016570A1 (en) | Method for testing hepatocellular carcinoma using polymorphism in IL-1β gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080008683.5 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10703912 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13201520 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2752802 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011550565 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2010703912 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010703912 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20117021902 Country of ref document: KR Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI1008936 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: PI1008936 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: PI1008936 Country of ref document: BR Kind code of ref document: A2 Effective date: 20110817 |










